Am J Transl Res 2021;13(3):1365-1376 www.ajtr.org /ISSN:1943-8141/AJTR0112306 Original Article LncRNA OSER1-AS1 interacts with miR-612/FOXM1 axis to modulate gefitinib resistance of lung adenocarcinoma Tingting Shi1, Weijuan Sun1, Yan-Long Shi1, Qiang Wang1, Ze-Xuan Yan2, Mei Zhang3 1Department of Oncology, 960th Hospital of PLA, Jinan, China; 2Institute of Pathology and Southwest Cancer Center, Southwest Hospital, Army Medical University, Chongqing, China; 3Department of Cerebral Surgery, 960th Hospital of PLA, Jinan, China Received April 10, 2020; Accepted December 30, 2020; Epub March 15, 2021; Published March 30, 2021 Abstract: Long noncoding RNAs (lncRNAs) play crucial roles in the acquired resistance to EGFR-directed therapies in lung cancer. LncRNA OSER1-AS1 has been reported to promote tumorigenesis of hepatocellular carcinoma. However, its functions and underlying molecular mechanisms remain unclear in the acquired gefitinib-resistance of lung cancer. Our study revealed that increased expression of OSER1-AS1 was correlated with gefitinib resistance in lung adenocarcinoma. Higher OSER1-AS1 expression predicted disease progression of lung adenocarcinoma patients. The in vitro assays indicated OSER1-AS1 contributed to gefitinib resistance of lung adenocarcinoma cells via inhibiting cell apoptosis and cell cycle arrest. In vivo experiments showed that the knockdown of OSER1-AS1 restored the sensitivity of lung cancer cells to gefitinib. Further studies showed that OSER1-AS1 functioned as a molecular sponge of miR-612. OSER1-AS1 down-regulated miR-612 to increase FOXM1 expression, suggesting that miR-612/FOXM1 axis was regulated by OSER1-AS1, which was partially responsible for gefitinib resistance of lung adenocarcinoma. In conclusion, OSER1-AS1 promoted gefitinib resistance of lung adenocarcinoma through the miR-612/FOXM1 axis. Keywords: LncRNA OSER1-AS1, lung adenocarcinoma, gefitinib, miR-612, FOXM1 Introduction they could not be directly translated into pro- teins [5]. Various mechanisms were involved in Non-small-cell lung cancer (NSCLS) is globally the lncRNAs regulated process, such as spong- the most frequent subtype of lung cancer, ing microRNA (miRNA) as competitive endoge- which is also featured withhigh cancer-associ- nous RNA (ceRNA) [6]. Previous investigation ated mortalities [1]. Studies identified the onco- also indicated that some lncRNAs were involved genic role of EGFR in the development and pro- in gefitinib resistance of lung cancer [7]. For gression of lung cancer [2]. Then EGFR-tyrosine instance, lncRNA MALAT1/ZEB1 axis promotes kinase inhibitors (TKIs) were developed and EGFR-TKI resistance through epithelial-to-mes- emerged as one of the most promising option enchymal transition (EMT) regulation [8]. Fur- for lung cancer, especially lung adenocarcino- ther studies for lncRNA in the regulation of TKI ma with EGFR-activating mutations [3]. How- resistance will contribute to the development ever, clinical resistance impeded the long-term of novel strategies to improve therapeutic therapeutic efficiency of TKIs [4]. Thus, further efficiency. investigation of the mechanism underlying TKI resistance is essential for improving the prog- Recent study identified lncRNA OSER1-AS1 pro- nosis of lung adenocarcinoma patients. moted tumorigenesis of hepatocellular carci- noma, which was correlated with its competi- Long non-coding RNAs (lncRNAs) showed criti- tion with miR-372-3p/Rab23 axis [9]. We also cal roles in the regulation of carcinogenesis observed increased OSER1-AS1 expression in and progression of human cancer, although gefitinib resistance of lung adenocarcinoma. OSER1-AS1 promotes gefitinib resistance However, the role of OSER1-AS1 was still un- DH: For, 5’-GGGAGCCAAAAGGGTCAT-3’, Rev, known in lung adenocarcinoma. In present stu- 5’-GAGTCCTTCCACGATACCAA-3’; miR-612: For, dy, we explored the biological role of OSER1- 5’-GCAGGGCTTCTGAGCTCCTTAA-3’; Rev, 5’-GC- AS1 in gefitinib resistance of lung adenocarci- GAGCACAGAATTAATACGAC; U6: For, 5’-CTCGCT- noma. Detailed molecular mechanism was also TCGGCAGCAGCACATATA-3’, Rev, 5’-AAATATGG- studied in the regulation of miR-612/Forkhead AACGCTTCACGA-3’. box M1 (FOXM1) axis by OSER1-AS1. RNA oligoribonucleotides and cell transfection Materials and methods The plasmids of OSER1-AS1 overexpressing or TCGA dataset analysis silencing (shOSER1) were designed and syn- thesized by GeneChem (Shanghai, China). The We collected the RNA-seq data and clinical small interfering RNA against FOXM1, and miR- data of the lung adenocarcinoma patients from 612 mimics were synthesized by Gene Pharma The Cancer Genome Atlas (TCGA) database (Shanghai, China). Cells were transfected with website (http://cancergenome.nih.gov/). The Lipofectamine 3000 (Invitrogen, Paisley, UK). statistical analysis for the correlations with Cells transfection efficiency was evaluated with clinical characteristics were performed with RT-qPCR assays 48 h after transfection. GraphPad 8. Receiver Operator Characteristic Curve (ROC) and Kaplan-Meier survival curves Cell proliferation assays were analyzed for the prognostic value of OSER1-AS1. Cell Counting Kit-8 (CCK-8) was purchased for Beyotime (Shanghai, China). Totally 5000 cells Cell culture were planted in 96-well plates and treated with The lung adenocarcinoma cell lines (A549, 0.1 μM gefitinib. We added 10 μl CCK-8 reagent H1299 and SPCA1) and normal bronchial epi- into each well and incubated for 2 h at 37°C. thelial cells (16HBE) were purchased from ATCC Then cell proliferation was measured with the (Rockville, MD). Cells were cultured in DMEM absorption at 450 nm using a microplate read- (Gibco, Grand Island, NY) supplemented with er (Tecan, Switzerland). 10% fetal bovine serum (HyClone, Logan, UT), Flowcytometry analysis for cell cycle and apop- and maintained in the 5% CO and 37°C incu- 2 tosis bator. Gefitinib resistant A549 cells (A549/GR) were generated by continual gefitinib treatment Flow cytometry analysis was performed with a for nine months. FACS Calibur (BD Biosciences, CA). For the cell Reverse transcription-quantitative polymerase cycle analysis, gefitinib treated cells were col- chain reaction (RT-qPCR) assay lected and fixed with 75% cold ethanol over- night. Cells were stained with PI and RNase Total RNA extraction was performed with Trizol solution form Cell Cycle and Apoptosis Analys- reagent (Takara, Japan), and reverse transcrip- is Kit (C1052, Beyotime). For the analysis of tion was performed with AMV reverse transcrip- cell apoptosis, all collected cells were stained tase (Takara, Otsu, Japan) and RevertAid™ H with Annexin V-FITC Apoptosis Detection Kit Minus First Strand cDNA Synthesis Kit (Takara). (C1062S, Beyotime). Cell cycle distributions SYBR PrimeScript RT-PCR kit (Takara) was used and cell apoptosis were analyzed with FlowJo for real-time PCR in BioRad CFX96 Sequence 10 software (Tree Star, San Carlos, CA). Detection System (BioRad company, Berkeley, CA). GAPDH and U6 were used as gene or Tumorigenesis assays microRNA internal control. The primers were synthesized by RiboBio (Guangzhou, China), The tumorigenesis assays were authorized by and the sequences are shown as follows: the animal center of PLA 960th Hospital. BALB/c OSER1-AS1: For, 5’-AATCACTGCAATTGAAGGAA- nude mice were randomly grouped with shOS- AAA-3’, Rev, 5’-CCTTGTTTTCCAACCCTTAGACT- ER1 and control groups (n = 6 each group). 3’; FOXM1: For, 5’-CGTCGGCCACTGATTCTCAAA- Stably infected cells were implanted at the right 3’, Rev, 5’-GGCAGGGGATCTCTTAGGTTC-3’; GAP- flank of the mice. Oral gavage gefitinib treat- 1366 Am J Transl Res 2021;13(3):1365-1376 OSER1-AS1 promotes gefitinib resistance ment was performed after 15 days of xenograft comparison within groups were analyzed with implantation, which were administrated with student’s t-test or one-way ANOVA. The corre- 25 mg/kg in 1% Tween 80 (Sigma, St Louis, lation of RNA expression was analyzed with MO). Tumor volumes were measured every five Pearson correlation test. P < 0.05 were consid- days with the formula: Volume = length * ered statistically significant. width2/2. The mice were sacrificed on the 30th day after implantation. The xenografts were Results excised and photographed. OSER1-AS1 was correlated with gefitinib resis- Immunohistochemistry (IHC) staining tance of lung adenocarcinoma IHC staining of the xenografts were perform- We initially assessed the expression of OSER1- ed as our previously study [10]. The primary AS1 in adenocarcinoma with the dataset from FOXM1 antibody was purchased from Abcam TCGA database. The results showed higher (ab232649, Cambridge, MA). OSER1-AS1 expression in tumor tissues than adjacent normal tissues (P = 0.015, Figure 1A). Luciferase activity analysis Patients with late clinical stage also showed higher levels of OSER1-AS1 than that with early Wild type and mutant OSER1-AS1 sequences stage (P = 0.001, Figure 1B). Notably, the pa- (as shown) were subcloned into the pGL3-basic tients with higher OSER1-AS1 expression show- luciferase reporter vector (Promega, Madison, ed worse response to gefitinib (2 years) Figure( WI). A549 cells were transfected with the lucif- 1C). ROC analysis indicated a prognostic value erase vector and miRNA mimics (miR-612) or of OSER1-AS1 in disease progression of lung negative control (NT). After cultured for 48 adenocarcinoma (cutoff value = 4.30, area un- hours, cells were lysed to measure the lucifer- der the curve = 0.666, P < 0.001, Figure 1D). ase activities with the Dual-Luciferase Reporter Kaplan-Meier analysis indicated