On the History of the Green Monkey Chlorocebus Sabaeus (L., 1766) in the Cape Verde Islands, with Notes on Other Introduced Mammals
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Monkeys, Apes and Human Identity in the Early American Republic Brett Mizelle University Ofminnesota
"Man Cannot Behold It Without Contemplating Himself": Monkeys, Apes and Human Identity in the Early American Republic Brett Mizelle University ofMinnesota While seeking refuge in Germantown from the yellow fever epidemic that plagued Philadelphia in the summer of 1793, Elizabeth Drinker and her friends encountered a man traveling through the town "with something in a barrel to Show which he said was half man, half beast." Although Drinker wrote that the proprietor of this animal exhibition "call'd it a Man[de]," she "believe[d] it was a young Baboon." Intrigued by the possibility of observing first hand a creature that supposedly blurred the boundary between the human and the animal, Drinker and her party "paid 5 l/2 [pence] for seeing it." After examin- ing this creature, however, Drinker noted that she was disturbed by this exhi- bition, concluding that the baboon "look'd sorrowful, I pity'd the poor thing, and wished it in its own Country."' The exhibitor's marketing of this exotic animal as "half man, half beast" and Drinker's positive feelings for this captive creature both depended upon an imagined resemblance between this baboon and human beings. While the proprietor exaggerated and manipulated this resemblance to sell his animal as a hybrid, threshold creature, Drinker similarly drew upon resemblance when she felt sorry for "the poor thing." The idea of resemblance seen here in both the exploitation of and sympathy for this baboon emerges, Thierry Lenain argues, because "a series of common features-general physical appearance, plus some striking details of the appearance and some behavioral features- immediately link monkeys with men in the imagination." These analogies are exaggerated and multiplied as Numerous human characteristics are displayed in the monkey's physiognomy and movements, eliciting a reaction of the 'it almost looks' type, and the onlooker spontaneously seeks signals that endorse this reaction, ignoring characteristics and features that are peculiar to the animal alone. -
Table S1. Nakharuthai and Srisapoome (2020)
Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P. -
Mouse Models of Human Disease an Evolutionary Perspective Robert L
170 commentary Evolution, Medicine, and Public Health [2016] pp. 170–176 doi:10.1093/emph/eow014 Mouse models of human disease An evolutionary perspective Robert L. Perlman* Department of Pediatrics, The University of Chicago, 5841 S. Maryland Ave, MC 5058, Chicago, IL 60637, USA *E-mail: [email protected] Received 31 December 2015; revised version accepted 12 April 2016 ABSTRACT The use of mice as model organisms to study human biology is predicated on the genetic and physio- logical similarities between the species. Nonetheless, mice and humans have evolved in and become adapted to different environments and so, despite their phylogenetic relatedness, they have become very different organisms. Mice often respond to experimental interventions in ways that differ strikingly from humans. Mice are invaluable for studying biological processes that have been conserved during the evolution of the rodent and primate lineages and for investigating the developmental mechanisms by which the conserved mammalian genome gives rise to a variety of different species. Mice are less reliable as models of human disease, however, because the networks linking genes to disease are likely to differ between the two species. The use of mice in biomedical research needs to take account of the evolved differences as well as the similarities between mice and humans. KEYWORDS: allometry; cancer; gene networks; life history; model organisms transgenic, knockout, and knockin mice, have If you have cancer and you are a mouse, we can provided added impetus and powerful tools for take good care of you. Judah Folkman [1] mouse research, and have led to a dramatic increase in the use of mice as model organisms. -
Micromys Minutus)
Acta Theriol (2013) 58:101–104 DOI 10.1007/s13364-012-0102-0 SHORT COMMUNICATION The origin of Swedish and Norwegian populations of the Eurasian harvest mouse (Micromys minutus) Lars Råberg & Jon Loman & Olof Hellgren & Jeroen van der Kooij & Kjell Isaksen & Roar Solheim Received: 7 May 2012 /Accepted: 17 September 2012 /Published online: 29 September 2012 # Mammal Research Institute, Polish Academy of Sciences, Białowieża, Poland 2012 Abstract The harvest mouse (Micromys minutus) occurs the Mediterranean, from France to Russia and northwards throughout most of continental Europe. There are also two to central Finland (Mitchell-Jones et al. 1999). Recently, isolated and recently discovered populations on the it has also been found to occur in Sweden and Norway. Scandinavian peninsula, in Sweden and Norway. Here, we In 1985, an isolated population was discovered in the investigate the origin of these populations through analyses province of Dalsland in western Sweden (Loman 1986), of mitochondrial DNA. We found that the two populations and during the last decade, this population has been on the Scandinavian peninsula have different mtDNA found to extend into the surrounding provinces as well haplotypes. A comparison of our haplotypes to published as into Norway. The known distribution in Norway is sequences from most of Europe showed that all Swedish and limited to a relatively small area close to the Swedish Norwegian haplotypes are most closely related to the border, in Eidskog, Hedmark (van der Kooij et al. 2001; haplotypes in harvest mice from Denmark. Hence, the two van der Kooij et al., unpublished data). In 2007, another populations seem to represent independent colonisations but population was discovered in the province of Skåne in originate from the same geographical area. -
Proposal for Inclusion of the Chimpanzee
CMS Distribution: General CONVENTION ON MIGRATORY UNEP/CMS/COP12/Doc.25.1.1 25 May 2017 SPECIES Original: English 12th MEETING OF THE CONFERENCE OF THE PARTIES Manila, Philippines, 23 - 28 October 2017 Agenda Item 25.1 PROPOSAL FOR THE INCLUSION OF THE CHIMPANZEE (Pan troglodytes) ON APPENDIX I AND II OF THE CONVENTION Summary: The Governments of Congo and the United Republic of Tanzania have jointly submitted the attached proposal* for the inclusion of the Chimpanzee (Pan troglodytes) on Appendix I and II of CMS. *The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CMS Secretariat (or the United Nations Environment Programme) concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author. UNEP/CMS/COP12/Doc.25.1.1 PROPOSAL FOR THE INCLUSION OF CHIMPANZEE (Pan troglodytes) ON APPENDICES I AND II OF THE CONVENTION ON THE CONSERVATION OF MIGRATORY SPECIES OF WILD ANIMALS A: PROPOSAL Inclusion of Pan troglodytes in Appendix I and II of the Convention on the Conservation of Migratory Species of Wild Animals. B: PROPONENTS: Congo and the United Republic of Tanzania C: SUPPORTING STATEMENT 1. Taxonomy 1.1 Class: Mammalia 1.2 Order: Primates 1.3 Family: Hominidae 1.4 Genus, species or subspecies, including author and year: Pan troglodytes (Blumenbach 1775) (Wilson & Reeder 2005) [Note: Pan troglodytes is understood in the sense of Wilson and Reeder (2005), the current reference for terrestrial mammals used by CMS). -
A Guide to Mites
A GUIDE TO MITES concentrated in areas where clothes constrict the body, or MITES in areas like the armpits or under the breasts. These bites Mites are arachnids, belonging to the same group as can be extremely itchy and may cause emotional distress. ticks and spiders. Adult mites have eight legs and are Scratching the affected area may lead to secondary very small—sometimes microscopic—in size. They are bacterial infections. Rat and bird mites are very small, a very diverse group of arthropods that can be found in approximately the size of the period at the end of this just about any habitat. Mites are scavengers, predators, sentence. They are quite active and will enter the living or parasites of plants, insects and animals. Some mites areas of a home when their hosts (rats or birds) have left can transmit diseases, cause agricultural losses, affect or have died. Heavy infestations may cause some mites honeybee colonies, or cause dermatitis and allergies in to search for additional blood meals. Unfed females may humans. Although mites such as mold mites go unnoticed live ten days or more after rats have been eliminated. In and have no direct effect on humans, they can become a this area, tropical rat mites are normally associated with nuisance due to their large numbers. Other mites known the roof rat (Rattus rattus), but are also occasionally found to cause a red itchy rash (known as contact dermatitis) on the Norway rat, (R. norvegicus) and house mouse (Mus include a variety of grain and mold mites. Some species musculus). -
A Phylogeographic Survey of the Pygmy Mouse Mus Minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome B Sequences of Museum Specimens
A Phylogeographic Survey of the Pygmy Mouse Mus minutoides in South Africa: Taxonomic and Karyotypic Inference from Cytochrome b Sequences of Museum Specimens Pascale Chevret1*, Terence J. Robinson2, Julie Perez3, Fre´de´ric Veyrunes3, Janice Britton-Davidian3 1 Laboratoire de Biome´trie et Biologie Evolutive, UMR CNRS 5558, Universite´ Lyon 1, Villeurbanne, France, 2 Evolutionary Genomics Group, Department of Botany and Zoology, University of Stellenbosch, Stellenbosch, South Africa, 3 Institut des Sciences de l’Evolution de Montpellier, UMR CNRS 5554, Universite´ Montpellier 2, Montpellier, France Abstract The African pygmy mice (Mus, subgenus Nannomys) are a group of small-sized rodents that occur widely throughout sub- Saharan Africa. Chromosomal diversity within this group is extensive and numerous studies have shown the karyotype to be a useful taxonomic marker. This is pertinent to Mus minutoides populations in South Africa where two different cytotypes (2n = 34, 2n = 18) and a modification of the sex determination system (due to the presence of a Y chromosome in some females) have been recorded. This chromosomal diversity is mirrored by mitochondrial DNA sequences that unambiguously discriminate among the various pygmy mouse species and, importantly, the different M. minutoides cytotypes. However, the geographic delimitation and taxonomy of pygmy mice populations in South Africa is poorly understood. To address this, tissue samples of M. minutoides were taken and analysed from specimens housed in six South African museum collections. Partial cytochrome b sequences (400 pb) were successfully amplified from 44% of the 154 samples processed. Two species were identified: M. indutus and M. minutoides. The sequences of the M. indutus samples provided two unexpected features: i) nuclear copies of the cytochrome b gene were detected in many specimens, and ii) the range of this species was found to extend considerably further south than is presently understood. -
Notes on Lagothrix Flavicauda (Primates: Atelidae): Oldest Known Specimen and the Importance of the Revisions of Museum Specimens
ZOOLOGIA 36: e29951 ISSN 1984-4689 (online) zoologia.pensoft.net SHORT COMMUNICATION Notes on Lagothrix flavicauda (Primates: Atelidae): oldest known specimen and the importance of the revisions of museum specimens José Eduardo Serrano-Villavicencio 1,2, Luís Fábio Silveira 3 1Programa de Pós-graduação em Mastozoologia, Museu de Zoologia, Universidade de São Paulo. Avenida Nazaré 481, Ipiranga, 04263-000 São Paulo, SP, Brazil. 2Centro de Investigación Biodiversidad Sostenible (BioS), Lima, Peru. 3Museu de Zoologia, Universidade de São Paulo. Avenida Nazaré 481, Ipiranga, 04263-000 São Paulo, SP, Brazil. Corresponding author: José Eduardo Serrano-Villavicencio ([email protected]) http://zoobank.org/B29AF1E9-F78A-475D-AF1F-3AECEBABA626 ABSTRACT. The yellow-tailed woolly monkey, Lagothrix flavicauda (Humboldt, 1812), is a large atelid endemic to the cloud forests of Peru. The identity of this species was uncertain for at least 150 years, since its original description in 1812 without a voucher specimen. Additionally, the absence of expeditions to the remote Peruvian cloud forests made it impossible to collect material that would help to confirm the true identity ofL. flavicauda during the 19th and first half of the 20th century. Until now, the specimens of L. flavicauda collected by H. Watkins, in 1925, in La Lejía (Amazonas, Peru) were thought to be the oldest ones deposited in any scientific collection. Nevertheless, after reviewing the databases of the several international museums and literature, we found one specimen of L. flavicauda deposited at the Muséum National d’histoire Naturelle (Paris, France) collected in 1900 by G.A. Baër, in the most eastern part of San Martín (Peru), where the presence of this species was not confirmed until 2011. -
Rats and Mice Have Always Posed a Threat to Human Health
Rats and mice have always posed a threat to human health. Not only do they spread disease but they also cause serious damage to human food and animal feed as well as to buildings, insulation material and electricity cabling. Rats and mice - unwanted house guests! RATS AND MICE ARE AGILE MAMMALS. A mouse can get through a small, 6-7 mm hole (about the diameter of a normal-sized pen) and a rat can get through a 20 mm hole. They can also jump several decimetres at a time. They have no problem climbing up the inside of a vertical sewage pipe and can fall several metres without injuring themselves. Rats are also good swimmers and can be underwater for 5 minutes. IN SWEDEN THERE ARE BASICALLY four different types of rodent that affect us as humans and our housing: the brown rat, the house mouse and the small and large field mouse. THE BROWN RAT (RATTUS NORVEGICUS) THRIVES in all human environments, and especially in damp environments like cellars and sewers. The brown rat is between 20-30 cm in length not counting its tail, which is about 15-23 cm long. These rats normally have brown backs and grey underbellies, but there are also darker ones. They are primarily nocturnal, often keep together in large family groups and dig and gnaw out extensive tunnel systems. Inside these systems, they build large chambers where they store food and build their nests. A pair of rats can produce between 800 and 1000 offspring a year. Since their young are sexually mature and can have offspring of their own at just 2-4 months old, rats reproduce extraordinarily quickly. -
Primate Occurrence Across a Human- Impacted Landscape In
Primate occurrence across a human- impacted landscape in Guinea-Bissau and neighbouring regions in West Africa: using a systematic literature review to highlight the next conservation steps Elena Bersacola1,2, Joana Bessa1,3, Amélia Frazão-Moreira1,4, Dora Biro3, Cláudia Sousa1,4,† and Kimberley Jane Hockings1,4,5 1 Centre for Research in Anthropology (CRIA/NOVA FCSH), Lisbon, Portugal 2 Anthropological Centre for Conservation, the Environment and Development (ACCEND), Department of Humanities and Social Sciences, Oxford Brookes University, Oxford, United Kingdom 3 Department of Zoology, University of Oxford, Oxford, United Kingdom 4 Department of Anthropology, Faculty of Social Sciences and Humanities, Universidade NOVA de Lisboa, Lisbon, Portugal 5 Centre for Ecology and Conservation, College of Life and Environmental Sciences, University of Exeter, Cornwall, United Kingdom † Deceased. ABSTRACT Background. West African landscapes are largely characterised by complex agroforest mosaics. Although the West African forests are considered a nonhuman primate hotspot, knowledge on the distribution of many species is often lacking and out- of-date. Considering the fast-changing nature of the landscapes in this region, up- to-date information on primate occurrence is urgently needed, particularly of taxa such as colobines, which may be more sensitive to habitat modification than others. Understanding wildlife occurrence and mechanisms of persistence in these human- dominated landscapes is fundamental for developing effective conservation strategies. Submitted 2 March 2018 Accepted 6 May 2018 Methods. In this paper, we aim to review current knowledge on the distribution of Published 23 May 2018 three threatened primates in Guinea-Bissau and neighbouring regions, highlighting Corresponding author research gaps and identifying priority research and conservation action. -
Mice Are Here to Stay
Mice A re Here to Stay Wherever people live, there are mice. It would be difficult to find another animal that has adapted to the habitats created by humans as well as the house mouse has. It thus seemed obvious to Diethard Tautz at the Max Planck Institute for Evolutionary Biology in Plön that the species would make an ideal model system for investigating how evolution works. BIOLOGY & MEDICINE_Evolution Mice A re Here to Stay TEXT CORNELIA STOLZE he mice at the Max Planck mice themselves only within a range of can be a key factor in the emergence of Institute in Plön live in their 30 to 50 centimeters, they convey high- new species. For Tautz, the house very own house: they have ly complex messages. mouse is a model for the processes of 16 rooms where they can Diethard Tautz and his colleagues evolution: it would be difficult to find form their family clans and have discovered that house mice be- another animal species that lends itself T territories as they see fit. The experi- have naturally only when they live in so well to the study of the genetic ments Tautz and his colleagues carry a familiar environment and interact mechanisms of evolution. out to study such facets as the rodents’ with other members of their species. “Not only is this species extremely communication, behavior and partner- When animals living in the wild are adaptable, as demonstrated by its dis- ships sometimes take months. During captured, they lose their familiar envi- persal all over the globe, but we also this time, the mice are largely left to ronment: everything smells and tastes know its genome better than that of al- their own devices. -
AFRICAN PRIMATES the Journal of the Africa Section of the IUCN SSC Primate Specialist Group
Volume 9 2014 ISSN 1093-8966 AFRICAN PRIMATES The Journal of the Africa Section of the IUCN SSC Primate Specialist Group Editor-in-Chief: Janette Wallis PSG Chairman: Russell A. Mittermeier PSG Deputy Chair: Anthony B. Rylands Red List Authorities: Sanjay Molur, Christoph Schwitzer, and Liz Williamson African Primates The Journal of the Africa Section of the IUCN SSC Primate Specialist Group ISSN 1093-8966 African Primates Editorial Board IUCN/SSC Primate Specialist Group Janette Wallis – Editor-in-Chief Chairman: Russell A. Mittermeier Deputy Chair: Anthony B. Rylands University of Oklahoma, Norman, OK USA Simon Bearder Vice Chair, Section on Great Apes:Liz Williamson Oxford Brookes University, Oxford, UK Vice-Chair, Section on Small Apes: Benjamin M. Rawson R. Patrick Boundja Regional Vice-Chairs – Neotropics Wildlife Conservation Society, Congo; Univ of Mass, USA Mesoamerica: Liliana Cortés-Ortiz Thomas M. Butynski Andean Countries: Erwin Palacios and Eckhard W. Heymann Sustainability Centre Eastern Africa, Nanyuki, Kenya Brazil and the Guianas: M. Cecília M. Kierulff, Fabiano Rodrigues Phillip Cronje de Melo, and Maurício Talebi Jane Goodall Institute, Mpumalanga, South Africa Regional Vice Chairs – Africa Edem A. Eniang W. Scott McGraw, David N. M. Mbora, and Janette Wallis Biodiversity Preservation Center, Calabar, Nigeria Colin Groves Regional Vice Chairs – Madagascar Christoph Schwitzer and Jonah Ratsimbazafy Australian National University, Canberra, Australia Michael A. Huffman Regional Vice Chairs – Asia Kyoto University, Inuyama,