DOCSLIB.ORG

Pseudogene HSPA7 Is a Poor Prognostic Biomarker in Kidney Renal Clear Cell Carcinoma (KIRC) and Correlated with Immune Infltrates

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pseudogene HSPA7 Is a Poor Prognostic Biomarker in Kidney Renal Clear Cell Carcinoma (KIRC) and Correlated with Immune Infltrates Pseudogene HSPA7 is a Poor Prognostic Biomarker in Kidney Renal Clear Cell Carcinoma (KIRC) and Correlated With Immune Inltrates Chunjin Ding Nantong University Aliated Hospital: Aliated Hospital of Nantong University Rundong He Nanjing Medical University Jinghan Zhang Nanjing Medical University Aliated Nanjing Children's Hospital: Children's Hospital of Nanjing Medical University Zhan Dong Nanjing Medical University Aliated Nanjing Children's Hospital: Children's Hospital of Nanjing Medical University Jun Wu ( [email protected] ) Nanjing Medical University https://orcid.org/0000-0001-6353-3013 Primary research Keywords: Kidney Renal Clear Cell Carcinoma (KIRC), HSPA7, immune, prognostic biomarker, tumor Posted Date: May 18th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-518429/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Cancer Cell International on August 19th, 2021. See the published version at https://doi.org/10.1186/s12935-021-02141-1. Page 1/21 Abstract Background: Pseudogenes played important roles in tumorigenesis, while there are nearly no reports about the expression and roles of HSPA7 in the cancer. Methods: Firstly,we used Logistic regression,the KS test, the GEPIA database, UALCAN database and qRT- PCR to analyze the level of HSPA7 expressed in KIRC,then we used the Cox regression and the Kaplan- Meier curve to analyze the overall survival(OS) of KIRC patients with different Clinico-pathological parameters. Thirdly, we used the multivariate Cox analysis of inuencing factors to compare the correlation between the HSPA7 expression level and the clinical parameters. Finally, we used multi-GSEA analysis and the Tumor Immunoassay Resource (TIMER) database to explore the functional role of HSPA7 in KIRC. Results: The HSPA7 is highly expressed in KIRC tumor tissues, and its expression is related to clinico- pathological features and survival in KIRCpatints.GSEA analysis displayed the high expression of HSPA7 in KIRC were related to several tumor-related and immune-related pathways. With the TIMER database analysis we showed that HSPA7 levels were correlated with the CD4+ T cells, neutrophils and Dendritic Cell. Conclusions: Our study showed that HSPA7 is very important in the tumor progression and may act as a poor prognostic biomarker for KIRC tumor by modulating immune inltrating cells. Introduction The morbidity of renal cell carcinoma (RCC) is about 4.2% of all newly-appeared cancer cases, which make RCC become one of the most frequent malignances worldwide. According to a recent survey, there were about 73,820 new cases of RCC and 14,770 deaths occurred in United States in 2019[1]. Kidney Renal Clear Cell Carcinoma (KIRC) is the most common kidney cancer subtype [2]. At present, the primary treatment of KIRC is surgery,while 30% of the patients who underwent surgery still experience metastasis[3], and the currently used drugs are not effective and have relatively great side effects. Early identication and diagnosis of KIRC patients can help with more precise clinical treatment. Therefore,it is urgent to discover new and reliable markers to predict the prognosis of patients. Pseudogenes are non-coding genes lacking of protein-coding ability, and were once labeled as junk genes. However, there is growing evidence that pseudogenes can inuence the regulatory mechanisms of many human cancers. [4]. And Pseudogene expression were treated as a novel marker and used in a variety of cancer types to stratify patients subtypes [5]and is therefore should taken into account in cancer survival prognostic factors.The HSPA7 (HSP70B) gene discovered in 1985 and encoded near the highly homologous HSPA6 (HSP70B') on chromosome 1, although mRNA can be expressed after thermal stimulation, it cannot transcribe a functional protein[6]. Numerous investigations have shown that HSPA6 plays an important role in multiple human cancers, including esophageal cancer[7, 8], glioma[9], lung cancer[10], hepatocellular carcinoma[11] and leukemia[12].However, little has been reported about the Page 2/21 expression and role of HSPA7 in cancer. Our study showed that high expression of HSPA7 can indicate the poor prognosis of KIRC. Our study examined the expression and prognostic value of HSPA7 in KIRC patients in the Cancer Genome Atlas (TCGA) and validated them in multiple independent cohorts. Moreover, GSEA[13] and Tumor Immunoassay Resource (TIMER) database[14] were used to assay the potential mechanisms of HSPA7 in KIRC. Our results implied that the functional role of HSPA7 in KIRC may through regulating immune cell inltration. Methods 2.1.Data Mining and Data Collection The KIRC data of TCGA consists of 72 normal tissues and 539 tumor samples,was acquired from the TCGA data portal (https://tcga-data.nci.nih.gov/tcga/). Clinical data pertaining to patients’ age, gender, survival, grade, stage, and recurred/progressed outcome were also acquired from the data portal. The dataset including mRNA expression counts and survival data with clinical information. The samples with missing expression data were excluded from the study.The dataset contains survival data with clinical information and mRNA expression counts. The samples with missing expression data were excluded from our study. 2.2.Data Analysis The R-3.6.2 project was used to analysis the acquired data.Firstly, we used the Logistic regression and the KS test to analyze the relation between the HSPA7 gene expression and Clinico-pathological features. Then we used the Cox regression and the Kaplan-Meier curve to analyze the overall survival of KIRC patients with different Clinico-pathological parameters from TCGA data. Finally, we used the multivariate Cox analysis of inuencing factors to compare the correlation between the HSPA7 expression level and the clinical parameters,such as age, gender grade, stage, T classication, N classication, and M classication, related to survival. The Cutoff Finder.2 was used to determine the cut-off value of HSPA7 expression. 2.3.Gene Set Enrichment Analysis (GSEA) Gene Set Enrichment Analysis (GSEA) is a computational method that determines whether an a priori dened set of genes shows statistically signicant between two biological expression states[13]. In our study, an ordered list of genes based on the pathways related to the HSPA7 expression level were generated by the GSEA,and then the signicant differences between the high and low-level expression groups of HSPA7 were annotated. The multi-GSEA results and signaling pathway enrichment analysis of phenotypes and were ranked by normalized enrichment score (NES) and the nominal p-value. 2.4. Analysis of TIMER database Page 3/21 The TIMER (https://cistrome.shinyapps.io/timer/) database is designed for analysing immune cell inltrates in multiple cancers. This database can estimate tumour immune inltration by macrophages, dendritic cells, CD4/CD8+ T cells, neutrophils , and B cells [15].We used the TIMER database to assess the HSPA7 different expression levels in particular tumours, and then we explored the correlation between HSPA7 expression level and the degree of inltration in particular immune cell subsets. We further explored the differences in patient survival as a function of gene expression or immune cell inltration by Kaplan-Meier curve analyses 2.5. Analysis of GEPIA and UALCAN database The GEPIA (http://gepia.cancer-pku.cn/index.html) databse and UALCAN (http://ualcan.path.uab.edu) databse can explored the association of mRNA expression level with overall survival(OS). We uesd these two database to explore the correlation between the HSPA7 expression and patient overall survival in KIRC. 2.6.RNA Extraction and qRT-PCR Analysiy RNA extraction and qRT-PCR were performed as the product manual described(Cat# R312-01, Cat# Q131- 02, Vazyme,China).The primers used in this study are purchased from Generay (Shanghai, China) and listed as follows. HSPA7-R: CATCCCCAAGGTGCAGAAGT HSPA7-F: ACCATCCTCTCCACCTCCTC GAPDH-R: GGGAGCCAAAAGGGTCAT GAPDH-F: GAGTCCTTCCACGATACCAA Results 3.1.Characteristics of the of the Patients 537 patients’ clinical data were acquired from TCGA, including the age, gender, Histological grade, TNM classication of KIRC(Table 1). 3.2.High HSPA7 mRNA Expression in KIRC First, we assessed the differences in HSPA7 expression between KIRC tumor tissues and adjacent tissues via differential expression scatter plots and paired difference analyses. We nd that the expression level of HSPA7 was signicantlly higher in KIRC tumor tissues (p=6.183e-35) and in paired cancer tissues(p=3.311e-18) compared with adjacent tissues(Figure 1A and 1B). Then, the expression level of HSPA7 in KIRC tumor tissues and adjacent tissues were veried by GEPIA[16] (Figures 1C) database, UALCAN database(Figures 1D)[17] and qRT-PCR analysis(Figures 1E) . Page 4/21 3.3. Correlation Between HSPA7 Expression level and Clinico-pathological featuresin KIRC tumors As the Table 2 shown the expression of HSPA7 was highly statistically signicantly correlated with clinical stage (p = 0.044) and distant metastasis (positive vs. negative, p = 0.049) . 3.4.Correlation Between KIRC patients Survival and HSPA7 Expression To evaluate the effect of HSPA7 expression on KIRC patients survival, the log-rank test and Kaplan-Meier survival analysis were used to estimate the correlation between HSPA7 expression and KIRC patients prognosis. The patients with high HSPA7 expression level displayed relatively poor survival (p=1.176e−04; Figure 2A). The clinical subgroup analysis implied that the patients in Histological grade (G1–2 vs. G3–4) , clinical stage(Stage I vs Stage IV), M classication and T classication (the T1–2 vs. T3–4) with HSPA7 expression also had signicantly poor overall survival(OS) (Figure 2B-E) , whereas not in the N classication (Figures 2F). We performed the univariate analysis with the variables and listed in the Table 3. We also performed Multivariate analysis with the Cox proportional hazards model and the results implied that the expression of HSPA7 (HR =1.304605, p =0.005187) is a potential prognostic factor for KIRC patients (Table 4).
Load more

Recommended publications
  • Theranostics Transcriptomic Analysis Identifies a Tumor Subtype Mrna
    Theranostics 2021, Vol. 11, Issue 1 132 Ivyspring International Publisher Theranostics 2021; 11(1): 132-146. doi: 10.7150/thno.47525 Research Paper Transcriptomic analysis identifies a tumor subtype mRNA classifier for invasive non-functioning pituitary neuroendocrine tumor diagnostics Xinjie Bao1#, Gengchao Wang2,3#, Shan Yu2,3#, Jian Sun4, Liu He2,3, Hualu Zhao2,3, Yanni Ma2,3, Fang Wang2,3, Xiaoshuang Wang2,3, Renzhi Wang1 and Jia Yu2,3,5 1. Department of Neurosurgery, Pituitary Center, Peking Union Medical College Hospital (PUMCH), Chinese Academy of Medical Sciences (CAMS) & Peking Union Medical College (PUMC), Beijing 100730, PR China. 2. State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS) & School of Basic Medicine, Peking Union Medical College (PUMC), Beijing 100005, PR China. 3. Department of Biochemistry, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (CAMS) & School of Basic Medicine, Peking Union Medical College (PUMC), Beijing 100005, PR China. 4. Department of Pathology, Peking Union Medical College Hospital (PUMCH), Chinese Academy of Medical Sciences (CAMS) & Peking Union Medical College (PUMC), Beijing 100730, PR China. 5. Medical Epigenetic Research Center, Chinese Academy of Medical Sciences (CAMS), Beijing 100005, PR China. #These authors contributed equally to this work. Corresponding authors: Jia Yu, State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences, Chinese Academy of Medical
    [Show full text]
  • Beyond K48 and K63: Non-Canonical Protein Ubiquitination
    Tracz and Bialek Cell Mol Biol Lett (2021) 26:1 https://doi.org/10.1186/s11658‑020‑00245‑6 Cellular & Molecular Biology Letters REVIEW LETTER Open Access Beyond K48 and K63: non‑canonical protein ubiquitination Michal Tracz and Wojciech Bialek* *Correspondence: [email protected] Abstract Faculty of Biotechnology, Protein ubiquitination has become one of the most extensively studied post-trans- University of Wroclaw, Wroclaw, Poland lational modifcations. Originally discovered as a critical element in highly regulated proteolysis, ubiquitination is now regarded as essential for many other cellular pro- cesses. This results from the unique features of ubiquitin (Ub) and its ability to form various homo- and heterotypic linkage types involving one of the seven diferent lysine residues or the free amino group located at its N-terminus. While K48- and K63-linked chains are broadly covered in the literature, the other types of chains assembled through K6, K11, K27, K29, and K33 residues deserve equal attention in the light of the latest discoveries. Here, we provide a concise summary of recent advances in the feld of these poorly understood Ub linkages and their possible roles in vivo. Keywords: Ubiquitin, Non-canonical, Atypical ubiquitination, Ubiquitin chains Introduction Protein ubiquitination (interchangeably called ubiquitylation) involves the covalent attachment of the 76-amino acid eukaryotic molecule ubiquitin (Ub) to substrate pro- teins. An enzymatic cascade of a Ub activating enzyme (E1), Ub-conjugating enzymes (E2s), and Ub ligases (E3s) governs the process, which is now recognized as an essential post-translational protein modifcation (PTM) of eukaryotic cells [1]. Ubiquitination is initiated by E1, an enzyme requiring ATP for the activation of Ub, which forms a thi- oester bond between the C-terminal Gly carboxyl group of Ub and its active site Cys.
    [Show full text]
  • Submitted As an Original Research Paper to XXXXXX Deletions and De
    SOX11 deletions and mutations in human developmental disorders Submitted as an Original Research Paper to XXXXXX Deletions and de novo variants involving SOX11 are associated with a human neurodevelopmental disorder 1 SOX11 deletions and mutations in human developmental disorders Abstract SOX11 is a transcription factor which is proposed to play a role in brain development. A role for SOX11 in human developmental disorders was suggested by a recent report of SOX11 mutations in 2 patients with Coffin-Siris syndrome. Here we further investigate the role of SOX11 variants in neurodevelopmental disorders. We identified 6 individuals with chromosome 2p25 deletions involving SOX11. These individuals had non-syndromic intellectual disability with microcephaly, developmental delay and shared dysmorphic features. We next utilised trio exome sequencing to identify 3 novel de novo SOX11 variants. Two of these individuals had a phenotype compatible with Coffin-Siris syndrome while 1 had non-syndromic intellectual disability. The pathogenicity of these mutations was confirmed using an in vitro gene expression system. To further investigate the role of loss of SOX11 in microcephaly we knocked down SOX11 in xenopus. Morphants had significant reduction in head size compared to controls. This suggests that SOX11 loss of function can be associated with microcephaly. We thus propose that SOX11 deletion or mutation can present with either non-syndromic intellectual disability or a Coffin-Siris phenotype. 2 SOX11 deletions and mutations in human developmental disorders Introduction The vertebrate SOX protein family consists of 30 genes [Pillai-Kastoori et al, 2015]. The SOX genes are classified into 8 subfamilies (SOXA-SOXJ) on the basis of sequence similarity.
    [Show full text]
  • Various Anti-HSPA2 Antibodies Yield Different Results in Studies On
    International Journal of Molecular Sciences Article Various Anti-HSPA2 Antibodies Yield Different Results in Studies on Cancer-Related Functions of Heat Shock Protein A2 Dorota Scieglinska *, Damian Robert Sojka, Agnieszka Gogler-Pigłowska, Vira Chumak and Zdzisław Krawczyk Center for Translational Research and Molecular Biology of Cancer, Maria Sklodowska-Curie National Research Institute of Oncology Gliwice Branch, 44-101 Gliwice, Poland; [email protected] (D.R.S.); [email protected] (A.G.-P.); [email protected] (V.C.); [email protected] (Z.K.) * Correspondence: [email protected] Received: 20 May 2020; Accepted: 15 June 2020; Published: 16 June 2020 Abstract: Heat shock proteins (HSPs) constitute a major part of the molecular chaperone system and play a fundamental role in cell proteostasis. The HSPA (HSP70) family groups twelve highly homologous HSPA proteins. Certain HSPAs are regarded as important cancer-related proteins, prospective therapeutic targets for cancer treatment, and also as potential cancer biomarkers. Heat Shock Protein A2 (HSPA2), a testis-enriched chaperone and one of the least characterized members of the HSPA family, has recently emerged as an important cancer-relevant protein with potential biomarker significance. Nevertheless, conflicting conclusions have been recently drawn both according to HSPA2 role in cancer cells, as well as to its prognostic value. In this work we have shown that one of the serious limitations in HSPA2 protein research is cross-reactivity of antibodies marketed as specific for HSPA2 with one or more other HSPA(s). Among non-specific antibodies were also those recently used for HSPA2 detection in functional and biomarker studies.
    [Show full text]
  • DHHC Protein Family Targets Different Subsets of Glioma Stem Cells In
    Chen et al. Journal of Experimental & Clinical Cancer Research (2019) 38:25 https://doi.org/10.1186/s13046-019-1033-2 RESEARCH Open Access DHHC protein family targets different subsets of glioma stem cells in specific niches Xueran Chen1,3*†, Lei Hu1,2†, Haoran Yang1,2, Huihui Ma4,5, Kaiqin Ye1,3, Chenggang Zhao1,2, Zhiyang Zhao1,2, Haiming Dai1,3, Hongzhi Wang1,3 and Zhiyou Fang1,3* Abstract Background: Glioblastomas (GBM) comprise different subsets that exhibit marked heterogeneity and plasticity, leading to a lack of success of genomic profiling in guiding the development of precision medicine approaches against these tumors. Accordingly, there is an urgent need to investigate the regulatory mechanisms for different GBM subsets and identify novel biomarkers and therapeutic targets relevant in the context of GBM-specific niches. The DHHC family of proteins is associated tightly with the malignant development and progression of gliomas. However, the role of these proteins in the plasticity of GBM subsets remains unclear. Methods: This study utilized human glioma proneural or mesenchymal stem cells as indicated. The effects of DHHC proteins on different GBM subsets were investigated through in vitro and in vivo assays (i.e., colony formation assay, flow cytometry assay, double immunofluorescence, western blot, and xenograft model). Western blot, co-immunoprecipitation, and liquid chromatograph mass spectrometer-mass spectrometry assays were used to detect the protein complexes of ZDHHC18 and ZDHHC23 in various GBM subtypes, and explore the mechanism of DHHC proteins in targeting different subsets of GSCs in specific niches. Results: ZDHHC18 and ZDHHC23 could target the glioma stem cells of different GBM subsets in the context of their specific niches and regulate the cellular plasticity of these subtypes.
    [Show full text]
  • Discovering Pharmacogenomic Variants and Pathways with the Epigenome and Spatial Genome
    The Pharmacoepigenomics Informatics Pipeline and H-GREEN Hi-C Compiler: Discovering Pharmacogenomic Variants and Pathways with the Epigenome and Spatial Genome by Ari Lawrence Allyn-Feuer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in the University of Michigan 2018 Doctoral Committee: Professor Brian D. Athey, Chair Assistant Professor Alan P. Boyle Professor Ivo D. Dinov Research Professor Gerald A. Higgins Professor Wolfgang Sadee, The Ohio State University Ari Lawrence Allyn-Feuer [email protected] ORCID iD: 0000-0002-8379-2765 © Ari Allyn-Feuer 2018 Dedication In the epilogue of Altneuland, Theodor Herzl famously wrote: “Dreams are not so different from deeds as some may think. All the deeds of men are dreams at first, and become dreams in the end.” Medical advances undergo a similar progression, from invisible to visible and back. Before they are accomplished, advances in the physician’s art are illegible: no one differentiates from the rest the suffering and death which could be alleviated with methods which do not yet exist. Unavoidable ills have none of the moral force of avoidable ones. Then, for a brief period, beginning shortly before it is deployed in mainstream practice, and slowly concluding over the generation after it becomes widespread, an advance is visible. People see the improvements and celebrate them. Then, subsequently, for the rest of history, if we are lucky, such an advance is more invisible than it was before it was invented. No one tallies the children who do not get polio, the firm ground that used to be a malarial swamp, or the quiet fact of sanitation.
    [Show full text]
  • The Interplay Between Long Noncoding Rnas and Proteins of the Epigenetic Machinery in Ovarian Cancer
    cancers Review The Interplay between Long Noncoding RNAs and Proteins of the Epigenetic Machinery in Ovarian Cancer Naiade Calanca 1 , Cecilie Abildgaard 2,3 , Cláudia Aparecida Rainho 1 and Silvia Regina Rogatto 3,* 1 Department of Chemical and Biological Sciences, Institute of Biosciences, São Paulo State University (UNESP), Botucatu 18618-689, Brazil; [email protected] (N.C.); [email protected] (C.A.R.) 2 Department of Oncology, University Hospital of Southern Denmark-Vejle, Institute of Regional Health Research, University of Southern Denmark, 5000 Odense, Denmark; [email protected] 3 Department of Clinical Genetics, University Hospital of Southern Denmark-Vejle, Institute of Regional Health Research, University of Southern Denmark, 5000 Odense, Denmark * Correspondence: [email protected]; Tel.: +45-7940-6669 Received: 20 August 2020; Accepted: 16 September 2020; Published: 21 September 2020 Simple Summary: Epithelial ovarian cancer is an aggressive disease associated with relapse, resistance to chemotherapy, and high mortality rates. Recent discoveries have pointed out that long noncoding RNAs (lncRNAs) are potential biomarkers or therapeutic targets in several tumor types. However, fundamental knowledge about their functions and regulation is still lacking. Here, we present the current understanding of the interplay between lncRNAs and the epigenetic machinery influencing ovarian carcinogenesis. We also provide an overview of bioinformatics tools and databases that can be exploited for lncRNAs investigations. Altogether, this information can support the development of clinical initiatives to monitor disease progression or discover new strategies for the therapeutic management of ovarian cancer. Abstract: Comprehensive large-scale sequencing and bioinformatics analyses have uncovered a myriad of cancer-associated long noncoding RNAs (lncRNAs).
    [Show full text]
  • Targeting Glioma Stem Cells Through Combined BMI1 and EZH2 Inhibition
    ARTICLES Targeting glioma stem cells through combined BMI1 and EZH2 inhibition Xun Jin1–3 , Leo J Y Kim1,4–6, Qiulian Wu1,6, Lisa C Wallace1, Briana C Prager1,4–7, Tanwarat Sanvoranart1, Ryan C Gimple1,4–6, Xiuxing Wang1,6, Stephen C Mack1,8 , Tyler E Miller1,4,5, Ping Huang1, Claudia L Valentim1, Qi-gang Zhou1, Jill S Barnholtz-Sloan9, Shideng Bao1,7,9, Andrew E Sloan9,10 & Jeremy N Rich1,6,7,9 Glioblastomas are lethal cancers defined by angiogenesis and pseudopalisading necrosis. Here, we demonstrate that these histological features are associated with distinct transcriptional programs, with vascular regions showing a proneural profile, and hypoxic regions showing a mesenchymal pattern. As these regions harbor glioma stem cells (GSCs), we investigated the epigenetic regulation of these two niches. Proneural, perivascular GSCs activated EZH2, whereas mesenchymal GSCs in hypoxic regions expressed BMI1 protein, which promoted cellular survival under stress due to downregulation of the E3 ligase RNF144A. Using both genetic and pharmacologic inhibition, we found that proneural GSCs are preferentially sensitive to EZH2 disruption, whereas mesenchymal GSCs are more sensitive to BMI1 inhibition. Given that glioblastomas contain both proneural and mesenchymal GSCs, combined EZH2 and BMI1 targeting proved more effective than either agent alone both in culture and in vivo, suggesting that strategies that simultaneously target multiple epigenetic regulators within glioblastomas may be effective in overcoming therapy resistance caused by intratumoral heterogeneity. Glioblastoma is the most prevalent and lethal primary brain tumor, isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2); non-G-CIMP with current therapies offering only palliation1.
    [Show full text]
  • Bioinformatics and Molecular Approaches for the Development of Biological Artificial Cartilage by Nguyen P.T. Huynh Department O
    Bioinformatics and Molecular Approaches for the Development of Biological Artificial Cartilage By Nguyen P.T. Huynh Department of Cell Biology Duke University Date: __________________ Approved: _______________________ Farshid Guilak, Supervisor _______________________ Blanche Capel, Chair _______________________ Michel Bagnat _______________________ Charles Gersbach _______________________ Eda Yildirim Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Cell Biology in the Graduate School of Duke University 2018 ABSTRACT Bioinformatics and Molecular Approaches for the Development of Biological Artificial Cartilage By Nguyen P.T. Huynh Department of Cell Biology Duke University Date: __________________ Approved: _______________________ Farshid Guilak, Supervisor _______________________ Blanche Capel, Chair _______________________ Michel Bagnat _______________________ Charles Gersbach _______________________ Eda Yildirim An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Cell Biology in the Graduate School of Duke University 2018 Copyright by Nguyen P.T. Huynh 2018 Abstract Osteoarthritis (OA) is one of the leading causes of disability in the United States, afflicting over 27 million Americans and imposing an economic burden of more than $128 billion each year (1, 2). OA is characterized by progressive degeneration of articular cartilage together with sub-chondral bone remodeling
    [Show full text]
  • HSPA2 Expression Predicts Early Postsurgical Relapse and Promotes Tumor Cell Migration and Invasion in Pancreatic Cancer
    HSPA2 Expression Predicts Early Postsurgical Relapse and Promotes Tumor Cell Migration and Invasion in Pancreatic Cancer Lu-Lu Zhai Renmin Hospital of Wuhan University: Wuhan University Renmin Hospital https://orcid.org/0000-0003- 0839-7316 Pei-Pei Qiao Ningxia Medical University Yue-Shen Sun Peking Union Medical College Hospital Zhi-Gang Tang ( [email protected] ) Deptment of General Surgery, Renmin Hospital of Wuhan University, Wuhan, China. https://orcid.org/0000-0001-5390-9670 Tong-Fa Ju Aliated Hangzhou First People's Hospital Zhejiang University School of Medicine: Hangzhou First People's Hospital Research article Keywords: HSPA2, Pancreatic cancer, Recurrence, Migration, Invasion Posted Date: March 1st, 2021 DOI: https://doi.org/10.21203/rs.3.rs-218267/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/27 Abstract Background: Heat shock protein A2 (HSPA2) is known to relate to the pathogenesis and progress of cancer. This study aimed to investigate the connection between HSPA2 and early postsurgical relapse, and the inuences of HSPA2 on cell biological behaviors in pancreatic cancer (PC). Methods: Expression of HSPA2 in cancerous and noncancerous samples was determined by bioinformatics and immunostaining methods. The signicance of HSPA2 expression in predicting early postsurgical recurrence was assessed. The biological role and potential mechanisms of HSPA2 in PC progression were uncovered by enrichment analysis. HSPA2 expression in human PC cells was detected by immunoblotting. Silencing of HSPA2 in BxPC-3 cells and upregulation of HSPA2 in PANC-1 cells were achieved with siRNA and overexpression plasmid, respectively, and then the impacts of HSPA2 downregulation and upregulation on cancer cell biological behaviors were estimated.
    [Show full text]
  • Roles of Ubiquitination and Sumoylation in DNA Damage Response
    Curr. Issues Mol. Biol. (2020) 35: 59-84. Roles of Ubiquitination and SUMOylation in DNA Damage Response Siyuan Su1,2, Yanqiong Zhang1,2 and Pengda Liu1,2* 1Lineberger Comprehensive Cancer Center, Te University of North Carolina at Chapel Hill, Chapel Hill, NC, USA. 2Department of Biochemistry and Biophysics, Te University of North Carolina at Chapel Hill, Chapel Hill, NC, USA. *Correspondence: [email protected] htps://doi.org/10.21775/cimb.035.059 Abstract that genome instability leads to human disorders Ubiquitin and ubiquitin-like modifers, such as including cancer, understanding detailed molecu- SUMO, exert distinct physiological functions by lar mechanisms for ubiquitin and SUMO-related conjugating to protein substrates. Ubiquitination or regulations in DNA damage response may provide SUMOylation of protein substrates determine the novel insights into therapeutic modalities to treat fate of modifed proteins, including proteasomal human diseases associated with deregulated DNA degradation, cellular re-localization, alternations in damage response. binding partners and serving as a protein-binding platform, in a ubiquitin or SUMO linkage-depend- ent manner. DNA damage occurs constantly in Introduction living organisms but is also repaired by distinct DNA encodes for inheritable genetic information tightly controlled mechanisms including homolo- that is not only essential to exert normal cellular gous recombination, non-homologous end joining, function but also indispensable to maintain the inter-strand crosslink repair, nucleotide excision human society. Tus, DNA should be stable while repair and base excision repair. On sensing damaged versatile. Although certain genetic changes are DNA, a ubiquitination/SUMOylation landscape is permissible to drive evolution (usually at a low established to recruit DNA damage repair factors.
    [Show full text]
  • Whole-Transcriptome Analysis of Fully Viable Energy Efficient Glycolytic
    CANCER GENOMICS & PROTEOMICS 17 : 469-497 (2020) doi:10.21873/cgp.20205 Whole-transcriptome Analysis of Fully Viable Energy Efficient Glycolytic-null Cancer Cells Established by Double Genetic Knockout of Lactate Dehydrogenase A/B or Glucose-6-Phosphate Isomerase ELIZABETH MAZZIO 1, RAMESH BADISA 1, NZINGA MACK 1, SHAMIR CASSIM 2, MASA ZDRALEVIC 3# , JACQUES POUYSSEGUR 2,3 and KARAM F.A. SOLIMAN 1 1College of Pharmacy & Pharmaceutical Sciences, Florida A&M University, Tallahassee, FL, U.S.A.; 2Department of Medical Biology, Centre Scientifique de Monaco, Monaco, Monaco; 3University Côte d'Azur, IRCAN, CNRS, Centre A. Lacassagne, Nice, France Abstract. Background/Aim: Nearly all mammalian tumors viability. These findings show a high biochemical energy of diverse tissues are believed to be dependent on efficiency as measured by ATP in glycolysis-null cells. Next, fermentative glycolysis, marked by elevated production of transcriptomic analysis conducted on 48,226 mRNA lactic acid and expression of glycolytic enzymes, most notably transcripts reflect 273 differentially expressed genes (DEGS) lactic acid dehydrogenase (LDH). Therefore, there has been in the GPI KO clone set, 193 DEGS in the LDHA/B DKO significant interest in developing chemotherapy drugs that clone set with 47 DEGs common to both KO clones. selectively target various isoforms of the LDH enzyme. Glycolytic-null cells reflect up-regulation in gene transcripts However, considerable questions remain as to the typically associated with nutrient deprivation / fasting and consequences of biological ablation of LDH or upstream possible use of fats for energy: thioredoxin interacting protein targeting of the glycolytic pathway. Materials and Methods: (TXNIP), mitochondrial 3-hydroxy-3-methylglutaryl-CoA In this study, we explore the biochemical and whole synthase 2 (HMGCS2), PPAR γ coactivator 1 α ( PGC-1 α), transcriptomic effects of CRISPR-Cas9 gene knockout (KO) and acetyl-CoA acyltransferase 2 (ACAA2).
    [Show full text]