Clemson University TigerPrints
All Theses Theses
8-2013 DIVERSITY AMONG ISOLATES OF PHYTOPHTHORA INNC AMOMI FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA Simon Schreier Clemson University, [email protected]
Follow this and additional works at: https://tigerprints.clemson.edu/all_theses Part of the Plant Pathology Commons
Recommended Citation Schreier, Simon, "DIVERSITY AMONG ISOLATES OF PHYTOPHTHORA IC NNAMOMI FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA" (2013). All Theses. 1761. https://tigerprints.clemson.edu/all_theses/1761
This Thesis is brought to you for free and open access by the Theses at TigerPrints. It has been accepted for inclusion in All Theses by an authorized administrator of TigerPrints. For more information, please contact [email protected].
DIVERSITY AMONG ISOLATES OF PHYTOPHTHORA CINNAMOMI FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA
A thesis Presented to the Graduate School of Clemson University
In Partial Fulfillment of the Requirements for the Degree Master of Science Plant and Environmental Sciences
by Simon Gabriel Isaac Schreier August 2013
Accepted by: Dr. Steven N. Jeffers, Committee Chair Dr. Julia L. Kerrigan Dr. Saara J. DeWalt ABSTRACT
Phytophthora cinnamomi is a devastating pathogen that can attack over 900 hosts.
It is the most common species of Phytophthora isolated from woody ornamental crops in
South Carolina but little is known about variability among isolates of P. cinnamomi that attack these plants. Therefore, 142 isolates of P. cinnamomi recovered from diseased plant samples submitted to the Clemson University Plant Problem Clinic between 1995 and 2011 were characterized for mycelium growth habit, growth rate, mefenoxam sensitivity, mating type, and sporangium morphology. Mycelium growth habit on
PARPH-V8 selective medium was classified as aerial, appressed, or dwarf; 87% of isolates had the aerial mycelium growth habit. Isolates with different growth habits had significantly different growth rates. All isolates were uniformly sensitive to the fungicide mefenoxam at 100 ppm. The population was composed of 129 isolates that were mating type A2 and 13 isolates that were mating type A1, with six of these A1 isolates recovered from Camellia spp. All isolates with the aerial and appressed mycelium growth habits, which were most of the isolates in the study, produced few sporangia from clarified V8 juice agar plugs immersed in non-sterile soil extract for 1 to 4 days under continuous fluorescent light; however, the two isolates with the dwarf mycelium growth habit and a single isolate of P. cinnamomi var. parvispora produced abundant sporangia under these same incubation conditions. Isolates in this population originated from plant samples sent from 27 counties in South Carolina, two counties in Virginia, and one county in Georgia.
The 142 isolates were found associated with 56 known species and 16 unspecified
ii species in 46 genera and 31 families. Thirty-three previously unreported host plant associations were discovered.
The genetic diversity of this population was measured by sequencing DNA for several loci and building phylogenies based on these data. The ITS region was sequenced for all isolates in the population. There was a high degree of genetic uniformity in the ITS region for this population. Four other loci—β-tub, cox1, cox2, and rps10—were sequenced for a set of 59 isolates representative of the population. Two isolates, Pc40
(mating type A2) and Pc138 (mating type A1) from avocado trees in California, were incorporated into this study group as standards for comparison. Mating types were distinguishable at the β-tub locus, and both mating types and mycelium growth habit types were genetically distinct at the rps10 locus. Cluster analysis of the genotypes at each locus revealed seven distinct groups. Strong correlations were observed between cluster analysis groups and phenotypes of the isolates. This is the first study to find significant correlations between genotype and phenotypic characters other than mating type in P. cinnamomi.
iii DEDICATION
To everyone who helped me along the way; teachers, mentors, and friends. Especially to
Mom, Pops, and Max, I am here because of you.
iv ACKNOWLEDGMENTS
Dr. Steven Jeffers: for guiding me through three enlightening years of graduate school
and advising me on science, life, and everything in between, and whose help I could not
have succeeded without.
Dr. Julia Kerrigan and Dr. Saara DeWalt: for their role on my committee. I truly
appreciate your support, assistance, and patience.
Dr. Jaesoon Hwang and Inga Meadows: who helped get my research feet on the ground.
Lynn Luszcz: who pulled isolates, ordered materials, told stories, shared music, and (on
occasion) fed me. This project would have been impossible without her help.
Dr. Frank Martin, USDA-ARS Research Station, Salinas, CA: who provided intellectual
guidance and support.
Meg Williamson and the Clemson University Plant Problem Clinic: who received
diseased plant samples from which most of the isolates used in this study were
obtained.
Dr. William Bridges: for help and guidance with statistical analyses.
The people at the Clemson University Genomics Institute (CUGI): who expertly and
efficiently handled sequencing for this project.
The staff of the former Department of Entomology, Soils, and Plant Sciences: who
opened up a new world of plant pathology through classes, seminars, and conversation.
My fellow students: who have been supportive, informative, adventurous, and—above all
else—friends.
v TABLE OF CONTENTS
Page
TITLE PAGE ...... i
ABSTRACT ...... ii
DEDICATION ...... iv
ACKNOWLEDGMENTS ...... v
LIST OF TABLES ...... viii
LIST OF FIGURES ...... ix
CHAPTERS
I. LITERATURE REVIEW AND INTRODUCTION ...... 1
The Impact of Phytophthora cinnamomi on Ornamental Crops ...... 1 Phytophthora species and the Ornamental Plant Industry ...... 2 Phytophthora cinnamomi: Diseases, Biology, and Ecology ...... 6 Description and Ecology of Phytophthora cinnamomi ...... 8 Current Understanding of the Diversity of Phytophthora cinnamomi ...... 13 Research Project...... 20 Literature Cited ...... 22
II. PHENOTYPIC DIVERSITY AMONG AND HOST PLANT ASSOCIATIONS FOR ISOLATES OF PHYTOPHTHORA CINNAMOMI FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA...... 33
Abstract ...... 33 Introduction ...... 34 Materials and Methods ...... 40 Results ...... 50 Discussion ...... 56 Literature Cited ...... 66
III. GENETIC DIVERSITY AMONG ISOLATES OF PHYTOPTHORA CINNAMOMI FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA...... 90
vi Table of Contents (continued)
Page
Abstract ...... 90 Introduction ...... 91 Materials and Methods ...... 98 Results ...... 103 Discussion ...... 110 Literature Cited ...... 117
IV. SUMMARY OF FINDINGS AND FUTURE RESEARCH ...... 134
APPENDICES ...... 136
A: List of all isolates used in this study: Geographic information ...... 137 B: List of all isolates used in this study: Morphological and physiological characters ...... 149 C: List of all isolates used in this study: Molecular characters and species identification (far right column) ...... 155 D: Alternative β-tub phylogenetic tree incorporating isolate 05-0798 ...... 164 E: List of the subset of isolates used for phylogenetic analysis: Terminal clade and cluster analysis groups ...... 166
vii LIST OF TABLES
Table Page
2.1 Host plant associations for 142 isolates of Phytophthora cinnamomi recovered from ornamental plants between 1995 and 2011 ...... 74
2.2 Phenotypic characters for 142 isolates of Phytophthora cinnamomi used in this study ...... 80
2.3 Summary and analyses of morphological characters for 141 isolates of Phytophthora cinnamomi and one isolate of P. cinnamomi var. parvispora recovered from ornamental plants between 1995 and 2011 grouped by mycelium growth habit on PARPH-V8 selective medium ...... 84
viii LIST OF FIGURES
Figure Page
2.1 Relative frequency by county of plant samples in South Carolina from which isolates of Phytophthora cinnamomi were recovered between 1995 and 2011 ...... 85
2.2 Three mycelium growth habits of Phytophthora cinnamomi on PARPH-V8 after 72 h in the dark at 25ºC ...... 87
2.3 Sporangia of Phytophthora cinnamomi that were produced from clarified V8A plugs immersed in non-sterile soil extract solution and held under fluorescent light for 24 to 48 h...... 88
3.1 ITS phylogeny for 141 isolates of Phytophthora cinnamomi recovered from ornamental plants in South Carolina between 1995 and 2011...... 125
3.2A Phylogenetic trees using four different loci for a representative subset of 59 isolates of Phytophthora cinnamomi. β-tubulin: 56 isolates were included and three isolates (99-2746, 04-1256, and 05-0798) were omitted from the analysis ...... 128
3.2B Phylogenetic trees using four different loci for a representative subset of 59 isolates of Phytophthora cinnamomi. cox1: 57 isolates were included and two isolates (01-0926 and 99-2746) were omitted from the analysis ...... 129
3.2C Phylogenetic trees using four different loci for a representative subset of 59 isolates of Phytophthora cinnamomi. cox2: all 59 isolates were included ...... 130
3.2D Phylogenetic trees using four different loci for a representative subset of 59 isolates of Phytophthora cinnamomi. rps10: all 59 isolates were included ...... 131
ix List of Figures (continued)
Figure Page
3.3 Cluster analysis of all genotypes for five loci from 59 isolates of Phytophthora cinnamomi recovered from ornamental plants in South Carolina between 1995 and 2011 ...... 132
x CHAPTER 1
LITERATURE REVIEW AND INTRODUCTION
The Impact of Phytophthora cinnamomi on Ornamental Crops
Plant diseases cause significant economic losses to agricultural systems on an annual basis, with pathogens claiming 10-16% of global agricultural output (Chakraborty and Newton 2011, Oerke 2006, Strange and Scott 2005). Losses due to plant diseases cost the United States $220 billion a year (Agrios 2005). The ornamental crop industry is greatly impacted by plant disease because of the demand for pristine, symptom-free plants (Garibaldi and Gullino 2007). Oomycete pathogens, including species of
Phytophthora and Pythium, as well as downy mildews, are extremely detrimental to ornamental crops (Agrios 2005, Erwin and Ribeiro 1996, Jiang and Tyler 2012, Lebeda et al. 2008). Of the dozens of pathogenic species of Phytophthora, P. cinnamomi Rands is one of the most devastating, infecting somewhere between 900 to more than 3,000 host plants (Erwin and Ribeiro 1996, Hardham 2005, Martin and Coffey 2012, Zentmyer
1980). Fungicides are a primary means of plant disease management in commercial agriculture, and many fungicides are active against oomycetes (Erwin and Ribeiro 1996).
The ability of a pathogen to develop resistance and avoid the toxic effects of fungicides is dependent on its evolutionary potential; as such, it is important to have a sound understanding of the diversity of P. cinnamomi (Anderson 2005, McDonald and Linde
2002). A better understanding of the genetic and phenotypic diversity of P. cinnamomi
1 will provide insight into the potential for this pathogen to adapt to management strategies.
This information also could be used to reveal cryptic groups within the species (de Lima
Favaro et al. 2011, Runge et al. 2011). Identifying cryptic groups will aid in identifying pathogenic subspecies and could potentially add to the rapidly growing list of newly described species of Phytophthora.
Phytophthora species and the Ornamental Plant Industry
Ornamental plants are those grown primarily for aesthetic value, but they may provide secondary benefits such as privacy barriers, wind protection, and storm water mitigation (Rosen 1990). The number of plants cultivated for these purposes is astounding. For example, Bailey and Bailey (1977) provide a listing of cultivated plants grown in North America (excluding Mexico) that totals over 20,000 species. Baker and
Linderman (1979) estimated that 1,100 genera of plants were grown for the global ornamental plant industry. While a current accounting of ornamental plant species is lacking, these numbers have no doubt increased drastically in the intervening years.
Better breeding practices and the globalization of the agriculture marketplace have contributed immensely to industry growth, and it is estimated that revenue doubles every seven years (Wickens 2004).
Ornamental crops generally can be divided into six groups: floriculture crops (cut flowers, potted plants, and foliage plants), bedding plants, nursery crops (trees, shrubs, vines, and perennials), bulb crops (including rhizomes, tubers, and corms), seed crops,
2 and turf grasses (Baker and Linderman, 1979). Managing diseases of ornamental plants is a unique challenge due to the diversity of the crops grown, the need to maintain aesthetic value, large initial investments, propagation in an artificial environment, and the transport of plants (Alford 2000, Daughtrey and Benson 2005, Garibaldi and Gullino 1990, Jones and Benson 2001).
Ornamental plants are an important industry in the United States. Despite declining value due to a slowing economy in the late 2000s, the total wholesale crop value of ornamental plants in the United States in 2012 was $3.82 billion (Anonymous
2013). The industry is highly fragmented into relatively small operations; the top 50 producers produce less than 25% of total revenue. For comparison, the top five companies in the personal computer industry account for over half the revenue (Pettey
2012). In the United States, total receipts from the sale of ornamental plants from retailers in 2012 were $32.1 billion; however, the vast majority of plants sold were from outside the United States, with the top three exporters being Colombia (64%), Ecuador (17%), and The Netherlands (6%) (Anonymous 2010, Anonymous 2012b). As of 2011, there were over 5,000 producers of ornamental plants in the United States. Each of these growers employs an average of 18.7 workers during the peak of the growing season, for a total of roughly 100,000 employees directly employed by growers. This figure does not include those employed in ancillary industries such as retail, landscape installation and maintenance, and pest and disease management. Although growers have experienced a moderate deflation in the wake of the 2008 economic crisis, the ornamental plant industry still represents an important sector of the United States agricultural economy.
3 In South Carolina, the ornamental plant industry is a substantial contributor to agricultural revenue. The total value of all crops grown in South Carolina in 2011 was
$798,490,000; the wholesale value of ornamental plants was $87,982,000, accounting for
11% of total agricultural revenue in the state (Anonymous 2012a, Anonymous 2012b). Of the 15 top ornamental plant producing states, South Carolina is ranked 15th for number of production facilities, but 14th for revenue, having fallen from 13th in 2010 after being superseded by Maryland (Anonymous 2012b). The wholesale value of ornamental crops in South Carolina in 2011 decreased 8.4% from 2010. Revenue from the ornamental industry can be broken down by plant category: $75,634,000 from bedding and garden plants (86%), $8,711,000 from potted plants (10%), $1,199,000 from indoor herbaceous plants (1.3%), and the balance of $2,438,000 coming from unspecified plant categories
(2.7%).
Because damage from plant disease easily can decrease the aesthetic and economic value of ornamental plants, disease management is a constant challenge. For this reason, preventative management is important (Garibaldi and Gullino 1990, Jones and Benson 2001). For effective disease management, prophylactic fungicide applications when conditions favor infection and subsequent disease development, in addition to rapid response when a pathogen is detected are necessary (Komada and Asaga
2003, Mueller et al. 2004). Fungicides are an important part of an integrated pest management approach to disease management; as such, resistance to fungicides can be a threat to effective disease management (Hermann and Gisi 2012, Hu et al. 2008, Thind
2012).
4 Ever since the discovery of the fungicide metalaxyl in 1977, and later the more active isomer mefenoxam, these fungicides have been the primary chemical weapons in the fight against oomycete diseases (Cohen and Coffey 1986, Erwin and Ribeiro 1996).
These compounds inhibit both sporulation and mycelium growth (Staub and Young
1980). Metalaxyl and mefenoxam inhibit rRNA synthesis by intercalating with RNA polymerases (Davidse et al. 1983). There is a significant risk that Phytophthora species could become resistant to these closely related fungicides due to their highly specific mode of action. Only two years after its introduction, resistant isolates of P. infestans were discovered in European potato fields (Gisi and Cohen 1996). Since then, resistance to metalaxyl and mefenoxam has been discovered for several species of Phytophthora found on ornamental crops (Hwang and Benson 2005, Olson et al. 2013). The continued use of a single fungicide with a highly specific mode of action creates a high risk of resistance development in species of Phytophthora. Fortunately isolates of P. cinnamomi resistant to metalaxyl and mefenoxam have not been discovered (Benson and Grand
2000, Duan et al. 2008, Hu et al. 2010, Olson et al. 2013).
Under selection pressure from fungicides, evolution will favor populations of fungi that exhibit resistance (Fincham 2001). Resistance development in a population is dependent on three factors: the number of individuals, the rate of mutation, and the genetic diversity within the populations (Anderson 2005). McDonald and Linde (2002) assert that pathogens with a high evolutionary potential are more likely to develop resistance. One measure of evolutionary potential is the genetic diversity of a pathogen.
In a sense, it is like entering the evolutionary lottery with many different tickets, rather
5 than several copies of the same ticket. It is imperative that the genetic diversity of the pathogen be quantified to better gauge the capability of P. cinnamomi to develop resistance to chemical fungicides.
Investigations into the diversity of this pathogen are important from a taxonomic point of view as well. Research on species of Phytophthora has increased greatly in recent years. In the past decade, the number of described species of Phytophthora has nearly doubled (Brasier 2009). New species are being described at an unprecedented rate, and some of these are being resolved from previously ambiguous or heterogeneous taxonomic groups. Measuring genetic and morphological diversity has led to the discovery of cryptic species in several other genera of fungi and oomycetes (de Lima
Favaro et al. 2011, Runge et al. 2011). A thorough study of the genetic and morphological diversity of P. cinnamomi, a species traditionally considered to be homogeneous, could reveal that it actually is composed of distinct groups.
Phytophthora cinnamomi: Diseases, Biology, and Ecology
The genus Phytophthora is a member of the phylum Oomycota, a fungus-like lineage of microscopic eukaryotes in the kingdom Chromista (Cavalier-Smith 1986,
Levesque et al. 2008). The genera Phytophthora and Pythium are two of the most destructive groups of plant pathogens within Oomycota (Spring and Thines 2010). The genus Phytophthora contains numerous plant pathogens of historical and ecological importance—from the potato blight pathogen that caused the great famine in Ireland
6 (i.e., P. infestans) to the pathogen responsible for Phytophthora dieback in forests throughout Australia (i.e., P. cinnamomi) (Dell and Malajczuk 1989, Erwin and Ribeiro
1996, Nowicki et al. 2012). A number of Phytophthora species damage many ornamental crops, including both woody and herbaceous plants (Erwin and Ribeiro 1996, Hardy and
Sivasithamparam 1988, Jones and Benson 2001, Olson et al. 2013, Zentmyer 1980).
Diseases caused by species of Phytophthora are common in South Carolina and contribute to large economic losses from plant damage and quarantine (Williams 2009).
Phytophthora cinnamomi and P. nicotianae are the most commonly isolated species of
Phytophthora from woody and herbaceous ornamental plants in South Carolina, respectively (Duan et al. 2008, Ducharme and Jeffers 1998, Eisenmann 2003, Olson et al.
2013). P. cinnamomi is particularly detrimental, affecting a wide range of hosts (Erwin and Ribeiro 1996, Wills 1993, Zentmyer 1980, Zhou et al. 1992). Infection by P. cinnamomi most commonly causes symptoms including root rot (i.e., blackening and sloughing of the root cortex) and crown rot (i.e., the formation of dark lesions on the root crown and lower stem), which can lead to dieback of the entire plant and death (Chase et al. 1995, Erwin and Ribeiro 1996, Zentmyer 1980).
P. cinnamomi is a soilborne pathogen; it can survive in soil even in the absence of a host for prolonged periods (Jones and Benson 2001, Zentmyer 1980). Disease development is favored by wet or oversaturated soils, which permit motile zoospores to travel through water films surrounding soil particles and roots (Daughtrey and Benson
2005, Gleason et al. 2009, Hardham 2005). These edaphic conditions further exacerbate disease development by creating anaerobic conditions that can stress root systems and
7 make plants more susceptible to infection. Over the years, this pathogen has been associated with a great number of host plants, with estimates ranging from 900 to 3,000 species (Erwin and Ribeiro 1996, Hardham 2005, Martin and Coffey 2012, Zentmyer
1980).
Description and Ecology of Phytophthora cinnamomi
The genus Phytophthora and other oomycetes bear some resemblance to members of the kingdom Fungi. While both types of organisms grow vegetatively by means of hyphae, hyphae of Phytophthora species are diploid, while species of fungi have haploid hyphae (Erwin and Ribeiro 1996, Rossman and Palm 2006). Phytophthora species can reproduce both sexually through the union of an oogonium and an antheridium or asexually through the production of chlamydospores or sporangia (Judelson 2007).
Antheridia introduce gametes to oogonia in one of two ways: 1) amphigyny, in which the oogonium passes through the antheridium or 2) paragyny, wherein the antheridium attaches itself to the side of the oogonium (Erwin and Ribeiro 1996, Hüberli et al. 1997).
The result of either process, if fertilization is successful, is an oospore (Ko 1980). Some species are homothallic and are capable of sexual reproduction in single-isolate culture.
Other species are heterothallic and require the presence of two isolates with opposite mating types. Heterothallic species are divided into two mating-type groups: A1 and A2
(Erwin and Ribeiro 1996, Schumann and D'Arcy 2006). Oospores, the result of sexual
8 recombination, are thick-walled spores that can survive in soil or plant tissue for years
(Erwin and Ribeiro 1996).
Asexual reproduction is achieved by forming chlamydospores and sporangia.
Chlamydospores are spherical, thick walled, and sometimes pigmented resting structures
(Chang et al. 1974, Haasis and Nelson 1963, Stamps 1953). They are thought to be one type of survival structure for Phytophthora species, capable of persisting in soil or plant tissue for many years (Hwang and Ko 1978). Sporangia are lemon-shaped, ovoid, or spherical structures with an opening at the distal end. They are capable of direct germination by developing a germ tube from the apical pore, thus functioning as a conidium (Hwang and Ko 1978). Sporangia also are capable of indirect germination by producing zoospores, biflagellate motile spores capable of moving through water (Erwin and Ribeiro 1996, Mehrlich 1935). The longer, more powerful of the two flagella is called the whiplash flagellum, which provides the force that pushes the zoospore. The shorter flagellum has filaments extending perpendicular to the axis of the main flagellum and is called the tinsel flagellum; this flagellum pulls the zoospore (Hwang and Ko
1978). These filaments work in tandem to propel the zoospore through water films in oversaturated or poorly drained soils, in flowing waters, or in ponds. The cytoplasm of the sporangium can differentiate into many mono-nucleate spores, which eventually are released as zoospores. Spores are directed towards host plant tissue by chemotaxis and negative geotropism (Hickman 1970).
Species of Phytophthora are spread through dissemination of infected plant tissue or infested plants, plant debris, soil, and water (Erwin and Ribeiro 1996). In times of
9 environmental duress, chlamydospores and oospores are capable of surviving until favorable conditions prevail (Weste 1983). Disease progression is exacerbated in situations where soils are oversaturated and sanitation is poor. Recycling irrigation water can further exacerbate a Phytophthora disease problem in cultivated settings and nurseries; if inoculum gets into retention or irrigation ponds, use of infested water for irrigation can lead to infection of many plants throughout the landscape or nursery
(Reeves 1975).
Phytophthora cinnamomi was discovered first in Sumatra attacking cinnamon plants and was described by R. D. Rands in 1922 (Rands 1922). It now is known to cause a number of destructive diseases including Phytophthora dieback, littleleaf disease of short leaf pines, chestnut root rot, avocado root rot, and many others (Campbell and
Copeland 1954, Crandall et al. 1945, Dell and Malajczuk 1989, Zentmyer and Ohr 1978).
The pathogen is believed to have originated in Papua New Guinea but now is distributed globally (Old et al. 1984, Zentmyer 1980). Because of its broad host range, the tissues that are infected and the symptoms produced may vary. However P. cinnamomi commonly invades small feeder roots, causing a root rot that eventually progresses into larger roots. The pathogen also can invade the root crown, trunks, and woody stems— causing an orange to reddish-brown, sharply delimited canker (Erwin and Ribeiro 1996).
As the infection progresses chlorosis, reduction of leaf size, wilting, and dieback may occur due to the diminished ability of roots to uptake water and nutrients (Zentmyer
1980).
10 Phytophthora cinnamomi is a heterothallic species, and isolates in the United
States predominantly are of the A2 mating type (Zentmyer 1980). The hyphae of this species branch irregularly and have a coralloid morphology. Young cultures produce abundant hyphal swellings. Hyphae of mature cultures have numerous botryose swellings as a distinguishing feature (Ho and Zentmyer 1977). The sporangia are nonpapillate and are produced on simple or irregularly branched sporangiophores. Chlamydospores have a somewhat thickened walled and can occur in grape-like clusters. Sexual structures usually do not occur in single-isolate cultures but form readily when isolates of opposite mating types are brought together in vitro on an appropriate agar medium (Chang et al.
1974). The oogonia are smooth-walled and hyaline, developing slight yellow-brown pigmentation with age, and antheridia are amphigynous. When sexual reproduction occurs, the oospore almost entirely fills the oogonium (Zentmyer 1980). Cultures of P. cinnamomi commonly produce aerial hyphae, and on agar media the pathogen grows best at temperatures between 24º C and 28º C but can endure extremes of 5º C and 34º C
(Benson 1981, Erwin and Ribeiro 1996).
Gross colony morphology of P. cinnamomi is fairly unique among Phytophthora species (Zentmyer 1980). Most isolates develop a camellioid or rosette pattern. However, there is some deviation from these growth patterns, with certain isolates showing a reduced growth rate or alternate morphology (Eggers et al. 2012, Ho and Zentmyer
1977).
Of the four spore stages, formation of sporangia is potentially the most detrimental from a plant pathology perspective. By quickly generating numerous motile
11 zoospores, sporangia have the potential to dramatically increase inoculum in a relatively short period of time. The sporangia of P. cinnamomi lack a distinct papilla and are persistent; they are not readily dislodged from sporangiophores (Ho and Zentmyer 1977).
In general, they are ovoid to broadly ellipsoid in shape (Zentmyer and Ribeiro 1977).
Zentmyer (1980) gathered data from multiple publications to determine an average measure of sporangium dimensions: 43.6 to 75.0 µm long by 25.9 to 47.0 µm wide. The ratio of length to width can be a diagnostic morphological feature for Phytophthora spp.; in P. cinnamomi, the length:width ratio ranged from 1.4 to 1.9. One important feature about P. cinnamomi sporangia is the relatively low numbers produced in aqueous media
(Hwang and Ko 1978, Mehrlich 1935). Most species of Phytophthora readily produce sporangia in liquid media or on agar. Sporangium production in P. cinnamomi can be induced by exposing a culture to non-sterile soil solution, so it originally was hypothesized that several bacteria, particularly members of the genus Pseudomonas, may stimulate sporangium formation (Mehrlich 1935). We now know that both the microbes and dilute salts in soil extract solution help stimulate sporangium production (Erwin and
Ribeiro 1996). Some variability in the number of sporangia produced by isolates of P. cinnamomi has been observed, with some isolates producing abundant clusters of sporangia while other produce relatively few (Ho and Zentmyer 1977).
Mefenoxam sensitivity serves as another diagnostic feature for some
Phytophthora species and populations. This compound is one of the most widely used fungicides to manage Phytophthora diseases on ornamental crops (Parra and Ristaino
2001). Almost 3,000 kg of this material were used in six states during 2009, down from
12 37,000 kg in 2006 (Anonymous 2007, Anonymous 2011). A possible reason for this decline in usage is the emergence of resistant isolates of some species of Phytophthora and the introduction of new oomycete-specific fungicides (Olson et al. 2013). The discovery of resistant isolates of P. nicotianae and P. drechsleri in Virginia and the
Carolinas is troubling news for South Carolina growers (Hwang and Benson 2005, Olson et al. 2013). A 2008 study of 53 isolates of P. cinnamomi from ornamental crops in South
Carolina found no mefenoxam insensitive isolates (Duan et al. 2008). Others have reported similar results (Benson and Grand 2000, Greene et al. 2006, Hu et al. 2010).
However, continued monitoring will be necessary to determine if insensitivity has developed in South Carolina populations of P. cinnamomi.
Current Understanding of the Diversity of Phytophthora cinnamomi
The genetics of Phytophthora species historically have been understudied
(Kamoun 2003). Species of Phytophthora are diploid in their vegetative growth state, producing haploid oogonia and antheridia during sexual reproduction (Rossman and Palm
2006). Genome size among members of the genus varies greatly, ranging from 18 to 250 megabases (Mao and Tyler 1991, Martin 1995, Tooley and Therrien 1987). The genomes of some species of Phytophthora, like the well-studied P. sojae and P. infestans, are characterized by a large number of repetitive sequences (Judelson and Randall 1998, Mao and Tyler 1996). These motifs have been used to develop primers for the rapid identification and quantification of P. infestans. Some Phytophthora species exhibit
13 highly variable morphology, even when asexual reproduction predominates (Caten and
Jinks 1968). Several theories exist to explain this phenomenon (e.g. transposable elements, gene conversion, mitotic recombination, dispensable chromosomes) but none have been supported by significant evidence (Kamoun 2003).
Phytophthora cinnamomi is considered a heterothallic species, despite in vitro oospore induction under specific conditions (Savage et al. 1968, Zentmyer 1952). In
North American populations, the A2 mating type occurs much more frequently than the
A1 mating type (Zentmyer 1980). Brasier and Sansome (1975) observed meiosis in cultures induced to form gametes and determined that for a single complement of chromosomes n = 9 or 10.
Numerous studies have been conducted to assess the intraspecific variability among isolates of P. cinnamomi, in terms of both phenotype and genotype. Zentmyer
(1980) compared data from a number of studies and concluded that variation in reported sizes of oogonia and oospores were more likely due to differences in experimental conditions than the presence of separate races or strains of P. cinnamomi. Eggers et al.
(2012) measured sexual and asexual spore sizes in a mid-Atlantic forest population of P. cinnamomi, and found that spore sizes and length:width ratios fell within the limits of prior literature. Furthermore, the observed variation did not correlate with pathogenicity or genetic markers. Attempts to group the pathogen into pathotypes based on differences in pathogenicity and virulence were largely inconclusive (Zentmyer 1980). In his monograph, Zentmyer (1980) briefly mentions variation in gross colony morphology, but he does not elaborate by describing these different colony types. Hüberli et al. (2001)
14 measured phenotypic variation in two clonal lineages of P. cinnamomi from Western
Australia. This study showed that even within clonal lineages, specific isolates can display divergent morphological and pathogenic characters and that the spectrum of these characters within a lineage was “broad and continuous.” Cluster analysis of these characters roughly grouped the isolates by geographic location with a fairly low degree of accuracy (76% to 77%).
The intraspecific genetic diversity of P. cinnamomi has received a great deal of attention in recent years. The first studies used isozyme analysis to measure genetic diversity of the pathogen (Old et al. 1988, Old et al. 1984, Oudemans and Coffey 1991).
This methodology revealed low genetic diversity among A2 isolates. Conversely, the A1 mating type displayed high diversity. A study of a South African population of P. cinnamomi identified nine different multilocus isozyme genotypes (Linde et al. 1997); seven A2 genotypes and two A1 genotypes were characterized. Nonetheless, low levels of gene diversity were measured along with a low number of alleles per locus. No geographic pattern of genotype distribution could be found. From these data, the researchers surmised that sexual reproduction in the population was rare to nonexistent.
Two methods have been used to measure variability on a genome scale: random amplification of polymorphic DNA (RAPD) and amplified fragment length polymorphisms (AFLP). RAPD uses nonspecific primers to amplify genomic DNA; when samples are run on an electrophoretic gel the resultant patterns potentially could be used to identify a unique genotype (Williamson et al. 1990). RAPD was used to measure the inter-population genetic variation between two populations of P. cinnamomi, one
15 from South Africa and the other from Australia (Linde et al. 1999). The genetic distance between the two groups was minimal, and further evidence was found to support the hypothesis that sexual reproduction was extremely limited. RAPD was used to confirm this hypothesis in a study of a single population from Taiwan (Chang et al. 1996). This study showed low overall diversity within the population, with two groups segregating by mating type.
Amplified fragment length polymorphism assays are more reproducible and have higher resolution and sensitivity than RAPD assays (Mueller and Wolfenbarger 1999).
The genomic DNA of an organism is digested and adaptor sequences are ligated to the sticky ends created by the endonucleases. The fragments are then amplified using primers that bind to the adaptors. The amplicons are separated and visualized on polyacrylamide gels (Vos et al. 1995). Pagliaccia et al. (2013) recently used AFLP markers to investigate the genetic diversity among isolates of P. cinnamomi from avocado orchards in
California. This study also included representative global samples for comparison. Two distinct clades of A2 mating type isolates were revealed; one was spread geographically and temporally throughout the sample population while the other was found only in a single geographic area. A1 isolates formed a separate clade. These results indicate that there are two clonal lineages of P. cinnamomi in California avocado orchards, and the one from the limited geographic area may have been introduced only recently. The fact that A2 and A1 isolates fell into mutually exclusive clades is further indication of the absence of sexual reproduction. Another study also showed that the two mating types are characterized by different AFLP profiles (Duan et al. 2008). This study of a South
16 Carolina population from ornamental plants went on to show that despite only having two
A1 isolates, this mating type exhibited greater genetic diversity than any cluster of A2 isolates. These studies add evidence to the assertion that P. cinnamomi has low genetic diversity and that mating types can be distinguished genetically.
Microsatellites, or simple sequence repeats (SSR), provide a highly polymorphic marker for use in population genetic studies (Jarne and Lagoda 1996). Microsatellite loci are composed of a set number of short, repeated sequences (such as [CA]n). Their high inter- and intraspecific variability makes them useful for population genetic studies
(Goldstein et al. 1995). Dobrowolski et al. (2002) first used microsatellites as a tool to investigate P. cinnamomi diversity by using [A]n microsatellites in mitochondria similar to those found in plant chloroplasts. One coding and three non-coding poly-A mitochondrial loci were evaluated, but these were found to be minimally polymorphic.
Subsequently, four microsatellite loci were identified in P. cinnamomi and used to reveal three clonal lineages in Australian populations (Dobrowolski et al. 2002, Dobrowolski at al. 2003). These three groups corresponded to the isozyme types previously discovered
(Old et al. 1984, Old et al. 1988). A study of isolates from oak forests in the mid-Atlantic region used the same microsatellite loci to identify two clonal lineages (Eggers et al.
2012). These lineages, while sharing some similar fragment lengths with the Australia populations studied by Dobrowolski (2002) were distinct from those populations. In addition, the study measured the associations of various morphological characters with genotype, but no significant connection was found. As in prior studies, microsatellites
17 indicated no sexual reproduction was occurring, even in areas where both mating types were present.
The aforementioned studies indicate that P. cinnamomi is most likely, at this point in its natural history, a clonally reproducing species with no sexual reproduction. In situations where clonal reproduction predominates and sexual reproduction is rare, mitochondrial haplotypes may provide a useful marker for investigating populations
(Carter et al. 1990). Work with the mitochondrial genome began by using restriction fragment length polymorphisms (RFLP) to identify species, and occasionally intraspecific groups (Erwin and Ribeiro 1996). RFLP has been used to identify species based on the cox1 and cox2 gene clusters (Martin and Tooley 2003), but this study incorporated only four isolates of P. cinnamomi. No intraspecific variation was detected in this very limited sample set. Since then, several mitochondrial loci have been analyzed and successfully used to elucidate phylogenetic relationships within the genus (Kroon et al. 2004; Martin and Tooley 2003, 2004). However, the high interspecific variability and low intraspecific variability that make these genes excellent markers for delimiting species also make them relatively uninformative for intraspecific studies.
Other studies have demonstrated that intergenic regions have greater intraspecific variation, making them useful for species and population level phylogenetic studies
(Mammella et al. 2011, Schena and Cooke 2006, Tooley et al. 2006). Martin and Coffey
(2012) used full mitochondrion genomes from a variety of Phytophthora species to identify regions from the mitochondrion genome of P. cinnamomi that have utility as intraspecific markers. They discovered intraspecific differences in multiple loci mostly
18 consisting of single nucleotide polymorphisms (SNPs) and length mutations. Network analysis grouped isolates into units similar to those from prior isozyme studies, and, once again, mating types were clustered into clearly separate groups. This study provided the most up-to-date assessment of mitochondrion genetic markers. The researchers determined that only two to three loci need to be sequenced to resolve P. cinnamomi populations into groups based on mitochondrion haplotypes.
Direct gene sequencing also has been used to measure genetic variability in populations. Greene et al. (2006) sequenced three loci in a population of isolates of P. cinnamomi isolated from Fraser fir (Abies fraseri) in North Carolina. Genetic diversity within the population was absent, but some diversity was observed when this population was compared with isolates from other geographic regions and from other hosts. This study was the first of its kind to use multilocus sequencing to characterize genetic diversity in a population of P. cinnamomi from North Carolina.
Taken together, these genetic studies indicate that P. cinnamomi has low diversity, especially within populations from similar geographic regions. Mating between compatible isolates occurs readily under laboratory conditions (Hwang and Ko 1978), but sexual reproduction in natural settings is believed to be rare or nonexistent (Chang et al.
1974, Judelson 2007). There is very little evidence to show that genotype is a predictor of phenotype such as sporangium morphology or growth rate. However, genetic differences are useful for distinguishing A1 and A2 mating types. This disjunction between genotype and phenotype may be due in part to a degree of plasticity in gene expression.
19 Genetic data from many studies are openly available at the Phytophthora
Database (www.phytophthoradb.org) (Park et al. 2008), which is curated and maintained by researchers at The Pennsylvania State University. This database serves as a repository for sequence data, as well as procedures and conditions for molecular protocols. While other databases are available, the Phytophthora Database has the most frequently updated and actively curated genetic information available.
Research Project
The goal of this project was to measure the genetic and phenotypic variability of a population of P. cinnamomi, and determine if there were significant correlations between these traits. This project pertains to a population of P. cinnamomi isolates recovered by the Plant Problem Clinic at Clemson University between 1995 and 2011. Most of the isolates were recovered from diseased plant samples that originated at locations in South
Carolina, but the true point of origin of each isolate is difficult to ascertain due to the highly mobile nature of plant materials in the ornamental plant industry. Nonetheless, revealing the host-pathogen relationships and the diversity of this pathogen is important for effective management.
The first component of this project was confirming the identity of the isolates and determining the host-pathogen relationships. To ensure accurate results in the rest of this project, there could be no uncertainties about the species identity of each isolate in the study population.
20 The second objective was to compile a list of potential hosts in the population.
This goal involved checking numerous literature sources to determine whether the host had been reported before, and if so, to determine whether pathogenicity was confirmed.
Developing this list helped add several plant species to the host range of the pathogen.
The third part of this study involved studying genetic and phenotypic variation.
Genetic data began with RFLP fingerprints, which helped identify isolates that were not
P. cinnamomi; these isolates were removed from the study. Sequencing the ITS region followed. This locus is used as a diagnostic to determine species identity. Other loci
(cox1, cox2, β-tub, and rps10) were selected for sequencing for a representative subset of isolates based on their utility in previous studies. Phenotypic information that was investigated included mating type, sporangium morphology, mycelium growth habit, mefenoxam sensitivity, and mycelium growth rate.
Finally, these data were analyzed to determine if genotype served as a predictor of phenotype. Statistical analyses were conducted to group isolates with similar genetic profiles and measure the correlation between phenotypic characters and genotypes. While phenotypic plasticity has been observed in P. cinnamomi, the data derived from five sequenced loci (approximately 3.5 kb) revealed genetic and morphological groupings that previously were not recognized in this species.
This study will contribute to the determination of the genetic and morphological variability that is inherent to the species P. cinnamomi, and in doing so aid to reveal cryptic groups within the species. Chapter two will address the morphological diversity of this population and the host-pathogen associations present in the population. Genetic
21 diversity and correlation between genotype and phenotype is addressed in chapter three.
The results of this study and potential future projects are discussed in chapter four.
Literature Cited
Agrios, G. 2005. Plant Pathology, 5th edition, Elsevier Academic Press, Burlington, MA.
Alford, D. V. 2000. Pest and Disease Management Handbook. Blackwell Science, Hoboken, NJ.
Anderson, J. B. 2005. Evolution of antifungal-drug resistance: Mechanisms and pathogen fitness. Nature Reviews Microbiology 3:547-556.
Anonymous. 2007. Agricultural chemical usage (online). United States Department of Agriculture, National Agriculture Statistics Service, Washington D.C., USA.
Anonymous. 2010. Census of horticultural specialties (online). United States Department of Agriculture, Washington D.C., USA.
Anonymous. 2011. Agricultural chemical usage (online). United States Department of Agriculture, National Agricultural Statistics Service, Washington D.C., USA.
Anonymous. 2012a. Floriculture crops: 2011 summary (online). United States Department of Agriculture, National Agricultural Statistics Service, Washington D.C., USA.
22 Anonymous. 2012b. State agriculture overview: South Carolina (online). United States Department of Agriculture, National Agricultural Statistics Service, Washington D.C., USA.
Anonymous. 2013. Ornamental Floriculture and Nursery Products: Economic (online). The Gale Group, Farmington Hills, MI.
Bailey, L.H., Bailey, E.Z., and Staff of the L.H. Bailey Hortorium. 1977. Hortus Third: A Concise Dictionary of Plants Cultivated in the United States and Canada. Macmillan Publishing Co., New York, NY.
Baker, K., and Linderman, R. 1979. Unique features of the pathology of ornamental plant. Annual Review of Phytopathology 17:253-277.
Benson, D.M. 1981. Cold inactivation of Phytophthora cinnamomi. Phytopathology 72:560-563.
Benson D., and Grand L. 2000. Incidence of Phytophthora root rot of Fraser fir in North Carolina and sensitivity of isolates of Phytophthora cinnamomi to metalaxyl. Plant Disease 84:661-664.
Brasier, C. 2009. Phytophthora biodiversity: How many Phytophthora species are there? Pages 101-115 in: Proceedings of the Fourth Meeting of the International Union of Forest Research Organizations (IUFRO) Working Party S07.02.09: Phytophthoras in Forests and Natural Ecosystems. Goheen, E. M., and Frankel, S. J., tech. coords. General Technical Reports PSW-GTR-221. US Dept. of Agriculture, Forest Service, Pacific Southwest Research Station. Albany, CA.
Brasier, C., and Sansome, E. 1975. Diploidy and gametangial meiosis in Phytophthora cinnamomi, P. infestans and P. drechsleri. Transactions of the British Mycological Society 65:49-65.
Campbell, W. A., and Copeland, O. L. 1954. Littleleaf disease of shortleaf and loblolly pines. Page 41 in: Circular No. 940, US Department of Agriculture, Washington D.C.
Carter, D., Archer, S., Buck, K., Shaw, D., and Shattock, R. 1990. Restriction fragment length polymorphisms of mitochondrial DNA of Phytophthora infestans. Mycological Research 94:1123-1128.
23 Caten, C., and Jinks, J. 1968. Spontaneous variability of single isolates of Phytophthora infestans. Canadian Journal of Botany 46:329-348.
Cavalier-Smith T. 1986. The kingdom Chromista: Origin and systematics. Progress in Phycological Research 4:309-347.
Chakraborty, S., and Newton, A. 2011. Climate change, plant diseases and food security: an overview. Plant Pathology 60:2-14.
Chang, S., Shepherd, C., and Pratt, B. 1974. Control of sexuality in Phytophthora cinnamomi. Australian Journal of Botany 22:669-679.
Chang, T., Yang, W., and Wang, W. 1996. Use of random amplified polymorphic DNA markers for the detection of genetic variation in Phytophthora cinnamomi in Taiwan. Botanical Bulletin of Academia Sinica 37:165-171.
Chase, A. R., Daughtrey, M., and Simone, G. W. 1995. Diseases of Annuals and Perennials. Ball Publishing, West Chicago, IL.
Cohen, Y., and Coffey, M. D. 1986. Systemic fungicides and the control of oomycetes. Annual Review of Phytopathology 24:311-338.
Crandall, B. S., Gravatt, G., and Ryan, M. M. 1945. Root disease of Castanea species and some coniferous and broadleaf nursery stocks, caused by Phytophthora cinnamomi. Phytopathology 35:162-180.
Daughtrey, M. L., and Benson, D. M. 2005. Principles of plant health management for ornamental plants. Annual Review of Phytopathology 43:141-169.
Davidse, L. C., Hofman, A. E., and Velthuis, G. 1983. Specific interference of metalaxyl with endogenous RNA polymerase activity in isolated nuclei from Phytophthora megasperma f. sp. medicaginis. Experimental Mycology 7:344-361. de Lima Favaro, L. C., de Melo, F. L., Aguilar-Vildoso, C. I., and Araujo, W. L. 2011. Polyphasic analysis of intraspecific diversity in Epicoccum nigrum warrants reclassification into separate species (online). PLoS One 6:e14828.
Dell, B., and Malajczuk, N. 1989. Jarrah dieback-A disease caused by Phytophthora cinnamomi. Pages 67-87 in: The Jarrah Forest: A Complex Mediterranean Ecosystem. B. Dell, J.J. Havel, and N. Malajczuk, eds. Springer, Dordrecht, The Netherlands.
24 Dobrowolski, M. P., Tommerup, I., Blakeman, H. D., and O'Brien, P. A. 2002. Non- Mendelian inheritance revealed in a genetic analysis of sexual progeny of Phytophthora cinnamomi with microsatellite markers. Fungal Genetics and Biology 35:197-212.
Dobrowolski, M., Tommerup, I., Shearer, B., and O'Brien, P. 2003. Three clonal lineages of Phytophthora cinnamomi in Australia revealed by microsatellites. Phytopathology 93:695-704.
Duan, C., Riley, M., and Jeffers, S. N. 2008. Characterization of Phytophthora cinnamomi populations from ornamental plants in South Carolina, USA. Archives of Phytopathology and Plant Protection 41:14-30.
Ducharme, D., and Jeffers, S. N. 1998. Incidence of Phytophthora species in containerized woody ornamental crop nurseries. Phytopathology 88:S23.
Eggers, J., Balci, Y., and MacDonald, W. L. 2009. Variation among Phytophthora cinnamomi isolates from oak forest soils in the Eastern United States. Plant Disease 96:1608-1614.
Eisenmann J. A. 2003.Identification, Pathogenicity, and Virulence of Isolates of Phytophthora nicotianae from Ornamental Plants. M.S. Thesis. Clemson University, Clemson, SC.
Erwin, D. C., and Ribeiro, O. K. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN
Fincham, J. R. S. 1970. Fungal genetics. Annual Review of Genetics 4:347-372.
Garibaldi, A., and Gullino, M. 2007. Critical aspects in management of fungal diseases of ornamental plants and directions in research. Phytopathologia Mediterranea 46:135-149.
Garibaldi, A., and Gullino, M. 1990. Disease management of ornamental plants: A never ending challenge. Mededelingen van de Faculteit Landbouwwetenschappen, Rijksuniversiteit Gent 55:189-201.
Gisi, U., and Cohen, Y. 1996. Resistance to phenylamide fungicides: A case study with Phytophthora infestans involving mating type and race structure. Annual Review of Phytopathology 34:549-572.
25 Gleason, M. L., Daughtrey, M. L., Chase, A. R., Moorman, G. W., and Mueller, D. S. 2009. Diseases of Herbaceous Perennials. American Phytopathological Society, St. Paul, MN.
Goldstein, D. B., Linares, A. R., Cavalli-Sforza, L. L., and Feldman, M. W. 1995. An evaluation of genetic distances for use with microsatellite loci. Genetics 139:463-471.
Greene, M. D., Benson, M., and Ivors, K. L. 2006. Multilocus sequence analysis of Phytophthora cinnamomi from Fraser fir in North Carolina. Phytopathology 96:S42-S42.
Haasis, F., and Nelson, R. 1963. Studies on the biological relationship of species of Phytophthora as measured by oospore formation in intra-and interspecific crosses. Plant Disease Reporter 47:705-709.
Hardham, A. R. 2005. Phytophthora cinnamomi. Molecular Plant Pathology 6:589-604.
Hardy, G., and Sivasithamparam, K. 1988. Phytophthora spp. associated with container- grown plants in nurseries in Western Australia. Plant Disease 72:435-437.
Hermann, D., and Gisi, U. 2012. Fungicide resistance in Oomycetes with special reference to Phytophthora infestans and phenylamides. Pages 133-140 in: Fungicide Resistance in Crop Protection Risk and Management. T. S. Thind, ed. CABI Publishing, Oxfordshire, U.K.
Hickman, C.J. 1970. Biology of Phytophthora zoospores. Phytopathology 60:1128-1135.
Ho, H., and Zentmyer, G. 1977. Morphology of Phytophthora cinnamomi. Mycologia 69:701-713.
Hu J., Hong C., Stromberg E. L., and Moorman G. W. 2010. Mefenoxam Sensitivity in Phytophthora cinnamomi Isolates. Plant Disease 94 1:39-44.
Hu, J., Hong, C., Stromberg, E., and Moorman, G. 2008. Mefenoxam sensitivity and fitness analysis of Phytophthora nicotianae isolates from nurseries in Virginia, USA. Plant Pathology 57:728-736.
Hu, J., Hong, C., Stromberg, E. L., and Moorman, G. W. 2010. Mefenoxam sensitivity in Phytophthora cinnamomi isolates. Plant Disease 94:39-44.
26 Hüberli, D., Tommerup, I., and Hardy, G. E. J. 1997. The role of paragynous and amphigynous antheridia in sexual reproduction of Phytophthora cinnamomi. Mycological Research 101:1383-1388.
Hüberli, D., Tommerup, I. C., Dobrowolski, M. P., Calver, M. C., and Hardy, G. E. 2001. Phenotypic variation in a clonal lineage of two Phytophthora cinnamomi populations from Western Australia. Mycological Research 105:1053-1064.
Hwang, S., and Ko, W. 1978. Biology of chlamydospores, sporangia, and zoospores of Phytophthora cinnamomi in soil. Phytopathology 68:726-731.
Hwang, J., and Benson, D. 2005. Identification, mefenoxam sensitivity, and compatibility type of Phytophthora spp. attacking floriculture crops in North Carolina. Plant Disease 89:185-190.
Jarne, P., and Lagoda, P. J. 1996. Microsatellites, from molecules to populations and back. Trends in Ecology and Evolution 11:424-429.
Jiang, R. H., and Tyler, B. M. 2012. Mechanisms and evolution of virulence in Oomycetes. Annual Review of Phytopathology 50:295-318.
Jones, R. K., and Benson, D. M., eds. 2001. Diseases of Woody Ornamentals and Trees in Nurseries. American Phytopathological Society, St. Paul, MN.
Judelson, H. S. 2007. Sexual reproduction in plant pathogenic Oomycetes: Biology and impact on disease. Pages 445-458 in: Sex in Fungi. J. Heitman, J. W. Kronstad, J. W. Taylor, and L. A. Casselton, eds. ASM Press, Washington D.C., USA.
Judelson, H. S., and Randall, T. A. 1998. Families of repeated DNA in the oomycete Phytophthora infestans and their distribution within the genus. Genome 41:605-615.
Kamoun, S. 2003. Molecular genetics of pathogenic oomycetes. Eukaryotic Cell 2:191- 199.
Ko, W. 1980. Sexuality, evolution and origin of Phytophthora. Plant Protection Bulletin, Taiwan 22:141-151.
Komada, H., and Asaga, K. 2003. Current topics and problems concerning fungicides against seed-borne pathogens in vegetable and ornamental crops. Journal of Pesticide Science 28:440-447.
27 Kroon, L., Bakker, F., Van Den Bosch, G., Bonants, P., and Flier, W. 2004. Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genetics and Biology 41:766-782.
Lebeda, A., Spencer-Phillips, P. T., and Cooke, B. M. 2008. The Downy Mildews- Genetics, Molecular Biology and Control. Springer, Dordrecht, The Netherlands.
Levesque, C. A., de Cock, A. W. A. M., Robideau, G., Desaulniers, N., and Bala, K. 2008. The Oomycota. Phytopathology 98:S184.
Linde, C., Drenth, A., Kemp, G., Wingfield, M. J., and Von Broembsen, S. 1997. Population structure of Phytophthora cinnamomi in South Africa. Phytopathology 87:822-827.
Linde, C., Drenth, A., and Wingfield, M. J. 1999. Gene and genotypic diversity of Phytophthora cinnamomi in South Africa and Australia revealed by DNA polymorphisms. European Journal of Plant Pathology 105:667-680.
Mammella, M. A., Cacciola, S. O., Martin, F., and Schena, L. 2011. Genetic characterization of Phytophthora nicotianae by the analysis of polymorphic regions of the mitochondrial DNA. Fungal Biology 115:432-442.
Mao, Y., and Tyler, B. M. 1991. Genome organization of Phytophthora megasperma f. sp. glycinea. Experimental Mycology 15:283-291.
Mao, Y., and Tyler, B. M. 1996. The Phytophthora sojae genome contains tandem repeat sequences which vary from strain to strain. Fungal Genetics and Biology 20:43-51.
Martin, F. N. 1995. Electrophoretic karyotype polymorphisms in the genus Pythium. Mycologia 87:333-353.
Martin, F. N., and Coffey, M. D. 2012. Mitochondrial haplotype analysis for differentiation of isolates of Phytophthora cinnamomi. Phytopathology 102:229-239.
Martin, F. N., and Tooley, P. W. 2003. Phylogenetic relationships of Phytophthora ramorum, P. nemorosa, and P. pseudosyringae, three species recovered from areas in California with sudden oak death. Mycological Research 107:1379-1391.
Martin, F. N., and Tooley, P. W. 2004. Identification of Phytophthora isolates to species level using restriction fragment length polymorphism analysis of a polymerase chain reaction-amplified region of mitochondrial DNA. Phytopathology 94:983-991.
28 McDonald, B. A., and Linde, C. 2002. Pathogen population genetics, evolutionary potential, and durable resistance. Annual Review of Phytopathology 40:349-379.
Mehrlich, F. P. 1935. Nonsterile soil leachate stimulating to zoosporangia production by Phytophthora sp. Phytopathology 25:432-434.
Mueller, D., Jeffers, S. N., and Buck, J. 2004. Effect of timing of fungicide applications on development of rusts on daylily, geranium, and sunflower. Plant Disease 88:657-661.
Mueller, U. G., and Wolfenbarger, L. L. 1999. AFLP genotyping and fingerprinting. Trends in Ecology and Evolution 14:389-394.
Nowicki, M., Foolad, M. R., Nowakowska, M., and Kozik, E. U. 2012. Potato and tomato late blight caused by Phytophthora infestans: An overview of pathology and resistance breeding. Plant Disease 96:4-17.
Oerke, E.C. 2006. Crop losses to pests. Journal of Agricultural Science 144:31-43.
Old, K., Dudzinski, M., and Bell, J. 1988. Isozyme variability in field populations of Phytophthora cinnamomi in Australia. Australian Journal of Botany 36:355-360.
Old, K., Moran, G., and Bell, J. 1984. Isozyme variability among isolates of Phytophthora cinnamomi from Australia and Papua New Guinea. Canadian Journal of Botany 62:2016-2022.
Olson, H., Jeffers, S. N., Ivors, K., Steddom, K., Williams-Woodward, J., Mmbaga, M., Benson, D., and Hong, C. 2013. Diversity and mefenoxam sensitivity of Phytophthora spp. associated with the ornamental horticulture industry in the southeastern United States. Plant Disease 97:86-92.
Oudemans, P. and Coffey, M.D. 1991. A revised systematics of twelve papillate Phytophthora species based on isozyme analysis. Mycological Research 95:1025-1046.
Pagliaccia, D., Pond, E., McKee, B., and Douhan, G. 2013. Population genetic structure of Phytophthora cinnamomi associated with avocado in California and the discovery of a potentially recent introduction of a new clonal lineage. Phytopathology 103:91-97.
29 Park, J., Park, B., Veeraraghavan, N., Jung, K., Lee, Y.-H., Blair, J. E., Geiser, D. M., Isard, S.,Mansfield, M. A., Nikolaeva, E., Park, S.-Y., Russo, J., Kim, S. H., Greene, M., Ivors, K.L., Balci, Y., Peiman, M., Erwin, D. C., Coffey, M. D., Rossman, A., Farr, D., Cline, E., Grünwald, N. J., Luster, D. G., Schrandt, J., Martin, F., Ribeiro, O. K., Makalowska, I., and Kang, S. 2008. Phytophthora Database: A forensic database supporting the identification and monitoring of Phytophthora. Plant Disease 92:966-972.
Parra, G. and Ristaino, J.B. 2001. Resistance to mefenoxam and metalaxyl among field isolates of Phytophthora capsici causing Phytophthora blight of bell pepper. Plant Disease 85:1069-1075.
Pettey, C. 2012. Gartner Says Worldwide PC Shipments in Fourth Quarter of 2011 Declined 1.4 Percent; Year-End Shipments Increased 0.5 Percent (online). Gartner Research Group, Stamford, CT. < http://www.gartner.com/newsroom/id/1893523>
Rands, R. D. 1922. Stripe canker of Cinnamon caused by Phytophthora cinnamomi n. sp. Mededelingen van het Instituut voor Plantenziekten 54:53.
Reeves, R.J. 1975. Behaviour of Phytophthora cinnamomi Rands in different soil and water regimes. Soil Biology and Biochemistry 7:19-24.
Rosen, D., ed. 1990. Armored scale insects: their biology, natural enemies and control. Elsevier Inc., Cambridge, MA.
Rossman, A. Y., and Palm, M. E. 2006. Why are Phytophthora and other Oomycota not true fungi? Outlooks on Pest Management 17:217-219.
Runge, F., Choi, Y., and Thines, M. 2011. Phylogenetic investigations in the genus Pseudoperonospora reveal overlooked species and cryptic diversity in the P. cubensis species cluster. European Journal of Plant Pathology 129:135-146.
Savage, E.J., Clayton, C.W., Hunter, J.H., Brenneman, J.A., Laviola, C., and Gallegly, M.E. 1968. Homothallism, heterothallism, and interspecific hybridization in the genus Phytophthora. Phytopathology 58:1004-1021.
Schena, L., and Cooke, D. E. 2006. Assessing the potential of regions of the nuclear and mitochondrial genome to develop a "molecular tool box" for the detection and characterization of Phytophthora species. Journal of Microbiological Methods 67:70-85.
Schumann, G. L., and D'Arcy, C. J. 2010. Essential Plant Pathology, Second Edition. American Phytopathological Society, St. Paul, MN.
30 Shearer, B., Crane, C., and Cochrane, A. 2004. Quantification of the susceptibility of the native flora of the South-West Botanical Province, Western Australia, to Phytophthora cinnamomi. Australian Journal of Botany 52:435-443.
Spring, O., and Thines, M. 2010. Molecular techniques for classification and diagnosis of plant pathogenic Oomycota. Pages 35-50 in: Molecular Identification of Fungi. Y. Gherbawy, and K. Voigt, eds. Springer, Berlin, Germany.
Stamps, D. J. 1953. Oospore production in paired cultures of Phytophthora species. Transactions of the British Mycological Society 58:237-251.
Staub, T.H., and Young, T.R. 1980. Fungitoxicity of metalaxyl against Phytophthora parasitica var. nicotianae. Phytopathology 70:797-801.
Strange, R. N., and Scott, P. R. 2005. Plant disease: A threat to global food security. Annual Review of Phytopathology 43:83-116.
Thind, T. S. 2012. Fungicide Resistance in Crop Protection: Risk and Management. CABI Publishing, Oxfordshire, U.K.
Tooley, P. W., Martin, F. N., Carras, M. M., and Frederick, R. D. 2006. Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions. Phytopathology 96:336- 345.
Tooley, P. W., and Therrien, C. D. 1987. Cytophotometric determination of the nuclear DNA content of 23 Mexican and 18 non-Mexican isolates of Phytophthora infestans. Experimental Mycology 11:19-26.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., van De Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M., and Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23:4407-4414.
Weste, G. 1983. Population dynamics and survival of Phytophthora. Pages 237-257 in: Phytophthora: Its Biology, Taxonomy, Ecology, and Pathology. D. C. Erwin, S. Bartnicki-Garcia, and P.H. Tsao eds. American Phytopathological Society, St. Paul, MN.
Wickens, G. E. 2004. Economic Botany: Principles and Practices. Kluwer Academic Publishers, Dordrecht, The Netherlands.
31 Williamson, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18:6531-6535.
Williams, M. 2009. Annual Report: Plant Problem Clinic. Cooperative Extension Service, Clemson University, Clemson, SC.
Wills, R. 1993. The ecological impact of Phytophthora cinnamomi in the Stirling Range National Park, Western Australia. Australian Journal of Ecology 18:145-159.
Zentmyer, G.A. 1952. A substance stimulating sexual reproduction in Phytophthora cinnamomi. Phytopathology 42:24.
Zentmyer, G.A. 1980. Phytophthora cinnamomi and the Diseases it Causes. Monograph No. 10. The American Phytopathological Society, St. Paul, MN.
Zentmyer, G.A., and Ohr, H. 1978. Avocado root rot. California Avocado Society Yearbook 55:29-36.
Zentmyer, G.A., and Ribeiro, O.K. 1977. The effect of visible and near-visible radiation on sporangium production by Phytophthora cinnamomi. Phytopathology 67:91-95.
Zhou, X., Zhu, Z., Lu, C., Wang, S., and Ko, W. 1992. Phytophthora cinnamomi in Shanghai and its possible origin. Mycopathologia 120:29-32.
32 CHAPTER TWO
PHENOTYPIC DIVERSITY AMONG AND HOST PLANT ASSOCIATIONS FOR
ISOLATES OF PHYTOPHTHORA CINNAMOMI FROM ORNAMENTAL PLANTS IN
SOUTH CAROLINA
Abstract
Phytophthora cinnamomi is a devastating pathogen that can attack over 900 hosts—including many shrubs and trees. It is the most common species of Phytophthora isolated from woody ornamental crops in South Carolina but little is known about variability among isolates of P. cinnamomi that attack these plants. Therefore, 142 isolates of P. cinnamomi recovered from diseased plant samples submitted to the
Clemson University Plant Problem Clinic between 1995 and 2011 were characterized for mycelium growth habit, growth rate, mefenoxam sensitivity, mating type, and sporangium morphology. Isolate identities were confirmed by restriction fragment length polymorphism patterns and sequencing of the internal transcribed spacer region.
Mycelium growth habit on PARPH-V8 selective medium was classified as aerial, appressed, or dwarf; 87% of isolates had the aerial mycelium growth habit. Average mycelium growth rate on PARPH-V8, measured as colony diameter after 72 h at 25°C in the dark, was 64.7 mm for all isolates combined, but isolates with different growth habits had significantly different growth rates. All isolates were uniformly sensitive to the fungicide mefenoxam at 100 ppm. The population was composed of 129 isolates that
33 were mating type A2 and 13 isolates that were mating type A1, with six of these A1 isolates recovered from Camellia spp. All isolates with the aerial and appressed mycelium growth habits, which were most of the isolates in the study, produced few sporangia from clarified V8 juice agar plugs immersed in non-sterile soil extract for 1 to
4 days under continuous fluorescent light; however, the two isolates with the dwarf mycelium growth habit and a single isolate of P. cinnamomi var. parvispora produced abundant sporangia under these same incubation conditions. All three of these isolates were mating type A1. Isolates in this population originated from plant samples sent from
27 counties in South Carolina, two counties in Virginia, and one county in Georgia. The
142 isolates were found associated with 56 known species and 16 unspecified species in
46 genera and 31 families. Thirty-three previously unreported host plant associations were discovered.
Introduction
Phytophthora cinnamomi Rands is a devastating pathogen that by conservative estimates attacks over 900 species of plants (Erwin and Ribeiro 1996, Zentmyer 1980).
Woody ornamental plants are particularly susceptible to root, crown, and stem rots caused by this pathogen (Davison 1972, Jones and Benson 2001, Zentmyer 1980). P. cinnamomi is a major problem in both cultivated and wild settings. It is the causal agent of Phytophthora dieback, which affects large areas of eucalyptus forests in western
Australia (Dell and Malajczuk 1989, Robin et al. 2012). In the U.S., efforts to reintroduce
34 American chestnut (Castanea dentata) have been hindered by Phytophthora root rot, which also is caused by P. cinnamomi (Crandall et al. 1945, Jeffers et al. 2009). In a recent study on mefenoxam sensitivity of Phytophthora spp. associated with the ornamental horticulture industry in six southeastern United States, P. cinnamomi was the species most frequently associated with woody ornamental crops (Olson et al. 2013).
P. cinnamomi was also found to be one of four species that are responsible for the majority of Phytophthora diseases in the southeastern United States. Ornamental horticulture is a major industry in the region, and management of P. cinnamomi is an ongoing challenge for this industry—in nurseries, greenhouses, and landscapes
(Daughtrey and Benson 2005, Duan et al. 2008).
The number of species of Phytophthora that have been characterized has steadily increased in the past decade. Brasier (2009) estimated that in the year 2000, more than
100 years after the first species of Phytophthora was described, there were approximately
60 species of Phytophthora recognized, but more than 50 new species were described between 2000 and 2007. Additional new species continue to be described, with more than 100 species currently recognized (Lamour 2013). In light of these discoveries, it is important to have a sound understanding of intraspecific variation to provide useful information when new species are being delineated. This information also could reveal cryptic groups within a species or prevent unnecessary splitting of taxonomic units.
P. cinnamomi first was isolated in 1922 from diseased cinnamon trees in Sumatra, and Southeast Asia is considered to be the likely point of origin for this species (Crandall and Gravatt 1967, Erwin and Ribiero 1996, Zentmyer 1980). P. cinnamomi likely was
35 spread during the era of sailing ships and plant exploration, and the pathogen is now globally distributed (Robin et al. 2012). It may have been introduced to the U.S. when the country was being colonized and imports of plants and timber were coming from
Southeast Asia (Crandall and Gravatt 1967, Zentmyer 1980). In studies of the genus
Phytophthora by Waterhouse (1963), P. cinnamomi was placed in Group 6 based on morphological features—including non-papillate sporangia and oogonia with amphigynous antheridia. More recently, a multilocus phylogeny of known species of
Phytophthora divided the genus into a series of clades of species (Blair et al. 2008), with
P. cinnamomi in clade 7 along with the closely related P. cambivora and P. sojae. In
1980, Zentmyer summarized the current knowledge on P. cinnamomi in a monograph
(Zentmyer 1980), and this information was updated in 1996 in a book covering the genus
Phytophthora (Erwin and Ribeiro 1996).
Characterizing a population of P. cinnamomi should include a study of morphological and physiological variability as well as molecular genetic variability. The genus Phytophthora has several attributes that are useful for phenotypic description.
Traditionally, sporangium morphology has been used as a diagnostic character (Erwin and Ribeiro 1996, Liyanage and Wheeler 1989, Waterhouse 1963). Species of
Phytophthora exhibit differences in several metrics of sporangium morphology: abundance, shape, size, length:width ratio, type of papilla, and sporangiophore habit.
These features are used primarily to distinguish species from one another, but there also is a degree of phenotypic plasticity within species (Britt and Hanson 2009).
36 Isolates of P. cinnamomi produce non-papillate sporangia (Erwin and Ribeiro
1996, Ho and Zentmyer 1977, Waterhouse 1963, Zentmyer 1980). Previous studies of intraspecific variation in sporangium morphology have found that dimensions and subsequent length:width ratios varied widely among isolates but fell within previously described limits of 1.3 to 1.8 (Eggers et al. 2012, Zentmyer 1980). Inducing sporangium formation in the laboratory by this species can be a challenge (Chen and Zentmyer 1970,
Hwang and Ko 1978, Zentmyer 1965). A complex mineral and salt solution was developed by Chen and Zentmyer (1970) to stimulate sporangium formation. This process is time and labor intensive and has not always been effective (S. N. Jeffers, personal communication). A more efficient protocol is available using non-sterile soil extract solution (Duan et al. 2008, Ferguson and Jeffers 1999, Mehrlich 1935). Even using this method, sporangium formation by isolates of P. cinnamomi is meager, and the scarcity of sporangia in culture is a diagnostic feature of the species (Ferguson and Jeffers
1999, Mehrlich 1935, Robin et al. 2012). Recognizing the variability of sporangium morphology and development provides a more complete understanding of the morphological plasticity of P. cinnamomi and may help reveal previously uncharacterized morphotypes.
While sporangia are the result of asexual reproduction, oospores are the product of sexual reproduction— either by self-fertilization by a single isolate (homothallism) or by crossing two compatible isolates with opposite mating types, A1 and A2,
(heterothallism) (Erwin and Ribiero 1996). Although P. cinnamomi has been reported to produce homothallic oospores under certain circumstances (Zaki et al. 1983), this species
37 is universally accepted to be heterothallic (Erwin and Ribeiro 1996, Robin et al. 2008,
Zentmyer 1980). In the U.S., a disproportionate ratio of A2 over A1 isolates is common in nearly all populations of the pathogen (Duan et al. 2008, Eggers et al. 2102, Martin and
Coffey 2012, Pagliaccia et al. 2013, Zentmyer 1980). There is mounting evidence that the two mating types seldom produce viable oospores in situ (Dobrowolski et al. 2003,
Martin and Coffey 2012). In these studies, it is proposed that A1 and A2 mating types may be in the midst of a historical divergence. Therefore, it is useful to include a mating type analysis in any study of a population of P. cinnamomi to determine the mating type ratio and if morphological variation is associated with mating type. Such variation would suggest that the mating types are divergent in predictable ways that extend beyond oospore production.
Gross mycelium growth habit and colony morphology also are useful tools for parsing species of Phytophthora and subgroups within a species (Aragaki and Uchida
2001, Blair et al. 2008, Erwin and Ribeiro 1996, Gallegly et al. 2008, Satour and Butler
1968). Various formulations of V8 juice agar are commonly used media for culturing
Phytophthora species for growth and morphological analysis (Erwin and Ribeiro 1996,
Ribeiro 1978, Robin et al. 2008). On V8 agar, P. cinnamomi forms medium-dense, wooly hyphae that grow uniformly from the starting point. The hyphae grow in an aerial fashion above the surface of the agar, filling the space between the medium and the petri dish lid
(Coffey 1992, Hardham 2005). However, in some studies, the colony morphology of P. cinnamomi has been evaluated using potato dextrose agar (PDA) (Ho and Zentmyer
1977, Zentmyer 1980). In these studies P. cinnamomi mostly grew in a rosette pattern.
38 Some variability in gross mycelium morphology was described in these studies, but individual morphological types were not characterized or described. A recent study of isolates from eastern oak forests classified cultures as either “rosaceous” or “stellate” when grown on PDA (Eggers et al. 2012). Hüberli et al. (2001) also classified gross colony morphology on PDA with the terms “rosaceous,” “petaloid,” or “no-pattern.”
Other, more objective characters aid in defining phenotypic variation, and isolate growth rate is a common metric (Eggers et al. 2012, Erwin and Ribeiro 1996, Hüberli et al.
2001).
Sensitivity to chemical fungicides may be used as a measure of physiological diversity. In Phytophthora species, assaying sensitivity to the fungicides mefenoxam and metalaxyl can be informative and is important for making informed management decisions (Olson et al. 2013). In recent years, a number of fungicide insensitive isolates in several species of Phytophthora were reported from ornamental crops in North
Carolina, Virginia, and sites in the eastern United States (Hu et al. 2008, Hwang and
Benson 2005, Lamour et al. 2003, Olson and Benson 2011). Species of Phytophthora that have developed insensitivity to mefenoxam require other means of disease management
(Dunn et al. 2010, Olson et al. 2013, Venkataramana et al. 2010). In all published studies on P. cinnamomi, however, this species has been found to be sensitive to mefenoxam
(Benson and Grand 2000, Duan et al. 2010, Hu et al. 2010, Olson et al. 2013).
A catalogue of host plant associations is an important tool for diagnosing and managing diseases caused by P. cinnamomi. In 1980, Zentmyer reported at least 900 host plants for P. cinnamomi, but some researchers suggest that there are over 3,500 hosts
39 (Erwin and Ribiero 1996, Hardham 2005, Shearer et al. 2004, Zentmyer 1980). This broad host range probably has helped contribute to the global distribution of P. cinnamomi and has increased its potential to cause environmental and economic damage.
The objectives of this study were to measure the variability of several diagnostic morphological characters within a population of P. cinnamomi isolated from ornamental plants in South Carolina to determine if intraspecific morphological types exist and to identify new host plant associations. The characters assayed were mycelium growth habit, colony growth rate, sporangium morphology and abundance, mating type, and mefenoxam sensitivity. Isolation records were used to determine the host plant for each isolate, and this information was compared to the literature to determine if previously non-reported host-pathogen associations were present in this population. A preliminary report has been published (Schreier and Jeffers 2013)
Materials and Methods
Isolates. The 155 isolates in this study were obtained from the permanent collection of Phytophthora spp. maintained by S.N. Jeffers at Clemson University. The isolates of Phytophthora spp., which had been identified tentatively as P. cinnamomi, were pulled from the collection. These isolates came from diseased ornamental plant samples submitted to the Clemson University Plant Problem Clinic between 1995 and
2011. Restriction fragment length polymorphism (RFLP) profiles and sequencing of the internal transcribed spacer (ITS) region were used to determine the identities of all
40 isolates. Molecular data were corroborated with morphological information to provide a more robust identification. For each stored culture, a small block of agar containing mycelium was transferred to PARPH-V8 selective medium (Ferguson and Jeffers 1999) to revive the isolate. The components of 1 liter of PARPH-V8 were the following: 950 ml of distilled water, 50 ml of buffered and clarified V8 juice (see below), 15 g of Bacto agar (Becton, Dickinson, and Co.), 5 mg of pimaricin as Delvocid Instant (Gist-brocades,
Delft, The Netherlands), 250 mg of ampicillin sodium salt (IBI Scientific, Peosta, IA), 10 mg of rifamycin-SV sodium salt (Sigma-Aldrich Co., St. Louis, MO), 50 mg of pentachloronitrobenzene as Terraclor 75WP (Chemtura USA Corp., Middlebury, CT), and 50 mg of hymexazol as Tachigaren 70WP (Daiichi Sankyo Co. Ltd., Tokyo, Japan).
Antibiotics and fungicides were added to molten agar after autoclaving and cooling to
50°C. Buffered and clarified V8 juice was prepared by thoroughly mixing 1 g of CaCO3 with 100 ml of V8 juice (Campbell Soup Company, Camden, NJ). After centrifugation at
12,000 rpm for 15 min, the supernatant was decanted and stored at -20°C.
Cultures revived from storage were grown for 3 to 4 days at 25°C in the dark to produce actively growing mycelium. A single hypha from the edge of the advancing colony was transferred to 10% clarified V8 agar (cV8A: 100 ml of buffered and clarified
V8 juice, 15 g of Bacto agar, and 900 ml of distilled water) to ensure cultures corresponded to a single genotype and to verify axenic culture. Subcultures from single- hypha colonies were prepared for both long-term and short-term use in this study. Long- term cultures were made by transferring hyphae to an 8-ml glass vial filled with 5 ml of cV8A. These vials were maintained at 25°C for 5 days to allow for growth and then were
41 placed in the dark at 15°C for the duration of the study. Short-term cultures were maintained on petri plates containing PARPH-V8 at 25°C in the dark.
Extracting DNA for identification. All 155 isolates recovered from the collection were grown on PARPH-V8 for 3 days at 25ºC in the dark. A small block of agar containing mycelium was transferred from the margin of the advancing colony to cV8A. After 3 days at 25ºC in the dark, a 5-mm agar plug was taken from the actively growing margin of a colony and placed in a 60-mm petri dish. The plug was covered with
5 ml of 10% cV8 broth (cV8B: 100 ml of buffered and clarified V8 juice and 900 ml of distilled water). The plates were held at 25°C in the dark for 4 to 5 days. Mycelium mats were collected by vacuum filtration and then rinsed with distilled water to remove residual growth medium. Dry mycelium mats were moved to 1.5-ml screw-top microcentrifuge tubes, and DNA extraction followed immediately (Bowman et al. 2007).
DNA was extracted with a DNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA) using a modified protocol. Microcentrifuge tubes containing mycelium mats were filled with 0.5-mm-diameter glass beads (Biospec Products, Inc., Bartlesville, OK) to approximately two-thirds full, and 400 µl of buffer AP1 was added. Tubes were vigorously agitated for 1.5 min in a Mini Beadbeater-8 (Biospec Products, Inc.); 4 µl of
RNase A was added and tubes were vortexed for 1 min. The tubes were incubated at
65°C for 10 min, with gentle mixing by inversion every 3 min. Then, a 130-µl volume of
Buffer AP2 was added, and the tubes were placed on ice for a minimum of 5 min. The samples were centrifuged at 13,500 rpm, and the supernatant was recovered on a
42 QIAshredder Mini Spin Column (Qiagen Inc.). The remaining steps were conducted following the protocol provided by the manufacturer.
PCR amplification. ITS regions 1 and 2 were amplified using genus-specific primers: ITS 6 (5´‐GAAGGTGAAGTCGTAACAAGG‐3´) and ITS 4
(5´‐TCCTCCGCTTATTGA TATGC‐3´) (Bowers et al. 2007, Bowman et al. 2007,
Cooke et al. 2000). The reaction mixture had a total volume of 25.25 µl: 17.0 µl of double-distilled water, 2.5 µl of 10× PCR Buffer (-MgCl2) (Invitrogen, Carlsbad, CA),
2.5 µl of 1 mM dNTP mixture, 1 µl of 50 mM MgCl2, 0.5 µl of 25 µM of each primer,
0.25 µl (1.25 units) of Platinum® Taq Polymerase (Invitrogen), and 1 µl of template
DNA. The reaction was conducted in a T1 Thermocycler (Biometra®, Göttingen,
Germany): 94°C for 3 min, followed by 35 cycles of 55°C for 30 sec, 72°C for 1.5 min, and 94°C for 30 sec. The final extension step was 72°C for 10 min. Samples immediately were cooled to 4°C and moved to storage at -20°C. Amplified fragments were analyzed using RFLP and Sanger Sequencing.
RFLP fingerprints of the ribosomal encoded ITS region. ITS regions 1 and 2 amplification products were digested using the endonucleases AluI and MspI (Promega,
Madison, WI). The reaction mixture consisted of 10 µl of PCR product and 2 µl of enzyme mix: 1.6 µl of double-distilled water, 0.2 µl of endonuclease, and 0.2 µl of 10×
Buffer B supplied by the manufacturer. The reaction mixture was incubated at 37°C for 3 h and then heated to 65°C to denature the enzymes. Digested DNA was electrophoresed on a 2% agarose gel consisting of 1 g of 0.5× NuSieve®GTG®Agarose (Cambrex Bio
Science, Rockland, Inc. Rockland, ME) and 1 g of 0.5× UltraPure™ Agarose
43 (Invitrogen) dissolved in 100 ml of tris-Borate EDTA buffer (Qiagen Inc.). Gels were stained at 5% with 10 mg/ml of GelRed™ (Biotium, Hayward, CA), a non-carcinogenic alternative to ethidium bromide. Aliquots of 10 µl of digested DNA were mixed with 2 µl of 10× DNA gel-loading buffer (Eppendorf North America Inc., Westbury, NY) and pipetted into wells cast into the gel. TrackIt 100 base pair DNA ladder (Invitrogen) was used as a marker to estimate band sizes and to provide benchmarks for analytical software. Gels were run at 70 V for 3 h and visualized with UV light.
Band sizes were calculated using the AlphaImager Gel Imaging System
(Alphatech Innotech Corp., San Leandro, CA). DNA fragments from digestion products were compared to known standards (Cooke et al. 2000) to determine the identity of each isolate. If fragments sizes from both restriction enzyme digests corresponded to fragments from standard P. cinnamomi isolates then the test isolate was labeled as P. cinnamomi. If neither digest yielded the predicted fragment size for P. cinnamomi, the isolate was considered not to be P. cinnamomi and was excluded from further study. If the fragments from one digest corresponded with standard P. cinnamomi, the isolate tentatively was included in the study. This decision was made because a SNP or indel could interfere with endonuclease site recognition. These isolates were digested a second time to confirm the ambiguous RFLP profile. For all isolates labeled tentatively as P. cinnamomi, species identity was confirmed using additional ITS sequencing and morphological characters.
Sequencing the ITS region. ITS 1 and 2 amplification products from all isolates labeled as P. cinnamomi, tentatively or otherwise, were purified using ExoSAP-IT
44 (Affymetrix, Santa Clara, CA); 2 µl (1 unit) of ExoSAP-IT was mixed with 5 µl of amplification product. The mixture was held at 37ºC for 15 min and then heated to 80ºC for 15 min to denature the enzyme. This reaction was divided into two 3.5-µl aliquots, and 0.5 µl of 2 µM ITS4 and ITS6 primers each were added to one tube, providing both a forward and reverse sequencing reaction. All sequencing reactions were conducted at the
Clemson University Genomics Institute (CUGI). Forward and reverse sequences were trimmed, edited, and aligned using Sequencher 5.0 (Gene Codes Corp., Ann Arbor, MI).
Heterozygous sites were labeled with the appropriate IUPAC code. Consensus sequences were compared to sequences logged in the Phytophthora Database at Pennsylvania State
University (www.phytophthoradb.org) using nucleotide BLAST to determine species identity (Park et al. 2008). Isolates that were at least 99% homologous to sequences of two or more accessions of P. cinnamomi in the database were identified as P. cinnamomi.
Sporangium production. Isolates were grown on PARPH-V8 for 3 days at 25ºC in the dark. A plug of agar containing mycelium was moved to cV8A and grown for 3 days at 25ºC in the dark. Five 3-mm-diameter plugs were cut in the advancing margin of the culture using a cork borer. These plugs were moved to an empty 60-mm petri dish, and plugs were immersed in 8 ml of 1.5% non-sterile soil extract solution (NSSES)
(Jeffers and Aldwinckle 1987). NSSES was produced by mixing 30 g of soil (not infested with Phytophthora spp.) in 2 liters of distilled water. The suspension was mixed for 4 h and then allowed to settle over night at room temperature (21 to 25°C). The supernatant was decanted and centrifuged at 12,000 rpm for 10 min. This supernatant was filtered through cheese cloth and stored at 4ºC. After immersion in NSSES, the agar plugs were
45 incubated at room temperature (ranging from 22-27ºC) under constant fluorescent illumination. The cultures were observed at 24-h intervals for 4 days. After 48 h, the
NSSES was removed and replaced with distilled water. Plugs were observed microscopically (40 to 200×) to determine whether sporangia were present, the number of sporangia per plug at first flush, the type of papillae present on sporangia, and sporangiophore growth habit. Sporangia were classified as non-papillate if the apical thickening of the sporangium wall was inconspicuous, and semi-papillate or papillate if the papilla protruded beyond the normal contour of the sporangium apex (Blackwell
1949). Sporangiophore growth habit was classified as simple, branched, or sympodial.
Data on mean number of sporangia per plug were compared by one-way analysis of variance (ANOVA). All statistical analyses in this study were conducted using JMP statistical software ver. 10.0.
Oospore production and mating type. Oospores were produced in 24-well tissue culture plates (Greiner Bio-one North America Inc., Monroe, NC); each well contained 1 ml of super clarified V8 agar (scV8A) (Chee et al. 1976, Eisenmann 2003).
The components of 1 liter of scV8A were: 900 ml of distilled water, 100 ml of buffered and clarified V8 juice, 15 g of Bacto agar, 30 mg of beta-sitosterol (Sigma-Aldrich Co.) dissolved in 10 ml of 95% ethanol, 20 mg of L-tryptophan (Sigma-Aldrich Co.), 100 mg of CaCl2·2H2O, and 1 mg of thiamine hydrochloride (Sigma-Aldrich Co.). The amendments were added to the medium prior to autoclaving.
Mating type was determined by pairing each test isolate with a standard A1 and
A2 isolate of P. cinnamomi (Duan et al. 2008): isolate no. 99-2589 (A1) and isolate no.
46 96-1108 (A2). To obtain actively growing mycelia, test isolates and standards were grown on thin cV8A (5 ml of medium in a 60-mm petri plate) for 3 days at 25°C in the dark. Plugs (1 mm in diameter) from colony margins were removed and transferred to wells. One plug from a standard and one from a study isolate were placed across from each other in a well. Each study isolate was paired twice with the A1 standard and twice with the A2 standard, for a total of four wells per isolate. Paired cultures were incubated in the dark at 20°C for up to 6 weeks.
Plates were examined microscopically (20 to 400×) for oospore formation at weekly intervals beginning 2 weeks after the experiment was initiated. Isolates that consistently formed oospores when paired with the A1 standard isolate and not with the
A2 isolate were labeled as A2. Isolates that consistently produced oospores when paired with the A2 standard and not with the A1 standard were labeled A1. The experiment was conducted twice; each time the order of the isolates in 24-well plates was randomized. For isolates that did not produce oospores in the first or second trial, a third trial was conducted using a different set of standard isolates: isolate no. 96-0182 (A1) and isolate no. 96-1306 (A2) (Camacho 2009). Fisher’s Exact Test was used to determine if there was an association between the A1 mating type and isolation from Camellia spp.
Mefenoxam sensitivity. All 142 isolates were screened for sensitivity to the fungicide mefenoxam (as Subdue Maxx; Syngenta Crop Protection, Greensboro, NC) at
100 mg of active ingredient/liter using 48-well tissue culture plates (Greiner Bio-One
North America, Inc.; Olson et al. 2013). To obtain actively growing mycelia, isolates and standards were grown on thin cV8A for 3 days at 25°C in the dark. Each well contained
47 0.5 ml of 5% cV8A medium; 24 wells contained mefenoxam-amended medium and 24 wells contained non-amended medium. Mefenoxam was added to 5% cV8A after the medium had been autoclaved and cooled to below 50°C. An agar plug (1 mm in diameter) from the margin of an active culture was placed in the center of each well.
Plates were held at 25°C in the dark for five days. Each isolate was tested three times on mefenoxam-amended medium and three times on non-amended medium.
Plugs in wells were observed visually and microscopically (10 to 70×), and mycelium growth was rated on a scale from 0 to 5: 0 = no growth; 1 = hyphae visible only microscopically, with a few hyphae growing from the plug; 2 = hyphae visible only microscopically, with uniform growth around the plug; 3 = mycelium just visible macroscopically, with uniform growth around the plug; 4 = mycelium visible macroscopically but growth less than growth in non-amended wells; and 5 = mycelium visible macroscopically and growth equal to that in non-amended wells (Olson et al.
2013). A mean growth rating ˂4 indicated an isolate was sensitive to mefenoxam, and a mean growth rating ≥4 corresponded to an insensitive isolate. This assay was conducted twice, and isolates were randomly ordered in wells on the plates. Results from the two trials were averaged to obtain an overall mean score for each isolate.
Colony growth rate and mycelium growth habit. Isolates were grown on
PARPH-V8 at 25˚C for 72 h in the dark. A single agar plug 5 mm in diameter was taken from the actively growing margin of a colony and placed in the center of a 90-mm plate of PARPH-V8. Colony size was measured after 72 h in the dark at 25ºC. Perpendicular transects through the center of the original agar plug were drawn. Measurements were
48 taken from the tips of the hyphae at the margin of a colony along these transects, with two measurements per colony. These values were averaged to get a measure of mean colony diameter.
Gross mycelium growth habit was observed visually and microscopically (10 to
40×). Growth habit was sorted into three categories: aerial, appressed, and dwarf. Aerial colonies had dense mats of hyphae growing above the agar surface, filling the space between the agar surface and the petri dish lid. Appressed isolates had a markedly lower density of hyphae per unit area than aerial isolates and exhibited diminished or absent aerial growth. Dwarf isolates grew extremely slowly, with very dense mats of aerial hyphae growing only a short distance from the original plug. Mycelium growth rate and habit assays were conducted four times. Growth rates from the trials were averaged, and mycelium growth habit was compared across trials. Isolates that produced differing growth habits were labeled with the growth habit that occurred in the majority of assays.
An overall mean growth rate was calculated for each mycelium growth habit type using all the isolates with that type of growth habit. Student’s t test was used to determine if the mycelium growth habit types exhibited different mean growth rates.
Host plant associations. For isolates confirmed to be P. cinnamomi, the following data were collected or determined from the information provided when diseased plant samples were submitted to the Clemson University Plant Problem Clinic: host plant species, cultivar, and common name; tissue from which the sample was isolated; and geographic origin. Some records were incomplete. Current Latin binomial names were confirmed with assistance from Dr. P. D. McMillan, Clemson University
49 Botanist. Host plant associations were investigated in the literature to determine the earliest available reports. Several databases and publications were used for this purpose— including the USDA Agricultural Research Service Fungal Database (http://nt.ars- grin.gov/fungaldatabases/fungushost/fungushost.cfm), the Zentmyer monograph (1980),
Diseases and Disorders of Plants in Florida (Alfieri et al. 1994), and two investigative web resources: Web of Science (http://apps.webofknowledge.com/) and Google Scholar
(http://scholar.google.com/). Host plant associations not previously reported are noted as new. Host plants were classified using the terminology reported on the USDA-APHIS
List of Regulated Hosts and Plants Proven or Associated with Phytophthora ramorum
(Prakash 2012): Proven Host — P. cinnamomi was isolated from this plant and Koch’s postulates have been completed and documented; Associated Plant — P. cinnamomi has been cultured from or detected in plant tissue, but Koch’s postulates have not been completed.
Results
Isolates in the study population. Of the 155 isolates originally pulled from the collection, 142 isolates were confirmed to be P. cinnamomi and, therefore, were used in this study. The isolates were collected from ornamental plants in South Carolina (139 isolates), Virginia (2 isolates), and Georgia (1 isolates) during a 12-year period between
1995 and 2011 (Table 2.1, Fig. 2.1).
50 ITS-RFLP profiles were produced for all recovered isolates by digesting ITS 1 and
2 amplification products with AluI and MspI, and 140 isolates produced band patterns matching that of a standard isolate of P. cinnamomi (Cooke et al. 2000). The band sizes produced were 550, 210, and 190 bp when digested with AluI and 400, 210, 170, and 150 bp when digested with MspI.
Fifteen isolates produced band patterns that were ambiguous or inconsistent with those for P. cinnamomi. Four isolates produced P. cinnamomi banding patterns when digested with AluI but patterns not consistent with P. cinnamomi when digested with
MspI. Conversely, three isolates produced P. cinnamomi band patterns when digested with MspI but not with AluI. In cases that only one digest produced a P. cinnamomi profile, the isolates were labeled tentatively as P. cinnamomi. Identifications of these isolates later were refuted or verified using morphological characters and ITS 1 and 2 sequences. Eight isolates produced band patterns inconsistent with P. cinnamomi when digested with both endonucleases, so these isolates were excluded from the study, which reduced the study population to 147 isolates.
The ITS region of the 147 isolates were sequenced, and sequences were compared to isolates in the Phytophthora Database. The amplicon, once trimmed and aligned, was
631 bp in length. The ITS sequences from 141 isolates matched sequences of at least two
P. cinnamomi accessions in the database with ≥99% sequence homology. The sequence of one isolate (99-1940) matched the sequence of multiple isolates of P. cinnamomi var. parvispora with ≥99% sequence homology. Three isolates were identified at P. taxon niederhauserii and were removed from the study. Two isolates with MspI profiles
51 differing from that of P. cinnamomi failed to sequence after multiple attempts, and were excluded from further study. Consequently, the study population consisted of 141 isolates identified as P. cinnamomi and one isolate identified as P. cinnamomi var. parvispora using molecular means.
Morphological characters. All 155 initially recovered isolates were cultured to evaluate growth rate and habit on PARPH-V8. Isolates that had been shown to be a species other than P. cinnamomi by means of molecular techniques were included to verify the results from the molecular assays. Isolates that were determined not to be P. cinnamomi using molecular methods exhibited growth habits different from those exhibited by typical isolates of P. cinnamomi; for example, they lacked the coralloid hyphae and botryose hyphal swellings that are diagnostic of the species (Erwin and
Ribeiro 1996, Robin et al. 2012, Zentmyer 1980). Of the seven isolates with ambiguous
RFLP profiles, two exhibited a growth habit characteristic of P. cinnamomi, which confirmed ITS sequencing results. The other five isolates with ambiguous RFLP band patterns did not display the typical mycelium morphology of P. cinnamomi, which also confirmed results from ITS sequencing. The two isolates that failed to sequence also did not exhibit the typical mycelium morphology of P. cinnamomi. The eight isolates that had RFLP profiles inconsistent with those for P. cinnamomi also had mycelium morphology that was inconsistent with P. cinnamomi.
Three types of mycelium growth habit were recognized (Tables 2.2 and 2.3, Fig.
2.2). Of the 142 confirmed isolates of P. cinnamomi, 123 isolates (87%) had an aerial mycelium growth habit, 17 isolates (12%) had an appressed mycelium growth habit, and
52 two isolates (1%) had a dwarf mycelium growth habit. Thirteen isolates were mating type
A1, and 129 isolates were mating type A2. Both dwarf isolates were mating type A1, as was the single isolate of P. cinnamomi var. parvispora. Mean colony diameters of all three mycelium growth habits were different (P<0.0001; Table 2.3).
Sporangia were produced on five 3-mm agar plugs, each containing actively growing mycelium, in NSSES (Fig. 2.3). The majority of isolates produced sporangia within the 96-h trial period, and all sporangia produced were non-papillate on simple or branched sporangiophores (Table 2.2). Nearly all isolates that produced sporangia had done so within the first 48 h—before replacing the NSSES with distilled water. Sporangia from all sporulating isolates exhibited internal proliferation. There were consistently fewer than 35 sporangia per plug on isolates with aerial and appressed mycelium growth habits, and many of these isolates produced fewer than 10 sporangia per plug. The mean numbers of sporangia per plug for isolates with aerial and appressed mycelium growth habits were not significantly different (P>0.05; Table 2.3). However, the one isolate of
P. cinnamomi var. parvispora and the two isolates with the dwarf colony growth habit produced in excess of 100 sporangia per plug, and these numbers of sporangia were significantly greater than those produced by isolates with the other mycelium growth habits. The sporangia produced by the dwarf isolates were similar to sporangia produced by the other isolates of P. cinnamomi; they were non-papillate, ovoid, and internally proliferating (Fig. 2.3).
All 142 isolates crossed with the standard A1 and A2 isolates in the mating type study; 129 (91%) isolates were mating type A2 and 13 isolates (9%) were mating type A1
53 (Tables 2.2 and 2.3). Of the A1 isolates, 10 had the aerial mycelium growth habit, two had the dwarf mycelium growth habit, and one was P. cinnamomi var. parvispora (Table
2.3). Six of these 13 A1 isolates were recovered from species of Camellia and the other seven isolates were each recovered from a different host plant, one each from: Cedrus deodara, Gardenia sp., Hypericum androsaemum, Lilium hybrid, Paeonia sp., Santolina chamaecyparissus, and Sedum reflexum. Six of the seven isolates from Camellia spp. were mating type A1, the exception being isolate 07-0292. Fisher’s exact test was used to show that the probability that an isolate was mating type A1 was significantly greater if the host was a species of Camellia (P<0.0001).
Mefenoxam sensitivity. Mefenoxam sensitivity trials were conducted twice, and results from the two trials were consistent so were combined. Isolates grown in non- amended wells uniformly had growth ratings between 4 and 5, with mycelia covering the surface of the agar in each well. All 142 isolates confirmed to be P. cinnamomi grown in wells amended with 100 ppm mefenoxam uniformly had mean growth ratings ≤1, indicating that they were extremely sensitive to this fungicide. Because these results were consistent and uniform, they were not included in Tables 2.2 and 2.3.
Host plant associations. Host plant associations for the 142 isolates of P. cinnamomi were compared to those reported in the literature (Table 2.1). This population of isolates was found on plants in 46 genera from 31 families. There were four gymnosperm families (Cupressaceae, Ginkgoaceae, Pinaceae, Taxaceae) and one monocot family (Liliaceae); the other 27 families were eudicots. Plant samples from which isolates were recovered came from 27 counties in South Carolina, two counties in
54 Virginia, and one county in Georgia. The top five most represented counties in South
Carolina were Greenville (24 samples = 17%), Richland (14 samples = 10%), Pickens (13 samples = 9%), Lexington (11 samples = 8%), and Spartanburg (11 samples = 8%) (Fig.
2.1). In all, 72 plant species were found to be hosts of P. cinnamomi. Of these, 67 were associated plants. Only five were proven host plants based on Koch’s postulates. Most importantly, 33 of these host plants previously have not been reported and are new host plant associations for P. cinnamomi. Some of these new host plant associations have been noted in unpublished, online diseases indices for North Carolina and South Carolina
(Table 2.1).
Notable isolates. One P. cinnamomi var. parvispora A1 isolate from Hypericum androsaemum (St. John’s wort) was present in the collection. This isolate previously had been studied in our laboratory (Camacho 2009). The isolate produced aerial hyphae, but there were notably fewer hyphae swellings and chlamydospores than in typical isolates of
P. cinnamomi. In addition, sporangia were readily produced in abundance (Fig. 2.3).
The 17 appressed isolates produced a pronouncedly diminished amount of aerial mycelium (Figure 2.2). For the most part, any aerial mycelium that did develop was localized around the inoculation plug. Otherwise the mycelium was bound by the plane of the agar medium surface. The mycelium was less dense on the medium than in aerial isolates Other than mycelium growth habit, these isolates were similar to isolates that produced the aerial mycelium growth habit. Sparse isolates were present in the population from 1996 to 2010 and came from 15 different hosts in 11 genera. All appressed isolates were mating type A2.
55 The two dwarf isolates were characterized by extremely slow growing and dense mycelium (Fig. 2.2), and they readily produced sporangia in NSSES in 24 to 48 h (Fig.
2.3). These isolates were collected from Lilium hybrid cv. Orange Delight in 2002 and
Sedum reflexum cv. Blue Stonecrop in 2004. Both came from the same nursery and were mating type A1.
Discussion
Initially, 155 isolates were pulled from the permanent collection of Phytophthora species at Clemson University. In the process of identification, RFLP analysis, using
MspI and AluI, yielded some inconsistent results. Seven isolates could not be identified definitively as P. cinnamomi using RFLP patterns alone. Two of these isolates ultimately were identified as P. cinnamomi using ITS sequencing and morphological characters. The other five ambiguous isolates were determined not to be P. cinnamomi. These seven ambiguous isolates accounted for 4.5% of the 155 isolates. By corroborating genetic and morphological data, 142 isolates ultimately were identified as P. cinnamomi and used in this study; the identifications of these isolates were considered robust and reliable.
Utilizing both genetic and morphological characters to identify individual isolates were necessary for a study seeking to accurately determine the breadth of variability within a species and to report new, previously unreported hosts.
Sequencing of the ITS 1 and 2 region was the most reliable method for confirming species identification. In all, DNA samples from 147 isolates tentatively identified as P.
56 cinnamomi were sequenced, and 142 isolates were determined to be P. cinnamomi. Two of these 142 isolates originally had ambiguous identities based on RFLP patterns .
Sequences from three isolates matched sequences from isolates of P. taxon niederhauserii, a taxon closely related to P. cinnamomi (Blair et al. 2008). DNA from the remaining two isolates failed to sequence after multiple attempts. The identities of the
142 isolates identified as P. cinnamomi by ITS sequencing were confirmed using multiple morphological features, such as mycelium morphology and growth habit, sporangium morphology and production, and oospore production and mating type. The reliability of
ITS sequencing for species identification in this genus is entirely dependent on well- curated databases. The Phytophthora Database at Pennsylvania State University (Park et al. 2008), which serves as a repository for sequences of several loci from all species of
Phytophthora, was invaluable for this purpose. Ongoing maintenance and curation of this database should be a priority for the research community studying species of
Phytophthora.
Sequencing of the ITS region was a more reliable method of confirming species identity than was RFLP analysis. RFLP procedures were developed starting in 1997 and have proven useful for identification of Phytophthora species (Appiah et al. 2004, Cooke and Duncan 1997, Cooke et al. 2000). In light of recent developments that have made sequencing faster and less expensive, direct sequencing of fingerprinting loci such as the
ITS region is more useful. ITS sequencing gave no false positives or negatives. Both
RFLP and direct sequencing used the same information (the ITS sequence) to determine species identity, but direct sequencing produced higher resolution data. In addition, RFLP
57 cannot be used to distinguish closely related taxa that may only differ in a few nucleic acid residues, but ITS can. Both techniques rely on well-curated databases to provide data for comparison. The database of RFLP profiles created by Cooke and colleagues (2000) has not been maintained and includes only 45 species plus five variants of those species—most of the ones that were known and described at the time. Consequently, the usefulness of this database is limited. By comparison, the Phytophthora Database is actively curated with up-to-date data and taxonomic classifications, and therefore expediting species identification and genetic analysis. Two other genetic sequence databases—Phytophthora-ID (Grünwald et al. 2011) and GenBank, maintained by the
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/genbank/)—also can be useful for identifying isolates of
Phytophthora spp. when ITS sequence data are available.
The presence of an isolate of P. cinnamomi var. parvispora in the Clemson
University collection of Phytophthora species previously had been discovered using molecular methods (Camacho 2009). The identity of this isolate was confirmed with molecular data; there was 100% homology between the ITS sequence from this isolate and sequences from five isolates of P. cinnamomi var. parvispora in the Phytophthora
Database (PD_02691, PD_00188, PD_00394, PD_01686, and PD_01848). This isolate was mating type A1 and was recovered from roots of Hypericum androsaemum, which was collected in Greenville Co., SC in 1999. The isolate of P. cinnamomi var. parvispora had both genetic and morphological characters that were clearly distinct from those of typical isolates of P. cinnamomi. RFLP analysis of this isolate yielded minutely smaller
58 fragment sizes than those produced by digesting the ITS 1 and 2 region of P. cinnamomi.
Digestion of the amplification product from the P. cinnamomi var. parvispora isolate with AluI produced a 200-bp fragment but a 210-bp fragment from the P. cinnamomi amplification product; likewise, digestion with MspI produced fragments that had 170 bp in P. cinnamomi and 160 bp in P. cinnamomi var. parvispora. The P. cinnamomi var. parvispora isolate also produced abundant sporangia when agar plugs were immersed in
NSSES, which was very different from typical isolates of P. cinnamomi that produced very few sporangia. P. cinnamomi var. parvispora already is recognized in the literature as being distinct from P. cinnamomi in at least one study (Blair 2008). Additional studies may conclude that it is a separate species and not a variety of P. cinnamomi.
The isolates that were identified positively as P. cinnamomi based on ITS sequence data were a morphologically diverse group. Although they all developed coralloid hyphae with botryose hyphal swellings (Erwin and Ribeiro 1996, Waterhouse
1963, Zentmyer 1980), they exhibited three distinct mycelium growth habits on PARPH-
V8 selective medium: aerial, appressed, and dwarf. The aerial growth habit was by far the most frequent and corresponded to the traditional description of the mycelium growth habit for P. cinnamomi. The appressed growth habit was the second most frequent type, and only two isolates exhibited the dwarf growth habit. Isolates with aerial and appressed growth habits had different growth rates on PARPH-V8 medium but were similar in sporangium production and morphology. Isolates with the aerial growth habit grew faster than isolates with the appressed growth habit, and all isolates with these two growth habits produced limited numbers of non-papillate sporangia on simple or branched
59 sporangiophores when agar plugs were immersed in NSSES and placed under fluorescent light for 24 to 48 h.
The growth rate of isolates with the dwarf growth habit was significantly slower than the growth rates of isolates with the other two growth habits. The isolates with the dwarf growth habit were the only ones, aside from the P. cinnamomi var. parvispora isolate, that exhibited drastically different sporangium production. Whereas the majority of isolates of P. cinnamomi in this study produced few sporangia over the 96-h test period, the two dwarf isolates developed an abundance of sporangia in 24 h. They formed at the tips of long, slender sporangiophores that protruded radially from the agar plug.
The sporangia were non-papillate and similar to sporangia produced by isolates with the other growth habits.
Except for mycelium growth habit and growth rate measured as colony diameter, it appears that the 139 isolates that exhibited the aerial or appressed growth habits were mostly similar. The two isolates with the dwarf mycelium growth habit appear to be divergent from the other groups in multiple morphological characters. If these isolates are indeed members of the same species as the other 139 isolates, as is indicated by their being labeled as P. cinnamomi in the most current molecular database, than they represent a significant contribution to the morphological variability of the species. More genetic information is needed to determine whether the morphological differences of these two isolates are correlated with genetic variability or merely the result of a certain degree of phenotypic plasticity.
60 Despite the attempt to describe and utilize morphological groupings based on mycelium growth habit, this trait at times was a challenge to characterize. Unlike colony diameter, it is largely subjective and exists on a gradient. Distinguishing between the aerial and appressed growth habits depended on visual assessment of mycelium density in the agar and amount of aerial hyphae above the agar surface—both of which varied on a continuum. Nonetheless, the three different growth habits were useful for describing some of the morphological diversity observed in the population of isolates of P. cinnamomi from ornamental crops in South Carolina and could prove important if these morphological types are congruent with genetic delineations. These differences in mycelium growth habit were observed on PARPH-V8 selective medium, which is a standard isolation medium. Therefore, it is possible to identify differences in mycelium growth on original isolation plates or on subcultures from these plates.
The aerial growth habit on PARPH-V8 selective medium most closely resembles the growth habit reported by several others (Coffey 1992, Hardham 2005, Robin et al.
2012). The hyphae developed on top of the agar surface and for the most part filled the space between the agar and the petri dish lid. The delineated “lobes” or “zones” of growth observed on PDA in previous studies were not present (Ho and Zentmyer 1977,
Zentmyer 1980). In a recent study of isolates of P. cinnamomi from soils around oak trees in the eastern U.S. (Eggers et al. 2012), obvious differences in mycelium growth habit also were observed. Two colony types, both with aerial hyphae, were reported— stellate and rosaceous—but, again, these were produced on PDA. In a study of P. cinnamomi isolates from Western Australia, three distinct colony types were
61 recognized—rosaceous, petalloid, and no-pattern—when isolates were grown on PDA
(Hüberli et al. 2001). PDA is a rich medium high in carbohydrates that is not recommended for isolation of and sporulation by species of Phytophthora (Erwin and
Ribeiro 1996). Consequently, it would be more useful and efficient to evaluate mycelium growth habit on media commonly used for isolation, growth, and sporulation—like those made with V8 juice (Erwin and Ribeiro 1996).
The appressed and dwarf mycelium growth habit types observed on PARPH-V8 medium were not previously noted in the literature, but they may correspond to one of the different colony types produced on PDA that have been observed by others (Eggers et al.
2012, Zentmyer 1980). Alternatively, these groups could have been overlooked as they are represented by proportionately few isolates in the population. It remains to be seen whether these different growth habits are the result of phenotypic plasticity or if they can be correlated with genetic differences among the isolates.
Fungicide insensitivity potentially could hinder management of diseases caused by P. cinnamomi (Dreistadt 2001, Jeffers et al. 2001). New fungicides that selectively target Phytophthora spp. and other oomycetes have been developed in recent years
(Gullino et al. 2000, Young et al. 2004, Young and Slawecki 2001). Nonetheless, mefenoxam remains a potent and economical chemical control option for disease management on ornamental crops (Olson et al. 2013). Mefenoxam is a phenylamide compound that is selective for oomycetes (Schwinn and Staub 1987), but there is a risk that Phytophthora species could develop resistance to this fungicide. Resistance already has been detected in several species recovered from ornamental crops (Hu et al. 2008,
62 Hwang and Benson 2005, Jeffers et al. 2001, Olson and Benson 2011, Olson et al. 2013).
To date, though, isolates of P. cinnamomi insensitive to mefenoxam have not been discovered in the southeastern U.S. (Benson and Grand 2000, Duan et al. 2008, Hu et al.
2010, Olson et al. 2013). Likewise, all 142 isolates in this study were sensitive to mefenoxam at 100 ppm. Fifty-one of these isolates were tested previously using a different assay protocol; all were found to be sensitive to 1 ppm mefenoxam and EC50 values were equal to or less than 0.2 µg/ml (Duan et al. 2008). Results for the two assay methods with different rates of mefenoxam are similar and corroborative. Consequently, mefenoxam still should be an effective fungicide for the management of diseases caused by P. cinnamomi in South Carolina.
The A2 mating type was present in a much greater proportion than the A1 mating type in the population of 142 isolates of P. cinnamomi from ornamental crops used in this study, which is consistent with other published reports (Benson and Grand 2000, Ho and
Zentmyer 1977, Galindo and Zentmyer 1964, Zentmyer 1980). In Phytophthora
Diseases Worldwide by Erwin and Ribeiro (1996) state on page 270 in the chapter on P. cinnamomi, “The A1 mating type is more commonly found than the A2” and cite references; however, on the next page (page 271) they state: “Worldwide, the main mating type is A2.” Since this book was published, people working with P. cinnamomi have assumed the statement on page 270 was a typographical error. It has been noted that isolates of P. cinnamomi recovered from Camellia spp. with Phytophthora root rot in the United States were mating type A1 (Galindo and Zentmyer 1964, Zentmyer 1976). I found similar results; of the seven isolates isolates recovered from Camellia spp., six
63 were mating type A1. It appears that isolates of P. cinnamomi with the A1 mating type are more virulent than isolates with the A2 mating type on Camellia spp. (Zentmyer
1976, Zentmyer and Guillemet 1981), but Camellia spp. were not the only ornamental plant hosts for isolates with the A1 mating type in the test population studied here; seven
A1 mating type isolates came from other host plants—all in different genera.
The 142 isolates identified as P. cinnamomi were isolated from a diverse range of ornamental plants, spanning 56 species (not counting plant samples for which the host species was not specified), 46 genera, and 31 families. All but three isolates came from plant samples collected in South Carolina, with two isolates coming from plants in
Virginia and one isolate coming from a Georgia plant specimen. A large portion of the samples from South Carolina came from the five counties in the northwestern part of the state—where temperatures are more moderate is within the native range of many species in the family Ericaceae (USDA Plants Database; www.plants.usda.gov), the family to which the most number of diseased plants in this study belonged.
For host associations that had been reported previously, most have not had Koch’s postulates conducted and were labeled as associated plants and not proven hosts. The main exception was for host-pathogen relationships in the genus Rhododendron, where five hosts have been proven using Koch’s postulates (Benson et al. 1982). There were 33 host plant associations that had not been reported previously, and four of these new associations were not specified to species, only to genus. However, these four also were the first report of these genera being hosts. Some associations within the genus
Rhododendron were specified to the cultivar level because of the importance of P.
64 cinnamomi as a pathogen in this taxonomic group. Several new host plant associations reported here have been mentioned in two online plant disease indices, one from South
Carolina
(http://www.clemson.edu/public/regulatory/plant_industry/plant_prob_clinic/pdf/index_o f_plant_diseases_in_south_carolina.pdf) and another from North Carolina
(http://www.cals.ncsu.edu/course/pp318/host.pdf). These references have not been published formally, so new host-pathogen relationships reported in this study that previously had been mentioned in these documents were considered first reports.
Information in the online index from North Carolina corroborates some of the new hosts reported here. Some of the information in the index from South Carolina regarding species of Phytophthora isolated from ornamental plants is based on results from identifications made in our laboratory over the years, and these host plant associations formally are reported here in this study.
In summary, the population of isolates of P. cinnamomi from ornamental plants in
South Carolina used in this study was morphologically diverse in some respects while highly conserved in others. Isolates with visibly different mycelium growth habits were recognized and the growth rates for the isolates with these different growth habits varied significantly; however, traits such as sporangium morphology and mefenoxam sensitivity were invariant among all but a few isolates. Whether this diversity is an aspect of the overall species or is indicative of cryptic groups within the species remains to be seen.
More abundant and detailed genetic information in conjunction with this phenotypic data may help clarify this situation.
65 Literature Cited
Abad, Z. G., Creswell, T., Jones, R. K., and Shew, H. D. 1994. Occurrence of Phytophthora species on various hosts in North Carolina. Plant Disease 78:830.
Alfieri, S. A., Langdon, K. R., Kimbrough, J. W., El-Gholl, N. E., and Wehlburg, C., eds. 1994. Diseases and Disorders of Plants in Florida. 1st edition. Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Gainesville, Florida.
Anonymous. 1963. Plant disease survey for the 12 months ending June 30. New South Wales Department of Agriculture and Biology, Division of Science Services. Sydney, Australia.
Appiah, A. A., Flood, J., Archer, S. A., and Bridge, P. D. 2004. Molecular analysis of the major Phytophthora species on cocoa. Plant Pathology 53:209-219.
Aragaki, M., and Uchida, J. Y. 2001. Morphological distinctions between Phytophthora capsici and P. tropicalis sp. nov. Mycologia 93:137-145.
Benson, D. M., and Grand, L. F. 2000. Incidence of Phytophthora root rot of Fraser Fir in North Carolina and sensitivity of isolates of Phytophthora cinnamomi to metalaxyl. Plant Disease 84:661-664.
Benson, D. M., Jones, R. K., and Barker, K. R. 1982. Disease loss assessment for azalea, rhododendron, and Japanese holly in North Carolina nurseries. Plant Disease 66:125-127.
Blackwell, E. M. 1949. Terminology in Phytophthora: With Definitions and Descriptions. Mycological Papers No. 30. Commonwealth Mycological Institute, London, U.K.
Blair, J. E., Coffey, M. D., Park, S., Geiser, D. M., and Kang, S. 2008. A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genetics and Biology 45:266-277.
Bowers, J., Martin, F. N., Tooley, P., and Luz, E. 2007. Genetic and morphological diversity of temperate and tropical isolates of Phytophthora capsici. Phytopathology 97:492-503.
66 Bowman, K. D., Albrecht, U., Graham, J. H., and Bright, D. B. 2007. Detection of Phytophthora nicotianae and P. palmivora in citrus roots using PCR-RFLP in comparison with other methods. European Journal of Plant Pathology 119:143-158.
Brasier, C. M. 2009. Phytophthora biodiversity: How many Phytophthora species are there? Pages 101-115 in: Proceedings of the Fourth Meeting of the International Union of Forest Research Organizations (IUFRO) Working Party S07.02.09: Phytophthoras in Forests and Natural Ecosystems. Goheen, E. M., and Frankel, S. J., tech. coords. General Technical Reports PSW-GTR-221. US Dept. of Agriculture, Forest Service, Pacific Southwest Research Station. Albany, CA.
Britt, J., and Hansen, E. 2009. Phenotypic plasticity, fitness and multilocus genotypes of Phytophthora ramorum populations in southern Oregon tanoak forests. Phytopathology 99:S16.
Camacho, E. R. 2009. Diseases of floriculture crops in South Carolina: Evaluation of a pre-plant sanitation treatment and identification of species of Phytophthora. M. S. Thesis. Clemson University, Clemson, SC.
Cameron, H. R. 1962. Susceptibility of pear roots to Phytophthora. Phytopathology 52:1295-1297.
Caruso, F. L., and Ramsdell, D. C. 1995. Compendium of Blueberry and Cranberry Diseases. American Phytopathological Society, St. Paul, MN.
Chee, K. H., Zentmyer, G. A., Foong, K. M., and Klure, L. J. 1976. Mating types of Phytophthora palmivora in Malaysia. Plant Disease Reporter 60:866-867.
Cho W. D., and Shin H. D., eds. 2004. List of plant diseases in North Korea. 4th edition. Korean Society of Plant Pathology, Seoul, South Korea.
Chen, D., and Zentmyer, G. A. 1970. Production of sporangia by Phytophthora cinnamomi in axenic culture. Mycologia 62:397-402.
Coffey, M. D. 1992. Phytophthora root rot of avocado. Pages 423-444 in: Plant Diseases of International Importance. Singh, U.S., Mukhopadhyay, A.N., Kumar, J., and Chaube, H.S. eds. Prentice Hall, Upper Saddle River, NJ.
Cooke, D. E., and Duncan, J. M. 1997. Phylogenetic analysis of Phytophthora species based on ITS1 and ITS2 sequences of the ribosomal RNA gene repeat. Mycology Research 101:667-677.
67 Cooke, D. E. L., Drenth, A., Duncan, J. M, Wagels, G., and Brasier, C. M. 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genetics and Biology 30:17-32.
Crandall, B.S., and Gravatt, G.F. 1967. The distribution of Phytophthora cinnamomi. Part II—Geographical distribution. Ceiba 13:57-78.
Crandall, B. S., Gravatt, G. F., and Ryan, M. M. 1945. Root disease of Castanea species and some coniferous and broadleaf nursery stocks, caused by Phytophthora cinnamomi. Phytopathology 35:162-180.
Daughtrey, M. L., and Benson, D. M. 2005. Principles of plant health management for ornamental plants. Annual Review of Phytopathology 43:141-169.
Davison, E. M. 1972. Phytophthora cinnamomi on ornamentals in South Australia. Plant Disease Reporter 56:290.
Dell, B., and Malajczuk, N. 1989. Jarrah dieback — A disease caused by Phytophthora cinnamomi. Pages 67-87 in The Jarrah Forest: A Complex Mediterranean Ecosystem. Dell, B., Havel, J. J., and Malajczuk, N, eds. Springer, Dordrecht, The Netherlands.
Dingley, J. M., and Brien, R. 1969. Records of Plant Diseases in New Zealand. New Zealand Department of Scientific and Industrial Research, Palmerston North, New Zealand.
Dobrowolski, M. P., Tommerup, I. C., Shearer, B. L., and O'Brien, P. A. 2003. Three clonal lineages of Phytophthora cinnamomi in Australia revealed by microsatellites. Phytopathology 93:695-704.
Dreistadt, S. H. 2001. Integrated Pest Management for Floriculture and Nurseries. Agriculture and Natural Resources Publications No. 3402. University of California, Oakland, CA.
Duan, C. H., Riley, M. B., and Jeffers, S. N. 2008. Characterization of Phytophthora cinnamomi populations from ornamental plants in South Carolina, USA. Archives of Phytopathology and Plant Protection 41:14-30.
Dunn, A. R., Milgroom, M. G., Meitz, J. C., McLeod, A., Fry, W. E., McGrath, M. T., Dillard, H. R., and Smart, C. D. 2010. Population structure and resistance to mefenoxam of Phytophthora capsici in New York State. Plant Disease 94:1461-1468.
68 Eggers, J. E., Balci, Y., and MacDonald, W. L. 2012. Variation among Phytophthora cinnamomi isolates from oak forest soils in the eastern United States. Plant Disease 96:1608-1614.
Eisenmann, J. A. 2003. Identification, pathogenicity, and virulence of isolates of Phytophthora nicotianae from ornamental plants. M.S. Thesis. Clemson University, Clemson, SC.
Erwin, D. C., and Ribeiro, O. K. 1996. Phytophthora Diseases Worldwide. The American Phytopathological Society, St. Paul, MN
Ferguson, A. J., and Jeffers, S. N. 1999. Detecting multiple species of Phytophthora in container mixes from ornamental crop nurseries. Plant Disease 83:1129-1136.
Gadgil, P. D., Dick, M. A., Hood, I. A., and Pennycook, S. R. 2005. Fungi on Trees and Shrubs in New Zealand. Fungal Diversity Press, Hong Kong, China.
Galindo, J, and Zentmyer, G. A. 1964. Mating types in Phytophthora cinnamomi. Phytopathology 54:9.
Gallegly, M. E., and Hong, C. 2008. Phytophthora: Identifying Species by Morphology and DNA Fingerprints. The American Phytopathological Society, St. Paul, MN.
Gullino, M. L., Leroux, P., and Smith, C.M. 2000. Uses and challenges of novel compounds for plant disease control. Crop Protection 19: 1-11.
Grand, L. F., ed. 1985. North Carolina Plant Disease Index. 6th ed. North Carolina Agricultural Research Service, Durham, NC.
Grünwald, N. J., Martin, F. N., Larsen, M. M., Sullivan, Press, C. M., Coffey, M. D., Hansen, E. M., and Parke, J. L. 2011. Phytophthora-ID.org: A sequence-based Phytophthora identification tool. Plant Disease 95: 337-342.
Hardham, A. R. 2005. Phytophthora cinnamomi. Molecular Plant Pathology 6:589-604.
Hendrix, F. F., and Campbell, W. A. 1966. Root rot organisms isolated from ornamental plants in Georgia. Plant Disease Reporter 6:393-395.
Ho, H. H., and Zentmyer, G. A., 1977. Morphology of Phytophthora cinnamomi. Mycologia 69:701-713.
69 Hoitink, H. A. J., and Schmitthenner, A. F. 1974. Relative prevalence and virulence of Phytophthora species involved in rhododendron root rot. Phytopathology 64:1371- 1374.
Hu, J., Hong, C., Stromberg, E. L., and Moorman, G. W. 2008. Mefenoxam sensitivity and fitness analysis of Phytophthora nicotianae isolates from nurseries in Virginia, USA. Plant Pathology 57:728-736.
Hu, J. H., Hong, C. X., Stromberg, E. L., and Moorman, G. W. 2010. Mefenoxam sensitivity in Phytophthora cinnamomi isolates. Plant Disease 94:39-44.
Hüberli, D., Tommerup, I. C., Dobrowolski, M. P., Calver, M. C., and Hardy, G. E. S. St. J. 2001. Phenotypic variation in a clonal lineage of two Phytophthora cinnamomi populations from Western Australia. Mycology Research 105:1053-1064.
Hwang, J., and Benson, D. M. 2005. Identification, mefenoxam sensitivity, and compatibility type of Phytophthora spp. attacking floriculture crops in North Carolina. Plant Disease 89:185-190.
Hwang, S. C, and Ko, W. H. 1978. Biology of chlamydospores, sporangia, and zoospores of Phytophthora cinnamomi in soil. Phytopathology 68:726-731.
Jeffers, S. N., and Aldwinckle, H. S. 1987. Enhancing detection of Phytophthora cactorum in naturally infested soil. Phytopathology 77:1475-1482.
Jeffers, S. N., James, J. B., and Sisco, P. H. 2009. Screening for resistance to Phytophthora cinnamomi in hybrid seedlings of American chestnut. Pages 188-194 in Proceedings of the Fourth Meeting of the International Union of Forest Research Organizations (IUFRO) Working Party S07.02.09: Phytophthoras in Forests and Natural Ecosystems. Goheen, E.M.; Frankel, S.J., tech. coords. Gen. Tech. Rep. PSW-GTR-221. USDA Forest Service-Pacific Southwest Research Station, Albany, CA.
Jeffers, S. N., Miller, R. W., and Powell, C. C. 2001. Fungicides for ornamental crops in the nursery. Pages 409-416 in: Diseases of Woody Ornamentals and Trees in Nurseries. Jones, R. K., and Benson, D. M., eds. The American Phytopathological Society, St. Paul, MN.
Jeffers, W. F., Cox, C. E., Jehle, R. A., Weaver, L. O., Morgan, O. D., and Moore, J. E. 1951. Notes on occurrence of some plant diseases in Maryland during 1950. Plant Disease Reporter 35:385-386.
70 Jones, R. K., and Benson, D. M. 2001. Diseases of Woody Ornamentals and Trees in Nurseries. The American Phytopathological Society, St. Paul, MN.
Jones, R. K. and Jeffers, S. N. 2001. Ginkgo Diseases. Pages 175-176 in: Diseases of Woody Ornamentals and Trees in Nurseries. Jones, R. K., and Benson, D. M., eds. The American Phytopathological Society, St. Paul, MN.
Kirby, H. W., and Grand, L. F. 1975. Susceptibility of Pinus strobus and Lupinus spp. to Phytophthora cinnamomi. Phytopathology 65:693-695.
Lamour, K. H, ed. 2013. Phytophthora: A Global Perspective. CAB International, Oxfordshire, U.K.
Lamour, K. H., Daughtrey, M. L., Benson, D. M, Hwang, J., and Hausbeck, M. K. 2003. Etiology of Phytophthora drechsleri and P. nicotianae (= P. parasitica) diseases affecting floriculture crops. Plant Disease 87:854-858.
Liyanage, N. I. S., and Wheeler, B. E. J. 1989. Comparative morphology of Phytophthora species on rubber. Plant Pathology 38:592-597.
Manning, W. J., and Crossan, D. F. 1966. Evidence for variation in degree of pathogenicity of isolates of Phytophthora cinnamomi to broadleaf and coniferous evergreens. Plant Disease Reporter 50:647-649.
Martin, F. N., and Coffey, M. D. 2012. Mitochondrial haplotype analysis for differentiation of isolates of Phytophthora cinnamomi. Phytopathology 102:229-239.
Mehrlich, F. P. 1935. Nonsterile soil leachate stimulating to zoosporangia production by Phytophthora sp. Phytopathology 25: 432-434.
Moorman, G. W., Hong, C. X., and Richardson, P. A. 2004. First report of Phytophthora cinnamomi on Ilex glabra in Virginia. Plant Disease 88:1283.
Moreau, C., and Moreau, M. 1952. Étude mycologique de la maladie de l’encre du chêne. Revue de Pathologie Vegetale 31:201-231.
Olson, H. A., and Benson, D. M. 2011. Characterization of Phytophthora spp. on floriculture crops in North Carolina. Plant Disease 95:1013-1020.
71 Olson, H. A., Jeffers, S. N., Ivors, K. L., Steddom, K. C., Williams-Woodward, J. L., Mmbaga, M. T., Benson, D. M., and Hong, C. X. 2013. Diversity and mefenoxam sensitivity of Phytophthora spp. associated with the ornamental horticulture industry in the southeastern United States. Plant Disease 97:86-92.
Pagliaccia, D., Pond, E., McKee, B., and Douhan, G. W. 2013. Population genetic structure of Phytophthora cinnamomi associated with avocado in California and the discovery of a potentially recent introduction of a new clonal lineage. Phytopathology 103:91-97.
Park, J., Park, B., Veeraraghavan, N., Jung, K., Lee, Y. H., Blair, J. E., Geiser, D. M., and Kang, S. 2008. Phytophthora Database: a forensic database supporting the identification and monitoring of Phytophthora. Plant Disease 92:966-972.
Prakash, K. 2012. List of regulated hosts and plants proven or associated with Phytophthora ramorum (online). United States Department of Agriculture, Washington D.C. Accessed May 18, 2013.
Ribeiro, O. K., ed. 1978. A Source Book of the Genus Phytophthora. Lubrecht and Cramer, Ltd., Port Jervis, NY.
Robin, C., Smith, I., and Hansen, E. M. 2012. Phytophthora cinnamomi. Forest Phytophthoras 2(1). DOI:10.5399/osu/fp.2.1.3041.
Satour, M. M, and Butler, E. E. 1968. Comparative morphological and physiological studies of the progenies from intraspecific matings of Phytophthora capsici. Phytopathology 58:183-192.
Schreier, S. G. I., and Jeffers, S.N. 2013. Characterization of Phytophthora cinnamomi from ornamental crops in South Carolina. Phytopathology 103:S128-S129.
Schwinn, F. J, and Staub, T. 1987. Phenylamides and other fungicides against Oomycetes. Pages 260-273 in: Modern Selective Fungicides-Properties, Application, Mechanisms of Action. Lyr, H. ed. Longman Scientific and Technical, London, UK.
Shearer, B. L, Crane, C. E, and Cochrane, A. 2004. Quantification of the susceptibility of the native flora of the South-West Botanical Province, Western Australia, to Phytophthora cinnamomi. Australian Journal of Botany 52:435-443.
72 Torgeson, D. C. 1954. Root rot of Lawson cypress and other ornamentals caused by Phytophthora cinnamomi. Contributions to the Boyce Thompson Institute 17:359-373.
Venkataramana, C., Taylor, R. J., Pasche, J. S., and Gudmestad, N. C. 2010. Prevalence of mefenoxam resistance among Phytophthora erythroseptica Pethybridge isolates in Minnesota and North Dakota. American Journal of Potato Research 87:521-530.
Waterhouse, G. M. 1963. Key to the species of Phytophthora de Bary. Mycological Papers No. 92. Commonwealth Mycological Institute, Kew, Surrey, United Kingdom.
Young, D. H., Kemmitt, G. M., Owen, J., Dehne, H. W., Gisi, U., Kuck, K. H., Russell, P. E., and Lyr, H. 2005. A comparative study of XR-539 and other oomycete fungicides: similarity to dimethomorph and amino acid amides in its mechanism of action. Pages 142-152 in: Modern Fungicides and Antifungal Compounds. Dehne, H. W., Gisi, U., Kuch, K. H., Russell, P. E., and Lyrm H. eds. British Crop Protection Council, Alton, United Kingdom.
Young, D. H., and Slawecki, R. A. 2001. Mode of action of zoxamide (RH-7281), a new oomycete fungicide. Pesticide Biochemistry and Physiology 69:100-111.
Zaki, A., Zentmyer, G. A., Sims, J., and Keen, N. 1983. Stimulation of sexual reproduction in the A2 mating type of Phytophthora cinnamomi by oleic acid and lipids from avocado roots. Phytopathology 73:199-203.
Zentmyer, G. A. 1965. Bacterial stimulation of sporangium production in Phytophthora cinnamomi. Science 150:1178-1179.
Zentmyer, G. A. 1976. Distribution of the A1 mating type of Phytophthora cinnamomi. Phytopathology 66:701-703.
Zentmyer, G. A. 1980. Phytophthora cinnamomi and the diseases it causes. Monograph No. 10. The American Phytopathological Society, St. Paul, MN.
Zentmyer, G. A. and Guillemet, F. B. 1981. Evidence for strains of Phytophthora cinnamomi. Plant Disease 65:475-477.
Zentmyer, G. A., and Munnecke, D. E. 1952. Phytophthora root rot of nursery stock. Plant Disease Reporter 36:211-212
73 Table 2.1. Host plant associations for 142 isolates of Phytophthora cinnamomi recovered from ornamental plants between 1995 and 2011s
Host plantt Host statusu
Common Associated/ Previously No. of samples Family Genus Species Cultivar Name Proven reported by countyv Adoxaceae Viburnum obovatum Small-leaf Associated No Hampton-1 arrowwood
Viburnum tinus Laurustinus Associated No Dorchester-1 Aquifoliaceae Ilex cornuta Steeds Chinese holly Associated Nox Laurens-1 Ilex crenata Japanese holly Associated Jeffers et al. 1950 Charleston-1 Georgetown-1 Greenville-1 Marion-1
Ilex glabra Shamrock Inkberry Associated Moorman et al. Greenville-1 2004 Pickens-1
Ilex opaca American holly Associated Manning & Crossan Spartanburg-1 1966
Ilex × attenuata Foster holly Associated Alfieri et al. 1994 Greenville-1 Oconee-1
Ilex vomitoria Nana Yaupon holly Associated Grand 1985 Georgetown-1 Ilex sp. Holly Associated Yesy Pickens-1 Asteraceae Santolina chamaecyparissus Lavender Associated No Albamarle, VA-1 cotton Berberidaceae Berberis sp. Barberry Associated Grand 1985 Greenville-1 Betulaceae Betula nigra River birch Associated No Dekalb, GA-1 Buxaceae Buxus sempervirens Boxwood Associated Hendrix & Greenville-1 Campbell 1966 Lexington-1
Crassulaceae Sedum reflexum Stonecrop Associated No York-1
74 Cupressaceae Chamaecyparis obtusa Hinoki Associated Torgeson 1954 Spartanburg-2 falsecypress
Chamaecyparis thyoides Atlantic white Associated Nox Oconee-1 cedar
Cupressocyparis × leylandii Leyland Associated Nox Anderson-3 (syn. Cuprocyparis) cypress Georgetown-1 Greenville-1 Horry-1 Laurens-1 Pickens-1 Richland-2 Spartanburg-1
Juniperus squamata Blue Star, Flaky juniper Associated Gadgil 2005 Edgefield-1 Sargent Fairfield-1 Lexington-1
Thuja occidentalis Emerald Arborvitae Associated Nox Pickens-1 Green
Ericaceae Kalmia latifolia Mountain Associated Hoitink & Aiken-1 laurel Schmitthenner 1974 Oconee-1
Pieris japonica Japanese pieris Associated Dingley & Brien Aiken-1 1969
Pieris sp. Pieris Associated Yesy Richland-1 Rhododendron eriocarpum Pink Dwarf indica Associated Hoitink & Greenville-1 Gumpo azalea Schmitthenner 1974 Richland-1
Rhododendron hybrid Encore Azalea Associated No Charleston-1 Rhododendron hybrid Indica Southern Proven Benson et al. 1982 Colleton-1 indica hybrid azalea Rhododendron hybrid Lord Azalea Associated No Abbeville-1 Roberts
Rhododendron hybrid Pink Ruffle Belgian indica Associated No Greenville-1 hybrid azalea
75 Rhododendron hybrid Sunglow NCSU hybrid Proven Benson et al. 1982 Richland-1 azalea
Rhododendron hybrid Yaku Azalea Associated No Greenville-1 Princess
Rhododendron obtusum Coral Bells, Kurume hybrid Proven Benson et al. 1982 Edgefield-1 Christmas azalea Pickens-1 Cheer, Richland-1 Hershey Red
Rhododendron spp. Azalea Proven Benson et al. 1982 Aiken-1 Anderson-1 Berkeley-1 Charleston-1 Colleton-1 Darlington-1 Georgetown-1 Greenville-3 Lexington-3 Oconee-1 Pickens-1 Richland-4 Spartanburg-1
Rhododendron × satsuki Satsuki Satsuki hybrid Proven Benson et al. 1982 Beaufort-1 azalea Charleston-1
Rhododendron × chinsei Chinsei Chinsei hybrid Associated No Lexington-1 azalea
Rhododendron spp. Rhododendron Associated Yesy Anderson-1 Darlington-1 Greenville-2 Oconee-1 Spartanburg-2
76 Vaccinium spp. Blueberry Associated Caruso and Anderson-1 Ramsdell 1995 Georgetown-1 Lexington-1 Richland-2 Fagaceae Quercus rubra Red oak Associated Moreau & Moreau Spartanburg-1 Quercus virginiana Live oak Associated Alfieri et al. 1994 Richland-1 Ginkgoaceae Ginkgo biloba Ginkgo Associated Jeffers & Jones Oconee-1 2001
Hamamelidaceae Fothergilla sp. Witchalder Associated No Pickens-1
Hydrangeaceae Hydrangea quercifolia Alice Oakleaf Associated Nox Pickens-2 hydrangea
Hypericaceae Hypericum androsaemum Allbury Tutsan Associated Anonymous 1963 Greenville-1z Purple
Iteaceae Itea virginica Little Virginia Associated No Pickens-1 Henry sweetspire
Liliaceae Lilium hybrid Orange Lily Associated Martin & Coffey York-1 Delight 2012
Myricaceae Myrica cerifera Wax myrtle Associated Grand 1985 Aiken-1 Beaufort-2 Georgetown-1 Lexington-1
Oleaceae Osmanthus heterophyllus Veriegatus Variegated Associated No Charleston-1 holly tea olive
Paeoniaceae Paeonia sp. Peony Associated Now Anderson-1 Pinaceae Cedrus deodara Deodar cedar Associated Zentmyer & Anderson-1 Munnecke 1952 Berkeley-1 Spartanburg-1
Picea glauca White spruce Associated Now Greenville-1
77 Pinus strobus White pine Associated Kirby & Grand Greenville-2 1975 Pickens-1
Pittosporaceae Pittosporum tobira Wheeler’s Japanese Associated No Georgetown-1 Dwarf pittosporum
Plantaginaceae Digitalis purpurea Excelsior Common Associated Now Anderson-1 foxglove
Veronica officinalis Minuet Gypsyweed Associated No York-1 Rosaceae Eriobotrya japonica Loquat Associated No Beaufort-1 Photinia sp. Photinia Associated Now Richland-1 Pyrus calleryana Bradford Callery pear Associated Cameron 1962 Chesterfield-1 Clarendon-1 Colleton-1
Rhaphiolepis umbellata Blueberry Indian Associated No Spartanburg-1 muffin hawthorn
Rosa banksiae Lady Banks' Associated No Lexington-1 rose
Rubiaceae Gardenia sp. Gardenia Associated Nox Beaufort-1 Sapindaceae Acer palmatum Bloodgood Japanese maple Associated Cho & Shin 2004 Lexington-1 Acer saccharum Green Sugar maple Associated Now Florence-1 Mountain
Acer sp. Maple Associated Yesy Florence-1 Saxifragaceae Heuchera hybrid Can Can Coral bells Associated Abad et al. 1994 Aiken-1 Schisandraceae Illicium floridanum Star-anise Associated No Oconee-1
Illicium sp. Anise tree Associated No Edgefield-1 Styracaceae Halesia tetraptera Carolina Associated No Charleston-1 (syn. carolina) silverbell
Taxaceae Taxus spp. Yew Associated Jeffers et al. 1950 Nelson, VA-1 Spartanburg-1
78 Theaceae Camellia japonica Japanese Associated Zentmyer & Greenville-3 camellia Munnecke 1952 Oconee-1
Camellia spp. Camellia Associated Yesy Calhoun-1 Greenville-2
Cleyera japonica Sakaki Associated No Pickens-1 Cleyera sp. Cleyera Associated No Georgetown-1 Ternstroemia gymnanthera Japanese Associated No Georgetown-1 ternstroemia
Vitaceae Vitis sp. French Associated Anonymous 1963 Greenville-1 American grape Totals: 31 46 56 named 67 associated hosts SC-27 16 unnamed 5 proven hosts VA-2 72 in all 33 new hosts GA-1 s Diseased plant samples were submitted to the Clemson University Plant Problem Clinic for diagnosis. P. cinnamomi was isolated directly from plant roots and stems t Host plants from which isolates were recovered; names of plants are as complete as records permit. u Based on the literature, the plant has or has not been reported previously as a host of P. cinnamomi: Plant species proven to be hosts have had Koch’s postulates conducted; plant species associated with the pathogen have not had Koch’s postulates conducted. If the host-pathogen relationship has been reported previously, the appropriate citation is listed. v 139 plant samples came from South Carolina, two plant samples came from Virginia, and one plant sample came from Georgia. w This host-pathogen association was mentioned in an unpublished online plant disease index for South Carolina. x This host-pathogen association was mentioned in an unpublished online plant disease index for North Carolina. y The species of this host plant was not reported, but other species in this genus have been reported to be either associated or proven hosts. z Isolate 99-1940 is P. cinnamomi var. parvispora
79 Table 2.2. Phenotypic characters for 142 isolates of Phytophthora cinnamomi used in this study.
w Isolate Colony Mycelium Sporangiophore Sporangia per Mating t u v x y No. diameter (mm) growth habit Simple Branched plug (no.) type 95-2292 67.8 Aerial x x 8.8 A2 95-2321 64.7 Aerial x x 5.6 A2 96-0182 66.6 Aerial x x 0.4 A1 96-0646 73.9 Aerial 0.0 A2
96-1108 74.3 Aerial x x 4.2 A2 96-1310 65.9 Aerial 0.0 A2
96-1391 46.9 Aerial x x 7.8 A2 96-2105 72.7 Aerial x x 1.2 A2 96-2193 71.6 Aerial x x 6.2 A2 96-2254 74.9 Aerial 0.0 A2
96-2325 68.0 Aerial x x 12.8 A2 97-0003 67.5 Aerial x x 3.6 A2 97-0193 76.3 Aerial x x 7.6 A2 97-1101 68.4 Aerial x x 10.4 A2 97-1103 69.9 Aerial x x 0.6 A2 97-2058 74.7 Aerial x x 4.0 A2 97-2332 53.5 Aerial x x 5.6 A2 97-2581 75.7 Aerial x x 4.8 A2 97-2764 36.7 Aerial x 2.0 A2 97-2822 50.2 Aerial x 0.4 A2 97-2838 50.3 Aerial x x 3.2 A2 97-2940 72.0 Aerial x x 1.0 A2 97-3051 72.5 Aerial x x 10.4 A2 97-3099 73.3 Aerial x x 2.2 A2 97-3132 71.2 Aerial x x 3.2 A2 97-3189 62.0 Aerial x x 2.2 A2 97-3193 66.3 Aerial x x 0.4 A2 97-3315 42.8 Aerial x x 6.6 A2 97-3334 54.9 Appressed x x 8.4 A2 97-3339 70.9 Aerial x x 7.2 A2 98-0289 62.9 Aerial x x 29.0 A2 98-1720 75.7 Aerial x x 23.4 A2 98-1820 62.8 Aerial x x 17.2 A2 98-1911 61.0 Aerial x x 4.0 A2 98-2300 62.5 Aerial x x 1.4 A2 98-2800 77.0 Aerial x x 16.2 A2 99-0066 56.4 Aerial x x 12.6 A2 99-1940z 70.4 Aerial x x >100 A1 99-2163 73.6 Aerial x x 0.4 A2 99-2212 56.8 Aerial x x 5.0 A2 99-2222 70.8 Aerial x x 1.4 A2 99-2395 66.2 Aerial x x 2.2 A2 99-2589 59.1 Aerial x x 22.6 A1 99-2746 72.5 Aerial x x 1.0 A2 00-0057 65.1 Aerial x x 0.6 A2 00-1182 73.3 Aerial x x 10.6 A2
80 00-1387 76.3 Aerial x x 6.8 A2 00-1422 71.3 Aerial x x 0.6 A2 00-1652 70.6 Aerial x x 4.2 A2 00-1834 63.2 Aerial 0.0 A2
00-1842 72.3 Aerial x x 2.6 A2 00-2043 66.2 Aerial x x 3.4 A2 00-2409 73.7 Aerial x x 6.4 A2 00-2590 72.1 Aerial x x 1.6 A2 00-2640 52.2 Aerial x x 10.2 A2 00-2860 68.6 Appressed x x 0.8 A2 00-2908 58.8 Aerial x x 3.0 A2 01-0032 64.0 Aerial x x 26.8 A2 01-0086 57.4 Aerial x x 13.8 A2 01-0136 52.5 Appressed x x 3.0 A2 01-0150 39.4 Appressed x x 6.6 A2 01-0416 47.3 Appressed x 0.6 A2 01-0887 68.4 Aerial x x 4.8 A2 01-0926 42.1 Appressed x x 9.0 A2 01-1191 48.7 Aerial 0.0 A2
01-2448 50.3 Aerial x 7.8 A2 01-2487 60.3 Aerial x 5.4 A2 02-0403 66.5 Aerial x x 12.4 A2 02-0651 65.1 Aerial x x 13.2 A2 02-0912 47.3 Appressed x 1.8 A2 02-0976 58.4 Aerial x x 11.4 A2 02-1047 20.0 Dwarf x x >100 A1 02-1054 43.9 Appressed x x 8.2 A2 02-1205 63.6 Aerial x x 6.8 A1 02-1208 50.2 Aerial 0.0 A2
02-1251 56.2 Aerial x x 1.0 A2 02-1456 66.2 Aerial x x 10.2 A2 03-0005 74.3 Aerial x x 30.0 A2 03-0156 55.1 Aerial x 0.8 A2 03-0747 59.2 Appressed 0.0 A2
03-0750 48.3 Aerial x 5.0 A2 03-0766 71.9 Aerial x x 16.0 A2 03-0778 62.3 Aerial x x 8.0 A2 03-0785 72.3 Aerial x x 11.4 A2 03-0913 73.2 Aerial x 10.8 A2 03-0918 55.7 Aerial x x 5.4 A2 03-1002 30.4 Appressed x x 19.0 A2 04-0023 68.6 Aerial x x 4.2 A2 04-0741 73.1 Aerial x 2.2 A2 04-1138 63.4 Aerial x x 1.6 A2 04-1187 77.3 Aerial x x 14.4 A2 04-1256 55.3 Aerial 0.0 A2
04-1307 75.4 Aerial x x 3.4 A2 04-1327 23.2 Dwarf x x >100 A1 05-0081 71.4 Aerial x x 16.0 A2 05-0089 70.7 Aerial x 0.2 A2 05-0169 70.2 Aerial x x 11.4 A2 05-0334 52.9 Appressed x x 13.6 A2 05-0425 43.3 Appressed x 4.0 A2
81 05-0442 54.9 Aerial x x 33.8 A2 05-0678 72.9 Aerial x x 34.0 A2 05-0798 33.9 Appressed x x 30.8 A2 05-0815 40.7 Aerial x 1.2 A2 05-0903 49.4 Aerial x x 22.0 A2 05-0908 69.3 Aerial 0.0 A2
05-0995 71.9 Aerial x 3.0 A2 05-1023 72.6 Aerial x x 13.4 A2 05-1033 73.0 Aerial x x 26.6 A2 05-1036 68.5 Aerial x x 6.0 A2 05-1090 66.3 Aerial x 0.6 A2 06-0840 60.6 Aerial x x 22.4 A2 06-0986 76.0 Aerial x x 22.6 A2 06-1093 68.9 Aerial x x 24.8 A2 07-0118 58.5 Appressed x x 9.6 A2 07-0292 55.6 Appressed x 4.2 A2 07-0317 53.3 Appressed x x 6.8 A2 07-0522 61.8 Aerial x x 4.4 A1 07-0998 64.2 Aerial x 6.4 A1 07-1027 65.3 Aerial x x 10.0 A2 07-1049 71.9 Aerial x x 33.0 A2 07-1080 76.7 Aerial x x 11.2 A2 07-1161 72.5 Aerial 0.0 A2
08-0199 59.8 Aerial x x 16.0 A2 08-0359 69.0 Aerial x x 5.2 A2 08-0369 67.1 Aerial x x 1.2 A2 08-0378 76.6 Aerial x x 0.4 A2 08-0514 72.4 Aerial x x 32.4 A2 08-1300 46.9 Aerial x x 9.0 A1 08-1313 76.7 Aerial x x 4.8 A2 09-1322 53.2 Aerial x x 0.4 A1 09-1330 50.0 Aerial x x 1.4 A1 09-1354 67.5 Aerial x x 4.2 A2 09-1428 70.6 Aerial x 5.2 A2 09-1536 73.8 Aerial x x 0.4 A2 09-1668 73.0 Aerial x 4.4 A2 09-1677 59.2 Aerial x x 4.4 A1 10-0037 69.4 Aerial x x 6.0 A1 10-0053 72.9 Aerial x x 3.0 A2 10-0911 67.2 Aerial x x 9.8 A2 10-1041C 42.0 Appressed x x 9.8 A2 11-0092 65.1 Aerial x x 1.0 A2 11-0201 57.7 Aerial x x 9.2 A2 t Isolate number is composed of the last two digits of the year in which an isolate was recovered and the Clemson Plant Problem Clinic sample identification number. u Diameter is an average of two perpendicular transects on each of four plates of PARPH-V8 medium; isolates were grown for 3 days at 25°C in the dark. v Mycelium growth habit for each isolate was assessed on four plates of PARPH-V8 medium after 3 days at 25°C in the dark. w Most sporangiophores for an isolate were either simple and unbranched or branched; many isolates produced both simple and branched sporangiophores.
82 x Mean number of sporangia produced on five 5-mm diameter disks of clarified V8 agar in 1.5% non- sterile soil extract solution after 24-48 h under continuous fluorescent light at 22-27°C. y Isolates that produced oospores when crossed with a standard A1 isolate were labeled A2 and those that produced oospores when crossed with a standard A2 isolate were labeled A1; isolates were grown on super clarified V8 agar at 25°C in the dark for 2-6 weeks. Results are from four crosses in two trials. z Isolate 99-1940 is P. cinnamomi var. parvispora.
83
Table 2.3. Summary and analyses of morphological characters for 141 isolates of Phytophthora cinnamomi and one isolate of P. cinnamomi var. parvispora recovered from ornamental plants between 1995 and 2011 grouped by mycelium growth habit on PARPH-V8 selective mediumy
Colony Sporangia Mating typez Mycelium Isolates diameter per plug A1 A2 Species growth habity No. % (mm)y (no.)y No. % No. % P. cinnamomi Aerial 122 86 67.5 a 8.0 a 10 10 112 90 Appressed 17 12 52.3 b 7.2 a 0 0 17 100 Dwarf 2 1 20.9 c >100 b 2 100 0 0 P. cinnamomi Aerial 1 1 70.0 a >100 b 1 100 0 0 var. parvispora
1-way ANOVAz Degrees of freedom 3 3 F value 41.6 119.3 P>F <0.0001 <0.0001 y Characters of individual isolates are listed in Table 2.2, and each character is described in the footnotes of that Table. Values for colony diameter and sporangia per plug are averages for the isolates within each mycelium growth habit category. z Data were analyzed by one-way analysis of variance (ANOVA); means within a column followed by the same letter are not significantly different based on individual pair-wise comparisons with Student’s t test and α = 0.05.
84 Figure 2.1. Relative frequency by county of plant samples in South Carolina from which isolates of Phytophthora cinnamomi were recovered between 1995 and 2011. The number of samples from each county in South Carolina was tabulated and overlaid on a county boundary map. Heat map construction was conducted in Google Fusion Tables (https://www.google.com/fusionTables/).
85 86
Figure 2.2. Three mycelium growth habits of Phytophthora cinnamomi on PARPH-V8 after 72 h in the dark at 25ºC; dotted lines indicates the extent of mycelium growth on the agar: (A) aerial—dense mats of hyphae growing above the agar surface, filling the space between the agar surface and the petri dish lid; (B) appressed—lower density of hyphae in the agar and a marked decrease in the development of aerial mycelium; and (C) dwarf—extremely slow growth of mycelium with dense mats of aerial hyphae around the agar plug.
A B
C
87
Figure 2.3. Sporangia of Phytophthora cinnamomi that were produced from clarified V8A plugs immersed in non-sterile soil extract solution and held under fluorescent light for 24 to 48 h: Typical P. cinnamomi—(A) only a few sporangia produced on each plug and (B) an ovoid, non-papillate sporangium produced on a simple sporangiophore; P. cinnamomi with the dwarf mycelium growth habit—(C) numerous sporangia produced on each plug and (D) an elliptical, non-papillate sporangium perched on simple, slender sporangiophore; and P. cinnamomi var. parvispora—(E) numerous sporangia produced on each plug and (F) an ovoid, non-papillate sporangium produced on a simple sporangiophore.
A A B
C D
88 E F
89 CHAPTER 3
GENETIC DIVERSITY AMONG ISOLATES OF PHYTOPTHORA CINNAMOMI
FROM ORNAMENTAL PLANTS IN SOUTH CAROLINA
Abstract
Phytophthora cinnamomi is a devastating plant pathogen that infects at least 900 host species. The genetic diversity of a population of 142 isolates of P. cinnamomi— including 139 isolates from South Carolina, two isolates from Virginia, and one isolate from Georgia—was measured by sequencing DNA for several loci and building phylogenies based on these data. The ITS region was sequenced for all isolates in the population, but this region showed low diversity; only three genotypes were different from the majority of the population. One genotype was represented by a single isolate of
P. cinnamomi var. parvispora. Another genotype was composed of four morphologically diverse isolates. A single isolate that was mating type A1 and had an aerial mycelium growth habit comprised the other genotype. Consequently, there was a high degree of genetic uniformity in the ITS region for this population. Four other loci—β-tub, cox1, cox2, and rps10—were sequenced for a set of 59 isolates representative of the population.
Two isolates, Pc40 (mating type A2) and Pc138 (mating type A1) from avocado trees in
California, were incorporated into this study group as standards for comparison. Mating types were distinguishable at the β-tub locus, and both mating types and mycelium growth habit types were genetically distinct at the rps10 locus. Cluster analysis of the
90 genotypes at each locus revealed seven distinct groups. Two isolates with a dwarf mycelium growth habit were genetically and morphologically distinct from all other isolates. The isolate of P. cinnamomi var. parvispora also was genetically and morphologically distinct from all other isolates. A cluster was composed of nine isolates with aerial mycelium growth habits that were mating type A1—including Pc138—and another was composed of 16 isolates with an appressed growth habit. Two other groups of isolates—one consisting of two isolates with A1 mating type and characterized by aerial mycelium growth habit, and the other composed of a single A2 mating type isolate with appressed mycelium growth habit—were genetically distinct but did not stand out morphologically based on the characters measured. The largest group consisted of 30 isolates with the A2 mating type that exhibited an aerial mycelium growth habit; this group included isolate Pc40. This is the first study to find significant correlations between genotype and phenotypic characters other than mating type in P. cinnamomi.
Introduction
Genetic information can reveal cryptic groups hidden within what has been considered a single taxon (Oudemans and Coffey 1991, Runge et al. 2011). Several genetic markers and methodologies have been employed in an effort to understand the variability of P. cinnamomi including isozymes, RAPD, AFLP, microsatellites, mitochondrial haplotypes, and direct gene sequencing (Chang et al. 1996, Dobrowolski et al. 2003, Dobrowolski et al. 2006, Duan et al. 2008, Greene et al. 2006, Linde et al.
91 1997, Linde et al. 1999, Martin and Coffey 2012, Martin and Tooley 2003, Mueller and
Wolfenbarger 1999, Old et al. 1984, Old et al. 1988, Williams et al. 1990). These studies consistently have revealed low genetic variability within and among geographically defined populations of P. cinnamomi. In these studies, the A1 and A2 mating types often can be distinguished based on genetic data. Except for the delineation of mating types, isolates of P. cinnamomi appear to be genetically uniform and predominantly mating type
A2 (Zentmyer 1976, Zentmyer and Guillemet 1981).
The genetic markers that have been used to study P. cinnamomi each have advantages and shortcomings. Prior to the advent of modern molecular techniques, isozymes were the most common marker used in populations genetic studies (Yamazaki and Maruyama 1975). They are useful for developing an inexpensive marker system, and are suitable for projects seeking to quickly identify low levels of variation (Man et al.
2007). Today they have been superseded by other molecular tools due to advances in the cost-effectiveness and quick turnaround of DNA and RNA markers (Goodwin 1997).
Random amplification of polymorphic DNA (RAPD) is used to measure genetic variability in a population on the genome level (Williams et el. 1990). This technique is useful for studying groups that have not received a great deal of attention because no prior knowledge about the genome of an organism is necessary. However, RAPD is not very sensitive for diversity in the form of SNPs and small indels, and the results are somewhat variable when reproduced (Blears et al. 1998). If species-specific genetic data are available, more reliable and better targeted techniques may prove to be informative.
92 Amplified fragment length polymorphism (AFLP) analysis is another method that measures variability of a population across the entire genome (Vos et al. 1995). AFLP has been shown to be more reproducible than comparable techniques such as restriction fragment length polymorphism (RFLP) and RAPD (Blears et al. 1998, Jones et al. 1997,
Vaneechoutte 1996). Genotyping using AFLP is a powerful tool that has been applied to a study population of P. cinnamomi. Duan et al. (2008) separated isolates into four major clusters using AFLP. In this study A1 isolates were distinct from A2 isolates. In addition, the two isolates in the A1 cluster had higher diversity than the three clusters of A2 isolates based on Nei’s gene diversity. Recently, Pagliaccia et al. (2013) used AFLP analysis to examine a population of P. cinnamomi from avocado trees in California and some other hosts, and they found three distinct clades—two clades contained only A2 isolates and one clade contained only A1 isolates. This technique is not without shortcomings. AFLP relies on length mutations in amplified fragments and mutations in endonuclease recognition sites. Therefore, most single nucleotide polymorphisms
(SNP’s) would be overlooked (Savelkoul et al. 1999). These small differences could be important for elucidating intraspecific relationships in closely related populations.
Microsatellites, or simple sequence repeats (SSRs), are loci that show a length mutation composed of tandem repeats of a repetitive motif (Jarne and Lagoda 1996).
These markers have been used to identify and track lineages in a number of species of
Phytophthora (Ivors et al. 2006, Lees et al. 2006, Mascheretti et al. 2008). Specific primers are required to amplify polymorphic regions, and species-specific microsatellite markers have been developed for P. cinnamomi (Dobrowolski et al. 2002, Dobrowolski
93 et al. 2003). Unfortunately these loci failed to provide substantive information for the
Australian population in the aforementioned studies and were deemed unsuitable for meaningful population genetic research (Dobrowolski et al. 2006).
Mitochondrial haplotypes recently have been used to analyze a worldwide set of
62 isolates of P. cinnamomi (Martin and Coffey 2012). Several mitochondrial genes were sequenced to determine which were most useful for grouping these isolates. Using this methodology, researchers identified SNPs and length mutations in several inter- and intragenic regions. This study delineated groups for the most part along similar lines as isozyme analysis, with few exceptions. Two loci were needed to differentiate 87% of the haplotypes in this population, and only one additional locus was necessary to differentiate the remaining 13% of the haplotypes. Analyzing mitochondrial haplotypes appears to be a powerful and efficient tool for delineating genotypes; however, it only recently has been developed. The study by Martin and Coffey (2012) was conducted concurrently with the work described in this thesis. There are potential shortcomings with haplotype analysis: using only mitochondrial genes to identify haplotypes is appropriate for species that reproduce clonally, but it has not been shown definitively that P. cinnamomi is strictly a clonal species. Nonetheless, evidence supporting the hypothesis that it is clonal is quickly accumulating, and mitochondrial markers may prove useful in the future.
Direct sequencing of both mitochondrial and nuclear loci can reveal minute differences in intraspecific groups. Unlike AFLP or RAPD, in which the whole genome is screened for polymorphisms, direct sequencing yields high resolution data from a small number of loci. This detailed information is used to elucidate the relationships among
94 closely related taxa or even within a species (Nei 1987). Greene et al. (2006), in a preliminary study, used this technique to measure the intraspecific variability of a population of P. cinnamomi from Fraser fir (Abies fraseri) in North Carolina. Low diversity was observed, but this study only sequenced two genes in 35 isolates from a limited geographic region and from a single host species. Including more isolates from a broader geographic area and more diverse hosts potentially could reveal variation not apparent in a smaller, more limited population. For these reasons the technique of direct sequencing was chosen to study a population of P. cinnamomi from ornamental plants.
Several primers have been developed for species of Phytophthora that amplify both nuclear and mitochondrial genes. One of the most informative loci is the internal transcribed spacer (ITS) region. This locus encodes non-structural RNA that is degraded during ribosome assembly (Ristaino 1998). Consequently there is relatively little evolutionary pressure acting on this locus (Baldwin 1992). Low evolutionary pressure yields higher rates of mutation and more inter- and intraspecific variation, making the ITS region an informative phylogenetic marker (Suh et al. 1993). This locus has been used to construct phylogenetic relationships in the genus Phytophthora and as a diagnostic marker for species identification (Blair et al. 2008, Cooke et al. 2000, Kroon et al. 2004,
Villa et al. 2006). The ITS sequence also can be used to measure intraspecific variability
(Greene et al. 2006, Liu et al. 2011, Maeder et al. 2010, Mir et al. 2010, Pandey and Ali
2012). In the previous chapter, this locus was used as one parameter for verification of species identity by means of RFLP fingerprinting and sequencing. More detailed information can be gleaned by measuring the allelic diversity of this locus and
95 constructing a phylogenetic tree. In addition to the ITS locus, sequences of other nuclear and mitochondrial loci can be useful in phylogenetic analysis of Phytophthora spp.: ITS:
β-tubulin (β-tub), cytochrome oxidase subunits 1 and 2 (cox1, cox2), and the 40S ribosomal protein S10 (rps10).
β-tub is a nuclear gene that codes for a microtubule element (Weerakon et al.
1998). Numerous phylogenetic studies in multiple taxa have employed β-tub as an informative locus (Edlind et al. 1996, Keeling et al. 2000, Leander et al. 2003, Samson et al. 2004). It previously has been used in multi-locus phylogenetic analyses of species of both Pythium and Phytophthora (Kroon et al. 2004, Villa et al. 2006). Studies in several genera of fungi have used it as a marker for measuring intraspecific variation (Geiser et al. 1998, Zhao et al. 2012). In a study by de Lima Favaro et al. (2011) a single species was resolved into two distinct groups by performing a phylogenetic analysis that incorporated β-tub data. This ability to reveal cryptic groups suggests that the β-tub locus could be a useful tool for discovering clades potentially hidden within a species.
The cox1 and cox2 loci code for subunits of cytochrome c oxidase, an essential enzyme in aerobic respiration (Khalimonchuk and Rödel 2005). The cox1 locus has a mutation rate that makes it suitable for population genetic study; it changes fast enough that closely related taxa can be differentiated but mostly is conserved within a species
(Hebert 2003). It has been used in conjunction with the ITS region for the purpose of oomycete DNA barcoding (Robideau et al. 2011). The cox2 locus has been shown to be useful for interspecific delineation, and has also been used to investigate intraspecific variation in fungi, lichenous algae, and oomycetes (Choi et al. 2011, Grünwald et al.
96 2011, Hudspeth et al. 2000, Martin 2000, Sadowska-Deś et al. 2013). Camacho (2009) used the cox2 locus to differentiate species that could not be resolves by ITS sequence alone.
Another mitochondrial gene, rps10, codes for the ribosomal protein S10 in mitochondria. It previously has been used by for identifying mitochondrion haplotypes of
P. cinnamomi (Martin and Coffey 2012) and P. ramorum (Martin 2008). This locus also has been used in comparative genomics of closely related species of Phytophthora
(Avila-Adame et al. 2006, Cardenas et al. 2012, Martin et al. 2007, Martin et al. 2012).
The construction of phylogenetic trees traditionally is used to analyze interspecific variation. Using them as a tool to investigate intraspecific relationships is prone to errors due to recombination within species (Posada and Crandall 2002). In P. cinnamomi, it is suspected that variation arises asexually as opposed to through sexual recombination (Hardham 2005, Martin and Coffey 2012, Weste and Marks 1987). Sexual recombination rarely is detected in the field and, therefore, should not hinder intraspecific phylogenetic analysis of this species (Martin and Coffey 2012, Zentmyer 1980).
Phylogenetic trees also are limited in that they only represent the evolutionary history of a single character, in this case a locus. A phylogenetic analysis that includes multiple loci from both the nucleus and mitochondria is more likely to represent the true evolutionary history of the species.
The objective of this study was to investigate the genetic diversity among 142 isolates of P. cinnamomi recovered from ornamental plants, predominantly from South
Carolina, that were submitted to the Clemson University Plant Problem Clinic, in the 12-
97 year period between 1995 and 2011. In a previous study (Chapter 2), morphological and physiological characters of these isolates were examined. The ITS region was sequenced for all 142 isolates, and then four additional loci were sequenced in a subset of 59 isolates that represented the morphological diversity of the larger population.
Materials and Methods
Isolates. The 142 isolates of P. cinnamomi used in this study were obtained from the permanent collection of Phytophthora spp. maintained by S. N. Jeffers at Clemson
University. These isolates came from diseased ornamental plant samples submitted to the
Clemson University Plant Problem Clinic between 1995 and 2011; 139 samples came from South Carolina, two samples came from Virginia, and one sample came from
Georgia. Identities of these 142 isolates previously were confirmed by analyzing molecular and morphological characters (Chapter 2): 141 isolates were P. cinnamomi var. cinnamomi (here after called P. cinnamomi) and one isolate was P. cinnamomi var. parvispora. A complete list of these isolates and the morphological characters associated with each one were reported previously (Chapter 2). In this study, selected morphological and physiological characters and host associations for these 142 isolates were examined and described. Three mycelium growth habits on PARPH-V8 selective medium were recognized (aerial—123 isolates, appressed—17 isolates, and dwarf—2 isolates), and 139 isolates were mating type A2 and 13 isolates were mating type A1.
Isolates with different mycelium growth habits had significantly different growth rates—
98 based on colony diameters after 3 days at 25°C; isolates with the aerial growth habit had the largest colony diameter and isolates with the dwarf growth habit had the smallest colony diameter. All isolates were sensitive to the fungicide mefenoxam at 100 ppm.
Most isolates produced few sporangia under laboratory conditions, but the isolate of P. cinnamomi var. parvispora and the two isolates with the dwarf mycelium growth habit produced abundant sporangia under these same conditions.
Two standard isolates of P. cinnamomi (isolate Pc40 and Pc138), recovered from avocado trees in Santa Barbara Co., California and obtained by S. N. Jeffers from G. A.
Zentmyer at the University of California, Riverside in 1980 were included for reference.
Isolate Pc40 is mating type A2 and was isolated in 1950, and isolate Pc138 is mating type
A1 and was isolated in 1970. Genetic information from a single isolate of P. sojae
(PD_00124) was obtained from the Phytophthora Database at Pennsylvania State
University (www.phytophthoradb.org) (Park et al. 2008) and used as an outgroup in phylogenetic analyses.
ITS sequencing and phylogenetic analysis. The ITS region of all isolates previously had been amplified and sequenced for species identification (Chapter 2).
Sequences were aligned using ClustalW in MEGA 5.1 (Tamura et al. 2011) under pairwise alignment parameters. Sequences were edited visually to eliminate indels and misaligned residues. A neighbor-joining phylogenetic tree was constructed in MEGA 5.1 using a Kimura 3-parameter model. Bootstrap analysis was performed using 1,000 replicates.
99 Variability of the ITS region. All polymorphisms were labeled with a position relative to the first aligned residue and categorized as transitions, transversions, or heterozygous sites. For each polymorphism, isolates that exhibited the change were tabulated. Variability was measured by counting the number of alleles, the number of residues in which they were different, and their proportional representation in the population.
Selection of a representative subset of isolates for additional sequencing.
DNA from a subset of isolates was selected for additional analysis based on the ITS phylogeny and morphological characters. This subset was representative of the morphological diversity present in the population (Chapter 2) and included all isolates that did not exhibit the standard aerial mycelium growth habit on PARPH-V8 selective medium and all isolates that were mating type A1. All isolates that were genetically distinct from the large clonal clade found in the ITS phylogeny were included as well, for a total of 30 isolates. In addition to these 30 diverse isolates, 29 isolates that exhibited the aerial mycelium growth habit and were mating type A2 were selected at random for inclusion in the subset, which made a total of 59 isolates of P. cinnamomi from ornamental plants in South Carolina. The two standard isolates from avocado, Pc40 and
Pc138, and the genetic data from the isolate of P. sojae also were included in this representative subset. There were a total of 62 DNA samples in the subset selected for additional genetic analyses.
PCR amplification. Genomic DNA for all isolates in the subset was available from previous work. The loci were amplified using genus-specific primers. The primer
100 sequences were as follows: β-tub — BTubF1 (5´‐GCCAAGTTCTGGGAGGTCATC‐3´) and BTubR1 (5´‐ CCTGGTACTGCTGGTACTCAG‐3´) (Villa et al. 2006); cox1 — cox1F (5´-TCCGTAGGTGAACCTGCGG‐3´) and cox1R
(5´‐TCCTCCGCTTATTGATATGC‐3´) (Martin et al. 2007); cox2 — FM35
(5´‐CAGAACCTTGGCAATTAGG‐3´) and FMPHY10-B
(5´‐GCAAAAGCACTAAAAATTAAATATAA‐3´) (Martin and Tooley 2003); rps10 —
RPS10F (5´‐GTTGGTTAGAGTAAAAGACT‐3´) and RPS10R
(5´‐GTATACTCTAACCAACTGAGT‐3´) (Martin et al. 2007). The reaction mixture had a total volume of 25.25 µl: 17.0 µl of distilled water, 2.5 µl of 10× PCR Buffer (-MgCl2)
(Invitrogen, Carlsbad, CA), 2.5 µl of 1 mM dNTP mixture, 1 µl of 50 mM MgCl2, 0.5 µl of 25 µM each primer, 0.25 µl of (1.25 units) Platinum® Taq Polymerase (Invitrogen), and 1 µl of template DNA. The reaction was conducted in a T1 Thermocycler
(Biometra®, Göttingen, Germany): 94°C for 3 min, followed by 35 cycles of annealing for 1 min, 72°C for 1.5 min, and 94°C for 1 min. The final elongation step was carried out at 72°C for 5 min. Samples were cooled immediately to 4°C and moved to storage at
-20°C. The protocol for amplification of all loci was identical, with the exception of the annealing temperature. Annealing temperatures were 60ºC for β-tub, 47°C for cox1 and cox2, and 59ºC for rps10.
Amplification products were purified using ExoSAP-IT (Affymetrix, Santa Clara,
CA); 2 µl (1 unit) of ExoSAP-IT was mixed with 5 µl of amplification product. The mixture was incubated at 37ºC for 15 min and then heated to 80ºC for 15 min to denature the enzyme. The mixtures then were divided into two 3.5-µl aliquots, and 0.5 µl of 2 µM
101 primer was added to each tube. Forward and reverse primers were used to provide complimentary sequencing reactions. All sequencing reactions were conducted at the
Clemson University Genomics Institute (CUGI). Forward and reverse sequences were trimmed to remove primer binding sites and poor quality data and then were aligned using Sequencher 5.0 (Gene Codes Corp., Ann Arbor, MI). Heterozygous sites were labeled with the appropriate IUPAC code.
Phylogenetic tree building. Sequences from each locus were aligned in MEGA
5.1 using ClustalW. The best evolutionary model for phylogenetic analysis was determined using the datum analysis package included with the software. The β-tub, cox2, and rps10 phylogenies were constructed using the Tamura 3-parameter model, and the cox1 phylogeny was constructed using the Jukes-Cantor model (Tamura et al. 2011).
Bootstrap analysis was performed using 1,000 replicates, and trees were edited with the
Interactive Tree of Life online tool (Letunic and Bork 2007). For each locus terminal monophyletic clades were treated as genotypes and assigned a unique numeric label.
Isolate 05-0798 (appressed mycelium growth habit, mating type A2) produced a short β- tub amplicon that hindered phylogenetic analysis. An alternative tree was generated with all sequences trimmed to match the amplicon size from this isolate. The groupings on the new tree were used to infer the genotype of this isolate at the β-tub locus.
Statistical analysis of genetic data. Due to the variable tree topologies produced by information from each locus, a cluster analysis was used to group isolates with similar genotypes across all loci. The Ward method was used to create a scree plot to determine the number of clusters Pearson’s chi-square test was used to determine if the terminal
102 clades at each locus, which had been previously labeled, were correlated with mycelium growth habit, mating type, and sporangium production. This test also was used to find correlations between cluster analysis groups and these morphological characters. A test for independence between cluster analysis group and the host family and order was conducted using a likelihood ratio test. All statistical analyses were conducted using JMP statistical software ver. 10.0.
Results
ITS sequences and phylogenetic analysis. The ITS region of all isolates was amplified and sequenced. Isolate 04-1138 failed to sequence after multiple attempts and was omitted from phylogenetic analysis. Therefore, the final analysis involved 140 isolates of P. cinnamomi, one isolate of P. cinnamomi var. parvispora, the two standard isolates of P. cinnamomi (Pc40 and Pc138), and one isolate of P. sojae, which served as the outgroup. Excluding the outgroup, four clades were present in the phylogenetic tree
(Fig. 3.1): 135 isolates with nearly identical ITS sequences fell into a single clade; four morphologically variable isolates formed another clade (02-1047, 04-1327, 05-0798, and
09-1322); one isolate (08-1300) that had an appressed mycelium growth habit and was mating type A1 formed its own monophyletic terminal clade; and the single isolate of P. cinnamomi var. parvispora (99-1940) formed another separate clade. The four morphologically variable isolates that formed a single clade were isolated in different years and from host plants in different families. Two of these isolates (02-1047 and 04-
103 1327) came from the same nursery, and the other two isolates (05-0798 and 09-1322) came from plant samples that originated in different counties in South Carolina (Chapter
2).
In the entire population of isolates that had been identified as P. cinnamomi using molecular and morphological techniques, there were 26 polymorphic loci (4.1%) and 8 alleles at the ITS locus. There were six positions that were conserved within groups but varied between groups: 228, 232, 243, 267, 601 and 604. Polymorphisms in all groups were mutually exclusive, and variable positions within any single group were conserved in the other two groups.
The clonal clade of 135 isolates exhibited extremely low levels of diversity at the
ITS locus. Only two positions out of 630 were polymorphic (0.3%). Four alleles were present: wild type, an allele with a one transition (G131A), an allele that contained one heterozygous position (G131R), and an allele with one transversion (T469A). At position
131, 8 out of 135 isolates did not have the wild type allele (5.9%). Only one isolate did not have the wild type allele at position 469 (0.7%).
In the group composed of four isolates, each isolate had a unique allele, and 18 positions (3.0%) were polymorphic. However 13 of these positions were heterozygous changes in only one isolate (09-1322). If these positions are omitted, only five polymorphic positions (0.8%) remained. Nonetheless, this small group had much higher diversity than the 135 isolates in the main clade, despite being composed of far fewer isolates. Each of these four isolates had a unique ITS sequence, and, even by conservative
104 estimates, there were at least twice as many polymorphic positions in this group of four isolates than in the large, nearly clonal group of 135 isolates.
Phylogenetic trees for representative isolates. A subset of 59 isolates was selected for further genetic analysis. Standard isolates Pc138 and Pc40 were included in this subset, for a total of 61 isolates. Four loci (β-tub, cox1, cox2, and rps10) were amplified and sequenced for all isolates in this subset. However, four isolates failed to produce an amplicon for at least one locus after several attempts. These isolates were omitted from the phylogenies. Isolate 05-0798 produced a shortened amplicon at the β- tub locus, so an alternative phylogeny was generated using this shortened sequence by trimming all the sequences in the dataset to the same size as the amplicon from isolate
05-0798 and constructing a phylogenetic tree (Appendix D). The genotype of this isolate was inferred from the tree generated using this trimmed dataset. In the phylogenetic trees for all four loci, the isolate of P. sojae, which served as the outgroup, formed a separate and very distinct clade that was distant from all other isolates.
The β-tub locus generated the most data, with 923 positions in the dataset (Fig.
3.2A). Isolates 99-2746, 04-1256, and 05-0798 failed to sequence and were omitted from the phylogeny. There were 11 distinct terminal clades in the phylogenetic tree, and several isolates that were in distinct groups in the ITS phylogeny were distinct in this phylogeny as well. Isolates 08-1300 and 09-1322 formed a clade as did isolates 02-1047 and 04-1327; the two isolates in each of these pairs had the same phenotype, and these phenotypes were different (Fig. 3.2A). As before, the P. cinnamomi var. parvispora isolate (99-1940) formed its own clade. All five of these distinct isolates were mating
105 type A1. In the alternate tree generated by trimming all β-tub data to the same size as the amplicon from isolate 05-0798, isolate 05-0798, which was mating type A2, was grouped with isolates 02-1047 and 04-1327.
There were 624 positions and three clades in the cox1 dataset (Fig. 3.2B). Isolates
01-0926 and 99-2746 failed to sequence after multiple attempts and were omitted from the phylogeny. Once again, the P. cinnamomi var. parvispora isolate (99-1940) formed its own clade. Isolates 08-1300 and 09-1322, which were distinct from the majority of isolates at most loci, were grouped with the large, homogenous cluster of isolates at this locus. Isolates 02-1047, 04-1327, and 05-0798 formed a terminal clade, but all three isolates had different phenotypes (Fig. 3.2B).
The cox2 dataset consisted of 768 positions and four clades, and all isolates were included in the analysis (Fig. 3.2C). Isolate 05-0798 and the P. cinnamomi var. parvispora isolate (99-1940) each were placed into distinct clades. Isolates 02-1047, 04-
1327, 08-1300, and 09-1322 were grouped together in a separate clade, and all four of these isolates were maiting type A1. All the other isolates formed a single, homogeneous clade.
The rps10 dataset included 470 positions and 5 clades (Fig. 3.2D). All isolates were sequenced successfully and, therefore, were included in the analysis. Isolates that had been part of the clonal clade in the other phylogenies were split into two large terminal clades. One clade was composed of isolates that exhibited the aerial mycelium growth habit and that were mating type A2—including standard isolate Pc40; the other clade was composed of isolates that exhibited both the aerial and appressed mycelium
106 growth habits and that were a mixture of both mating types—including standard isolate
Pc138, which was mating type A1. The six isolates that had distinct genotypes in the other phylogenies also were distinct at the rps10 locus. The isolate of P. cinnamomi var. parvispora (99-1940) formed a distinct clade. Isolate 05-0798 (mating type A2, appressed growth habit) was the sole member of a clade that was closely related to a clade consisting the other four isolates—02-1047, 04-1327, 08-1300, 09-1322—that all were mating type A1 (Fig. 3.2D). Two of these isolates exhibited the aerial mycelium growth habit (08-1300, 09-1322) and the other two isolates exhibited the dwarf mycelium growth habit (02-1047, 04-1327).
Genetic groups. Several trends were apparent in every dataset. Most isolates were grouped into a large clade of closely related isolates. The P. cinnamomi var. parvispora isolate (99-1940) was genetically distinct from all other isolates in the study population at every locus. At almost all loci, isolates 08-1300 and 09-1322 (aerial mycelium growth habit, mating type A1) always were grouped together and were distinct from the large cluster that contained the majority of isolates. The only exception was at the cox1 locus, where these two isolates were in the same clade as the majority of other isolates. Isolates 02-1047 and 04-1327 (dwarf mycelium growth habit, mating type A1) and isolate 05-0798 (aerial mycelium growth habit, mating type A2) were separate from the main group at all loci.
A hierarchical cluster analysis was performed using the cubic cluster criterion to group isolates based on similar genotypes across all loci (Fig. 3.3A). The analysis was based on the genotype labels applied to terminal monophyletic clades. Using the Ward
107 statistical method, the number of clusters was set at seven due to the natural break present in the scree plot at that cluster joint (Fig. 3.3B). These breaks suggested cutting points that represented natural clusters of isolates. The seven clusters included the four groups mentioned above); each of these four clusters consisted of one or two isolates and had a separate phenotype. The large nearly clonal clade that was present in all phylogenetic trees from individual loci was separated into three groups—each with a unique phenotype based on mating type and mycelium growth habit: one group consisted of nine isolates that were mating type A1 and exhibited the aerial mycelium growth habit (red clade in
Fig. 3.3), another clade consisted of 30 isolates that were mating type A2 and exhibited the aerial mycelium growth habit (yellow clade in Fig. 3.3), and the third group consisted of 16 isolates that were mating type A2 and exhibited the appressed mycelium growth habit.
Correlation of phenotype and genotype. Contingency analyses were conducted to determine if genotypes correlated with phenotypes. In the β-tub phylogeny (Fig.
3.2A), all A1 isolates were associated with four genotypes (P<0.0001) —i.e., no A1 isolates were present in any other group, and each of these four genotypes was composed entirely of A1 isolates. A second contingency analysis was conducted that incorporated only isolates from the large group of isolates that had homogenous sequences in the ITS phylogenetic tree. A1 isolates were clustered in a single terminal clade in the β-tub tree
(Fig. 3.2A), so this mating type again was correlated (P<0.0001) with genotype.
At the rps10 locus, genotype was correlated with mycelium growth habit
(P<0.0001). The large group of isolates with nearly clonal sequences at all other loci was
108 separated into two genotypes at this locus. One clade had only A2 isolates with the aerial growth habit and the other clade had a mixture of A1 isolates with the aerial growth habit and A2 isolates with the appressed growth habit. The only two isolates in this study with the dwarf mycelium growth habit, 02-1047 and 04-1327, had the same genotype
(P<0.0001), but this genotype was shared with two other isolates (Fig. 3.2D). If the P. cinnamomi var. parvispora isolate were omitted, the genotype for isolates 02-1047 and
04-1327 also was correlated with prolific sporangium production. The genetic and morphological characters of the 02-1047/04-1327 group distinguished it from all other isolates of P. cinnamomi in the study population. It is interesting that these two isolates were recovered from different host plants at the same nursery—one in 2002 and one in
2004 (Chapter 2).
The 08-1300/09-1322 group was not correlated with any of the morphological featuresthat would differentiate it from the large nearly clonal cluster that occurred at most loci. Both isolates had aerial mycelium growth habits, produced few sporangia, and were mating type A1.
Although isolate 05-0798 was closely related to the 02-1047/04-1327 group, it was nonetheless genetically distinct at most loci and in the cluster analysis. However, no unique morphological characters were associated with this isolate. It was characterized by an appressed mycelium growth habit and meager sporangium production. It was the only
A2 isolate with this phenotype that was not included in the large cluster of isolates with the same phenotype in the cluster analysis (green clade, Fig. 3.3).
109 In a previous study, host plant associations for all of the 142 isolates of P. cinnamomi were reported (Chapter 2). There was no correlation between cluster analysis group and host plant family or order (P>0.05). The cluster of isolates that were mating type A1 was correlated with host plants in the genus Camellia, but other isolates in this group came from six other host plant genera.
Discussion
The genetic groups delineated by the cluster analysis are highly correlated to diagnostic morphological features. This is the first study to find such associations in a population of P. cinnamomi. In this study, 142 isolates of P. cinnamomi from ornamental plants, primarily in South Carolina and collected over a 12-year period, were examined for genetic diversity by sequencing DNA at five loci—the ITS 1 and 2 region, β-tub, cox1, cox2, and rps10. Taken together, these five sequences included three mitochondrial and two nuclear loci. All the mitochondrial loci and one of the nuclear loci encoded functional genes and one nuclear locus coded a non-functional RNA domain. The scope of these genes contributed to a meaningful and informative phylogenetic analysis. The isolates used in this study previously were shown to vary in several diagnostic morphological and physiological characters—i.e., mycelium growth rate and habit on selective medium, sporangium production, and mating type—and were recovered from a braod array of host plants in 31 families (Chapter 2). By using the genotype data
110 generated in this study and the phenotype data from the previous study, discrete groups of isolates were identified.
Based on previous studies, P. cinnamomi is known to be a morphologically plastic species—at least to some degree (Eggers et al. 2012, Hüberli et al. 2001, Zentmyer
1980). However, there has been low genetic diversity within and among populations
(Chang et al. 1996, Dobrowolski et al. 2003, Dobrowolski et al. 2006, Duan et al. 2008,
Eggers et al. 2012, Greene et al. 2006, Hüberli et al. 2001, Linde et al. 1997, Linde et al.
1999, Martin and Coffey 2012, Martin and Tooley 2003, Mueller and Wolfenbarger
1999, Old et al. 1984, Old et al. 1988, Pagliaccia et al. 2013, Williams et al. 1990). The same can be said for the population of isolates of P. cinnamomi used in this study— which, for the most part, was very similar genetically. Based on DNA sequences at the
ITS locus, 135 out of 142 isolates were nearly identical, with polymorphisms present at only two positions and in low frequency in the entire population. This large, nearly clonal clade consisted of phenotypically diverse isolates—including 119 isolates with an aerial mycelium growth habit on PARPH-V8 selective medium and 16 isolates with an appressed growth habit. Of the 135 isolates, 126 isolates were mating type A2 and nine were mating type A1. The two A1 isolates with a dwarf mycelium growth habit were in a separate, terminal clade in the ITS phylogeny.
The clade of 135 genetically similar isolates in the ITS phylogeny was separated into two clades that were genetically and phenotypically distinct when the rps10 locus was sequenced. A1 isolates with the aerial mycelium growth habit were more closely related to A2 isolates with a different (i.e., appressed) growth habit than to A2 isolates
111 with the same (i.e., aerial) growth habit. This relationship may indicate that A1 isolates are more closely related to A2 isolates with divergent mycelium morphology than A2 isolates that are more similar in appearance.
The rps10 locus alone was not enough to delineate isolates with the appressed mycelium growth habit. Information from both the β-tub and rps10 loci was necessary to delineate these groups. At the β-tub locus, A2 isolates with aerial mycelium growth were genetically similar to A2 isolates with appressed mycelium growth. Therefore, it was the combination of data from the β-tub and rps10 loci that separated a distinct genetic group of isolates with appressed mycelium growth.
This example illustrates the importance of incorporating multiple loci and cluster analysis into a study such as this. While each locus provided a portion of the phylogenetic relationship in this population of P. cinnamomi, cluster analysis allowed us to visualize a more complete picture of the relationships among the isolates in this population. While the sequences characterized in this study are by no means an exhaustive sampling of the total genetic information available, they did provide a breadth of data that no single locus could have encompassed. The six isolates that consistently were not part of the large clonal clusters in individual phylogenies were separated into four distinct clades in the cluster analysis—two clades were composed of two isolates and two clades were composed of single isolates. These six isolates were related more closely to each other than they were to the other 136 isolates of P. cinnamomi.
No previous studies have found significant associations between morphological features and genetic groups. Eggers et al. (2012) found no relationship between sexual
112 and asexual spore sizes, pathogenicity, and genotype. Another study found that morphological traits varied within clonal lineages of P. cinnamomi (Hüberli et al. 2001), demonstrating that genetically similar isolates can exhibit phenotypic variability. On the contrary, this study found that morphological and physiological traits—including mycelium growth rate and habit and sporangium production—were highly correlated with genotype. These associations were made possible by incorporating data from multiple loci into a cluster analysis to delineate genetic groups. The morphological and physiological characters described previously (Chapter 2) were not indicative of phenotypic plasticity within clonal lineages but rather genetic differences among isolates in this population.
Eggers et al. (2012) found that pathogenicity could not be correlated to genetic markers. The results from this study were similar; there was no correlation among cluster analysis group and the host plant families from which isolates were recovered. However, many of the ornamental plants from which isolates in this study were recovered were classified as associated plants and were not proven host plants (Chapter 2). The broad host range of P. cinnamomi may contribute to the difficulty in correlating genotype and pathogenicity to specific host plants or groups of host plants.
Mating types formed genetically distinct groups. Several other studies have reached the same conclusion. This study adds to the body of evidence suggesting that the two mating types of P. cinnamomi are discrete genetic groups that have minimal interaction through mating and sexual recombination (Chang et al. 1996, Dobrowolski et al. 2003, Dobrowolski et al. 2006, Duan et al. 2008, Eggers et al. 2012, Greene et al.
113 2006, Hüberli et al. 2001, Linde et al. 1997, Linde et al. 1999, Martin and Coffey 2012,
Martin and Tooley 2003, Mueller and Wolfenbarger 1999, Old et al. 1984, Old et al.
1988, Pagliaccia et al. 2013, Williams et al. 1990); therefore, they appear to be segregating over time.
Two genetic groups that emerged from the cluster analysis were not definitively correlated with unique phenotypes based on the selected morphological traits used in this study. The group consisting of isolates 08-1300 and 09-1322 had a phenotype similar to all other A1 isolates with the aerial mycelium growth habit. Likewise, isolate 05-0798 was not phenotypically distinct from other A2 isolates with appressed mycelium growth.
Morphological characters that distinguish these two genetic groups may have been overlooked or not investigated.
A prior study in North Carolina was limited by the fact that all isolates in this population were collected from a restricted geographical area and in a relatively short evolutionary timeframe (Greene et al. 2006). There are indications that the relationships found in the study of this South Carolina isolates extend beyond the population of P. cinnamomi from ornamental plants in the area. The two standard isolates included in this study, Pc40 and Pc138, were isolated from roots of avocado trees in California in 1950 and 1970, respectively. These isolates were grouped by genotype with South Carolina isolates from ornamental plants that shared the same phenotype. Incorporating only two isolates from outside the study population does not confirm that the genetic groups found in this study exist in the global population of P. cinnamomi, but it does suggest that they are not limited to this population either.
114 The question remains: Are the genetically distinct isolates truly members of what currently is defined as the species P. cinnamomi? By correlating phenotypic and genetic data, we come to the conclusion that some of the genetic groups that were discovered in this study warrant special taxonomic consideration. For the purposes of this study, the species P. cinnamomi as it is currently understood is composed of all isolates that have sequence homology of >99% with isolates assessed as P. cinnamomi in the Phytophthora
Database, and exhibited morphological characters that are diagnostic of the species, such as coralloid hyphae and botryose swellings.
The two isolates characterized by the dwarf mycelium growth habit (02-1047 and
04-1327) were genetically and morphologically distinct in the final cluster analysis.
These isolates also were part of a genetically distinct clade at the ITS locus, which is the universally accepted barcoding region in fungi (Schoch et al. 2011); although Oomycetes are not fungi, they are subject to many of the same conventions. While this evidence suggests that these isolates are a distinct taxonomic unit, it is confounded by the fact that isolates 05-0798 and 09-1322 were in the same genetic group at the ITS locus; these isolates were phenotypically distinct from 02-1047 and 04-1327 as well as from each other. Sequences from two additional loci, β-tub and cox2, were needed to separate the two isolates with a dwarf mycelium growth habit from the other two isolates. Therefore, there is genetic diversity among these isolates at some loci, but overall they are genetically similar. Isolates with the dwarf mycelium growth habit were recovered from plant samples that came from the same nursery in South Carolina, so additional isolates from a broader geographic base need to be collected and examined before separating
115 isolates with this phenotype and genotype into a separate taxonomic unit—e.g., variety of
P. cinnamomi or species. Unfortunately only one other isolate with a ITS sequence homology greater than 99% was found in the Phytophthora Database (PD_02179).
The isolates characterized by being mating type A2 and having appressed mycelium growth formed a genetically discrete unit in the cluster analysis with one exception, isolate 05-0798. This isolate, which also was mating type A2 and had appressed mycelium growth, was relegated to a separate clade at all loci. If this group forms a formal taxonomic unit, then characters that differentiate isolate 05-0798 from the other isolates with the same phenotype need to be identified. Therefore, additional studies are needed to see if this isolate is unique based on other phenotype traits. The group of isolates exhibiting appressed mycelium growth most likely is a morphological variant of
P. cinnamomi that is correlated to minute genetic differences. The same can be said of the
A1 mating type isolates. Although they are phenotypically distinct, they are homologous to most A2 isolates at the ITS locus. This study confirms that mating types in P. cinnamomi are discrete genetic units, but it maintains that isolates with different mating types are still components of the species.
The determination of what constitutes a discrete taxonomic unit in the population of isolates currently called P. cinnamomi will be a challenge until more phenotype and genetic data are collected for a more diverse population of isolates. In this study, isolates that were genetically distinct were indistinguishable based on phenotypic characters. The opposite is true as well, as noted by Hüberli et al. (2001); genetically identical isolates exhibited variable phenotypic characters. Nonetheless this study identified meaningful
116 correlations among genotypes and phenotypes that previously were not described. It is one of the first studies to find such associations in P. cinnamomi.
In this study, five loci were sequenced to separate isolates into seven genetic groups using cluster analysis. Using a subset of these loci to get the same resolution would save time and money in future analyses. Martin and Coffey (2012) initially used seven loci to analyze mitochondrial haplotypes. They determined that only three loci were necessary to measure the same level of diversity. The same can be said in this study.
Only the β-tub, cox2, and rps10 loci were needed to generate a cluster analysis with the same results as the one produced using all five loci. The cox2 locus has the added benefit of generating a diagnostic sequence for species identification (Grünwald et al. 2011).
Using only these three markers can expedite determinations of genotypes of P. cinnamomi populations. Research is needed to determine if these markers produce results similar to those identified by Martin and Coffey (2012). Results from that research could make investigations into the diversity of this species more efficient.
Literature Cited
Avila-Adame, C., Gomez-Alpizar, L., Zismann, V., Jones, K. M., Buell, C. R., and Ristaino, J. B. 2006. Mitochondrial genome sequences and molecular evolution of the Irish potato famine pathogen, Phytophthora infestans. Current Genetics 49:39-46.
Baldwin, B. G. 1992. Phylogenetic utility of the internal transcribed spacers of nuclear ribosomal DNA in plants: an example from the Compositae. Molecular Phylogenetics and Evolution 1:3-16.
117 Blair, J. E., Coffey, M. D., Park, S., Geiser, D. M., and Kang, S. 2008. A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genetics and Biology 45:266-277.
Blears, M. J, Grandis, S. A. D., Lee, H., and Trevors, J. T. 1998. Amplified fragment length polymorphism (AFLP): a review of the procedure and its applications. Journal of Independent Microbiology and Biotechnology 21:99-114.
Camacho, E. R. 2009. Diseases of floriculture crops in South Carolina: Evaluation of a pre-plant sanitation treatment and identification of species of Phytophthora. M.S. Thesis, Clemson University, Clemson, SC.
Cardenas, T. M., Danies, G., Tabima, J., Bernal, A., and Restrepo, R. S. 2012. Phytophthora infestans population structure: A worldwide scale. Acta Biológica Colombiana 17:227-240.
Chang, T. T., Yang, W. W., and Wang, W. Y. 1996. Use of random amplified polymorphic DNA markers for the detection of genetic variation in Phytophthora cinnamomi in Taiwan. Botanical Bulletin of Academia Sinica 37:165-171.
Choi, Y. J., Thines, M., Han, J. G., and Shin, H. D. 2011. Mitochondrial phylogeny reveals intraspecific variation in Peronospora effusa, the spinach downy mildew pathogen. The Journal of Microbiology 49:1039-1043.
Cooke, D. E. L., Drenth, A., Duncan, J. M., Wagels, G., and Brasier, C. M. 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genetics and Biology 30:17-32. de Lima Favaro, L. C., de Melo, F. L., Aguilar-Vildoso, C. I., and Araujo, W. L. 2011. Polyphasic analysis of intraspecific diversity in Epicoccum nigrum warrants reclassification into separate species. PLoS One 6:p14828.
Dobrowolski, M. P., Tommerup, I. C., Blakeman, H. D., and O'Brien, P. A. 2002. Non- Mendelian inheritance revealed in a genetic analysis of sexual progeny of Phytophthora cinnamomi with microsatellite markers. Fungal Genetics and Biology 35:197-212.
Dobrowolski, M. P., Tommerup, I. C., and O'Brien, P. A. 2006. Microsatellites in the mitochondrial genome of Phytophthora cinnamomi failed to provide highly polymorphic markers for population genetics. FEMS Microbiology Letters 163:243-248.
118 Dobrowolski, M. P., Tommerup, I. C., Shearer, B. L., and O'Brien, P. A. 2003. Three clonal lineages of Phytophthora cinnamomi in Australia revealed by microsatellites. Phytopathology 93:695-704.
Duan, C. H., Riley, M. B., and Jeffers, S. N. 2008. Characterization of Phytophthora cinnamomi populations from ornamental plants in South Carolina, USA. Archives of Phytopathology and Plant Protection 41:14-30.
Edlind, T. D., Li, J., Visvesvara, G. S., Vodkin, M. H., McLaughlin, G. L., and Katiyar, S. K. 1996. Phylogenetic analysis of β-tubulin sequences from amitochondrial protozoa. Molecular Phylogenetics and Evolution 5:359-367.
Eggers, J. E., Balci, Y., and MacDonald, W. L. 2012. Variation among Phytophthora cinnamomi isolates from oak forest soils in the eastern United States. Plant Disease 96:1608-1614.
Geiser, D. M., Frisvad, J. C., and Taylor, J. W. 1998. Evolutionary relationships in Aspergillus section Fumigati inferred from partial β-tubulin and hydrophobin DNA sequences. Mycologia 90:831-845.
Goodwin, S. B. 1997. The population genetics of Phytophthora. Phytopathology 87:462- 473.
Greene, M. D., Benson, M., and Ivors, K. L. 2006. Multilocus sequence analysis of Phytophthora cinnamomi from Fraser fir in North Carolina. Phytopathology 96:S42.
Grünwald, N. J., Martin, F. N., Larsen, M. M., Sullivan, C. M., Press, C. M., Coffey, M. D., Hansen, E. M., and Parke, J. L. 2011. Phytophthora-ID. org: a sequence-based Phytophthora identification tool. Plant Disease 95:337-342.
Hardham, A. R. 2005. Phytophthora cinnamomi. Molecular Plant Pathology 6:589-604.
Hebert, P. D., Ratnasingham, S., and de Waard, J. R. 2003. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London 1:S96-S99.
Hüberli, D., Tommerup, I. C., Dobrowolski, M. P., Calver, M. C., and Hardy, G. E. 2001. Phenotypic variation in a clonal lineage of two Phytophthora cinnamomi populations from Western Australia. Mycology Research 105:1053-1064.
119 Hudspeth, D. S., Nadler, S. A., and Hudspeth, M. E. 2000. A cox2 molecular phylogeny of the Peronosporomycetes. Mycologia 92:674-684.
Ivors, K., Garbelotto, M., Vries, I. D. E., Ruyter‐Spira, C., Hekkert, B. T., Rosenzweig, N., and Bonants, P. 2006. Microsatellite markers identify three lineages of Phytophthora ramorum in US nurseries, yet single lineages in US forest and European nursery populations. Molecular Ecology 15:1493-1505.
Jarne, P., and Lagoda, P. J. 1996. Microsatellites, from molecules to populations and back. Trends in Ecology and Evolution 11:424-429.
Jones, C. J., Edwards, K. J., Castaglione, S., Winfield, M. O., Sala, F., Van de Wiel, C., Bredemeijer, G., Vosman, B., Matthes, M., Daly, A., Brettschneider, R., Bettini, P., Buiatti, M., Maestri, E., Malcevschi, A., Marmiroli, N., Aert, R., Volckaert, G., Rueda, J., Linacero, R., Vazquez, A., and Karp, A. 1997. Reproducibility testing of RAPD, AFLP and SSR markers in plants by a network of European laboratories. Molecular Breeding 3:381-390.
Keeling, P. J., Luker, M. A., and Palmer, J. D. 2000. Evidence from β-tubulin phylogeny that microsporidia evolved from within the fungi. Molecular Biology and Evolution 17:23-31.
Khalimonchuk, O., and Rödel, G. 2005. Biogenesis of cytochrome c oxidase. Mitochondrion 5:363-388.
Kroeber, H., and Marwitz, R. 1993. Phytophthora tentaculata sp. nov. and Phytophthora cinnamomi var. parvispora var. nov., two new fungi from ornamental plants in Germany. Zeitschrift fuer Pflanzenkrankheiten und Pflanzenschutz 100:250-258.
Kroon, L., Bakker, F. T., Van Den Bosch, G. B. M., Bonants, P. J., and Flier, W. G. 2004. Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genetics and Biology 41:766-782.
Leander, B. S., Clopton, R. E., and Keeling, P. J. 2003. Phylogeny of gregarines (Apicomplexa) as inferred from small-subunit rDNA and β-tubulin. International Journal of Systematic and Evolutionary Biology 53:345-354.
Lees, A. K., Wattier, R., Shaw, D. S., Sullivan, L., Williams, N. A., and Cooke, D. E. L. 2006. Novel microsatellite markers for the analysis of Phytophthora infestans populations. Plant Pathology 55:311-319.
120 Letunic, I. and Bork, P. 2007. Interactive Tree Of Life (iTOL): an online tool for phylogenetic tree display and annotation. Bioinformatics 23:127-128.
Linde, C., Drenth, A., Kemp, G. H. J., Wingfield, M. J., and von Broembsen, S. L. 1997. Population structure of Phytophthora cinnamomi in South Africa. Phytopathology 87:822-827.
Linde, C., Drenth, A., and Wingfield, M. J. 1999. Gene and genotypic diversity of Phytophthora cinnamomi in South Africa and Australia revealed by DNA polymorphisms. European Journal of Plant Pathology 105:667-680.
Liu, F., Lin, Y. R., Wang, S. J., Gao, X. M., Chen, L., and Jia, G. 2011. ITS sequence analysis of intraspecific genetic diversity of Hypoderma rubi. Journal of Fujian Agriculture and Forestry University 1:10.
Maeder, G., Zamberlan, P. M., Fagundes, N. J. R., Magnus, T., Salzano, F. M., Bonatto, S. L., and Freitas, L. B. 2010. The use and limits of ITS data in the analysis of intraspecific variation in Passiflora L. (Passifloraceae). Genetics and Molecular Biology 33:99-108.
Man in't Veld, W. A., Govers, F., and Meijer, H. J. G. 2007. Correlation of isozyme profiles with genomic sequences of Phytophthora ramorum and its P. sojae orthologues. Current Genetics 52:247-257.
Martin, F. N. 2000. Phylogenetic relationships among some Pythium species inferred from sequence analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia 92:711-727.
Martin, F. N. 2008. Mitochondrial haplotype determination in the oomycete plant pathogen Phytophthora ramorum. Current Genetics 54:23-34.
Martin, F. N., Bensasson, D., Tyler, B. M., and Boore, J. L. 2007. Mitochondrial genome sequences and comparative genomics of Phytophthora ramorum and P. sojae. Current Genetics 51:285-296.
Martin, F. N., and Coffey, M. D. 2012. Mitochondrial haplotype analysis for differentiation of isolates of Phytophthora cinnamomi. Phytopathology 102:229-239.
Martin, F. N., and Tooley, P. W. 2003. Phylogenetic relationships of Phytophthora ramorum, P. nemorosa, and P. pseudosyringae, three species recovered from areas in California with sudden oak death. Mycological Research 107:1379-1391.
121 Mascheretti, S., Croucher, P. J. P., Vettraino, A., Prospero, S., and Garbelotto, M. 2008. Reconstruction of the sudden oak death epidemic in California through microsatellite analysis of the pathogen Phytophthora ramorum. Molecular Ecology 17:2755-2768.
Mir, B. A., Koul, S., Kumar, A., Kaul, M. K., Soodan, A. S., and Raina, S. N. 2010. Intraspecific variation in the internal transcribed spacer (ITS) regions of rDNA in Withania somnifera (Linn.) Dunal. Indian Journal of Biotechnology 9:325-328.
Mueller, U. G., and Wolfenbarger, L. L. 1999. AFLP genotyping and fingerprinting. Trends in Ecology and Evolution 14:389-394.
Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press: New York, NY.
Old, K. M., Dudzinski, M. J., and Bell, J. C. 1988. Isozyme variability in field populations of Phytophthora cinnamomi in Australia. Australian Journal of Botany 36:355-360.
Old, K. M., Moran, G. F., and Bell, J. C. 1984. Isozyme variability among isolates of Phytophthora cinnamomi from Australia and Papua New Guinea. Canadian Journal of Botany 62:2016-2022.
Oudemans, P., and Coffey, M. D. 1991. A revised systematics of twelve papillate Phytophthora species based on isozyme analysis. Mycological Research 95:1025-1046.
Pagliaccia, D., Pond, E., McKee, B., and Douhan, G. W. 2013. Population genetic structure of Phytophthora cinnamomi associated with avocado in California and the discovery of a potentially recent introduction of a new clonal lineage. Phytopathology 103:91-97.
Pandey, A. K., and Ali, M. A. 2012. Intraspecific variation in Panax assamicus Ban. populations based on internal transcribed spacer (ITS) sequences of nrDNA. Indian Journal of Biotechnology 11:30-38.
Park, J., Park, B., Veeraraghavan, N., Jung, K., Lee, Y. H., Blair, J. E., Geiser, D. M., and Kang, S. 2008. Phytophthora Database: A forensic database supporting the identification and monitoring of Phytophthora. Plant Disease 92:966-972.
Posada, D., and Crandall, K. A. 2002. The effect of recombination on the accuracy of phylogeny estimation. Journal of Molecular Evolution. 54:396-402.
122 Ristaino, J. B., Madritch, M., Trout, C. L., and Parra, G. 1998. PCR amplification of ribosomal DNA for species identification in the plant pathogen genus Phytophthora. Applied Environmental Microbiology 64:948-954.
Robideau, G. P., De, C., Wam, A., Coffey, M. D., Voglmayr, H., Brouwer, H., Bala, K., Chitty, D. W., Desaulniers, N., and Eggerston, Q. A. 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular Ecology Resources 11:1002-1011.
Runge, F., Choi, Y. J., and Thines, M. 2011. Phylogenetic investigations in the genus Pseudoperonospora reveal overlooked species and cryptic diversity in the P. cubensis species cluster. European Journal of Plant Pathology 129:135-146.
Sadowska-Deś, A. D., Bálint, M., Otte, J., and Schmitt, I. 2013. Assessing intraspecific diversity in a lichen-forming fungus and its green algal symbiont: Evaluation of eight molecular markers. Fungal Ecology 6:141-151.
Samson, R. A., Seifert, K. A., Kuijpers, A. F., Houbraken, J., and Frisvad, J. C. 2004. Phylogenetic analysis of Penicillium subgenus Penicillium using partial β-tubulin sequences. Studies in Mycology 49:175-200.
Savelkoul, P. H. M., Aarts, H. J. M., De Haas, J., Dijkshoorn, L., Duim, B., Otsen, M., Rademaker, J. L. W., Schouls, L., and Lenstra, J. A. 1999. Amplified-fragment length polymorphism analysis: the state of an art. Journal of Clinical Microbiology 37:3083- 3091.
Schoch, C. L., Seifert, K. A., Huhndorf, S., Robert, V., Spouge, J. L., Levesque, C. A., Chen, W., and Fungal Barcoding Consortium. 2011. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences 109:6241-6246.
Schreier, S. G. I., and Jeffers, S.N. 2013. Characterization of Phytophthora cinnamomi from ornamental crops in South Carolina. Phytopathology 103:S128-S129.
Suh, Y., Thien, L. B., Reeve, H. E., and Zimmer, E. A. 1993. Molecular evolution and phylogenetic implications of internal transcribed spacer sequences of ribosomal DNA in Winteraceae. American Journal of Botany 80:1042-1055.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood,
123 evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:2731-2739.
Vaneechoutte, M. 1996. DNA fingerprinting techniques for microorganisms. Molecular Biotechnology 6:115-142.
Villa, N. O., Kageyama, K., Asano, T., and Suga, H. 2006. Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β- tubulin gene sequences. Mycologia 98:410-422.
Vos, P., Hogers, R., Bleeker, M., Reijans, M., Lee, T. v. d., Hornes, M., Friters, A., Pot, J., Paleman, J., and Kuiper, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucleic Acids Research 23:4407-4414.
Weerakoon, N. D., Roberts, J. K., Lehnen Jr., L. P., Wilkinson, J. M., and Marshall, J. S. 1998. Isolation and characterization of the single β-tubulin gene in Phytophthora cinnamomi. Mycologia 90:85-95.
Weste, G., and Marks, G. C. 1987. The biology of Phytophthora cinnamomi in Australasian forests. Annual Review of Phytopathology 25:207-229.
Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., and Tingey, S. V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18:6531-6535.
Yamazaki, T., and Maruyama, T. 1975. Isozyme polymorphism maintenance mechanisms viewed from the standpoint of population genetics. Genetics and Evolution 4:103-114.
Zentmyer, G. A. 1976. Distribution of the A1 mating type of Phytophthora cinnamomi. Phytopathology 66:701-703.
Zentmyer, G. A. 1980. Phytophthora cinnamomi and the diseases it causes. Monograph No. 10. The American Phytopathological Society, St. Paul, MN.
Zentmyer, G. A. and Guillemet, F. B. 1981. Evidence for strains of Phytophthora cinnamomi. Plant Disease 65:475-477.
Zhao, P., Kakishima, M., Uzuhashi, S., and Ishii, H. 2012. Multigene phylogenetic analysis of inter- and intraspecific relationships in Venturia nashicola and V. pirina. European Journal of Plant Pathology 132:245-258.
124 Figure 3.1. ITS phylogeny for 141 isolates of Phytophthora cinnamomi recovered from ornamental plants in South Carolina between 1995 and 2011. Isolate 04-1138 was omitted from analysis. The evolutionary history was inferred using the Neighbor-Joining method, and bootstrap values are shown on the branches. The Tamura 3-parameter evolutionary model was used. Two standard isolates of P. cinnamomi, Pc40 and Pc138, were included in the analysis as well as an isolate of P. sojae to serve as an out-group. Therefore, the analysis involved 144 nucleotide sequences, and bootstrap values were determined using 1,000 replicates. All positions containing gaps and missing data were eliminated, so there was a total of 630 positions in the dataset. A large clonal cluster consisting of 135 isolates was condensed. Evolutionary analyses were conducted in MEGA5. Circles indicate mating type: black = A1; open = A2. Boxes indicate mycelium growth habit: black = aerial, hatched = appressed, open = dwarf.
125
09-1322
05-0798
04-1327
02-1047
08-1300
99-1940
Clonal cluster (135 isolates)
P. sojae
126 Figure 3.2. Phylogenetic trees using four different loci for a representative subset of 59 isolates of Phytophthora cinnamomi. The evolutionary history was inferred using the Neighbor-Joining method, and bootstrap values are shown on the branches. The Tamura 3-parameter evolutionary model was used for β-tubulin, cox2, and rps10, and the Jukes- Cantor evolutionary model was used for cox1. Two standard isolates of P. cinnamomi, Pc40 and Pc138, were included in the analysis as well as an isolate of P. sojae to serve as an out-group. Evolutionary analyses were conducted in MEGA5, and bootstrap values were determined using 1,000 replicates. All positions containing gaps and missing data were eliminated. Circles indicate mating type: black = A1; open = A2; none: homothallic. Boxes indicate mycelium growth habit: black = aerial, hatched = appressed, open = dwarf.
A, β-tubulin: 56 isolates were included and three isolates (99-2746, 04-1256, and 05- 0798) were omitted from the analysis; therefore, the analysis involved 59 nucleotide sequences, so there were 923 positions in the dataset.
B, cox1: 57 isolates were included and two isolates (01-0926 and 99-2746) were omitted from the analysis; therefore, the analysis involved 60 nucleotide sequences. There were 624 positions in the dataset.
C, cox2: all 59 isolates were included, so the analysis involved 62 nucleotide sequences. There were 768 positions in the dataset.
D, rps10: all 59 isolates were included, so the analysis involved 62 nucleotide sequences. There were 470 positions in the dataset.
127 01-1191 Fig. 3.2A PC40 11-0201 08-0378 05-0908 03-0918 02-0403 00-1842 98-2300 97-2746 96-2105 96-1391 97-0193 98-0289 64 00-0057 01-2487 03-0766 04-1187 07-1080 02-1208 11-0092
64 96-2193 97-3132 99-2222 01-0086 02-0912 04-1138 07-0118 09-1428 01-0416 97-3334 00-2860 01-0136 01-0150 01-0926 01-2448 4 02-1054 03-1002 96-0182 99-2589 02-1205 07-0522 07-0998 61 09-1330 100 09-1677 10-0037 PC138 03-0747
51 05-0334 05-0425 07-0292 07-0317 10-1041c 99-1940
86 02-1047 04-1327 100 08-1300 98 09-1322 P. sojae
0.005
128 05-0798 96 Fig. 3.2B 02-1047 79 04-1327 99-1940 98-2300 97-3334 97-2764 96-2193 96-1391 96-0182 96-2105 97-0193 97-3132 98-0289 99-2222 99-2589 00-0057 00-1842 00-2860 01-0086 01-0136 01-0150 01-0416 01-1191 01-2448 01-2487 02-0403 02-0912 11-0201 02-1054 02-1205 02-1208 03-0747 03-0766 03-0918 03-1002 04-1138 04-1187 04-1256 05-0334 05-0425 05-0908 07-0118 07-0292 07-0317 07-0522 07-0998 07-1080 08-0378 08-1300 09-1322 09-1330 09-1428 09-1677 10-0037 10-1041c 11-0092 PC138 PC40
P. sojae
129 11-0201 Fig. 3.2C PC138 11-0092 10-1041c 10-0037 09-1677 09-1428 09-1330 08-0378 07-1080 07-0998 07-0522 07-0317 07-0292 07-0118 05-0908 05-0425 05-0334 04-1256 04-1187 04-1138 03-1002 03-0918 03-0766 03-0747 02-1208 02-1205 100 02-1054 02-0912 02-0403 01-2487 01-2448 01-1191 01-0926 01-0416 01-0150 01-0136 01-0086 00-2860 00-1842 00-0057 66 99-2746 99-2589 99-2222 98-2300 98-0289 97-3334 97-3132 97-2764 97-0193 96-2193 96-2105 96-0182 96-1391 PC40 99-1940 05-0798 02-1047 100 04-1327 95 08-1300 09-1322 P. sojae
0.005
130 P. sojae Fig. 3.2D 09-1428 11-0092 08-0378 07-1080 05-0908 04-1256 04-1187 04-1138 03-0918 03-0766 02-1208 02-0403 01-2487 01-2448
65 01-1191 01-0086 00-1842 00-0057 99-2746 99-2222 98-2300 98-0289 97-3132 97-2764 97-0193 96-2193 96-2105 96-1391 97 11-0201 PC40 96-0182 97-3334 99-2489 00-2860 01-0136 01-0150 01-0416 01-0926 02-0912 02-1054 02-1205 03-0747 83 03-1002 63 05-0334 05-0425 07-0118 07-0292 07-0317 07-0522 07-0998 09-1330 09-1677 10-0037 10-1041c PC138 99-1940 05-0798 02-1047 100 04-1327 65 08-1300 09-1322
0.005
131 Figure 3.3. Cluster analysis of all genotypes for five loci from 59 isolates of Phytophthora cinnamomi recovered from ornamental plants in South Carolina between 1995 and 2011.
A, Isolates were grouped based on similarities of genotypes across all loci. Analysis was performed in JMP 10.0. Circles indicate mating type: black = A1; open = A2; none: homothallic. Boxes indicate mycelium growth habit: black = aerial, hatched = appressed, open = dwarf.
B, Scree plot: The number of groups was set at seven due to the elbow break in the plot at this point. This break indicates that setting the number of clusters to seven is most likely indicative of natural groupings.
132 Fig. 3.3A
Fig. 3.3B
CHAPTER 4
SUMMARY OF FINDINGS AND FUTURE RESEARCH
This is the first study to find meaningful correlations between genotype and phenotypic characters other than mating type among isolates of Phytophthora cinnamomi. The isolates characterized by the dwarf mycelium growth habit appear to be a distinct taxonomic unit. The isolates that exhibited the appressed mycelium growth habit were genetically distinguishable. Mating type A1 and A2 isolates with aerial growth habit were differentiated using molecular data as well. The population of P. cinnamomi from ornamental crops in South Carolina has a minimal level of genetic variability, which is nonetheless correlated to distinct phenotypic characters.
There are several potential next steps in this research. More morphological characters should be measured, and these data could be used to determine if unique genotypes that were not morphologically distinct by the measures used in this study are divergent in other characters. Isolates that share homologous sequences with the distinct genetic groups found in this study should be garnered from collections around the world, and their genotypes and phenotypes examined. This information would reveal whether the diversity found in this population is indicative of regional variation within the species or diversity in the global population. Ultimately the goal is to determine whether these distinct groups are inherent in the diversity of P. cinnamomi or sufficiently divergent to qualify as new varieties or species.
134 Over the years, many genetic markers and tools have been used to measure diversity in P. cinnamomi (e.g., isozymes, RFLP, RAPD, AFLP, SSRs, mitochondrial haplotypes, and direct sequencing) and this myriad of methodologies may be a hindrance to an informative understanding of diversity in P. cinnamomi. With the exception of a recent paper (Martin, F. N., and Coffey, M. D. 2012. Mitochondrial haplotype analysis for differentiation of isolates of Phytophthora cinnamomi. Phytopathology 102:229-239), very few studies have examined similarities among the genetic groups identified using these different marker systems. This problem is exacerbated by the fact that most studies were focused on populations limited by geography, host range, and time. Further research should focus on a global set of isolates, like those used by Martin and Coffey, and should include both genotypic and phenotypic characters. Although the logistical difficulties of maintaining a set of plant pathogenic isolates of P. cinnamomi in one or more laboratories around the world would be a challenge, it is a necessity if the study of P. cinnamomi populations is to transition from being regionally focused to a more global perspective.
135
APPENDICES
136 APPENDIX A
List of all isolates used in this study: Geographic information
Sources Geographic origin
Isolate Common Plant no. name Genus Species Cultivar type Substrate County State 95-2292 Azalea Rhododendron sp. Shrub Roots Aiken SC
95-2321 Kurume Rhododendron obtusum Hershey Shrub Roots Edgefield SC hybrid azalea Red 96-0182 Camellia Camellia sp. Shrub Roots Calhoun SC
96-0646 Sakaki Cleyera japonica Shrub Roots Pickens SC
96-1108 Leyland Cupressocyparis × leylandii Tree Roots Pickens SC cypress (syn. Cuprocyparis) 96-1310 Wax myrtle Myrica cerifera Shrub Roots Aiken SC
96-1391 Ginkgo Ginkgo biloba Tree Roots Oconee SC
96-1433 Foxglove Digitalis purpurea Herbaceous Roots Berkeley SC
96-2105 French Vitis hybrid Vine Roots Georgetown SC American grape
137 96-2193 Rhododendron Rhododendron sp. Shrub Roots Spartanburg SC
96-2254 Callery pear Pyrus calleryana Tree Roots Chesterfield SC
96-2325 Rhododendron Rhododendron sp. Shrub Roots Greenville SC
97-0003 Laurustinus Viburnum tinus Shrub Roots Dorchester SC
97-0193 Blueberry Vaccinium sp. Shrub Roots Anderson SC
97-1101 Maple Acer sp. Tree Roots Florence SC
97-1103 Blueberry Vaccinium sp. Shrub Roots Georgetown SC
97-2058 Atlantic white Chamaecyparis thyoides Tree Roots Oconee SC cedar 97-2332 Blueberry Vaccinium sp. Shrub Roots Richland SC
97-2581 Leyland Cupressocyparis × leylandii Tree Roots Anderson SC cypress (syn. Cuprocyparis) 97-2764 Mountain Kalmia latifolia Shrub Roots Aiken SC laurel 97-2822 Dwarf indica Rhododendron eriocarpum Pink Shrub Roots Richland SC azalea Gumpo 97-2838 Leyland Cupressocyparis × leylandii Tree Roots Horry SC cypress (syn. Cuprocyparis) 97-2940 Oakleaf Hydrangea quercifolia Alice Shrub Roots Pickens SC hydrangea
138 97-3051 Azalea Rhododendron sp. Shrub Roots Lexington SC
97-3099 Deodar cedar Cedrus deodara Tree Roots Berkeley SC
97-3132 Blueberry Vaccinium sp. Shrub Roots Lexington SC
97-3189 Leyland Cupressocyparis × leylandii Tree Roots Anderson SC cypress (syn. Cuprocyparis)
97-3193 Callery pear Pyrus calleryana Tree Roots Colleton SC
97-3315 Japanese Holly Ilex crenata Shrub Roots Charleston SC
97-3334 Foster Holly Ilex × attenuata Shrub Roots Greenville SC
97-3339 Japanese Holly Ilex crenata Shrub Roots Marion SC
98-0289 Azalea Rhododendron sp. Shrub Roots Lexington SC
98-1720 Inkberry Ilex glabra Shamrock Shrub Roots Greenville SC
98-1820 Callery pear Pyrus calleryana Bradford Tree Roots Clarendon SC
98-1911 Satsuki hybrid Rhododendron × satsuki Satsuki Shrub Roots Beaufort SC azalea 98-2300 American Ilex opaca Tree Roots Spartanburg SC holly 98-2800 Azalea Rhododendron hybrid Yaku Shrub Roots Greenville SC Princess
139 99-0066 Information Roots SC missing 99-1940 Tutsan Hypericum androsaemum Allbury Shrub Roots Greenville SC Purple 99-2163 Rhododendron Rhododendron catawbiense Roseum Shrub Roots Anderson SC Superbum 99-2212 Southern Rhododendron hybrid Indica Shrub Roots Colleton SC indica hybrid azalea 99-2222 Common Digitalis purpurea Excelsior Herbaceous Roots Anderson SC foxglove 99-2395 Gardenia Gardenia sp. Shrub Roots Beaufort SC
99-2589 Gardenia Gardenia sp. Shrub Roots Beaufort SC
99-2746 Chinese holly Ilex cornuta Steeds Shrub Roots Laurens SC
00-0057 Leyland Cupressocyparis × leylandii Tree Roots Anderson SC cypress (syn. Cuprocyparis)
00-1182 Cleyera Cleyera sp. Shrub Roots Georgetown SC
00-1387 Azalea Rhododendron sp. Shrub Roots Greenville SC
00-1422 Kurume Rhododendron obtusum Christmas Shrub Roots Pickens SC hybrid azalea Cheer 00-1652 Azalea Rhododendron sp. Shrub Roots Oconee SC
140 00-1834 Rhododendron Rhododendron sp. Shrub Roots Anderson SC
00-1842 Chinsei hybrid Rhododendron × chinsei Chinsei Shrub Roots Lexington SC azalea 00-2043 Belgian indica Rhododendron hybrid Pink Shrub Roots Greenville SC hybrid azalea Ruffle 00-2409 Dwarf indica Rhododendron eriocarpum Pink Shrub Roots Greenville SC azalea Gumpo 00-2422 Juniper Juniperus sp. Tree Roots Aiken SC
00-2590 Azalea Rhododendron hybrid Encore Shrub Roots Charleston SC
00-2640 Azalea Rhododendron sp. Shrub Roots Pickens SC
00-2679 Yew Taxus sp. Tree Roots Calhoun SC
00-2860 Rhododendron Rhododendron sp. Shrub Roots Darlington SC
00-2908 Azalea Rhododendron sp. Shrub Roots Berkeley SC
01-0032 Azalea Rhododendron sp. Shrub Roots Colleton SC
01-0086 Japanese Acer palmatum Bloodgood Tree Roots Lexington SC maple 01-0136 Boxwood Buxus sempervirens Shrub Roots Lexington SC
01-0150 Foster Holly Ilex × attenuata Shrub Roots Oconee SC
141 01-0416 Boxwood Buxus sempervirens Shrub Roots Greenville SC
01-0887 Flaky juniper Juniperus squamata Shrub Roots Edgefield SC
01-0926 Star anise Illicium floridanum Shrub Roots Oconee SC
01-1191 Leyland Cupressocyparis × leylandii Tree Roots Richland SC cypress (syn. Cuprocyparis)
01-2448 Pieris Pieris sp. Shrub Roots Richland SC
01-2487 Sugar maple Acer saccharum Green Tree Roots Florence SC Mountain 02-0403 Flaky juniper Juniperus squamata Blue star Shrub Roots Fairfield SC
02-0651 Carolina Halesia tetraptera Shrub Roots Charleston SC silverbell (syn. carolina) 02-0912 Virginia Itea virginica Little Shrub Roots Pickens SC sweetspire Henry 02-0976 Flaky juniper Juniperus squamata Sargent Shrub Roots Lexington SC
02-1047 Lily Lilium hybrid Orange Herbaceous Roots York SC Delight 02-1054 Lady Banks' Rosa banksiae Shrub Roots Lexington SC Rose 02-1205 Japanese Camellia japonica Shrub Roots Greenville SC camellia 02-1208 Japanese Holly Ilex crenata Shrub Roots Georgetown SC
142 02-1251 Barberry Berberis sp. Shrub Roots Greenville SC
02-1456 Photinia Photinia sp. Shrub Roots Richland SC
03-0005 Kurume Rhododendron obtusum Coral Shrub Roots Richland SC hybrid azalea Bells 03-0156 Live oak Quercus virginiana Tree Roots Richland SC
03-0747 White pine Pinus strobus Tree Roots Greenville SC
03-0750 Anise tree Illicium sp. Tree Roots Edgefield SC
03-0766 Japanese pieris Pieris japonica Shrub Roots Aiken SC
03-0778 Satsuki hybrid Rhododendron × satsuki Satsuki Shrub Roots Charleston SC azalea 03-0785 Leyland Cupressocyparis × leylandii Tree Roots Spartanburg SC cypress (syn. Cuprocyparis)
03-0913 Leyland Cupressocyparis × leylandii Tree Roots Laurens SC cypress (syn. Cuprocyparis)
03-0918 White pine Pinus strobus Tree Roots Pickens SC
03-1002 Wax myrtle Myrica cerifera Shrub Roots Beaufort SC
04-0023 Azalea Rhododendron sp. Shrub Roots Oconee SC
143 04-0741 Leyland Cupressocyparis × leylandii Tree Roots Beaufort SC cypress (syn. Cuprocyparis)
04-1051 Rhododendron Rhododendron sp. Shrub Stem York SC
04-1138 Red oak Quercus rubra Tree Roots Spartanburg SC
04-1187 Indian Rhaphiolepis umbellata Blueberry Shrub Roots Spartanburg SC hawthorn Muffin 04-1227 Camellia Camellia sp. Shrub Roots Aiken SC
04-1256 Inkberry Ilex glabra Shamrock Shrub Roots Pickens SC
04-1307 River birch Betula nigra Tree Roots Dekalb GA
04-1327 Stonecrop Sedum reflexum Herbaceous Roots York SC
04-1366 Aquilegia Aquilegia caerulea Winky Herbaceous Roots York SC Red and White 05-0081 Variegated Osmanthus heterophyllus Variegatus Shrub Roots Charleston SC holly tea olive 05-0089 Leyland Cupressocyparis × leylandii Tree Roots Greenville SC cypress (syn. Cuprocyparis)
05-0169 Japanese Pittosporum tobira Wheeler’s Shrub Roots Georgetown SC pittosporum Dwarf 05-0334 Hinoki Chamaecyparis obtusa Tree Roots Spartanburg SC falsecypress
144 05-0425 Hinoki Chamaecyparis obtusa Tree Roots Spartanburg SC falsecypress 05-0442 Azalea Rhododendron hybrid Lord Shrub Roots Abbeville SC Roberts 05-0678 Soil Berkeley SC
05-0798 Gypsyweed Veronica officinalis Minuet Herbaceous Roots York SC
05-0815 Japanese Ternstroemia gymnanthera Bush Roots Georgetown SC ternstroemia 05-0903 Oakleaf Hydrangea quercifolia Shrub Roots Pickens SC hydrangea 05-0908 Leyland Cupressocyparis × leylandii Tree Roots Richland SC cypress (syn. Cuprocyparis)
05-0995 Coral bells Heuchera hybrid Can Can Herbaceous Roots Aiken SC
05-1023 Azalea Rhododendron sp. Shrub Roots Greenville SC
05-1033 White pine Pinus strobus Tree Roots Greenville SC
05-1036 Witchalder Fothergilla sp. Shrub Roots Pickens SC
05-1048 English Buxus sempervirens Shrub Roots Greenville SC boxwood 05-1090 Rhododendron Rhododendron sp. Shrub Roots Greenville SC
06-0840 Holly Ilex sp. Tree Roots Pickens SC
145 06-0986 Wax myrtle Myrica cerifera Shrub Roots Georgetown SC
06-0989 Wood spurge Euphorbia amygdaloides Herbaceous Roots Aiken SC
06-1093 Japanese holly Ilex crenata Shrub Roots Greenville SC
07-0118 Blueberry Vaccinium sp. Shrub Roots Richland SC
07-0248 Rose Rosa sp. Homerun Shrub Roots York SC
07-0292 Japanese Camellia Japonica Shrub Stem Greenville SC camellia 07-0317 Yaupon holly Ilex vomitoria Nana Shrub Roots Georgetown SC
07-0521 Catnip Nepeta cataria Herbaceous Stem Albemarle VA
07-0522 Lavender Santolina chamaecypar- Shrub Roots Albemarle VA cotton issus 07-0523 Blueberry Vaccinium sp. Shrub Roots Anderson SC
07-0998 Camellia Camellia sp. Shrub Roots Greenville SC
07-1027 Azalea Rhododendron sp. Shrub Roots Richland SC
07-1049 Azalea Rhododendron sp. Shrub Roots Charleston SC
07-1080 Yew Taxus sp. Tree Roots Spartanburg SC
146 07-1161 Loquat Eriobotrya japonica Shrub Roots Beaufort SC
08-0199 Rhododendron Rhododendron sp. Shrub Roots Spartanburg SC
08-0359 Azalea Rhododendron sp. Shrub Roots Richland SC
08-0369 Azalea Rhododendron sp. Shrub Roots Richland SC
08-0378 White spruce Picea glauca Tree Roots Greenville SC
08-0514 Leyland Cupressocyparis × leylandii Tree Roots Georgetown SC cypress (syn. Cuprocyparis) 08-1058 Arborvitae Thuja occidentalis Degroot’s Tree Roots Greenville SC Spire 08-1300 Deodar cedar Cedrus deodara Tree Roots Spartanburg SC
08-1313 NCSU hybrid Rhododendron hybrid Sunglow Shrub Roots Richland SC azalea 09-1322 Peony Paeonia sp. Herbaceous Roots Anderson SC
09-1330 Camellia Camellia sp. Shrub Roots Greenville SC
09-1354 Rhododendron Rhododendron sp. Shrub Roots Oconee SC
09-1428 Mountain Kalmia latifolia Shrub Roots Oconee SC laurel 09-1536 Wax myrtle Myrica cerifera Shrub Roots Beaufort SC
147 09-1562 Dogwood Cornus florida Tree Roots Pickens SC
09-1668 Deodar cedar Cedrus deodara Tree Roots Anderson SC
09-1677 Japanese Camellia japonica Shrub Roots Greenville SC camellia 10-0037 Japanese Camellia japonica Shrub Roots Oconee SC camellia 10-0053 Small-leaf Viburnum obovatum Shrub Roots Hampton SC arrowwood 10-0911 Yew Taxus sp. Tree Roots Nelson VA
10-1041c Azalea Rhododendron sp. Shrub Stem Lexington SC
11-0092 Arborvitae Thuja occidentalis Emerald Tree Roots Pickens SC green 11-0201 Wax myrtle Myrica cerifera Shrub Roots Lexington SC
148 APPENDIX B
List of all isolates used in this study: Morphological and physiological characters*
Mefenoxam Sporangium sensitivity Colony Mating diameter Growth Time until Sporangia Isolate no. type (mm) habit first flush (h) Sporangiophore per disc Mean Sensitivity
95-2292 A2 67.0 Aerial 24 Simple, branched 8.8 0.3 Sensitive 0.7 Sensitive 95-2321 A2 69.6 Aerial 24 Simple, branched 5.6 0.2 Sensitive 96-0182 A1 68.4 Aerial 24 Simple, branched 0.4 0.5 Sensitive 96-0646 A2 78.5 Aerial No flush ND 0.0 0.7 Sensitive 96-1108 A2 78.9 Aerial 72 Simple, branched 4.2 0.3 Sensitive 96-1310 A2 65.9 Aerial No flush ND 0.0 0.0 Sensitive 96-1391 A2 36.8 Aerial 24 Simple, branched 7.8 0.3 Sensitive 96-1433 NA 38.4 NA NA NA NA 0.5 Sensitive 96-2105 A2 74.4 Aerial 48 Simple, branched 1.2 0.3 Sensitive 96-2193 A2 74.9 Aerial 24 Simple, branched 6.2 0.2 Sensitive 96-2254 A2 77.2 Aerial No flush ND 0.0 0.5 Sensitive 96-2325 A2 73.3 Aerial 24 Simple, branched 12.8 0.3 Sensitive 97-0003 A2 77.7 Aerial 24 Simple, branched 3.6 0.3 Sensitive 97-0193 A2 73.9 Aerial 24 Simple, branched 7.6 0.3 Sensitive 97-1101 A2 75.7 Aerial 24 Simple, branched 10.4 0.3 Sensitive 97-1103 A2 67.3 Aerial 72 Simple, branched 0.6 0.2 Sensitive 97-2058 A2 73.7 Aerial 24 Simple, branched 4.0 0.3 Sensitive 97-2332 A2 42.3 Aerial 24 Simple, branched 5.6 0.2 Sensitive 97-2581 A2 74.8 Aerial 24 Simple, branched 4.8 0.3 Sensitive 97-2764 A2 35.3 Aerial 24 Simple 2.0
149 0.2 Sensitive 97-2822 A2 39.5 Aerial 48 Simple 0.4 0.3 Sensitive 97-2838 A2 40.6 Aerial 24 Simple, branched 3.2 0.3 Sensitive 97-2940 A2 80.4 Aerial 24 Simple, branched 1.0 0.2 Sensitive 97-3051 A2 72.1 Aerial 24 Simple, branched 10.4 0.2 Sensitive 97-3099 A2 70.6 Aerial 24 Simple, branched 2.2 0.5 Sensitive 97-3132 A2 77.6 Aerial 24 Simple, branched 3.2 0.3 Sensitive 97-3189 A2 53.1 Aerial 72 Simple, branched 2.2 0.5 Sensitive 97-3193 A2 65.5 Aerial 24 Simple, branched 0.4 0.2 Sensitive 97-3315 A2 60.4 Aerial 24 Simple, branched 6.6 0.3 Sensitive 97-3334 A2 51.3 Appressed 24 Simple, branched 8.4 0.5 Sensitive 97-3339 A2 79.5 Aerial 24 Simple, branched 7.2 0.3 Sensitive 98-0289 A2 53.4 Aerial 24 Simple, branched 29.0 0.7 Sensitive 98-1720 A2 78.3 Aerial 24 Simple, branched 23.4 0.3 Sensitive 98-1820 A2 65.0 Aerial 48 Simple, branched 17.2 0.5 Sensitive 98-1911 A2 44.2 Aerial 24 Simple, branched 4.0 0.5 Sensitive 98-2300 A2 78.3 Aerial 24 Simple, branched 1.4 0.2 Sensitive 98-2800 A2 58.5 Aerial 24 Simple, branched 16.2 0.3 Sensitive 99-0066 A2 63.0 Aerial 24 Simple, branched 12.6 0.0 Sensitive 99-1940 A1 69.8 Aerial 24 Simple, branched >100 0.3 Sensitive 99-2163 A2 79.6 Aerial 48 Simple, branched 0.4 0.2 Sensitive 99-2212 A2 23.6 Aerial 24 Simple, branched 5.0 0.3 Sensitive 99-2222 A2 76.7 Aerial 24 Simple, branched 1.4 0.2 Sensitive 99-2395 A2 67.9 Aerial 24 Simple, branched 2.2 0.3 Sensitive 99-2589 A1 68.2 Aerial 24 Simple, branched 22.6 0.3 Sensitive 99-2746 A2 77.3 Aerial 48 Simple, branched 1.0 0.2 Sensitive 00-0057 A2 51.7 Aerial 24 Simple, branched 0.6 0.3 Sensitive 00-1182 A2 77.7 Aerial 24 Simple, branched 10.6 0.2 Sensitive 00-1387 A2 78.7 Aerial 48 Simple, branched 6.8
150 0.2 Sensitive 00-1422 A2 69.6 Aerial 24 Simple, branched 0.6 0.2 Sensitive 00-1652 A2 64.9 Aerial 24 Simple, branched 4.2 0.7 Sensitive 00-1834 A2 47.7 Aerial No flush ND 0.0 0.7 Sensitive 00-1842 A2 76.7 Aerial 24 Simple, branched 2.6 0.3 Sensitive 00-2043 A2 65.3 Aerial 24 Simple, branched 3.4 0.3 Sensitive 00-2409 A2 73.5 Aerial 24 Simple, branched 6.4 0.3 Sensitive 00-2422 NA 51.3 NA NA NA NA 0.2 Sensitive 00-2590 A2 72.9 Aerial 48 Simple, branched 1.6 0.3 Sensitive 00-2640 A2 34.8 Aerial 24 Simple, branched 10.2 0.3 Sensitive 00-2679 NA 49.8 NA NA NA NA 0.2 Sensitive 00-2860 A2 32.4 Appressed 48 Simple, branched 0.8 0.3 Sensitive 00-2908 A2 69.5 Aerial 24 Simple, branched 3.0 0.0 Sensitive 01-0032 A2 70.0 Aerial 24 Simple, branched 26.8 0.8 Sensitive 01-0086 A2 29.1 Aerial 24 Simple, branched 13.8 0.2 Sensitive 01-0136 A2 50.0 Appressed 24 Simple, branched 3.0 0.7 Sensitive 01-0150 A2 30.2 Appressed 24 Simple, branched 6.6 0.2 Sensitive 01-0416 A2 22.2 Appressed 24 Simple 0.6 0.5 Sensitive 01-0887 A2 68.6 Aerial 24 Simple, branched 4.8 0.3 Sensitive 01-0926 A2 33.0 Appressed 24 Simple, branched 9.0 0.5 Sensitive 01-1191 A2 36.8 Aerial 24 Simple, branched 0.0 0.3 Sensitive 01-2448 A2 44.8 Aerial 48 Simple 7.8 0.0 Sensitive 01-2487 A2 66.8 Aerial 24 Simple, branched 5.4 0.3 Sensitive 02-0403 A2 64.8 Aerial 24 Simple, branched 12.4 0.3 Sensitive 02-0651 A2 60.9 Aerial 24 Simple, branched 13.2 0.7 Sensitive 02-0912 A2 24.6 Appressed 24 Simple, branched 1.8 0.3 Sensitive 02-0976 A2 40.8 Aerial 24 Simple, branched 11.4 0.3 Sensitive 02-1047 A1 19.4 Dwarf 24 Simple, branched >100 0.0 Sensitive 02-1054 A2 27.9 Appressed 24 Simple, branched 8.4
151 0.0 Sensitive 02-1205 A1 65.4 Aerial 24 Simple, branched 6.8 0.2 Sensitive 02-1208 A2 53.5 Aerial No flush ND 0.0 0.0 Sensitive 02-1251 A2 30.8 Aerial 24 Simple, branched 1.0 0.2 Sensitive 02-1456 A2 66.4 Aerial 24 Simple, branched 10.2 0.2 Sensitive 03-0005 A2 73.0 Aerial 24 Simple, branched 30.0 0.3 Sensitive 03-0156 A2 43.6 Aerial 24 Simple 0.8 0.0 Sensitive 03-0747 A2 47.9 Appressed No flush ND 0.0 0.3 Sensitive 03-0750 A2 41.1 Aerial 48 Simple 5.0 0.3 Sensitive 03-0766 A2 70.6 Aerial 24 Simple, branched 16.0 0.8 Sensitive 03-0778 A2 61.2 Aerial 24 Simple, branched 8.0 0.2 Sensitive 03-0785 A2 75.6 Aerial 24 Simple, branched 11.4 0.5 Sensitive 03-0913 A2 77.4 Aerial 24 Simple, branched 10.8 0.0 Sensitive 03-0918 A2 40.5 Aerial 48 Simple, branched 5.4 0.3 Sensitive 03-1002 A2 18.6 Appressed 24 Simple, branched 19.0 0.0 Sensitive 04-0023 A2 69.1 Aerial 24 Simple, branched 4.2 0.5 Sensitive 04-0741 A2 77.5 Aerial 24 Simple 2.2 0.2 Sensitive 04-1051 NA 25.8 NA NA NA Na 0.0 Sensitive 04-1138 NA 44.1 Aerial 24 Simple, branched 1.6 1.0 Sensitive 04-1187 A2 77.3 Aerial 24 Simple, branched 14.4 0.2 Sensitive 04-1227 NA 47.0 NA NA NA NA 0.3 Sensitive 04-1256 A2 21.6 Appressed No flush ND 0.0 0.7 Sensitive 04-1307 A2 79.3 Aerial 24 Simple, branched 3.4 0.2 Sensitive 04-1327 A1 19.8 Dwarf 24 Simple, branched >100 0.3 Sensitive 04-1366 NA 59.0 NA NA NA NA 0.5 Sensitive 05-0081 A2 69.5 Aerial 24 Simple, branched 16.0 0.2 Sensitive 05-0089 A2 68.0 Aerial 48 Simple 0.2 0.3 Sensitive 05-0169 A2 78.8 Aerial 24 Simple, branched 11.4 0.2 Sensitive 05-0334 A2 55.6 Appressed 24 Simple, branched 13.6
152 0.5 Sensitive 05-0425 A2 35.8 Appressed 24 Simple, branched 4.0 0.0 Sensitive 05-0442 A2 33.3 Aerial 24 Simple, branched 33.8 0.3 Sensitive 05-0678 A2 67.2 Aerial 24 Simple, branched 34.0 0.3 Sensitive 05-0798 A2 28.7 Appressed 24 Simple, branched 30.8 0.3 Sensitive 05-0815 A2 40.7 Aerial 24 Simple 1.2 0.5 Sensitive 05-0903 A2 33.9 Aerial 24 Simple, branched 22.0 0.2 Sensitive 05-0908 A2 78.6 Aerial 24 Simple, branched 0.0 0.3 Sensitive 05-0995 A2 73.9 Aerial 24 Simple, branched 3.0 0.3 Sensitive 05-1023 A2 76.5 Aerial 24 Simple, branched 13.4 0.3 Sensitive 05-1033 A2 73.3 Aerial 24 Simple, branched 26.6 0.0 Sensitive 05-1036 A2 68.2 Aerial 24 Simple, branched 6.0 0.5 Sensitive 05-1048 NA 30.8 NA NA NA NA 0.2 Sensitive 05-1090 A2 74.6 Aerial 24 Simple, branched 0.6 0.3 Sensitive 06-0840 A2 52.4 Aerial 24 Simple, branched 22.4 0.5 Sensitive 06-0986 A2 79.9 Aerial 24 Simple, branched 22.6 0.7 Sensitive 06-0989 NA 56.2 NA NA NA NA 0.5 Sensitive 06-1093 A2 64.6 Aerial 24 Simple, branched 24.8 0.2 Sensitive 07-0118 A2 51.0 Appressed 24 Simple, branched 9.6 0.0 Sensitive 07-0248 NA 39.7 NA NA NA NA 0.0 Sensitive 07-0292 A2 55.7 Appressed 24 Simple 4.2 0.2 Sensitive 07-0317 A2 47.3 Appressed 24 Simple, branched 6.8 0.3 Sensitive 07-0521 NA 55.7 NA NA NA NA 0.3 Sensitive 07-0522 A1 60.9 Aerial 24 Simple, branched 4.4 0.3 Sensitive 07-0523 NA 63.9 NA NA NA NA 0.0 Sensitive 07-0998 A1 61.9 Aerial 24 Simple 6.4 0.2 Sensitive 07-1027 A2 63.8 Aerial 24 Simple, branched 10.0 0.2 Sensitive 07-1049 A2 75.0 Aerial 24 Simple, branched 33.0 0.2 Sensitive 07-1080 A2 78.3 Aerial 24 Simple, branched 11.2
153 0.5 Sensitive 07-1161 A2 77.6 Aerial 24 Simple, branched 0.0 0.3 Sensitive 08-0199 A2 69.9 Aerial 24 Simple, branched 16.0 0.5 Sensitive 08-0359 A2 70.3 Aerial 48 Simple, branched 5.2 0.3 Sensitive 08-0369 A2 68.2 Aerial 24 Simple, branched 1.2 0.3 Sensitive 08-0378 A2 76.4 Aerial 24 Simple, branched 0.4 0.3 Sensitive 08-0514 A2 73.0 Aerial 48 Simple, branched 32.4 0.3 Sensitive 08-1058 NA 45.0 NA NA NA NA 0.3 Sensitive 08-1300 A1 37.5 Aerial 24 Simple, branched 9.0 0.2 Sensitive 08-1313 A2 75.7 Aerial 24 Simple, branched 4.8 0.3 Sensitive 09-1322 A1 37.1 Aerial 48 Simple, branched 0.4 0.0 Sensitive 09-1330 A1 24.5 Aerial 24 Simple, branched 1.4 0.3 Sensitive 09-1354 A2 73.4 Aerial 24 Simple, branched 4.2 0.5 Sensitive 09-1428 A2 71.8 Aerial 24 Simple 5.2 0.7 Sensitive 09-1536 A2 74.5 Aerial 24 Simple, branched 0.4 0.2 Sensitive 09-1562 NA 73.6 NA NA NA NA 0.3 Sensitive 09-1668 A2 77.2 Aerial 24 Simple 4.4 0.7 Sensitive 09-1677 A1 51.8 Aerial 24 Simple, branched 4.4 0.2 Sensitive 10-0037 A1 65.8 Aerial 24 Simple, branched 6.0 0.2 Sensitive 10-0053 A2 74.8 Aerial 48 Simple, branched 3.0 0.3 Sensitive 10-0911 A2 66.3 Aerial 24 Simple, branched 9.8 0.2 Sensitive 10-1041c A2 29.6 Appressed 24 Simple, branched 9.8 0.8 Sensitive 11-0092 A2 68.2 Aerial 24 Simple, branched 1.0 0.5 Sensitive 11-0201 A2 24.4 Aerial 24 Simple, branched 9.2
* NA: Not applicable – isolate was not P. cinnamomi, so information was not collected ND: No data – isolate did not produce sporangia after 96 h
154 APPENDIX C
List of all isolates used in this study: Molecular characters and species identification (far right column)
ITS-RFLPs Phytophthora Database Isolate no. AluI MspI ITS sequence homology Phytophthora sp. 95-2292 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
95-2321 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-0182 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-0646 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-1108 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-1310 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-1391 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-1433 800, 150 400, 210, 170, 150 P. taxon niederhauserii P. taxon niederhauserii
96-2105 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-2193 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-2254 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
96-2325 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-0003 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-0193 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-1101 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
155 97-1103 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2058 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2332 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2581 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2764 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2822 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2838 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-2940 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3051 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3099 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3132 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3189 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3193 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3315 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3334 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
97-3339 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
98-0289 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
98-1720 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
98-1820 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
156 98-1911 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
98-2300 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
98-2800 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-0066 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-1940 550, 210, 190 400, 210, 170, 150 P. cinnamomi var. P. cinnamomi var. parvispora parvispora 99-2163 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-2212 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-2222 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-2395 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-2589 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
99-2746 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-0057 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1182 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1387 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1422 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1652 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1834 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-1842 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-2043 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
157 00-2409 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-2422 800, 150 400, 210, 170, 150 P. taxon niederhauserii P. taxon niederhauserii
00-2590 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-2640 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-2679 385, 80 500, 350 Not sequenced
00-2860 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
00-2908 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0032 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0086 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0136 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0150 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0416 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0887 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-0926 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-1191 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-2448 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
01-2487 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-0403 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-0651 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
158 02-0912 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-0976 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1047 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1054 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1205 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1208 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1251 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
02-1456 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0005 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0156 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0747 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0750 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0766 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0778 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0785 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0913 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-0918 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
03-1002 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-0023 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
159 04-0741 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-1051 550, 210, 190 300, 215, 150 Failed to sequence
04-1138 550, 210, 190 400, 210, 170, 150 Failed to sequence
04-1187 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-1227 560, 415 550, 415 Not sequenced
04-1256 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-1307 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-1327 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
04-1366 200 400 Not sequenced
05-0081 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0089 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0169 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0334 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0425 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0442 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0678 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0798 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0815 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0903 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
160 05-0908 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-0995 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-1023 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-1033 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-1036 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
05-1048 800, 150 410, 130 Not sequenced
05-1090 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
06-0840 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
06-0986 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
06-0989 800, 150 240, 150 Not sequenced
06-1093 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
07-0118 550, 210, 190 1000 P. cinnamomi P. cinnamomi
07-0248 550, 210, 190 370, 300, 220 Failed to sequence
07-0292 550, 210, 190 400, 360, 215, 165 P. cinnamomi P. cinnamomi
07-0317 550, 210, 190 410, 190 P. cinnamomi P. cinnamomi
07-0521 800, 150 250, 140 Not sequenced
07-0522 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
07-0523 800, 150 240, 150 Not sequenced
07-0998 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
161 07-1027 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
07-1049 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
07-1080 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
07-1161 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-0199 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-0359 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-0369 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-0378 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-0514 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-1058 800, 150 400, 210, 170, 150 P. taxon niederhauserii P. taxon niederhauserii
08-1300 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
08-1313 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1322 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1330 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1354 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1428 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1536 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
09-1562 800, 150 240, 150 Not sequenced
09-1668 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
162 09-1677 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
10-0037 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
10-0053 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
10-0911 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
10-1041c 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
11-0092 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
11-0201 550, 210, 190 400, 210, 170, 150 P. cinnamomi P. cinnamomi
163 APPENDIX D
Alternative β-tub phylogenetic tree incorporating isolate 05-0798
164 02-1208 11-0092 09-1428 08-0378 07-1080 07-0118 05-0908 04-1187 04-1138 03-0918 03-0766 02-0912 02-0403 01-2487 65 01-1191 01-0086 00-1842 00-0057 99-2222 98-2300 98-0289 97-3132 97-2764 97-0193 96-2193 96-2105 96-1391 11-0201 PC40 97-3334 00-2860 01-0136 4 01-0150 01-0926 01-2448 02-1054 03-0747 03-1002 96-0182 99-2589 02-1205
99 07-0522 07-0998 64 09-1330 09-1677 10-0037 PC138 66 05-0334 05-0425 07-0292 07-0317 10-1041c 99-1940 02-1047 04-1327 99 05-0798 24 24 08-1300 67 09-1322 P. sojae
165 APPENDIX E
List of the subset of 61 isolates used for phylogenetic analysis:
Terminal clade and cluster analysis groups
Isolate no. ITS β-tub cox1 cox2 rps10 Cluster Pc138 1 5 1 1 6 1 Pc40 1 4 1 1 1 7 96-0182 1 5 1 1 6 1 96-1391 1 4 1 1 1 7 96-2105 1 4 1 1 1 7 96-2193 1 4 1 1 1 7 97-0193 1 4 1 1 1 7 97-2764 1 4 1 1 1 7 97-3132 1 4 1 1 1 7 97-3334 1 4 1 1 6 2 98-0289 1 4 1 1 1 7 98-2300 1 4 1 1 1 7 99-1940 2 3 2 4 5 3 99-2222 1 4 1 1 1 7 99-2589 1 5 1 1 6 1 99-2746 1 4 1 1 1 7 00-0057 1 4 1 1 1 7 00-1842 1 4 1 1 1 7 00-2860 1 4 1 1 6 2 01-0086 1 4 1 1 1 7 01-0136 1 4 1 1 6 2 01-0150 1 4 1 1 6 2 01-0416 1 4 1 1 6 2 01-0926 1 4 1 1 6 2 01-1191 1 4 1 1 1 7 01-2448 1 4 1 1 1 7 01-2487 1 4 1 1 1 7 02-0403 1 4 1 1 1 7 02-0912 1 4 1 1 6 2 02-1047 4 1 3 3 3 5 02-1054 1 4 1 1 6 2 02-1205 1 5 1 1 6 1 02-1208 1 4 1 1 1 7 03-0747 1 4 1 1 6 2 03-0766 1 4 1 1 1 7
166 03-0918 1 4 1 1 1 7 03-1002 1 4 1 1 6 2 04-1138 1 4 1 1 1 7 04-1187 1 4 1 1 1 7 04-1256 1 4 1 1 1 7 04-1327 4 1 3 3 3 5 05-0334 1 4 1 1 6 2 05-0425 1 4 1 1 6 2 05-0798 4 9 4 2 2 4 05-0908 1 4 1 1 1 7 07-0118 1 4 1 1 6 2 07-0292 1 4 1 1 6 2 07-0317 1 4 1 1 6 2 07-0522 1 5 1 1 6 1 07-0998 1 5 1 1 6 1 07-1080 1 4 1 1 1 7 08-0378 1 4 1 1 1 7 08-1300 3 2 1 3 4 6 09-1322 4 2 1 3 4 6 09-1330 1 5 1 1 6 1 09-1428 1 4 1 1 1 7 09-1677 1 5 1 1 6 1 10-0037 1 5 1 1 6 1 10-1041c 1 4 1 1 6 2 11-0092 1 4 1 1 1 7 11-0201 1 4 1 1 1 7
167