DOCSLIB.ORG

Original Article Lncrna OSER1-AS1 Interacts with Mir-612/FOXM1 Axis to Modulate Gefitinib Resistance of Lung Adenocarcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Lncrna OSER1-AS1 Interacts with Mir-612/FOXM1 Axis to Modulate Gefitinib Resistance of Lung Adenocarcinoma Am J Transl Res 2021;13(3):1365-1376 www.ajtr.org /ISSN:1943-8141/AJTR0112306 Original Article LncRNA OSER1-AS1 interacts with miR-612/FOXM1 axis to modulate gefitinib resistance of lung adenocarcinoma Tingting Shi1, Weijuan Sun1, Yan-Long Shi1, Qiang Wang1, Ze-Xuan Yan2, Mei Zhang3 1Department of Oncology, 960th Hospital of PLA, Jinan, China; 2Institute of Pathology and Southwest Cancer Center, Southwest Hospital, Army Medical University, Chongqing, China; 3Department of Cerebral Surgery, 960th Hospital of PLA, Jinan, China Received April 10, 2020; Accepted December 30, 2020; Epub March 15, 2021; Published March 30, 2021 Abstract: Long noncoding RNAs (lncRNAs) play crucial roles in the acquired resistance to EGFR-directed therapies in lung cancer. LncRNA OSER1-AS1 has been reported to promote tumorigenesis of hepatocellular carcinoma. However, its functions and underlying molecular mechanisms remain unclear in the acquired gefitinib-resistance of lung cancer. Our study revealed that increased expression of OSER1-AS1 was correlated with gefitinib resistance in lung adenocarcinoma. Higher OSER1-AS1 expression predicted disease progression of lung adenocarcinoma patients. The in vitro assays indicated OSER1-AS1 contributed to gefitinib resistance of lung adenocarcinoma cells via inhibiting cell apoptosis and cell cycle arrest. In vivo experiments showed that the knockdown of OSER1-AS1 restored the sensitivity of lung cancer cells to gefitinib. Further studies showed that OSER1-AS1 functioned as a molecular sponge of miR-612. OSER1-AS1 down-regulated miR-612 to increase FOXM1 expression, suggesting that miR-612/FOXM1 axis was regulated by OSER1-AS1, which was partially responsible for gefitinib resistance of lung adenocarcinoma. In conclusion, OSER1-AS1 promoted gefitinib resistance of lung adenocarcinoma through the miR-612/FOXM1 axis. Keywords: LncRNA OSER1-AS1, lung adenocarcinoma, gefitinib, miR-612, FOXM1 Introduction they could not be directly translated into pro- teins [5]. Various mechanisms were involved in Non-small-cell lung cancer (NSCLS) is globally the lncRNAs regulated process, such as spong- the most frequent subtype of lung cancer, ing microRNA (miRNA) as competitive endoge- which is also featured withhigh cancer-associ- nous RNA (ceRNA) [6]. Previous investigation ated mortalities [1]. Studies identified the onco- also indicated that some lncRNAs were involved genic role of EGFR in the development and pro- in gefitinib resistance of lung cancer [7]. For gression of lung cancer [2]. Then EGFR-tyrosine instance, lncRNA MALAT1/ZEB1 axis promotes kinase inhibitors (TKIs) were developed and EGFR-TKI resistance through epithelial-to-mes- emerged as one of the most promising option enchymal transition (EMT) regulation [8]. Fur- for lung cancer, especially lung adenocarcino- ther studies for lncRNA in the regulation of TKI ma with EGFR-activating mutations [3]. How- resistance will contribute to the development ever, clinical resistance impeded the long-term of novel strategies to improve therapeutic therapeutic efficiency of TKIs [4]. Thus, further efficiency. investigation of the mechanism underlying TKI resistance is essential for improving the prog- Recent study identified lncRNA OSER1-AS1 pro- nosis of lung adenocarcinoma patients. moted tumorigenesis of hepatocellular carci- noma, which was correlated with its competi- Long non-coding RNAs (lncRNAs) showed criti- tion with miR-372-3p/Rab23 axis [9]. We also cal roles in the regulation of carcinogenesis observed increased OSER1-AS1 expression in and progression of human cancer, although gefitinib resistance of lung adenocarcinoma. OSER1-AS1 promotes gefitinib resistance However, the role of OSER1-AS1 was still un- DH: For, 5’-GGGAGCCAAAAGGGTCAT-3’, Rev, known in lung adenocarcinoma. In present stu- 5’-GAGTCCTTCCACGATACCAA-3’; miR-612: For, dy, we explored the biological role of OSER1- 5’-GCAGGGCTTCTGAGCTCCTTAA-3’; Rev, 5’-GC- AS1 in gefitinib resistance of lung adenocarci- GAGCACAGAATTAATACGAC; U6: For, 5’-CTCGCT- noma. Detailed molecular mechanism was also TCGGCAGCAGCACATATA-3’, Rev, 5’-AAATATGG- studied in the regulation of miR-612/Forkhead AACGCTTCACGA-3’. box M1 (FOXM1) axis by OSER1-AS1. RNA oligoribonucleotides and cell transfection Materials and methods The plasmids of OSER1-AS1 overexpressing or TCGA dataset analysis silencing (shOSER1) were designed and syn- thesized by GeneChem (Shanghai, China). The We collected the RNA-seq data and clinical small interfering RNA against FOXM1, and miR- data of the lung adenocarcinoma patients from 612 mimics were synthesized by Gene Pharma The Cancer Genome Atlas (TCGA) database (Shanghai, China). Cells were transfected with website (http://cancergenome.nih.gov/). The Lipofectamine 3000 (Invitrogen, Paisley, UK). statistical analysis for the correlations with Cells transfection efficiency was evaluated with clinical characteristics were performed with RT-qPCR assays 48 h after transfection. GraphPad 8. Receiver Operator Characteristic Curve (ROC) and Kaplan-Meier survival curves Cell proliferation assays were analyzed for the prognostic value of OSER1-AS1. Cell Counting Kit-8 (CCK-8) was purchased for Beyotime (Shanghai, China). Totally 5000 cells Cell culture were planted in 96-well plates and treated with The lung adenocarcinoma cell lines (A549, 0.1 μM gefitinib. We added 10 μl CCK-8 reagent H1299 and SPCA1) and normal bronchial epi- into each well and incubated for 2 h at 37°C. thelial cells (16HBE) were purchased from ATCC Then cell proliferation was measured with the (Rockville, MD). Cells were cultured in DMEM absorption at 450 nm using a microplate read- (Gibco, Grand Island, NY) supplemented with er (Tecan, Switzerland). 10% fetal bovine serum (HyClone, Logan, UT), Flowcytometry analysis for cell cycle and apop- and maintained in the 5% CO and 37°C incu- 2 tosis bator. Gefitinib resistant A549 cells (A549/GR) were generated by continual gefitinib treatment Flow cytometry analysis was performed with a for nine months. FACS Calibur (BD Biosciences, CA). For the cell Reverse transcription-quantitative polymerase cycle analysis, gefitinib treated cells were col- chain reaction (RT-qPCR) assay lected and fixed with 75% cold ethanol over- night. Cells were stained with PI and RNase Total RNA extraction was performed with Trizol solution form Cell Cycle and Apoptosis Analys- reagent (Takara, Japan), and reverse transcrip- is Kit (C1052, Beyotime). For the analysis of tion was performed with AMV reverse transcrip- cell apoptosis, all collected cells were stained tase (Takara, Otsu, Japan) and RevertAid™ H with Annexin V-FITC Apoptosis Detection Kit Minus First Strand cDNA Synthesis Kit (Takara). (C1062S, Beyotime). Cell cycle distributions SYBR PrimeScript RT-PCR kit (Takara) was used and cell apoptosis were analyzed with FlowJo for real-time PCR in BioRad CFX96 Sequence 10 software (Tree Star, San Carlos, CA). Detection System (BioRad company, Berkeley, CA). GAPDH and U6 were used as gene or Tumorigenesis assays microRNA internal control. The primers were synthesized by RiboBio (Guangzhou, China), The tumorigenesis assays were authorized by and the sequences are shown as follows: the animal center of PLA 960th Hospital. BALB/c OSER1-AS1: For, 5’-AATCACTGCAATTGAAGGAA- nude mice were randomly grouped with shOS- AAA-3’, Rev, 5’-CCTTGTTTTCCAACCCTTAGACT- ER1 and control groups (n = 6 each group). 3’; FOXM1: For, 5’-CGTCGGCCACTGATTCTCAAA- Stably infected cells were implanted at the right 3’, Rev, 5’-GGCAGGGGATCTCTTAGGTTC-3’; GAP- flank of the mice. Oral gavage gefitinib treat- 1366 Am J Transl Res 2021;13(3):1365-1376 OSER1-AS1 promotes gefitinib resistance ment was performed after 15 days of xenograft comparison within groups were analyzed with implantation, which were administrated with student’s t-test or one-way ANOVA. The corre- 25 mg/kg in 1% Tween 80 (Sigma, St Louis, lation of RNA expression was analyzed with MO). Tumor volumes were measured every five Pearson correlation test. P < 0.05 were consid- days with the formula: Volume = length * ered statistically significant. width2/2. The mice were sacrificed on the 30th day after implantation. The xenografts were Results excised and photographed. OSER1-AS1 was correlated with gefitinib resis- Immunohistochemistry (IHC) staining tance of lung adenocarcinoma IHC staining of the xenografts were perform- We initially assessed the expression of OSER1- ed as our previously study [10]. The primary AS1 in adenocarcinoma with the dataset from FOXM1 antibody was purchased from Abcam TCGA database. The results showed higher (ab232649, Cambridge, MA). OSER1-AS1 expression in tumor tissues than adjacent normal tissues (P = 0.015, Figure 1A). Luciferase activity analysis Patients with late clinical stage also showed higher levels of OSER1-AS1 than that with early Wild type and mutant OSER1-AS1 sequences stage (P = 0.001, Figure 1B). Notably, the pa- (as shown) were subcloned into the pGL3-basic tients with higher OSER1-AS1 expression show- luciferase reporter vector (Promega, Madison, ed worse response to gefitinib (2 years) Figure( WI). A549 cells were transfected with the lucif- 1C). ROC analysis indicated a prognostic value erase vector and miRNA mimics (miR-612) or of OSER1-AS1 in disease progression of lung negative control (NT). After cultured for 48 adenocarcinoma (cutoff value = 4.30, area un- hours, cells were lysed to measure the lucifer- der the curve = 0.666, P < 0.001, Figure 1D). ase activities with the Dual-Luciferase Reporter Kaplan-Meier analysis indicated
Load more

Recommended publications
  • Book of Abstracts Ii Contents
    2014 CAP Congress / Congrès de l’ACP 2014 Sunday, 15 June 2014 - Friday, 20 June 2014 Laurentian University / Université Laurentienne Book of Abstracts ii Contents An Analytic Mathematical Model to Explain the Spiral Structure and Rotation Curve of NGC 3198. .......................................... 1 Belle-II: searching for new physics in the heavy flavor sector ................ 1 The high cost of science disengagement of Canadian Youth: Reimagining Physics Teacher Education for 21st Century ................................. 1 What your advisor never told you: Education for the ’Real World’ ............. 2 Back to the Ionosphere 50 Years Later: the CASSIOPE Enhanced Polar Outflow Probe (e- POP) ............................................. 2 Changing students’ approach to learning physics in undergraduate gateway courses . 3 Possible Astrophysical Observables of Quantum Gravity Effects near Black Holes . 3 Supersymmetry after the LHC data .............................. 4 The unintentional irradiation of a live human fetus: assessing the likelihood of a radiation- induced abortion ...................................... 4 Using Conceptual Multiple Choice Questions ........................ 5 Search for Supersymmetry at ATLAS ............................. 5 **WITHDRAWN** Monte Carlo Field-Theoretic Simulations for Melts of Diblock Copoly- mer .............................................. 6 Surface tension effects in soft composites ........................... 6 Correlated electron physics in quantum materials ...................... 6 The
    [Show full text]
  • Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
    cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Figure S1. HAEC ROS Production and ML090 NOX5-Inhibition
    Figure S1. HAEC ROS production and ML090 NOX5-inhibition. (a) Extracellular H2O2 production in HAEC treated with ML090 at different concentrations and 24 h after being infected with GFP and NOX5-β adenoviruses (MOI 100). **p< 0.01, and ****p< 0.0001 vs control NOX5-β-infected cells (ML090, 0 nM). Results expressed as mean ± SEM. Fold increase vs GFP-infected cells with 0 nM of ML090. n= 6. (b) NOX5-β overexpression and DHE oxidation in HAEC. Representative images from three experiments are shown. Intracellular superoxide anion production of HAEC 24 h after infection with GFP and NOX5-β adenoviruses at different MOIs treated or not with ML090 (10 nM). MOI: Multiplicity of infection. Figure S2. Ontology analysis of HAEC infected with NOX5-β. Ontology analysis shows that the response to unfolded protein is the most relevant. Figure S3. UPR mRNA expression in heart of infarcted transgenic mice. n= 12-13. Results expressed as mean ± SEM. Table S1: Altered gene expression due to NOX5-β expression at 12 h (bold, highlighted in yellow). N12hvsG12h N18hvsG18h N24hvsG24h GeneName GeneDescription TranscriptID logFC p-value logFC p-value logFC p-value family with sequence similarity NM_052966 1.45 1.20E-17 2.44 3.27E-19 2.96 6.24E-21 FAM129A 129. member A DnaJ (Hsp40) homolog. NM_001130182 2.19 9.83E-20 2.94 2.90E-19 3.01 1.68E-19 DNAJA4 subfamily A. member 4 phorbol-12-myristate-13-acetate- NM_021127 0.93 1.84E-12 2.41 1.32E-17 2.69 1.43E-18 PMAIP1 induced protein 1 E2F7 E2F transcription factor 7 NM_203394 0.71 8.35E-11 2.20 2.21E-17 2.48 1.84E-18 DnaJ (Hsp40) homolog.
    [Show full text]
  • Overexpression of Receptor-Like Kinase ERECTA Improves Thermotolerance in Rice and Tomato
    LETTERS Overexpression of receptor-like kinase ERECTA improves thermotolerance in rice and tomato Hui Shen1,2,9, Xiangbin Zhong1,9, Fangfang Zhao1, Yanmei Wang1, Bingxiao Yan1, Qun Li1, Genyun Chen1, Bizeng Mao3, Jianjun Wang4, Yangsheng Li5, Guoying Xiao6, Yuke He1, Han Xiao1, Jianming Li7 & Zuhua He1,8 The detrimental effects of global warming on crop productivity Overexpression of HSP101 increased tolerance to heat shock or threaten to reduce the world’s food supply1–3. Although plant prolonged heat stress in transgenic Arabidopsis, tobacco and cot- responses to changes in temperature have been studied4, ton9,14, although transgenic cotton produced fewer bolls and seeds genetic modification of crops to improve thermotolerance than control cotton plants under normal growth conditions14. has had little success to date. Here we demonstrate that On the other hand, engineering to increase the tolerance of plants to overexpression of the Arabidopsis thaliana receptor-like high temperatures during multiple hot summer seasons at different kinase ERECTA (ER) in Arabidopsis, rice and tomato locations has not been reported. In particular, there are few confers thermotolerance independent of water loss and that reports of engineering or breeding of thermotolerant staple crop Arabidopsis er mutants are hypersensitive to heat. A loss- species, except for a recent study, which reported that natural alleles of of-function mutation of a rice ER homolog and reduced a gene encoding proteasome α2 subunit from African rice contribute expression of a tomato ER allele decreased thermotolerance of to thermotolerance15. Therefore, genes other than HSP101 are critical both species. Transgenic tomato and rice lines overexpressing to thermotolerance improvement in crops16.
    [Show full text]
  • Applications and Potential of Genome-Editing Systems in Rice Improvement: Current and Future Perspectives
    agronomy Review Applications and Potential of Genome-Editing Systems in Rice Improvement: Current and Future Perspectives Javaria Tabassum 1 , Shakeel Ahmad 1,2 , Babar Hussain 3 , Amos Musyoki Mawia 1, Aqib Zeb 1 and Luo Ju 1,* 1 State Key Laboratory of Rice Biology, China National Rice Research Institute, Hangzhou 310006, China; [email protected] (J.T.); [email protected] (S.A.); [email protected] (A.M.M.); [email protected] (A.Z.) 2 Maize Research Station, Ayub Agricultural Research Institute, Faisalabad 38000, Pakistan 3 Department of Biological Sciences, Middle East Technical University, 06800 Ankara, Turkey; [email protected] * Correspondence: [email protected] or [email protected]; Tel.: +86-135-7570-6965 Abstract: Food crop production and quality are two major attributes that ensure food security. Rice is one of the major sources of food that feeds half of the world’s population. Therefore, to feed about 10 billion people by 2050, there is a need to develop high-yielding grain quality of rice varieties, with greater pace. Although conventional and mutation breeding techniques have played a significant role in the development of desired varieties in the past, due to certain limitations, these techniques cannot fulfill the high demands for food in the present era. However, rice production and grain quality can be improved by employing new breeding techniques, such as genome editing tools (GETs), with high efficiency. These tools, including clustered, regularly interspaced short palindromic repeats (CRISPR) systems, have revolutionized rice breeding. The protocol of CRISPR/Cas9 systems technology, and Citation: Tabassum, J.; Ahmad, S.; its variants, are the most reliable and efficient, and have been established in rice crops.
    [Show full text]
  • Evidence of Y Chromosome Long Non-Coding Rnas Involved in the Radiation Response of Male Non-Small Cell Lung Cancer Cells
    Graduate Theses, Dissertations, and Problem Reports 2020 Evidence of Y Chromosome Long Non-Coding RNAs involved in the Radiation Response of Male Non-Small Cell Lung Cancer Cells Tayvia Brownmiller West Virginia University, [email protected] Follow this and additional works at: https://researchrepository.wvu.edu/etd Part of the Cancer Biology Commons, Cell Biology Commons, Genetics Commons, Molecular Genetics Commons, and the Radiation Medicine Commons Recommended Citation Brownmiller, Tayvia, "Evidence of Y Chromosome Long Non-Coding RNAs involved in the Radiation Response of Male Non-Small Cell Lung Cancer Cells" (2020). Graduate Theses, Dissertations, and Problem Reports. 7784. https://researchrepository.wvu.edu/etd/7784 This Dissertation is protected by copyright and/or related rights. It has been brought to you by the The Research Repository @ WVU with permission from the rights-holder(s). You are free to use this Dissertation in any way that is permitted by the copyright and related rights legislation that applies to your use. For other uses you must obtain permission from the rights-holder(s) directly, unless additional rights are indicated by a Creative Commons license in the record and/ or on the work itself. This Dissertation has been accepted for inclusion in WVU Graduate Theses, Dissertations, and Problem Reports collection by an authorized administrator of The Research Repository @ WVU. For more information, please contact [email protected]. Evidence of Y Chromosome Long Non-Coding RNAs involved in the
    [Show full text]
  • Identification of Genomic Targets of Krüppel-Like Factor 9 in Mouse Hippocampal
    Identification of Genomic Targets of Krüppel-like Factor 9 in Mouse Hippocampal Neurons: Evidence for a role in modulating peripheral circadian clocks by Joseph R. Knoedler A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Neuroscience) in the University of Michigan 2016 Doctoral Committee: Professor Robert J. Denver, Chair Professor Daniel Goldman Professor Diane Robins Professor Audrey Seasholtz Associate Professor Bing Ye ©Joseph R. Knoedler All Rights Reserved 2016 To my parents, who never once questioned my decision to become the other kind of doctor, And to Lucy, who has pushed me to be a better person from day one. ii Acknowledgements I have a huge number of people to thank for having made it to this point, so in no particular order: -I would like to thank my adviser, Dr. Robert J. Denver, for his guidance, encouragement, and patience over the last seven years; his mentorship has been indispensable for my growth as a scientist -I would also like to thank my committee members, Drs. Audrey Seasholtz, Dan Goldman, Diane Robins and Bing Ye, for their constructive feedback and their willingness to meet in a frequently cold, windowless room across campus from where they work -I am hugely indebted to Pia Bagamasbad and Yasuhiro Kyono for teaching me almost everything I know about molecular biology and bioinformatics, and to Arasakumar Subramani for his tireless work during the home stretch to my dissertation -I am grateful for the Neuroscience Program leadership and staff, in particular
    [Show full text]
  • Low Incubation Temperature During Early Development Negatively
    www.nature.com/scientificreports OPEN Low incubation temperature during early development negatively afects survival and Received: 20 September 2017 Accepted: 21 February 2018 related innate immune processes Published: xx xx xxxx in zebrafsh larvae exposed to lipopolysaccharide Qirui Zhang, Martina Kopp, Igor Babiak & Jorge M. O. Fernandes In many fsh species, the immune system is signifcantly constrained by water temperature. In spite of its critical importance in protecting the host against pathogens, little is known about the infuence of embryonic incubation temperature on the innate immunity of fsh larvae. Zebrafsh (Danio rerio) embryos were incubated at 24, 28 or 32 °C until frst feeding. Larvae originating from each of these three temperature regimes were further distributed into three challenge temperatures and exposed to lipopolysaccharide (LPS) in a full factorial design (3 incubation × 3 challenge temperatures). At 24 h post LPS challenge, mortality of larvae incubated at 24 °C was 1.2 to 2.6-fold higher than those kept at 28 or 32 °C, regardless of the challenge temperature. LPS challenge at 24 °C stimulated similar immune- related processes but at diferent levels in larvae incubated at 24 or 32 °C, concomitantly with the down- regulation of some chemokine and lysozyme transcripts in the former group. Larvae incubated at 24 °C and LPS-challenged at 32 °C exhibited a limited immune response with up-regulation of hypoxia and oxidative stress processes. Annexin A2a, S100 calcium binding protein A10b and lymphocyte antigen-6, epidermis were identifed as promising candidates for LPS recognition and signal transduction. In teleosts, the innate immune system is extremely important for host defence.
    [Show full text]
  • And Benzo[A]Pyrene-Exposed
    RESEARCH ARTICLE Comparative analysis of distinctive transcriptome profiles with biochemical evidence in bisphenol S- and benzo[a]pyrene- exposed liver tissues of the olive flounder Paralichthys olivaceus Jee-Hyun Jung1,2*, Young-Sun Moon1, Bo-Mi Kim3, Young-Mi Lee4, Moonkoo Kim1,2, Jae- a1111111111 Sung Rhee5,6* a1111111111 a1111111111 1 Oil and POPs Research Group, Korea Institute of Ocean Science and Technology, Geoje, South Korea, 2 Department of Marine Environmental Science, Korea University of Science and Technology, Daejeon, a1111111111 South Korea, 3 Unit of Polar Genomics, Korea Polar Research Institute, Incheon, South Korea, a1111111111 4 Department of Life Science, College of Natural Sciences, Sangmyung University, Seoul, South Korea, 5 Department of Marine Science, College of Natural Sciences, Incheon National University, Incheon, South Korea, 6 Research Institute of Basic Sciences, Incheon National University, Incheon, South Korea * [email protected] (JHJ); [email protected] (JSR) OPEN ACCESS Citation: Jung J-H, Moon Y-S, Kim B-M, Lee Y-M, Kim M, Rhee J-S (2018) Comparative analysis of Abstract distinctive transcriptome profiles with biochemical evidence in bisphenol S- and benzo[a]pyrene- Flounder is a promising model species for environmental monitoring of coastal regions. To exposed liver tissues of the olive flounder assess the usefulness of liver transcriptome profiling, juvenile olive flounder Paralichthys oli- Paralichthys olivaceus. PLoS ONE 13(5): vaceus were exposed to two pollutants, bisphenol S (BPS) and benzo[a]pyrene (BaP), e0196425. https://doi.org/10.1371/journal. which have different chemical characteristics and have distinct modes of metabolic action in pone.0196425 teleost. Six hours after intraperitoneal injection with BPS (50 mg/kg bw) or BaP (20 mg/kg Editor: Cheryl S.
    [Show full text]
  • Transcriptome-Wide Association Analysis of 211 Neuroimaging Traits
    1 Transcriptome-wide association analysis of 211 neuroimaging traits identifies new 2 genes for brain structures and yields insights into the gene-level pleiotropy with other 3 complex traits 4 5 Running title: TWAS of brain structures 6 7 Bingxin Zhao1,6, Yue Shan1,6, Yue Yang1, Tengfei Li2,3, Tianyou Luo1, Ziliang Zhu1, Yun 8 Li*1,4,5,7, and Hongtu Zhu*1,3,7 9 10 1Department of Biostatistics, University of North Carolina at Chapel Hill, Chapel Hill, NC, 11 USA 12 2Department of Radiology, University of North Carolina at Chapel Hill, Chapel Hill, NC, 13 USA 14 3Biomedical Research Imaging Center, School of Medicine, University of North Carolina 15 at Chapel Hill, Chapel Hill, NC, USA 16 4Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC, 17 USA 18 5Department of Computer Science, University of North Carolina at Chapel Hill, Chapel 19 Hill, NC, USA 20 6 These authors contributed equally: Bingxin Zhao, Yue Shan. 21 7 These authors jointly supervised this Work: Yun Li, Hongtu Zhu. 22 *Corresponding authors: 23 Yun Li 24 5090 Genetic Medicine Building, 120 Mason Farm Road, Chapel Hill, NC 27599. 25 E-mail address: [email protected] Phone: (919) 843-2832 26 27 Hongtu Zhu 28 3105C McGavran-Greenberg Hall, 135 Dauer Drive, Chapel Hill, NC 27599. 29 E-mail address: [email protected] Phone: (919) 966-7250 30 31 List of Alzheimer's Disease Neuroimaging Initiative (ADNI) and Pediatric Imaging, 32 Neurocognition and Genetics (PING) authors provided in the supplemental materials. 1 1 Abstract 2 Structural and microstructural variations of human brain are heritable and highly 3 polygenic traits, With hundreds of associated genes founded in recent genome-wide 4 association studies (GWAS).
    [Show full text]
  • A Potent Cas9-Derived Gene Activator for Plant and Mammalian Cells
    LETTERS https://doi.org/10.1038/s41477-017-0046-0 A potent Cas9-derived gene activator for plant and mammalian cells Zhenxiang Li1, Dandan Zhang1, Xiangyu Xiong1, Bingyu Yan1, Wei Xie1,2, Jen Sheen3 and Jian-Feng Li 1,2,4* Overexpression of complementary DNA represents the most presumably by promoting the transcription initiation of the sgRNA commonly used gain-of-function approach for interrogat- by the U6 promoter. Therefore, we routinely add a G to the 5′ end ing gene functions and for manipulating biological traits. of sgRNAs when the target sequences start with a non-G nucleotide. However, this approach is challenging and inefficient for Although multiple sgRNAs tiling the proximal promoter of the multigene expression due to increased labour for cloning, target gene can synergistically boost the dCas9–VP64-mediated limited vector capacity, requirement of multiple promoters gene activation7–9,12–15, this strategy reduces the scalability of the sys- and terminators, and variable transgene expression levels. tem2 and may increase the risk of dCas9-mediated transcriptional Synthetic transcriptional activators provide a promising alter- perturbation at off-target non-promoter loci15–17. Therefore, we native strategy for gene activation by tethering an autono- sought to devise and screen for an improved dCas9–TAD (Fig. 1a) mous transcription activation domain (TAD) to an intended that would allow potent transcriptional activation of target genes gene promoter at the endogenous genomic locus through a using only a single sgRNA, thus maximizing the system’s scalabil- programmable DNA-binding module. Among the known cus- ity. As the first step, we modified dCas9–VP64 by adding additional tom DNA-binding modules, the nuclease-dead Streptococcus VP64 moieties (Supplementary Sequences).
    [Show full text]