DOCSLIB.ORG

The Interrupted Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Interrupted Gene © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC 14 NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION A self-splicing© Jones intron in & an Bartlett rRNA of the Learning, large ribosomal LLC subunit. © Kenneth Eward/Photo© Researchers, Jones &Inc. Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION The Interrupted Gene Edited by Donald Forsdyke www © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALECHAPTER CHAPTEROR DISTRIBUTION OUTLINE OUTLINE NOT FOR SALE OR DISTRIBUTION 4.1 Introduction • The positions of introns are usually conserved when homologous genes are compared between different or- 4.2 An Interrupted Gene Consists of Exons and Introns ganisms. The lengths of the corresponding introns may • Introns are removed by RNA splicing, which occurs in vary greatly, though. © Jones & Bartlettcis inLearning, individual RNA LLC molecules. © Jones & Bartlett• Introns Learning, usually do not encodeLLC proteins. NOT FOR SALE• ORMutations DISTRIBUTION in exons can affect polypeptide sequence; NOT FOR4.5 SALE Exon ORSequences DISTRIBUTION Under Negative Selection mutations in introns can affect RNA processing and hence may influence the sequence and/or production Are Conserved but Introns Vary of a polypeptide. • Comparisons of related genes in different species show 4.3 that the sequences of the corresponding exons are Exon and Intron Base Compositions Differ usually conserved but the sequences of the introns are • The four “rules”© forJones DNA base & compositionBartlett areLearning, the first LLC much less similar.© Jones & Bartlett Learning, LLC and second parityNOT rules, FOR the clusterSALE rule, OR and DISTRIBUTIONthe GC • Introns evolve muchNOT more FOR rapidly SALE than exons OR DISTRIBUTION rule. Exons and introns can be distinguished on the because of the lack of selective pressure to produce a basis of all rules except the first. polypeptide with a useful sequence. • The second parity rule suggests an extrusion of struc- 4.6 tured stem-loop segments from duplex DNA, which Exon Sequences Under Positive Selection Vary would be greater in introns. but Introns Are Conserved © Jones• The rules & relateBartlett to genomic Learning, characteristics, LLC or ©• UnderJones positive & Bartlett selection an Learning, individual with LLC an NOT“ pressures,”FOR SALE that constitute OR DISTRIBUTION the genome phenotype. NOT advantageous FOR SALE mutation OR survives DISTRIBUTION (i.e., is able to 4.4 produce more fertile progeny) relative to others Organization of Interrupted Genes May Be without the mutation. Conserved • Due to intrinsic genomic pressures, such as that which • Introns can be detected when genes are compared with conserves the potential to extrude stem-loops from du- their RNA transcription products by either restriction plex DNA, introns evolve more slowly than exons that © Jones & Bartlettmapping, Learning, electron microscopy,LLC or sequencing. © Jones & Bartlettare under Learning, positive selection LLC pressure. NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 8181 © Jones & Bartlett Learning, LLC. NOT FOR SALE OR DISTRIBUTION. © Jones & BartlettCHAPTER Learning, OUTLINE, CONTINUEDLLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION 4.7 Genes Show a Wide Distribution of Sizes Due • The exons of some genes appear homologous to the exons of others, suggesting a common exon Primarily to Intron Size and Number Variation ancestry. • Most genes are uninterrupted in Saccharomyces cerevisiae but are interrupted© in Jonesmulticellular & eukaryotes.Bartlett Learning, LLC4.10 Members of a Gene Family© Jones Have a Common& Bartlett Learning, LLC • Exons are usually short,NOT typically FOR encodingSALE fewerOR thanDISTRIBUTION Organization NOT FOR SALE OR DISTRIBUTION 100 amino acids. • A set of homologous genes should share common • Introns are short in unicellular/oligocellular eukary- features that preceded their evolutionary separation. otes but can be many kilobases (kb) in multicellular • All globin genes have a common form of organization eukaryotes. with three exons and two introns, suggesting that they • The overall length of a gene is determined largely by are descended from a single ancestral gene. ©its Jones introns. & Bartlett Learning, LLC • Intron© Jones positions & in Bartlettthe actin gene Learning, family are highly LLC variable, which suggests that introns do not separate 4.8 SomeNOT DNA FOR Sequences SALE Encode OR DISTRIBUTIONMore Than One NOT FOR SALE OR DISTRIBUTION functional domains. Polypeptide 4.11 There Are Many Forms of Information in DNA • The use of alternative initiation or termination codons allows multiple variants of a polypeptide chain. • Genetic information includes not only that related to • Different polypeptides can be produced from the same characters corresponding to the conventional pheno- © Jones & Bartlettsequence Learning, of DNA when theLLC mRNA is read in different © Jones & Bartletttype, but also Learning, that related to LLC characters (pressures) NOT FOR SALEreading OR frames DISTRIBUTION (as two overlapping genes). NOT FOR SALEcorresponding OR DISTRIBUTION to the genome “phenotype.” • Otherwise identical polypeptides, differing by the • In certain contexts, the definition of the gene can be presence or absence of certain regions, can be gener- seen as reversed from “one gene–one protein” to “one ated by differential (alternative) splicing when certain protein–one gene.” exons are included or excluded. This may take the form • Positional information may be important in of including or excluding individual exons, or of choos- development. ing between alternative© Jones exons. & Bartlett Learning, LLC • Sequences transferred ©“horizontally” Jones & from Bartlett other Learning, LLC species to the germline could land in introns or 4.9 Some Exons Can BeNOT Equated FOR with SALE Protein ORFunctional DISTRIBUTION NOT FOR SALE OR DISTRIBUTION intergenic DNA and then transfer “vertically” through Domains the generations. Some of these sequences may be • Proteins can consist of independent functional mod- involved in intracellular nonself-recognition. ules, the boundaries of which, in some cases, can be 4.12 Summary equated with those of exons. © Jones & Bartlett Learning, LLC © Jones & Bartlett Learning, LLC NOT FOR SALE OR DISTRIBUTION NOT FOR SALE OR DISTRIBUTION is operational with respect to phenotype. 4.1 Introduction Protein-encoding sequences can be inter- The simplest form of a gene is a length of DNA rupted, as can the 59 and 39 sequences (UTRs) © Jones & Bartlett Learning,that directly LLC corresponds to its polypeptide© Jones & Bartlettthat flank Learning, the protein-encoding LLC sequences NOT FOR SALE OR DISTRIBUTION product. Bacterial genes are almost NOTalways FOR of SALEwithin OR mRNA. DISTRIBUTION The interrupting sequences this type, in which a continuous sequence of are removed from the primary (RNA) 3N bases encodes a polypeptide of N amino transcript (or pre-mRNA) during gene acids. However, in eukaryotes ribosomal RNAs expression, generating an mRNA that includes (rRNAs), transfer RNAs (tRNAs), and mes- a continuous base sequence corresponding to senger© Jones RNAs (mRNAs)& Bartlett are Learning, first synthesized LLC the polypeptide product© Jones as determined & Bartlett by Learning,the LLC as longNOT precursor FOR SALE transcripts OR DISTRIBUTION that are subse- genetic code. The sequencesNOT FOR of SALEDNA compris OR DISTRIBUTION- quently shortened (see the chapter titled RNA ing an interrupted protein-encoding gene are Splicing and Processing). Thus eukaryotic genes divided into the two categories depicted in are much longer than the functional transcripts FIGURE 4.1: they produce. It is reasonable to assume that • Exons are the sequences retained in the © Jones &the Bartlett shortening Learning, involved LLC a trimming of addi- © Jonesmature & RNABartlett product. Learning, A mature LLC tran- NOT FOR SALEtional, perhapsOR DISTRIBUTION regulatory, sequences at the NOT scriptFOR SALEstarts and OR ends DISTRIBUTION with exons that 59 and/or 39 ends of transcripts, leaving the correspond to the 59 and 39 ends of the rRNA or protein-encoding sequence of the RNA. precursor intact. • Introns are the intervening sequences However, as it happens a eukaryotic that are removed when the primary © Jones & Bartlett Learning,gene can LLC include additional sequences© Jones that & BartlettRNA Learning, transcript LLCis processed to give the NOT FOR SALE OR DISTRIBUTIONlie both within and outside the regionNOT thatFOR SALE ORmature DISTRIBUTION RNA product. 82 CHAPTER 4 The Interrupted Gene © Jones & Bartlett Learning, LLC. NOT FOR SALE OR DISTRIBUTION. The exon sequences are in the same order in EXON 1 EXON 2 EXON 3 © Jones the& Bartlett gene and Learning,in the RNA, butLLC an interrupted DNA© Jones &INTRON Bartlett 1 Learning,INTRON LLC 2 NOT FORgene SALE is longer OR DISTRIBUTION than its mature RNA product NOT FOR SALE OR DISTRIBUTION because of the presence of the introns. RNA synthesis pre-mRNA The processing of interrupted genes INTRON 1 INTRON 2 requires an additional
Load more

Recommended publications
  • Discovery of DNA Structure and Function: Watson and Crick By: Leslie A
    01/08/2018 Discovery of DNA Double Helix: Watson and Crick | Learn Science at Scitable NUCLEIC ACID STRUCTURE AND FUNCTION | Lead Editor: Bob Moss Discovery of DNA Structure and Function: Watson and Crick By: Leslie A. Pray, Ph.D. © 2008 Nature Education Citation: Pray, L. (2008) Discovery of DNA structure and function: Watson and Crick. Nature Education 1(1):100 The landmark ideas of Watson and Crick relied heavily on the work of other scientists. What did the duo actually discover? Aa Aa Aa Many people believe that American biologist James Watson and English physicist Francis Crick discovered DNA in the 1950s. In reality, this is not the case. Rather, DNA was first identified in the late 1860s by Swiss chemist Friedrich Miescher. Then, in the decades following Miescher's discovery, other scientists--notably, Phoebus Levene and Erwin Chargaff--carried out a series of research efforts that revealed additional details about the DNA molecule, including its primary chemical components and the ways in which they joined with one another. Without the scientific foundation provided by these pioneers, Watson and Crick may never have reached their groundbreaking conclusion of 1953: that the DNA molecule exists in the form of a three-dimensional double helix. The First Piece of the Puzzle: Miescher Discovers DNA Although few people realize it, 1869 was a landmark year in genetic research, because it was the year in which Swiss physiological chemist Friedrich Miescher first identified what he called "nuclein" inside the nuclei of human white blood cells. (The term "nuclein" was later changed to "nucleic acid" and eventually to "deoxyribonucleic acid," or "DNA.") Miescher's plan was to isolate and characterize not the nuclein (which nobody at that time realized existed) but instead the protein components of leukocytes (white blood cells).
    [Show full text]
  • Biochemistrystanford00kornrich.Pdf
    University of California Berkeley Regional Oral History Office University of California The Bancroft Library Berkeley, California Program in the History of the Biosciences and Biotechnology Arthur Kornberg, M.D. BIOCHEMISTRY AT STANFORD, BIOTECHNOLOGY AT DNAX With an Introduction by Joshua Lederberg Interviews Conducted by Sally Smith Hughes, Ph.D. in 1997 Copyright 1998 by The Regents of the University of California Since 1954 the Regional Oral History Office has been interviewing leading participants in or well-placed witnesses to major events in the development of Northern California, the West, and the Nation. Oral history is a method of collecting historical information through tape-recorded interviews between a narrator with firsthand knowledge of historically significant events and a well- informed interviewer, with the goal of preserving substantive additions to the historical record. The tape recording is transcribed, lightly edited for continuity and clarity, and reviewed by the interviewee. The corrected manuscript is indexed, bound with photographs and illustrative materials, and placed in The Bancroft Library at the University of California, Berkeley, and in other research collections for scholarly use. Because it is primary material, oral history is not intended to present the final, verified, or complete narrative of events. It is a spoken account, offered by the interviewee in response to questioning, and as such it is reflective, partisan, deeply involved, and irreplaceable. ************************************ All uses of this manuscript are covered by a legal agreement between The Regents of the University of California and Arthur Kornberg, M.D., dated June 18, 1997. The manuscript is thereby made available for research purposes. All literary rights in the manuscript, including the right to publish, are reserved to The Bancroft Library of the University of California, Berkeley.
    [Show full text]
  • 1 History for Canonical and Non-Canonical Structures of Nucleic Acids
    1 1 History for Canonical and Non-canonical Structures of Nucleic Acids The main points of the learning: Understand canonical and non-canonical structures of nucleic acids and think of historical scientists in the research field of nucleic acids. 1.1 Introduction This book is to interpret the non-canonical structures and their stabilities of nucleic acids from the viewpoint of the chemistry and study their biological significances. There is more than 60 years’ history after the discovery of the double helix DNA structure by James Dewey Watson and Francis Harry Compton Crick in 1953, and chemical biology of nucleic acids is facing a new aspect today. Through this book, I expect that readers understand how the uncommon structure of nucleic acids became one of the common structures that fascinate us now. In this chapter, I introduce the history of nucleic acid structures and the perspective of research for non-canonical nucleic acid structures (see also Chapter 15). 1.2 History of Duplex The opening of the history of genetics was mainly done by three researchers. Charles Robert Darwin, who was a scientist of natural science, pioneered genetics. The proposition of genetic concept is indicated in his book On the Origin of Species published in 1859. He indicated the theory of biological evolution, which is the basic scientific hypothesis of natural diversity. In other words, he proposed biological evolution, which changed among individuals by adapting to the environment and be passed on to the next generation. However, that was still a primitive idea for the genetic concept. After that, Gregor Johann Mendel, who was a priest in Brno, Czech Republic, confirmed the mechanism of gene evolution by using “factor” inherited from parent to children using pea plant in 1865.
    [Show full text]
  • 2004 Albert Lasker Nomination Form
    albert and mary lasker foundation 110 East 42nd Street Suite 1300 New York, ny 10017 November 3, 2003 tel 212 286-0222 fax 212 286-0924 Greetings: www.laskerfoundation.org james w. fordyce On behalf of the Albert and Mary Lasker Foundation, I invite you to submit a nomination Chairman neen hunt, ed.d. for the 2004 Albert Lasker Medical Research Awards. President mrs. anne b. fordyce The Awards will be offered in three categories: Basic Medical Research, Clinical Medical Vice President Research, and Special Achievement in Medical Science. This is the 59th year of these christopher w. brody Treasurer awards. Since the program was first established in 1944, 68 Lasker Laureates have later w. michael brown Secretary won Nobel Prizes. Additional information on previous Lasker Laureates can be found jordan u. gutterman, m.d. online at our web site http://www.laskerfoundation.org. Representative Albert Lasker Medical Research Awards Program Nominations that have been made in previous years may be updated and resubmitted in purnell w. choppin, m.d. accordance with the instructions on page 2 of this nomination booklet. daniel e. koshland, jr., ph.d. mrs. william mccormick blair, jr. the honorable mark o. hatfied Nominations should be received by the Foundation no later than February 2, 2004. Directors Emeritus A distinguished panel of jurors will select the scientists to be honored. The 2004 Albert Lasker Medical Research Awards will be presented at a luncheon ceremony given by the Foundation in New York City on Friday, October 1, 2004. Sincerely, Joseph L. Goldstein, M.D. Chairman, Awards Jury Albert Lasker Medical Research Awards ALBERT LASKER MEDICAL2004 RESEARCH AWARDS PURPOSE AND DESCRIPTION OF THE AWARDS The major purpose of these Awards is to recognize and honor individuals who have made signifi- cant contributions in basic or clinical research in diseases that are the main cause of death and disability.
    [Show full text]
  • DNA: the Timeline and Evidence of Discovery
    1/19/2017 DNA: The Timeline and Evidence of Discovery Interactive Click and Learn (Ann Brokaw Rocky River High School) Introduction For almost a century, many scientists paved the way to the ultimate discovery of DNA and its double helix structure. Without the work of these pioneering scientists, Watson and Crick may never have made their ground-breaking double helix model, published in 1953. The knowledge of how genetic material is stored and copied in this molecule gave rise to a new way of looking at and manipulating biological processes, called molecular biology. The breakthrough changed the face of biology and our lives forever. Watch The Double Helix short film (approximately 15 minutes) – hyperlinked here. 1 1/19/2017 1865 The Garden Pea 1865 The Garden Pea In 1865, Gregor Mendel established the foundation of genetics by unraveling the basic principles of heredity, though his work would not be recognized as “revolutionary” until after his death. By studying the common garden pea plant, Mendel demonstrated the inheritance of “discrete units” and introduced the idea that the inheritance of these units from generation to generation follows particular patterns. These patterns are now referred to as the “Laws of Mendelian Inheritance.” 2 1/19/2017 1869 The Isolation of “Nuclein” 1869 Isolated Nuclein Friedrich Miescher, a Swiss researcher, noticed an unknown precipitate in his work with white blood cells. Upon isolating the material, he noted that it resisted protein-digesting enzymes. Why is it important that the material was not digested by the enzymes? Further work led him to the discovery that the substance contained carbon, hydrogen, nitrogen and large amounts of phosphorus with no sulfur.
    [Show full text]
  • Structure of DNA &
    Structure Of DNA & RNA By Himanshu Dev VMMC & SJH DNA DNA Deoxyribonucleic acid DNA - a polymer of deoxyribo- nucleotides. Usually double stranded. And have double-helix structure. found in chromosomes, mitochondria and chloroplasts. It acts as the genetic material in most of the organisms. Carries the genetic information A Few Key Events Led to the Discovery of the Structure of DNA DNA as an acidic substance present in nucleus was first identified by Friedrich Meischer in 1868. He named it as ‘Nuclein’. Friedrich Meischer In 1953 , James Watson and Francis Crick, described a very simple but famous Double Helix model for the structure of DNA. FRANCIS CRICK AND JAMES WATSON The scientific framework for their breakthrough was provided by other scientists including Linus Pauling Rosalind Franklin and Maurice Wilkins Erwin Chargaff Rosalind Franklin She worked in same laboratory as Maurice Wilkins. She study X-ray diffraction to study wet fibers of DNA. X-ray diffraction of wet DNA fibers The diffraction pattern is interpreted X Ray (using mathematical theory) Crystallography This can ultimately provide Rosalind information concerning the structure Franklin’s photo of the molecule She made marked advances in X-ray diffraction techniques with DNA The diffraction pattern she obtained suggested several structural features of DNA Helical More than one strand 10 base pairs per complete turn Rosalind Franklin Maurice Wilkins DNA Structure DNA structure is often divided into four different levels primary, secondary, tertiary
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name DCP1 decapping enzyme homolog A (S. cerevisiae) Gene Symbol Dcp1a Organism Mouse Gene Summary Description Not Available Gene Aliases 1110066A22Rik, 4930568L04Rik, AU019772, D14Ertd817e, Mitc1, SMIF RefSeq Accession No. NC_000080.6, NT_039606.8 UniGene ID Mm.28733 Ensembl Gene ID ENSMUSG00000021962 Entrez Gene ID 75901 Assay Information Unique Assay ID qMmuCID0013841 Assay Type SYBR® Green Detected Coding Transcript(s) ENSMUST00000022535 Amplicon Context Sequence TAATCTGGGAAGCACCGAGACTCTAGAAGAGACACCCTCTGGGTCACAGGATAA GTCTGCTCCGTCTGGTCATAAACATCTGACAGTAGAAGAGTTATTTGGAACCTCC TTGCCAAAGGAA Amplicon Length (bp) 91 Chromosome Location 14:30513043-30518984 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 98 R2 0.9997 cDNA Cq 22.41 cDNA Tm (Celsius) 81 gDNA Cq 24.87 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Dcp1a, Mouse Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Mouse Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Exon Amplification: a Strategy to Isolate Mammalian Genes Based on RNA Splicing (Gene Cloning/Polymerase Chain Reaction) ALAN J
    Proc. Natl. Acad. Sci. USA Vol. 88, pp. 4005-4009, May 1991 Genetics Exon amplification: A strategy to isolate mammalian genes based on RNA splicing (gene cloning/polymerase chain reaction) ALAN J. BUCKLER*, DAVID D. CHANG, SHARON L. GRAw, J. DAVID BROOK, DANIEL A. HABER, PHILLIP A. SHARP, AND DAVID E. HOUSMAN Center for Cancer Research, Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139 Contributed by Phillip A. Sharp, January 25, 1991 ABSTRACT We have developed a method, exon amplifi- (7, 8). Thus, this method may be generally applicable for the cation, for fast and efficient isolation of coding sequences from selection of exon sequences from any gene. The method is complex mammalian genomic DNA. This method is based on also both rapid and easily adapted to large scale experiments. the selection of RNA sequences, exons, which are flanked by A series of cloned genomic DNA fragments can be screened functional 5' and 3' splice sites. Fragments of cloned genomic within 1-2 weeks. The sensitivity of this method is high. DNA are inserted into an intron, which is flanked by 5' and 3' Genomic DNA segments of 20 kilobases (kb) or more can be splice sites of the human immunodeficiency virus 1 tat gene successfully screened in a single transfection by using a set contained within the plasmid pSPL1. COS-7 cells are trans- of pooled subclones. This method thus allows the rapid fected with these constructs, and the resulting RNA transcripts identification of exons in mammalian genomic DNA and are processed in vivo. Splice sites of exons contained within the should facilitate the isolation of a wide spectrum of genes of inserted genomic fragment are paired with splice sites of the significance in physiology and development.
    [Show full text]
  • Mrna Turnover Philip Mitchell* and David Tollervey†
    320 mRNA turnover Philip Mitchell* and David Tollervey† Nuclear RNA-binding proteins can record pre-mRNA are cotransported to the cytoplasm with the mRNP. These processing events in the structure of messenger proteins may preserve a record of the nuclear history of the ribonucleoprotein particles (mRNPs). During initial rounds of pre-mRNA in the cytoplasmic mRNP structure. This infor- translation, the mature mRNP structure is established and is mation can strongly influence the cytoplasmic fate of the monitored by mRNA surveillance systems. Competition for the mRNA and is used by mRNA surveillance systems that act cap structure links translation and subsequent mRNA as a checkpoint of mRNP integrity, particularly in the identi- degradation, which may also involve multiple deadenylases. fication of premature translation termination codons (PTCs). Addresses Cotransport of nuclear mRNA-binding proteins with mRNA Wellcome Trust Centre for Cell Biology, ICMB, University of Edinburgh, from the nucleus to the cytoplasm (nucleocytoplasmic shut- Kings’ Buildings, Edinburgh EH9 3JR, UK tling) was first observed for the heterogeneous nuclear *e-mail: [email protected] ribonucleoprotein (hnRNP) proteins. Some hnRNP proteins †e-mail: [email protected] are stripped from the mRNA at export [1], but hnRNP A1, Current Opinion in Cell Biology 2001, 13:320–325 A2, E, I and K are all exported (see [2]). Although roles for 0955-0674/01/$ — see front matter these hnRNP proteins in transport and translation have been © 2001 Elsevier Science Ltd. All rights reserved. reported [3•,4•], their affects on mRNA stability have been little studied. More is known about hnRNP D/AUF1 and Abbreviations AREs AU-rich sequence elements another nuclear RNA-binding protein, HuR, which act CBC cap-binding complex antagonistically to modulate the stability of a range of DAN deadenylating nuclease mRNAs containing AU-rich sequence elements (AREs) DSEs downstream sequence elements (reviewed in [2]).
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • (Bsc Zoology and Microbiology) Concept of Introns and Exons
    Unit-5 Molecular Biology (BSc Zoology and Microbiology) Concept of introns and exons Most of the portion of a gene in higher eukaryotes consists of noncoding DNA that interrupts the relatively short segments of coding DNA. The coding sequences are called exons. The noncoding sequences are called introns. Intron: An intron is a portion of a gene that does not code for amino acids An intron is any nucleotide sequence within a gene which is represented in the primary transcript of the gene, but not present in the final processed form. In other words, Introns are noncoding regions of an RNA transcript which are eliminated by splicing before translation. Sequences that are joined together in the final mature RNA after RNA splicing are exons. Introns are very large chunks of RNA within a messenger RNA molecule that interfere with the code of the exons. And these introns get removed from the RNA molecule to leave a string of exons attached to each other so that the appropriate amino acids can be encoded for. Introns are rare in genes of prokaryotes. #Look carefully at the diagram above, we have already discussed about the modification and processing of eukaryotic RNA. In which 5’ guanine cap and 3’poly A tail is added. So at that time, noncoding regions i.e. introns are removed. We hv done ths already. Ok Exon: The coding sequences are called Exon. An exon is the portion of a gene that codes for amino acids. In the cells of plants and animals, most gene sequences are broken up by one or more DNA sequences called introns.
    [Show full text]
  • Lasker Interactive Research Nom'18.Indd
    THE 2018 LASKER MEDICAL RESEARCH AWARDS Nomination Packet albert and mary lasker foundation November 1, 2017 Greetings: On behalf of the Albert and Mary Lasker Foundation, I invite you to submit a nomination for the 2018 Lasker Medical Research Awards. Since 1945, the Lasker Awards have recognized the contributions of scientists, physicians, and public citizens who have made major advances in the understanding, diagnosis, treatment, cure, and prevention of disease. The Medical Research Awards will be offered in three categories in 2018: Basic Research, Clinical Research, and Special Achievement. The Lasker Foundation seeks nominations of outstanding scientists; nominations of women and minorities are encouraged. Nominations that have been made in previous years are not automatically reconsidered. Please see the Nomination Requirements section of this booklet for instructions on updating and resubmitting a nomination. The Foundation accepts electronic submissions. For information on submitting an electronic nomination, please visit www.laskerfoundation.org. Lasker Awards often presage future recognition of the Nobel committee, and they have become known popularly as “America’s Nobels.” Eighty-seven Lasker laureates have received the Nobel Prize, including 40 in the last three decades. Additional information on the Awards Program and on Lasker laureates can be found on our website, www.laskerfoundation.org. A distinguished panel of jurors will select the scientists to be honored with Lasker Medical Research Awards. The 2018 Awards will
    [Show full text]