Functional Characterization of Rare NRXN1 Variants Identified in Autism
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Genetic Targeting of NRXN2 in Mice Unveils Role in Excitatory Cortical Synapse Function and Social Behaviors
King’s Research Portal DOI: 10.3389/fnsyn.2015.00003 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Born, G., Grayton, H. M., Langhorst, H., Dudanova, I., Rohlmann, A., Woodward, B. W., Collier, D. A., Fernandes, C., & Missler, M. (2015). Genetic targeting of NRXN2 in mice unveils role in excitatory cortical synapse function and social behaviors. Frontiers in Synaptic Neuroscience, 7(0), [3]. https://doi.org/10.3389/fnsyn.2015.00003 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. -
The Classification of Esterases: an Important Gene Family Involved in Insecticide Resistance - a Review
Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 107(4): 437-449, June 2012 437 The classification of esterases: an important gene family involved in insecticide resistance - A Review Isabela Reis Montella1,2, Renata Schama1,2,3/+, Denise Valle1,2,3 1Laboratório de Fisiologia e Controle de Artrópodes Vetores, Instituto Oswaldo Cruz-Fiocruz, Av. Brasil 4365, 21040-900 Rio de Janeiro, RJ, Brasil 2Instituto de Biologia do Exército, Rio de Janeiro, RJ, Brasil 3Instituto Nacional de Ciência e Tecnologia em Entomologia Molecular, Rio de Janeiro, RJ, Brasil The use of chemical insecticides continues to play a major role in the control of disease vector populations, which is leading to the global dissemination of insecticide resistance. A greater capacity to detoxify insecticides, due to an increase in the expression or activity of three major enzyme families, also known as metabolic resistance, is one major resistance mechanisms. The esterase family of enzymes hydrolyse ester bonds, which are present in a wide range of insecticides; therefore, these enzymes may be involved in resistance to the main chemicals employed in control programs. Historically, insecticide resistance has driven research on insect esterases and schemes for their classification. Currently, several different nomenclatures are used to describe the esterases of distinct species and a universal standard classification does not exist. The esterase gene family appears to be rapidly evolving and each insect species has a unique complement of detoxification genes with only a few orthologues across species. The examples listed in this review cover different aspects of their biochemical nature. However, they do not appear to contribute to reliably distinguish among the different resistance mechanisms. -
Systems Analysis Implicates WAVE2&Nbsp
JACC: BASIC TO TRANSLATIONAL SCIENCE VOL.5,NO.4,2020 ª 2020 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/). PRECLINICAL RESEARCH Systems Analysis Implicates WAVE2 Complex in the Pathogenesis of Developmental Left-Sided Obstructive Heart Defects a b b b Jonathan J. Edwards, MD, Andrew D. Rouillard, PHD, Nicolas F. Fernandez, PHD, Zichen Wang, PHD, b c d d Alexander Lachmann, PHD, Sunita S. Shankaran, PHD, Brent W. Bisgrove, PHD, Bradley Demarest, MS, e f g h Nahid Turan, PHD, Deepak Srivastava, MD, Daniel Bernstein, MD, John Deanfield, MD, h i j k Alessandro Giardini, MD, PHD, George Porter, MD, PHD, Richard Kim, MD, Amy E. Roberts, MD, k l m m,n Jane W. Newburger, MD, MPH, Elizabeth Goldmuntz, MD, Martina Brueckner, MD, Richard P. Lifton, MD, PHD, o,p,q r,s t d Christine E. Seidman, MD, Wendy K. Chung, MD, PHD, Martin Tristani-Firouzi, MD, H. Joseph Yost, PHD, b u,v Avi Ma’ayan, PHD, Bruce D. Gelb, MD VISUAL ABSTRACT Edwards, J.J. et al. J Am Coll Cardiol Basic Trans Science. 2020;5(4):376–86. ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2020.01.012 JACC: BASIC TO TRANSLATIONALSCIENCEVOL.5,NO.4,2020 Edwards et al. 377 APRIL 2020:376– 86 WAVE2 Complex in LVOTO HIGHLIGHTS ABBREVIATIONS AND ACRONYMS Combining CHD phenotype–driven gene set enrichment and CRISPR knockdown screening in zebrafish is an effective approach to identifying novel CHD genes. -
P.1.H.029. Abnormality of Social Behavior and Dysfunction of Autism
P.1.h.029. Abnormality of social behavior and dysfunction of autism related gene expression developing under chronic social defeat stress in male mice Kudryavtseva N.N., Kovalenko I.L., Smagin D.A., Galyamina A.G., Babenko V.N. Federal Research Center, Institute of Cytology and Genetics of SB RAS, Novosibirsk, Russia The ability of people to communicate with each other is a necessary component of social behavior and the normal development of individuals living in a community. An apparent decline in sociability may be the result of a negative social environment or the development of neurological disorders, including autistic spectrum disorders. The behavior of these humans may be characterized by the impairment of socialization, low communication, restricted and repetitive behaviors. This study aimed to analyze changes in the social behaviors induced by daily social defeat stress in male mice and to study the involvement of autism associated genes in the process of the deterioration of social behaviors. sensory contact agonistic interactions aggressive defeated mice Methods.The sensory contact model [1] was mice used to generate repeated experience of social defeats in male mice of C57BL/6J strain. After three days of sensory contact the partition is removed for 10 min to allow agonistic interactions between males. Undoubted superiority of one of the partners is evident The collected brain samples were sequenced at JSC Genoanalytica (www.genoanalytica.ru, within 2-3 daily social encounters with the same Moscow, Russia), where the mRNA was extracted using the Dynabeads mRNA Purification Kit (Ambion, USA). cDNA libraries were constructed using NEBNext mRNA Library PrepReagent Set opponent. -
Neurexin II Alpha (NRXN2) (NM 015080) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC219788 Neurexin II alpha (NRXN2) (NM_015080) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Neurexin II alpha (NRXN2) (NM_015080) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NRXN2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC219788 representing NM_015080 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCCGGGAGCCGGTGGCGGCCGACACCGCCGCCGCTGCTGTTGCTGCTGCTGCTGGCGCTGGCGG CGCGCGCGGACGGCCTGGAGTTCGGCGGCGGCCCCGGGCAGTGGGCTCGCTACGCGCGCTGGGCGGGCGC GGCGAGCAGCGGCGAGCTCAGCTTCAGCCTGCGCACCAACGCCACGCGCGCGCTGCTGCTCTACCTGGAC GACGGCGGCGACTGCGACTTCCTGGAGCTGCTGCTGGTGGACGGCCGCCTGCGGCTGCGCTTCACGCTTT CGTGCGCCGAGCCGGCCACGCTGCAGCTGGACACGCCGGTGGCCGACGACCGCTGGCACATGGTGCTGCT GACCCGCGACGCGCGCCGCACGGCGCTGGCGGTGGACGGCGAGGCCCGCGCCGCCGAGGTGCGCTCCAAG CGGCGCGAGATGCAGGTGGCCAGCGACCTGTTCGTGGGCGGCATCCCGCCCGACGTGCGCCTCTCGGCGC TTACGCTGAGCACCGTCAAGTACGAGCCGCCCTTCCGCGGCCTCTTGGCCAACCTGAAGCTGGGCGAGCG GCCCCCCGCGCTGCTGGGCAGCCAGGGCCTGCGCGGCGCCACCGCCGACCCGCTGTGCGCGCCCGCGCGC AACCCCTGCGCCAACGGCGGCCTCTGCACCGTGCTGGCCCCCGGCGAGGTGGGCTGCGACTGCAGCCACA CGGGCTTCGGCGGCAAGTTCTGCAGCGAAGAGGAGCACCCCATGGAAGGTCCGGCTCACCTGACGTTAAA CAGCGAAGTAGGGTCCTTACTGTTCTCCGAGGGGGGGGCCGGGAGAGGAGGAGCCGGCGATGTGCACCAG CCAACAAAAGGCAAGGAGGAGTTTGTGGCGACCTTCAAAGGCAATGAGTTCTTCTGCTACGACCTGTCAC -
Interaction of Acetylcholinesterase with Neurexin-1Β Regulates
Xiang et al. Molecular Brain 2014, 7:15 http://www.molecularbrain.com/content/7/1/15 RESEARCH Open Access Interaction of Acetylcholinesterase with Neurexin-1β regulates Glutamatergic Synaptic stability in Hippocampal neurons Yun-Yan Xiang1,2†, Haiheng Dong3†, Burton B Yang4, John F MacDonald1,2 and Wei-Yang Lu1,2,3,5* Abstract Background: Excess expression of acetylcholinesterase (AChE) in the cortex and hippocampus causes a decrease in the number of glutamatergic synapses and alters the expression of neurexin and neuroligin, trans-synaptic proteins that control synaptic stability. The molecular sequence and three-dimensional structure of AChE are homologous to the corresponding aspects of the ectodomain of neuroligin. This study investigated whether excess AChE interacts physically with neurexin to destabilize glutamatergic synapses. Results: The results showed that AChE clusters colocalized with neurexin assemblies in the neurites of hippocampal neurons and that AChE co-immunoprecipitated with neurexin from the lysate of these neurons. Moreover, when expressed in human embryonic kidney 293 cells, N-glycosylated AChE co-immunoprecipitated with non-O–glycosylated neurexin-1β,withN-glycosylation of the AChE being required for this co-precipitation to occur. Increasing extracellular AChE decreased the association of neurexin with neuroligin and inhibited neuroligin-induced synaptogenesis. The number and activity of excitatory synapses in cultured hippocampal neurons were reduced by extracellular catalytically inactive AChE. Conclusions: Excessive glycosylated AChE could competitively disrupt a subset of the neurexin–neuroligin junctions consequently impairing the integrity of glutamatergic synapses. This might serve a molecular mechanism of excessive AChE induced neurodegeneration. Keywords: Protein interaction, Glycosylation, Neurodegeneration, Synaptic apoptosis Introduction globular monomers and dimers of AChE-S. -
Deletion of Α-Neurexin II Results in Autism-Related
OPEN Citation: Transl Psychiatry (2014) 4, e484; doi:10.1038/tp.2014.123 www.nature.com/tp ORIGINAL ARTICLE Deletion of α-neurexin II results in autism-related behaviors in mice J Dachtler1, J Glasper2, RN Cohen1, JL Ivorra1, DJ Swiffen1, AJ Jackson1, MK Harte2, RJ Rodgers3 and SJ Clapcote1 Autism is a common and frequently disabling neurodevelopmental disorder with a strong genetic basis. Human genetic studies have discovered mutations disrupting exons of the NRXN2 gene, which encodes the synaptic adhesion protein α-neurexin II (Nrxn2α), in two unrelated individuals with autism, but a causal link between NRXN2 and the disorder remains unclear. To begin to test the hypothesis that Nrxn2α deficiency contributes to the symptoms of autism, we employed Nrxn2α knockout (KO) mice that genetically model Nrxn2α deficiency in vivo. We report that Nrxn2α KO mice displayed deficits in sociability and social memory when exposed to novel conspecifics. In tests of exploratory activity, Nrxn2α KO mice displayed an anxiety-like phenotype in comparison with wild-type littermates, with thigmotaxis in an open field, less time spent in the open arms of an elevated plus maze, more time spent in the enclosure of an emergence test and less time spent exploring novel objects. However, Nrxn2α KO mice did not exhibit any obvious changes in prepulse inhibition or in passive avoidance learning. Real-time PCR analysis of the frontal cortex and hippocampus revealed significant decreases in the mRNA levels of genes encoding proteins involved in both excitatory and inhibitory transmission. Quantification of protein expression revealed that Munc18-1, encoded by Stxbp1, was significantly decreased in the hippocampus of Nrxn2α KO mice, which is suggestive of deficiencies in presynaptic vesicular release. -
Acetylcholinesterase — New Roles for Gate a Relatively Long Distance to Reach the Active Site, Ache Is One of the Fastest an Old Actor Enzymes14
PERSPECTIVES be answered regarding AChE catalysis; for OPINION example, the mechanism behind the extremely fast turnover rate of the enzyme. Despite the fact that the substrate has to navi- Acetylcholinesterase — new roles for gate a relatively long distance to reach the active site, AChE is one of the fastest an old actor enzymes14. One theory to explain this phe- nomenon has to do with the unusually strong electric field of AChE. It has been argued that Hermona Soreq and Shlomo Seidman this field assists catalysis by attracting the cationic substrate and expelling the anionic The discovery of the first neurotransmitter — understanding of AChE functions beyond the acetate product15. Site-directed mutagenesis, acetylcholine — was soon followed by the classical view and suggest the molecular basis however, has indicated that reducing the elec- discovery of its hydrolysing enzyme, for its functional heterogeneity. tric field has no effect on catalysis16.However, acetylcholinesterase. The role of the same approach has indicated an effect on acetylcholinesterase in terminating From early to recent discoveries the rate of association of fasciculin, a peptide acetylcholine-mediated neurotransmission The unique biochemical properties and phys- that can inhibit AChE17. made it the focus of intense research for iological significance of AChE make it an much of the past century. But the complexity interesting target for detailed structure–func- of acetylcholinesterase gene regulation and tion analysis. AChE-coding sequences have recent evidence for some of the long- been cloned so far from a range of evolution- a Peripheral Choline binding site suspected ‘non-classical’ actions of this arily diverse vertebrate and invertebrate binding enzyme have more recently driven a species that include insects, nematodes, fish, site profound revolution in acetylcholinesterase reptiles, birds and several mammals, among Active site research. -
PSD-95 Binding Dynamically Regulates NLGN1 Trafficking and Function
PSD-95 binding dynamically regulates NLGN1 trafficking and function Jaehoon Jeonga, Saurabh Pandeya, Yan Lia, John D. Badger IIa, Wei Lua, and Katherine W. Rochea,1 aNational Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 Edited by Solomon H. Snyder, Johns Hopkins University School of Medicine, Baltimore, MD, and approved May 3, 2019 (received for review December 20, 2018) PSD-95 is a scaffolding protein that regulates the synaptic localization necessary for maintaining presynaptic release probability (15). of many receptors, channels, and signaling proteins. The NLGN gene Meanwhile, synaptic targeting of NLGN1 is known to be in- family encodes single-pass transmembrane postsynaptic cell adhesion dependent of PSD-95, as PSD-95 is recruited to the plasma molecules that are important for synapse assembly and function. At membrane after NLGN1 (13, 16, 17). In addition, non-PDZ excitatory synapses, NLGN1 mediates transsynaptic binding with ligand-dependent NLGN1 and NLGN3 functions have been in- neurexin, a presynaptic cell adhesion molecule, and also binds to vestigated (18), suggesting a complicated physiological interplay PSD-95, although the relevance of the PSD-95 interaction is not clear. between NLGNs and PSD-95. We now show that disruption of the NLGN1 and PSD-95 interaction Posttranslational modifications have been reported for several decreases surface expression of NLGN1 in cultured neurons. Further- NLGN isoforms and are postulated to confer distinct properties (11, more, PKA phosphorylates NLGN1 on S839, near the PDZ ligand, and 12). For example, phosphorylation of the cytoplasmic region of dynamically regulates PSD-95 binding. A phosphomimetic mutation NLGN1 has recently emerged as a mechanism for isoform-specific of NLGN1 S839 significantly reduced PSD-95 binding. -
Neurexin–Neuroligin Signaling in Synapse Development Ann Marie Craig and Yunhee Kang
Neurexin–neuroligin signaling in synapse development Ann Marie Craig and Yunhee Kang Neurexins and neuroligins are emerging as central organizing and knockdown of neuroligins in culture led to the idea molecules for excitatory glutamatergic and inhibitory that these molecules control the balance of GABAergic GABAergic synapses in mammalian brain. They function as cell and glutamatergic inputs [4,5]. We focus our discussion adhesion molecules, bridging the synaptic cleft. Remarkably, here on studies from the past two years that address how each partner can trigger formation of a hemisynapse: alternative splicing in both neurexin and neuroligin tran- neuroligins trigger presynaptic differentiation and neurexins scripts regulates their function. We also discuss initial trigger postsynaptic differentiation. Recent protein interaction results from studies of knockout mice and disease-linked assays and cell culture studies indicate a selectivity of function mutations. conferred by alternative splicing in both partners. An insert at site 4 of b-neurexins selectively promotes GABAergic synaptic Structure of neurexins and neuroligins function, whereas an insert at site B of neuroligin 1 selectively There are three neurexin genes in mammals, each of promotes glutamatergic synaptic function. Initial knockdown which has both an upstream promoter that is used to and knockout studies indicate that neurexins and neuroligins generate the larger a-neurexins and a downstream pro- have an essential role in synaptic transmission, particularly at moter that is used to generate the b-neurexins (Figure 1) GABAergic synapses, but further studies are needed to assess [6]. Alternative splicing at five sites and N- and O-gly- the in vivo functions of these complex protein families. -
Autism-Associated Mir-873 Regulates ARID1B, SHANK3 and NRXN2
Lu et al. Translational Psychiatry (2020) 10:418 https://doi.org/10.1038/s41398-020-01106-8 Translational Psychiatry ARTICLE Open Access Autism-associated miR-873 regulates ARID1B, SHANK3 and NRXN2 involved in neurodevelopment Jing Lu 1, Yan Zhu 1, Sarah Williams2, Michelle Watts 3,MaryA.Tonta1, Harold A. Coleman1, Helena C. Parkington1 and Charles Claudianos 1,4 Abstract Autism spectrum disorders (ASD) are highly heritable neurodevelopmental disorders with significant genetic heterogeneity. Noncoding microRNAs (miRNAs) are recognised as playing key roles in development of ASD albeit the function of these regulatory genes remains unclear. We previously conducted whole-exome sequencing of Australian families with ASD and identified four novel single nucleotide variations in mature miRNA sequences. A pull-down transcriptome analysis using transfected SH-SY5Y cells proposed a mechanistic model to examine changes in binding affinity associated with a unique mutation found in the conserved ‘seed’ region of miR-873-5p (rs777143952: T > A). Results suggested several ASD-risk genes were differentially targeted by wild-type and mutant miR-873 variants. In the current study, a dual-luciferase reporter assay confirmed miR-873 variants have a 20-30% inhibition/dysregulation effect on candidate autism risk genes ARID1B, SHANK3 and NRXN2 and also confirmed the affected expression with qPCR. In vitro mouse hippocampal neurons transfected with mutant miR-873 showed less morphological complexity and enhanced sodium currents and excitatory neurotransmission compared to cells transfected with wild-type miR- 873. A second in vitro study showed CRISPR/Cas9 miR-873 disrupted SH-SY5Y neuroblastoma cells acquired a neuronal-like morphology and increased expression of ASD important genes ARID1B, SHANK3, ADNP2, ANK2 and CHD8. -
Synaptic Modulators Nrxn1 and Nrxn3 Are Disregulated in a Disc1 Mouse
Letters to the Editor 585 National University of Ireland Galway, Galway, Ireland; 4Laboratory of Clinical Science, National Institute of Mental Health, National Institutes of Health, Bethesda, MD, USA; 5Center for Integrated Molecular Brain Imaging, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark and 6Department of Psychiatry, Laureate Institute for Brain Research, University of Oklahoma College of Medicine, Tulsa, OK, USA E-mail: [email protected] 7These senior authors contributed equally to this paper. References 1 Ichimiya T, Suhara T, Sudo Y, Okubo Y, Nakayama K, Nankai M et al. Biological Psychiatry 2002; 51: 715–722. 2 Cannon DM, Ichise M, Rollis D, Klaver JM, Gandhi SK, Charney DS et al. Biol Psychiatry 2007; 15: 870–877. 3 Cannon DM, Ichise M, Fromm SJ, Nugent AC, Rollis D, Gandhi SK et al. Biol Psychiatry 2006; 60: 207–217. 4 Purcell S, Neale B, Todd-Brown K, Thomas L, Ferreira MA, Bender D et al. American Journal of Human Genetics 2007; 81: 559–575. Figure 1 Map of t-values from voxel-wise analysis of 5 Shioe K, Ichimiya T, Suhara T, Takano A, Sudo Y, Yasuno F et al. Synapse 2003; 48: 184–188. rs6741892, overlaid on a sample axial magnetic resonance 6 Kalbitzer J, Frokjaer VG, Erritzoe D, Svarer C, Cumming P, imaging slice at the level of the medial thalamus (z = 6 mm). Nielsen FA et al. Neuroimage 2009; 45: 280–285. Bilaterally, T-allele carriers (n = 13) have greater serotonin- 7 Erritzoe D, Holst K, Frokjaer VG, Licht CL, Kalbitzer J, Nielsen FA transporter-binding potential than AA homozygotes (n = 42).