ANTICANCER RESEARCH 24: 1465-1468 (2004)

Pyroglutamyl-histidyl-glycine, the Endogenous Colon Mitosis Inhibitor, Regulates Cyclic AMP Level in Non-tumorigenic Colonic Epithelial Cells

WENCHE H. REICHELT1, JENS-GUSTAV H. IVERSEN2, JAN ERIK PAULSEN3, KJELL ELGJO4 and KARL L. REICHELT1

1Institute of Pediatric Research and 4Institute of Pathology, University of Oslo, The National Hospital, NO-0027 Oslo; 2Laboratory of Intracellular Signalling, Department of Physiology, NO-0317 Oslo; 3Department of Food Toxicology, Norwegian Institute of Public Health, NO-0403 Oslo, Norway

Abstract. Background: We have proposed that the mitosis gene expression of the proliferation-related genes c-fos and inhibiting peptide, pyroGlu-His-Gly (pEHG), a colon-specific egr-1 and the differentiation-related gene fosB (6,7). This negative feedback regulator of cell proliferation, works through a peptide is structurally similar to the thyrotropin-releasing G protein-coupled receptor (GPCR), as do many other hormone (TRH, pyroGlu-His-Pro-NH2) which binds to the G pyroglutamyl-peptides. Materials and Methods: Non-tumorigenic protein-coupled receptor (GPCR) thyrotropin-releasing YAMC (colon mucosa of Immorto mice), IMCE (Immorto-Min hormone receptor (TRH-R) (8). TRH-R activates Ca2+ mouse hybrid) and human hepatoma (HepG2) cell lines were release through G·q or G·11 (9,10) or regulates the level of exposed to pEHG. cAMP concentrations were measured with a cAMP through G·s or G·i (11,12). Many of the other protein binding assay, mRNA levels with real–time PCR and pyroglutamyl-containing peptides are also active by means of Ca2+ concentration with an inverted fluorescence microscope the GPCR pathway, as seen for: gonadotropin-releasing on Fura-2/AM-loaded cells. Results: pEHG (1 nM) increased hormone (13), adipokinetic hormone (14), fertilization the intracellular concentration of cAMP after 5-10 min in promoting peptide (15), neurotensin (16,17) and orexin A (18). YAMC cells, but not in HepG2 cells. No effect was seen on We therefore wanted to examine whether pEHG cytosolic Ca2+, or in the expression of the proliferation and stimulates gene expression by means of c-fos, egr-1 and differentiation regulatory genes c-fos, egr-1 or fosB in YAMC or fosB, and inhibits proliferation through binding a GPCR IMCE cells. Conclusion: pEHG stimulates the second and changing either cAMP or Ca2+. messenger cAMP, but has no effect on intracellular Ca2+ or the gene expression of c-fos, egr-1 or fosB. Materials and Methods

The mitosis inhibiting peptide, pyroGlu-His-Gly (pEHG), Cells and culture conditions. The epithelial cell lines derived from the isolated from mouse intestinal extracts (1), belongs to a group colon mucosa of Immorto mouse (young adult mouse colon, YAMC) of endogenous N-substituted growth-inhibiting oligopeptides and from an Immorto-Min mouse hybrid (Immorto-Min colonic with a high degree of tissue preference (2). This group of epithelium, IMCE) (obtained from Prof. R.D. Whitehead, Vanderbilt University, TN, USA) (19,20) were cultured at permissive temperature peptides is believed to be important in a tissue-specific negative (33ÆC) with 5 U/ml Á-interferon (Á-INF, Roche Diagnostics GmbH, feedback regulation of proliferation. Thus, pEHG inhibits Mannheim, Germany) in RPMI 1640 medium containing 10% FCS, proliferation of both normal mouse colon crypt epithelium (1), as described earlier (3). The human hepatoma cells (HepG2) (HB- colon non-tumourigenic epithelial cells (YAMC and IMCE) 8065, obtained from ATCC, Rockville, MD, USA) were cultured in a (3) and in human colon carcinoma cells (HT-29) in vitro (4) similar way, but at 37ÆC without Á-INF. The cells were seeded in and transplanted in vivo (5). In HT-29 cells, pEHG increased medium containing 1% FCS in 100-mm petri dishes (Costar Corporation, Cambridge, USA) 24 h before the start of the study.

Measurement of cytosol cyclic AMP. YAMC- (0.6 x 106 when seeded) Correspondence to: W.H. Reichelt, Institute of Pediatric Research, and HepG2-cells (2.5 x 106 when seeded) were stimulated with 1 nM University of Oslo, The National Hospital, NO-0027 Oslo, Norway. pEHG (Sigma Chemical, St. Louis, MO, USA), 10 ÌM forskolin Tel: +47 23072983, e-mail: [email protected] (Calbiochem, Darmstadt, Germany), or water (control) for 5-30 min. The cells were harvested and resuspended in 10 mM PIPES buffer Key Words: pEHG, cAMP, Ca2+, colonic epithelial cells. (Piperazine-N, N’-bis [2-ethanesulfonic acid] from Sigma Chemical),

0250-7005/2004 $2.00+.40 1465 ANTICANCER RESEARCH 24: 1465-1468 (2004)

Table I. cDNA specific primers for the genes which were analysed with real-time PCR.

Gene Sequence (5’→3’) Amplicon Acc.nr.$ egr-1 (+) CACCTGACCACAG*AGTCCTTTTC (-) CGAGTCGTTTGGCTGGGATA 86 bp NM_007913 c-fos (+) GATACACTCCAAGCG*GAGACAGAT (-) AGTTTTTCCTTCTCTTTCAGCAGATT 92 bp NM_010234 fos B (+) GAAGACCCCGAGAAGAGACA*CTTA (-) ACTTAGCTGCAGCCAGCTTGTT 87 bp NM_008036 GAPDH (+) CTGGAGAAACCT*GCCAAGTATGA (-) GCCCAAGATGCCCTTCAGT 81bp XM_194302

* Exon/Intron junction, the primers are then cDNA specific, (+) forward primer and (-) reverse primer, $ Acc.nr. GenBank Accession #

pH 7, containing 1 mM EDTA and 1 mM 3-isobutyl-1-methylxantine DNA synthesis assay. Cell growth was analysed by [methyl- (IBMX, from Calbiochem). Furthermore, the cells were sonicated 15 3H]thymidine incorporation, as earlier described (3). times for 1sec at 30 Ìm (Sonics Vibra Cell, Sonics & Materials Inc, Newtown, CT, USA), centrifuged at 15,000 rpm and the supernatants Statistics. Two-way ANOVA and Welch’s corrected t-test (two- stored at -70ÆC until assayed for intracellular cAMP using a protein tailed) were applied to evaluate the results. binding assay (21). Protein concentrations were determined by a BCA Protein Assay kit (Pierce, Rockford, IL, USA). Results Total RNA isolation and quantification with real-time polymerase chain reaction (PCR). YAMC cells (0.6 x 106 when seeded) were The colon mitosis-inhibiting peptide pEHG stimulates the incubated with 1 nM pEHG for 30 min, washed twice with intracellular level of cAMP at nanomolar concentrations after phosphate-buffered saline (PBS) and total RNA was isolated with 5 to 10 min (Figure 1). After 15 min the cAMP level was again the guanidinium isothiocyanate method (22). reduced to the control level. The Gs inhibitor cholera toxin cDNA-specific primers were designed using the Primer Express (CTX, 500 ng/ml, from Calbiochem) abrogated pEHG’s effect software version 1.5 (Applied Biosystems) and synthesised by on growth inhibition, when added 1 h before pEHG. The Eurogentec BEL SA (HERSTAL, Belgium) (see Table I). Total positive control forskolin (10 ÌM) stimulated the intracellular RNA was DNase I-treated, reverse transcribed and analysed with qPCRì Mastermix for Sybrì Green I (Eurogentec) (7). Each level of cAMP 75 times (75±55, p=0.0122, n=7) and sample was run in triplicate. The data are presented relative to the inhibited cell growth in YAMC cells by 45% (p=0.0036, n=8- gene expression of GAPDH, adjusting for unequal amounts of RNA. 9). pEHG had, however, no significant effect on the cAMP level in hepatoma cells (HepG2) (0.42-fold, p=0.222, n=5). Measurement of free cytosol Ca2+. For the experiments, approximately pEHG 0.1-10 nM had almost no effect on gene expression 3 2 4.4 x10 cells/cm were seeded in 10% FCS medium on glass cover of c-fos, egr-1 or fos-B (Table II). Only early growth response slips, coated for 1 h with 10 Ìg/ml fibronectin (Sigma Chemical, St. Louis, MO, USA) and grown for 24 h to sub-confluence. Cytosolic protein 1 (egr-1) was slightly up-regulated. pEHG (0.1 nM - free Ca2+ in single YAMC or IMCE cells was determined as 1 ÌM) had no effect at the examined time points on the 2+ previously described (23). Briefly, the cells were incubated for 45 min intracellular free Ca concentration in YAMC (Figure 2) or at room temperature with a solution of 5 ÌM Fura-2/AM (Teflabs, IMCE cells. However, bradykinin (200 nM), used as positive Austin, TX, USA), 0.25% DMSO and 0.025% Pluronic F-127 control, stimulated the intracellular concentration of Ca2+ (Molecular Probes, Eugene, OR, USA) in HSS (HEPES-buffered salt only seconds after application in both YAMC (Figure 1) and solution consisting of; 136 mM NaCl, 5 mM KCl, 1.2 mM MgCl2, 1.2 IMCE cells. mM CaCl2, 11 mM bacto-dextrose (Difco Laboratories, Detroit, MI, USA), 10 mM HEPES, pH 7.35). The cells were washed once and incubated in 400 Ìl HSS. Application of peptide to the cells was done Discussion by injecting 100 Ìl of an agonist, bradykinin, pEHG, or water (control), diluted in buffer, into the well. The Ca2+ imaging and The present study demonstrates that the colon mitosis- registration were performed as described in (24). The cytosol Ca2+ inhibiting peptide pEHG stimulates the intracellular level of concentration was calculated using the Grynkiewicz equation: cAMP at nanomolar concentrations after 5 to 10 min in 2+ [Ca ]= Kd‚(R-Rmin)/(Rmax-R). R is the ratio between fluorescence YAMC cells (Figure 1). pEHG’s effect on growth was intensity at 345 and 385 nm exitation. Rmin and Rmax signify the values of fura-2 calcium depletion and fura-2 calcium saturation, respectively. abrogated by the Gs inhibitor cholera toxin (CTX). This The calcium dissociation constant Kd of fura-2 is 224 nM and ‚ is the indicates that pEHG is bound to a G protein-coupled ratio of fluorescence between Ca2+-depleted and Ca2+-saturated fura- receptor (GPCR), like several other small pyroglutamyl- 2 at 385 nm excitation (25). peptides which activate G·s and adenylyl cyclase (AC). Most

1466 Reichelt et al: Colon Mitosis Inhibitor and Second Messengers

Table II. Gene expression of immediately early genes after 30-min exposure to pEHG (mean±SD).

[pEHG] (M) n egr-1 c-fos fosB

10-4 6 0.93±0.19 0.71±0.28 1.31±1.60 10-8 6 0.99±0.15 0.89±0.37 1.08±0.63 10-9 3 1.11±0.26 1.02±0.23 1.22±0.28 10-10 2 1.46±0.29 0.67±0.21 1.09±1.11 (p=0.009)

proliferation and differentiation like c-fos, egr-1 and fosB by pEHG in HT-29 cells (6,7), but not in YAMC cells. The promoter of all the three up-regulated genes, c-fos (28), egr- 1 (29) and fosB (30), contains a cAMP response element (CRE) -like motif. c-fos and egr-1 can both cause suppression Figure 1. The intracellular level of cyclic AMP is up-regulated after 5- to of cell growth (31) and stimulate proliferation (32,33). The 10- min incubation by 1 nM pEHG in YAMC cells (p<0.001, two-way reason for why pEHG stimulates gene expression of c-fos, ANOVA, n=5). egr-1 and fosB in HT-29 but not in YAMC cells has to be studied further. pEHG increases the cAMP concentration in the colon cell line YAMC, but has no effect on the hepatoma cells HepG2. This corroborates earlier results showing that pEHG is relatively cell-type/tissue-specific and has no effect on forestomach, ileal epithelium (34), spleen lymphocytes (35), or pituitary cell proliferation (36). In conclusion, the colon mitosis-inhibiting peptide pEHG stimulates production of the second messenger cAMP, most probably through a G protein-coupled receptor (GPCR), Gs· and adenylyl cyclase (AC). This effect of pEHG can account for its mitosis-inhibiting effect in colon epithelial cells.

Acknowledgements

We want to thank "The Mary and Robert Cade Foundation", Gainsville, FLA, USA for economic support. Additionally we thank Figure 2. The intracellular level of Ca2+ concentration in single cells after incubation by 1 nM pEHG (dotted line) or 200 nM bradykinin (full line) the engineers Kristin L. Sand and Torunn Flatebø for their help 2+ for various time points (0-300sec). with Ca measuring and Kristin A. Taskén, PhD and Håkon Ramberg at the Oslo Urological University Clinic, Aker University Hospital, Norway, for their help with cAMP measurements. of the pyroglutamyl-peptides are also signal molecules acting References through a GPCR and affect the second messenger cAMP and/or Ca2+ (8-12). This paper represents the first study that 1 Skraastad O, Fossli T, Edminson PD and Reichelt KL: Purification and characterisation of a mitosis inhibitory tripeptide demonstrates that even pEHG follows this trend, but earlier from mouse intestinal extracts. Epithelia 1: 107-119, 1987. studies have shown that cAMP probably is involved in the 2 Elgjo K, Reichelt KL and Gembitsky DS: Growth-inhibiting N- effect of the similar epidermal pentapeptide (26,27). substituted endogenous peptides. Progr Mol Subcell Biol 20: cAMP/PKA can arrest cells in G2 and inhibit growth by 143-159, 1998. inactivating cyclinB/CDK through inhibiting a MAP kinase 3 Reichelt WH, De Angelis PM, Knutsen HK, Husøy T, Elgjo K pathway, inhibiting the poly kinase-dependent activation of and Reichelt KL: The colon mitosis inhibitor pyroglutamyl- cdc25, or reducing the half-life of cyclin B1 protein. histidyl-glycine inhibits growth of non-tumorigenic colonic epithelial cells. Anticancer Res 24: 587-592, 2004. pEHG tends to have a stronger inhibitory effect on 4 Skraastad O and Reichelt KL: An endogenous colon mitosis proliferation in the colon carcinoma cells HT-29 (4) than in inhibitor reduces proliferation of colon carcinoma cells (HT 29) the non-tumorigenic YAMC and IMCE cells (3). This can be in serum-restricted medium. Virchows Arch B Cell Pathol Incl related to an induction of genes involved in regulation of Mol Pathol 56: 393-396, 1989.

1467 ANTICANCER RESEARCH 24: 1465-1468 (2004)

5 Paulsen JE: The synthetic colon peptide pyroGlu-His-GlyOH 21 Brown BL, Albano JD, Ekins RP and Sgherzi AM: A simple and inhibits growth of human colon carcinoma cells (HT-29) sensitive saturation assay method for the measurement of adenosine transplanted subcutaneously into athymic mice. Carcinogenesis 14: 3':5'-cyclic monophosphate. Biochem J 121: 561-562, 1971. 1719-1721, 1993. 22 Chomczynski P and Sacchi N: Single-step method of RNA 6 Reichelt WH, Liu Y, Luna L, Elgjo K and Reichelt KL: Early isolation by acid guanidinium thiocyanate- phenol-chloroform oncogene mRNA expression in HT-29 cells treated with the extraction. Anal Biochem 162: 156-159, 1987. endogenous colon mitosis inhibitor pyroglutamyl-histidyl-glycine. 23 Røttingen JA, Enden T, Camerer E, Iversen JG and Prydz H: Anticancer Res 22: 991-996, 2002. Binding of human factor VIIa to tissue factor induces cytosolic 7 Reichelt WH, Yndestad A, Wright MS, Elgjo K, Haug T and Ca2+ signals in J82 cells, transfected COS-1 cells, Madin-Darby Reichelt KL: The colon mitosis-inhibitor pyroglutamyl-histidyl- canine kidney cells and in human endothelial cells induced to glycine alters expression of immediate-early cancer-related genes synthesize tissue factor. J Biol Chem 270: 4650-4660, 1995. in HT-29 cells. Anticancer Res 23: 1229-1234, 2003. 24 Røtnes JS and Iversen JG: Thapsigargin reveals evidence for 8 Gershengorn MC and Osman R: Molecular and cellular biology fMLP-insensitive calcium pools in human leukocytes. Cell of thyrotropin-releasing hormone receptors. [Review]. Physiol Calcium 13: 487-500, 1992. Rev 76: 175-191, 1996. 25 Grynkiewicz G, Poenie M and Tsien RY: A new generation of 9 Aragay AM, Katz A and Simon MI: The G alpha q and G alpha Ca2+ indicators with greatly improved fluorescence properties. 11 proteins couple the thyrotropin-releasing hormone receptor J Biol Chem 260: 3440-3450, 1985. to phospholipase C in GH3 rat pituitary cells. J Biol Chem 267: 26 Elgjo K: Epidermal chalone and cyclic AMP: an in vivo study. J 24983-24988, 1992. Invest Dermatol 64: 14-18, 1975. 10 Hsieh KP and Martin TF: Thyrotropin-releasing hormone and 27 Elgjo K and Reichelt KL: Beta-receptor blockade by propranolol gonadotropin-releasing hormone receptors activate phospholipase modifies the effect of the inhibitory, endogenous epidermal C by coupling to the guanosine triphosphate-binding proteins Gq pentapeptide on epidermal cell flux at the G2-M transition but not and G11. Mol Endocrinol 6: 1673-1681, 1992. at the G1-S transition. Epithelial Cell Biol 3: 32-37, 1994. 11 Paulssen EJ, Paulssen RH, Gautvik KM and Gordeladze JO: 28 Hartig E, Loncarevic IF, Buscher M, Herrlich P and Rahmsdorf Hypothalamic hormones modulate G protein levels and second HJ: A new cAMP response element in the transcribed region of messenger responsiveness in GH3 rat pituitary tumour cells. the human c-fos gene. Nucleic Acids Res 19: 4153-4159, 1991. Biochem Pharmacol 44: 471-477, 1992. 29 Sakamoto KM, Bardeleben C, Yates KE, Raines MA, Golde DW 12 Paulssen RH Paulssen EJ, Gautvik KM and Gordeladze O: The and Gasson JC: 5' upstream sequence and genomic structure of thyroliberin receptor interacts directly with a stimulatory guanine- the human primary response gene, EGR-1/TIS8. Oncogene 6: nucleotide-binding protein in the activation of adenylyl cyclase in GH3 867-871, 1991. rat pituitary tumour cells. Evidence obtained by the use of antisense 30 Andersson M, Konradi C and Cenci MA: cAMP response RNA inhibition and immunoblocking of the stimulatory guanine- element-binding protein is required for dopamine-dependent nucleotide- binding protein. Eur J Biochem 204: 413-418, 1992. gene expression in the intact but not the dopamine-denervated 13 Gershengorn MC and Osman R: Minireview: Insights into G striatum. J Neurosci 21: 9930-9943, 2001. protein-coupled receptor function using molecular models. 31 Liebermann DA and Hoffman B: MyD genes in negative growth Endocrinology 142: 2-10, 2001. control. Oncogene 17: 3319-3329, 1998. 14 Vroemen SF, Van der Horst DJ and Van Marrewijk WJ: New 32 Holt JT, Gopal TV, Moulton AD and Nienhuis AW: Inducible insights into adipokinetic hormone signaling. Mol Cell production of c-fos antisense RNA inhibits 3T3 cell proliferation. Endocrinol 141: 7-12, 1998. Proc Natl Acad Sci USA 83: 4794-4798, 1986. 15 Fraser LR: Fertilization promoting peptide: an important regulator 33 Svaren J, Sevetson BR, Apel ED, Zimonjic DB, Popescu NC and of sperm function in vivo? Rev Reprod 3: 151-154, 1998. Milbrandt J: NAB2, a corepressor of NGFI-A (Egr-1) and 16 Osadchii OE and Pokrovskii VM: The effect of neurotensin on Krox20, is induced by proliferative and differentiative stimuli. the cardiovascular system. Usp Fiziol Nauk 29: 39-54, 1998. Mol Cell Biol 16: 3545-3553, 1996. 17 Souaze F: Maintaining cell sensitivity to G-protein coupled 34 Skraastad O and Reichelt KL: Further studies on the biological receptor agonists: neurotensin and the role of receptor gene characteristics of an endogenous colon mitosis inhibitor: activation. J Neuroendocrinol 13: 473-479, 2001. comparison with some structurally related peptides. Virchows 18 Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Arch B Cell Pathol Incl Mol Pathol 56: 321-325, 1989. Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, 35 Kunert RJ, Pawlikowski M, Stepien H and Janecka A: Inhibitory Arch JR, Buckingham RE, Haynes AC, Carr SA, Annan RS, effect of thyrotropin releasing hormone on spontaneous McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ proliferation of mouse spleen lymphocytes in vitro. Biochem and Yanagisawa M: Orexins and orexin receptors: a family of Biophys Res Commun 181: 562-565, 1991. hypothalamic neuropeptides and G protein-coupled receptors that 36 Pawlikowski M and Slowinska KD: Effects of TRH and TRH-like regulate feeding behavior. Cell 92: 573-585, 1998. peptides on anterior pituitary cell proliferation in rats. Cytobios 19 Whitehead RH, VanEeden PE, Noble MD, Ataliotis P and Jat 79: 117-122, 1994. PS: Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2Kb-tsA58 transgenic mice. Proc Natl Acad Sci USA 90: 587-591, 1993. 20 Whitehead RH and Joseph JL: Derivation of conditionally immortalized cell lines containing the Min mutation from the Received January 5, 2004 normal colonic mucosa and other tissues of an "Immortomouse"/Min Revised February 18, 2004 hybrid. Epithelial Cell Biol 3: 119-125, 1994. Accepted April 1, 2004

1468