THE ANTI-INFLAMMATORY MECHANISMS OF THE FLAVONOID APIGENIN IN VITRO AND IN VIVO

Thesis

Presented in partial fulfillment of the requirements for the degree Master of Science in the Graduate School of The Ohio State University

by

Courtney Nicholas, BS

Molecular, Cellular, and Developmental Biology Graduate Program

The Ohio State University

2009

Master’s Thesis Examination Committee:

Dr. Andrea I Doseff, advisor

Dr. Erich Grotewold

Dr. Mark Parthun

copyright by

Courtney Nicholas

2009

ii ABSTRACT

The cells of the innate immune system are responsible for an organism’s first line of defense against various pathogens. Cells such as macrophages and neutrophils are capable of detecting the presence of a bacterial, viral, fungal, or protozoan pathogen through specialized Toll-like receptors on the plasma

membrane. These receptors, when activated, initiate an inflammatory response mediated by various kinases, catalytic and regulatory proteins, and ubiquitin ligases, resulting in the activation of several transcription factors, including NF-

κB. It is through this signaling cascade that the cells are able to initiate phagocytosis to destroy the pathogen, and release pro-inflammatory cytokine molecules to activate other immune cells and propagate the immune response.

However, unregulated inflammation results in several serious human inflammatory diseases including sepsis and sepsis-related disorders such as acute lung injury. Several decades of failed clinical trials have led to the search for alternative therapies. Flavonoids, a class of polyphenolic plant compounds, are reported to be potent anti-inflammatory agents in vitro and in vivo, but their molecular and physiological mechanisms are still largely unknown. Apigenin is a member of the flavonoid family, and has similarly demonstrated anti-inflammatory properties. In these experiments it is shown that apigenin inhibits transcriptional

ii activation of NF-κB and subsequent release of pro-inflammatory cytokines TNFα,

IL-1, and IL-8 in response to bacterial lipopolysaccharide (LPS) stimulation.

Apigenin did not modulate degradation of the NF-κB inhibitor IκB or interfere with binding of NF-κB with DNA. However, apigenin modulated phosphorylation of

NF-κB’s p65 subunit via indirect inhibition of the IKK kinase. Apigenin was effective in reducing TNFα production mediated by several different Toll receptor ligands. Naringenin (a structurally similar compound), as well as glycosylated forms of apigenin failed to modulate inflammatory response, and glycosylated apigenin was not able to enter cells in vitro. In a mouse model of sepsis –related acute lung injury, intraperitoneal apigenin rescued LPS-induced mortality, improved cardiac function, and reduced TNFα in serum. Apigenin failed to modulate cell death in spleens, which is traditionally shown to correlate with sepsis-related death in humans and mice. However, apigenin decreased neutrophil infiltration, cell death, expression of chemotactic proteins in mouse lungs, and chemotactic response in human neutrophils in vitro. Apigenin was detected with no metabolic modifications in mouse liver and urine. This work further illuminates apigenin’s molecular and physiological mechanisms, highlights apigenin’s potential as an anti-inflammatory therapy, and suggests novel

iii therapeutic targets in the signaling cascade of bacterial-mediated inflammatory disorders.

iv ACKNOWLEDGEMENTS

I sincerely thank Melissa Vargo, Sanjay Batra, and Oliver Voss for their

excellent preliminary work on this project. I am forever grateful to Christie

Newland for her knowledge of mouse animal models, and for her advice and generous support. Thanks to Yoshinori Nishijima for his skills (and patience) with mouse echocardiograms. Thanks to Daniel Arango, Waka Omata, and Greg

Hostetler for their generous help with the experiments presented here. Thanks to

Mark Wewers and Anu Sarkar, for helping us get the mouse studies off the ground. I wish to thank Jamie Wolf and Clara Kwon for their work with Toll ligands and modified apigenin compounds. I also wish to thank George Heine for editing support. Thanks to Chris Baran and Tim Eubank for generously and unquestioningly providing materials and advice. The lab is thankful to Julian

Cambronero and Katherine Frondorf for their guidance and expertise in chemotaxis studies.

v VITA

February 7, 1977 ...... born Scranton, Pennsylvania

1995-2000 ...... B.S., Biology The University of Scranton

2005-2009 ...... graduate research/teaching assistant, The Ohio State University

Major Field of Study: Molecular, Cellular, and Developmental Biology

vi TABLE OF CONTENTS

Abstract ...... ii Acknowledgements ...... v Vita ...... vi List of Figures ...... ix

Chapter 1 – Introduction 1.1 Mammalian immunity and pathogenesis ...... 1 1.2 The TLR4 Pathway ...... 5 1.3 Inflammation-related disorders ...... 10 1.4 Experimental models of sepsis and sepsis-related disorders ...... 13 1.5 Plant immunity and pathogenesis ...... 16 1.6 Goals of the research ...... 20

Chapter 2 – Materials and Methods 2.1 Reagents ...... 21 2.2 Purification of human neutrophils ...... 21 2.3 Immunoblots ...... 23 2.4 Immunoprecipitation and in vitro kinase assay ...... 23 2.5 Mice ...... 25 2.6 Histology ...... 25 2.7 Detection of apoptosis in fixed tissues ...... 26 2.8 Detection of neutrophils and macrophages in fixed tissues ...... 27 2.9 Mouse bronchoalveolar lavage ...... 28 2.10 Extraction of apigenin from mouse liver ...... 28 2.11 Subcellular fractionation ...... 29 2.12 Preparation and analysis of samples via HPLC ...... 30 2.13 ELISA ...... 31 2.14 Mouse echocardiography ...... 31 2.15 Splenocyte isolation ...... 32 2.16 Flow cytometry of splenocytes ...... 32 2.17 Real-Time RTPCR ...... 33 2.18 Chemotaxis assay ...... 34 2.19 Graphing and statistical analysis ...... 35

vii Chapter 3 Apigenin modulates immune cell response to inflammatory agents in vitro ...... 36 3.1 Apigenin inhibits release of pro-inflammatory cytokines in vitro .... 37 3.2 Apigenin modulates IKK activity in vitro ...... 42 3.3 Apigenin indirectly modulates activity of the IKK kinase ...... 43 3.4 Apigenin modulates IKK kinase activity ...... 43 3.5 Apigenin modulates inflammation triggered by various Toll-receptor ligands in vitro ...... 44 3.6 Naringenin fails to modulate inflammatory response to LPS in vitro ...... 47 3.7 Modified apigenin molecules and anti-inflammatory activity in vitro ...... 49 3.8 Modified apigenin molecules and cellular permeability in vitro .... 50

Apigenin modulates response to inflammatory agents in vivo 3.9 Survival following a lethal dose of endotoxin in vivo ...... 53 3.10 TNFα in mouse serum ...... 54 3.11 Apoptosis in spleens ...... 54 3.12 Neutrophilia in lungs ...... 59 3.13 Cell death in lungs ...... 59 3.14 Chemokines in lungs ...... 63 3.15 Cardiac function ...... 65 3.16 Bioavailability of apigenin in mice ...... 65 3.17 Apigenin’s effect on chemotaxis in vitro ...... 69

Chapter 4 – Discussion ...... 72

Bibliography ...... 97

viii LIST OF FIGURES

Figure Page

1.1 Structure of drosophila, mammalian, and plant Toll-Like Receptors .... 4

1.2 Selected proteins of the Toll receptor pathways ...... 9

1.3 Representative chemical structures of flavonoids ...... 19

3.1 Apigenin inhibits release of pro-inflammatory cytokines ...... 38

3.2 Apigenin affects LPS-mediated activation of p65 ...... 41

3.3 Apigenin modulates inflammatory response to various Toll-Like Receptor Ligands ...... 46

3.4 Naringenin fails to inhibit release of pro-inflammatory cytokines ...... 48

3.5 Apigenin derivatives fail to modulate LPS-induced inflammation ...... 51

3.6 Glycosylation of apigenin modulates subcellular localization ...... 52

3.7 Apigenin rescues LPS-induced lethality in vivo ...... 56

3.8 Apigenin decreases concentration of TNFα in mouse serum ...... 57

3.9 Apigenin does not modulate apoptosis in spleens ...... 58

3.10 Apigenin modulates neutrophilia in the lungs of septic mice ...... 61

3.11 Apigenin modulates cell death in the lungs of septic mice ...... 62

3.12 Apigenin modulates chemokines in lung lavage and tissue of septic mice ...... 64

3.13 Apigenin modulates cardiac efficiency in mice ...... 67

ix 3.14 Apigenin is detected in urine and liver of mice after 1h ...... 68

3.15 Apigenin inhibits human neutrophil chemotaxis in vitro ...... 70

3.16 A model of the molecular and physiological mechanism of apigenin ...... 71

x CHAPTER 1

INTRODUCTION

1.1- Mammalian immunity and pathogenesis

The mammalian immune system consists of specialized cell types which are found systemically, and rid the organism of invading pathogens. The mammalian immune system can be divided into two classes - the innate immune system and the acquired immune system. Monocytes, macrophages, and neutrophils are cells of the innate immune system, responsible for the ‘first defense’ against invading pathogens. While both cell types are derived from the myeloid lineage of leukocytes, monocytes are further divided into the monocytic group, while neutrophils are divided into the granulocytic group. Both types are found in the circulating blood (1). Monocytes circulate in the blood of a healthy individual for approximately 24h before undergoing apoptosis, or programmed cell death (2). However, in an infected individual, these cells are able to detect a diversity of molecules called pathogen-associated molecular patterns (PAMPs), produced by or found on the surface of various pathogens (3). As such, unique receptor proteins, found on the plasma membrane and in the cytoplasm of macrophages and neutrophils, are capable of binding to these PAMPs and

1 activating a signaling cascade that directs the cell’s response to this pathogen.

These cells exit the blood vessel and enter the surrounding tissues where they differentiate into macrophages. Macrophages monitor surrounding tissues for infections; when a pathogen is detected, they are able to phagocytose and degrade the pathogen. In contrast to the mammalian system, in the face of predation and invading organisms, plants rely largely on structural defenses and chemical responses at the level of the individual cell which has been compromised (4). Regardless, both kingdoms of organisms require a mechanism of first detecting pathogens (5). Among the many newly- characterized families of pathogen recognition receptors, the Toll-like receptors are able to identify these various PAMPs (6).

Toll-like receptors (TLRs) are a family of membrane receptor proteins, conserved from plants to drosophila to mammals, fish and other vertebrates (7-

9). Currently, there are 5 Toll-like receptors identified in plants and 13 identified in mammals (6, 10). TLRs respond to many different PAMPs; those TLRs which have been identified in mammals respond to surface features of bacteria such as lipoproteins and lipopolysaccharides on Gram positive (via TLR1/2) and Gram negative bacteria [via TLR4, flagellin proteins (TLR5), or nucleic acids in the cytoplasm such as viral RNA (TLR3, 7, and 8) or DNA (TLR9)] (11-13). TLRs are

2 transmembrane glycoproteins consisting of extracellular multiple leucine-rich repeat (LRR) regions, and intracellular domains known as Toll/Interleukin-1

Receptor (TIR) domains (6). Both motifs are conserved across drosophila, plant, and mammalian TLRs. These motifs, and the conserved proteins discussed below, are described in subsequent sections, as well as in Figure 1.1.

3 D. melanogaster H. sapiens

leucine-rich repeat (LRR) domain

N- and C- terminal cysteine clusters

Toll-Interleukin receptor (TIR) A. thaliana homology domain

TIR nucleotide LRR binding site Tube MyD88 Pelle IRAK dTRAF6 TRAF6 DLAK IKK Adapted from Imler and Zheng et al J Leuk Bio 2004 and Means et al Life Sci 2000 Cactus IκB Dorsal NF-κB

Figure 1.1- Structure of Drosophila, mammalian, and plant Toll-Like receptors.

4 1.2- The TLR4 pathway

Upon ligand binding, the intracellular domains of the TLR4 receptor initiate

a signaling cascade by recruiting various proteins, which are well characterized in both drosophila and mammals. In mammals, the MyD88 protein associates with the TIR domain of most TLRs and recruits IRAK kinases 1 and 4 (IL-1 receptor associated kinase) (14-15). IRAK4-activated IRAK1 undergoes autophosphorylation, dissociation from MyD88, and association with TRAF6

(TNF receptor-associated factor 6), itself an ubiquitin ligase (15-18). Further ubiquitin-mediated associations take place between activated TRAF6 and a kinase complex composed of TAB1/TAB2/TAK1, whose downstream target is the

γ regulatory subunit of the IKK α//γ (Inhibitor of Kappa-B kinase) complex (16,

19). The IKK complex becomes activated upon the proteasomal degradation of

IKKγ (20). Selected proteins from the TLR pathways are shown in Figure 1.2.

Since much of the regulation of the immune response is controlled at the transcriptional level, activation of a membrane receptor and its subsequent signal cascade will culminate in the activation of one or several transcription factors.

One of the central transcription factors controlled by the Toll receptor family is

NF-κB (nuclear factor kappa B). The NF-κB family consists of several different complexes, each of which is able to control the expression of proteins including

5 pro-inflammatory cytokines, during inflammation (21-22). Current understanding of the various signaling cascades indicates that NF-κB complexes are created and activated via either the canonical or novel pathway. Active, heterodimeric

NF-κB complexes consist of one of three DNA-binding transcription factors

(p65/RelA, RelB, or c-Rel) and one of two non-DNA-binding regulatory subunits

(p50 or p52). Each transcription initiator contains a Rel homology domain (RHD) which allows for dimer formation and DNA binding, while each regulatory subunit contains a nuclear localization sequence (23). The canonical NF-κB pathway consists of the p50 and p65(Rel-A) complex, bound together with an inhibitory protein called IκB (inhibitor of kappa-B). Only after degradation of IκB can the p50/p65 complex interact with DNA to initiate transcription (24). When all three proteins are bound together, this inactive complex is found in the cytoplasm; however, ubiquitin-mediated degradation of IκB liberates the p50/p65 complex and allows it to translocate to the nucleus and initiate transcription (15-16, 25-26)

The degradation of IκB is initiated through a phosphorylation event, currently understood to be mediated in different ways by the kinases IKK and CK2 (27-30).

Conversely, the non-canonical NF-κB pathway involves post-translational proteolysis of a precursor protein p100, cleaved to produce the p52 subunit which is available to bind with either p65(RelA), RelB or c-Rel. p52/RelB dimers

6 are able to move immediately to the nucleus and initiate transcription, whereas

p52/c-Rel or p52/p65(RelA) dimers are bound by IκB and subsequently directed

to the canonical pathway (23). The IKK α/ kinase complex is a major modulator

of transcription factor NF-κB (nuclear factor kappa B) through these various

modes of activation. Interestingly, different IKK isoforms seem to play a role in both the canonical and non-canonical NF-κB pathways (23, 31-32). Recent observations have highlighted the possibility of a third activation pathway, which

involves direct phosphorylation of p65 but is independent of IκB (32-33). IKK is

specifically responsible for phosphorylation of p65 at ser276 and ser536, in both

LPS- and TNFα-mediated stimulation. Phosphorylation at ser276 is required for

recruitment of the chromatin remodeler p300/CBP, and phosphorylation at

ser536 is essential for complete LPS-mediated transcriptional activation (32).

The diversity of activation pathways may allow for more sensitive control of NF-

κB activity via multiple receptors/stimuli, or specificity of transcriptional targets.

Activated NF-κB then induces the expression of cytokines such as TNFα, IL-1,

and IL-8, which are responsible for subsequent activation of other immune cells,

and are shown to be upregulated in sepsis (34-35).

7 The following work will focus on the activation of NF-kB via phosphorylation of the p65 subunit, and the subsequent molecular and physiological effects.

8 TLR1 TLR4 TLR2 TLR2 TLR6

BTK TRAM MyD88 TIRAP

TRIF

IRAK1 IRF4

IRAK2 IRAK4 TLR3 TLR7/8 TLR9 NFB

TRIF MyD88 MyD88 UEV1A TRAF6 CK2 UbC13 TAB1

TAK1 TAK2 TBK TANK TRAF6 IRAK Ub P

IKK RIP IKK IKK Ub P

or IκB p65/ IKK IKKα p50 P RelA P

Figure 1.2- Selected proteins of the Toll receptor pathways.

9 1.3- Inflammation related disorders

Our understanding of organ failure due to invading pathogens has become more complex as our knowledge of the mammalian immune system has deepened. We now know that tissue damage often arises not from pathogen- associated toxins, but as a side-effect of our activated immune system (36).

Sepsis is a human clinical condition involving, at its inception, a localized bacterial, viral, protozoan, or fungal infection. Over the last three decades, 90% of human cases of sepsis with a defined pathogen source were attributed to either gram-negative or gram-positive bacteremia (a confirmed presence of bacteria in a tissue or blood sample) (37). The second feature of sepsis involves evidence of an activated immune system, namely elevated white blood cell count and abnormal body temperature, referred to as SIRS (systemic inflammatory response syndrome). Severe sepsis involves more serious clinical features, namely multi-organ failure (defined as three or more failing organs). This organ failure most often involves the lungs, followed by the cardiovascular system and the renal system (37). A subfamily of severe sepsis is septic shock, which involves infection, SIRS, and significant hypotension (<90 mm Hg) coupled with lactic acidosis and altered mental state.

10 Most noteworthy, the mortality rate of sepsis is between 30 and 50%; that

of severe sepsis and septic shock can be as high as 90% (38). Furthermore, the mortality rate of sepsis patients tripled between 1980 and 2000 (39). In a 2001 health report published by the Organisation for Economic Co-operation and

Development and reported by the Surviving Sepsis campaign

(www.survivingsepsis.org), there were more sepsis-related deaths than deaths

due to breast or colon cancer. As of 2001, sepsis ranked tenth in leading causes

of death in the United States (40). These statistics are still true, despite the fact

that 30 years have passed since sepsis has been recognized as a serious

disorder. Due to the identification of several risk factors in sepsis, supportive

care has yielded some successful treatments, directed at clinical symptoms but

not molecular mechanisms. Risk factors which strongly correlate with mortality in

sepsis are inadequate antibiotic treatment, existing medical conditions (such as

vascular disease, diabetes, and cancer) extreme hypotension, and neutrophil

deficiency (37, 41). Thus supportive treatments include antibiotics, correction of

changes in blood pressure, and minimalization of lung damage through lower

ventilator tidal volume (42). Molecular-based treatment options have met with

serious obstacles, namely the failure of in vitro successes to translate to the

clinic. More than 20 independent clinical trials have failed to improve mortality of

11 sepsis over the last 20 years. Those include anti-TNFα treatment (infliximab), inhibitors of adhesion molecules and enzymes involved in production of reactive oxygen species (ROS), ROS scavengers, and molecules which specifically target bacteria and endotoxins (43). Currently, activated protein C appears to be the most effective treatment, though its success rate is less than 7% (39). Thus, it is necessary to seek alternative medical options, as well as a more complete understanding of the molecular mechanisms of novel preventive and therapeutic compounds.

As mentioned previously, TLRs enable mammalian hosts to respond to a variety of pathogens, including gram negative and positive bacteria via TLR4 and

TLR2. Since bacterial infections have accounted for the vast majority of sepsis cases, the work described here will focus on the LPS-responsive TLR4 pathway and its potential therapeutic targets. Many model systems have been employed in order to characterize TLR4-related inflammation. Each of these models represents different subsets of sepsis-related disorders; therefore, the experiments performed with each model must be analyzed in context.

12 1.4- Experimental models of sepsis and sepsis- related disorders

Both in vitro and in vivo models of TLR4-mediated inflammation have

been used for decades. TLR4 is expressed on human and mouse monocytes

and macrophages, neutrophils, endothelial and epithelial cells (44-45). Thus,

freshly purified primary cells or immortalized cell lines such as THP-1 human

leukemias and RAW264.7 mouse macrophages can be stimulated with

commercially purified LPS or live bacteria in vitro in order to study innate immune

responses (30, 46-48). Similarly, mice and rats have been used in several types

of in vivo studies for the same purpose (49-51). Each in vivo model emulates a

different type of human sepsis. For example, both purified LPS and live bacteria can be administered intranasally (i.n.) or intratracheally (i.t.) to mimic human pneumonia and chronic/industrial septic lung injury (52-53). Other models of human sepsis use intraperitoneal (i.p) LPS, live bacteria, or cecal ligation and

puncture (CLP) to mimic bacteremia from bowel or other surgical interventions.

Lastly, both bacteria and LPS may be administered intravenously (i.v.) to

simulate an advanced systemic infection stemming from any of the

abovementioned injuries. As described, each model represents only a subset of

common outcomes, thus care must be taken in drawing conclusions using any

single model. Purified LPS is the standard choice in preliminary experiments due

13 to the fact that it is the simplest to implement and regulate. Doses of LPS are most easily quantified and regulated, and current supplies are guaranteed to be purely gram-negative, in contrast with live bacterial strains which are more difficult to quantify and regulate, and can easily become contaminated. The next experimental technique is the use of live bacteria, which more accurately mimics the reality of surgical infections. This is a more sophisticated model which incorporates bacterial motility, sensitivity to antibiotics, and ability to simulate a chronic condition. Of all in vivo models described here, i.p. LPS is a well- accepted initial model system because it is simple to implement and regulate, and is still representative of surgery-associated sepsis, which is a persistent and serious clinical problem.

Through the use of these models, as well as continuing human studies, many clinical features have been discovered. As mentioned previously, lung damage is the most frequent type of organ failure in human sepsis cases.

Sepsis-related lung injury in both human cases and animal models is marked by neutrophilia in the vasculature and epithelium, thickening of the alveolar walls and decrease of alveolar volume, protein leakage into the alveolar space, and cell death and breakdown in epithelial walls leading to diminished blood oxygen saturation (49-50, 54-56). While lung injury is the most common documented

14 organ failure in clinical sepsis, researchers have also turned their interest to the

spleen. A study of pediatric sepsis cases found evidence of consistent

lymphocyte apoptosis in septic children with multi-organ failure versus those without MOF (57). In a study of human sepsis victims versus traffic accident victims, it was noted that septic patients had significant levels of cell death in the spleen compared to those who had died from other causes (58). Subsequent work showed that rescue of this cell death, either through transgenic expression of anti-apoptotic molecules such as Bcl-2, inhibition of expression of pro- apoptotic molecules such as caspase-3 and knockout of caspase-1, or administration of pharmacological caspase inhibitors increased survival in mouse models of sepsis (59-62). It is not well understood how the loss of splenic B and

T lymphocytes impacts clinical outcome of sepsis; several published reports suggest that immune cells (macrophages or lymphocytes) which are charged with the task of phagocytosing these apoptotic bodies, become anergic or desensitized, and that apoptotic B cells from septic mice are able to inactivate peritoneal macrophages (62-63). While each of these studies propose valuable options for the treatment of sepsis and sepsis-related disorders, they are not without flaws; for example, untargeted inhibition of pro-apoptotic molecules would undoubtedly result in increased tumorigenesis. Thus, we turn our attention to

15 plant and natural compounds, as potential alternative therapies in the treatment

of sepsis and sepsis related disorders such as acute lung injury.

1.5- Plant immunity and pathogenesis

Plant response to pathogens and injury differs greatly from that of

mammals. While they lack circulating immune cells and a system of antibody

production, they employ effective means of defeating pathogens which include

construction of physical barriers around the wound site, strategic programmed

cell death, and production of proteins and chemicals with antimicrobial properties

(4). However, plants and animals share the same need for effective surveillance

of invading pathogens. Emerging evidence shows that plants are capable of

detecting the presence of PAMPs such as bacterial flagellin and LPS (64-66), and five orthologous TLRs have thus been identified (4). The next crucial step in plant defense often involves reserves of compounds called secondary metabolites (SMs) which serve as anti-microbial and anti-predatory molecules.

These molecules range from simple irritants/deterrents to compounds which intercalate DNA and disrupt membrane structure, mitochondrial function, and neural pathways – thereby protecting plants from microbes and herbivores (67).

16 SMs can be divided into three main families: flavonoids and other phenolic compounds, terpenes, and nitrogen- and sulphur-containing alkaloids (68). SMs have generated interest due to their long observed but newly characterized medical benefits such as anti-carcinogenic and anti-inflammatory effects (69-76).

For example, taxol is a terpene molecule discovered in the bark of the Pacific

Yew tree, which acts as a microtubule stabilizer and potent chemotherapeutic agent (77-78). Epigallocatechins (EGCs) which are found in various types of teas are shown to have potent anti-cancer effects (79). Resveratrol, a phenolic compound called a stillbene, has shown efficacy in the treatment and prevention of atherosclerosis and cholesterol-related disorders (68). Flavonoids have been specifically shown to be effective in models or patient studies of inflammatory bowel disease, sepsis, lupus, osteoarthritis, atherosclerosis, coronary heart disease, and cancers including breast, colorectal, pancreatic, lung, and leukemia

(25, 30, 73, 75, 80-86). Within the flavonoid family, there are six classifications based on structure: flavonols, flavones, flavan-3-ols, anthocyanidins, flavanones, and isoflavones. However, the basic structure of all flavonoids can be described as two benzene rings (rings A and B, Figure 1.3) bridged by a pyrane or pyrone ring (ring C, Figure 1.3). Representative structures are described in Figure 1.3.

Apigenin, a flavone, has generated considerable interest in anti-inflammatory

17 studies due to its ability to scavenge reactive oxygen species and inhibit

production of inflammatory signals (30, 51, 87-89). Apigenin aglycone or

glycosylated apigenin can be found in many common foods such as celery, fresh

and dried parsley, and vine spinach, fresh oregano and peppermint, artichokes,

hot green chili peppers, sage, rosemary, thyme, and chamomile tea. The

concentration extracted from these sources ranges from 4 µg/g of raw artichoke to 13 mg/g of dried parsley (90-93).

As mentioned previously, plant chemicals have attracted great interest due to their anti-proliferative, anti-cancer, and anti-inflammatory properties.

However, we have only recently begun to identify specific molecules from these sources, and describe the molecular mechanisms by which they are responsible for health benefits.

18 A. Flavonols

OH OH OH B B B OH O OH O OH OH O 2 2 2 OH A C 3 A C 3 A C 3 OH OH OH OH O OH O OH O

quercetin kaempferol taxifolin

B. Flavones OH OH B B OH O OH O 2 OH 2 A C A C 3 3

OH O OH O

apigenin luteolin

C. Flavanones OH B OH O 2 A C 3

OH O

naringenin

D. Apigenin glycosides

OH OH 8 OH O OH 7 2 OH OH OH OH 6 O 8 3 OH OH O O O 2 8 OH O 2 OH 7 O OH O 7 OH OH OH6 3 6 3 OH OH O OH OH O apigenin 7-O glycoside apigenin 6-C glucoside (isovitexin) apigenin 8-C glucoside (vitexin) (cosmosiin)

Figure 1.3- Representative chemical structures of flavonoids.

19 1.6- Goals of the research

Due to the effectiveness of flavonoids as anti-inflammatory molecules, and the need for alternative treatments in sepsis, we have endeavored here to understand the molecular and physiological mechanisms of apigenin in an in vitro

and in vivo model of human sepsis. We will demonstrate that apigenin inhibits

the activation of the inflammatory cascade via the NF-κB transcription factor,

through inhibition of the IKK kinase; apigenin is effective in modulating the

inflammatory response in vitro to various Toll ligands, and the chemotactic

response of activated immune cells in vitro; glycosylated apigenin compounds can neither modulate the inflammatory response, nor enter cells in vitro; apigenin rescues sepsis-related mortality in vivo, and modulates immune cell infiltration and cell death in lungs but fails to modulate cell death in spleens; that apigenin modulates expression of chemotactic proteins and cardiac efficiency in vivo; and

finally, that apigenin is found in the liver and urine in a mouse model of sepsis.

20 CHAPTER 2

MATERIALS AND METHODS

2.1- Reagents

Apigenin (#A3145), naringenin, and lipopolysaccharide (LPS; #L3880,

serotype 0127:B8, 1x106 EU/mg) were purchased from Sigma (St. Louis, MO).

Toll Receptor ligands were purchased from InvivoGen (San Diego, CA).

Apigenin 6-O glucoside (isovitexin) was purchased from Extrasynthese (France).

2.2- Purification of human monocytes and neutrophils

The purification of monocytes was performed as in (30). In brief, Blood donors were obtained from the American Red Cross (Columbus, OH) or from normal volunteers, following the protocols approved by an appropriate institutional review committee. Human monocytes were purified by clumping, on average 70–80% pure as estimated by flow cytometry. Briefly, fresh human monocytes were diluted 1/1 with sterile saline solution and subsequently centrifuged through a Histopaque-1077 gradient column (Sigma-Aldrich) at 600 x g for 20 min at 4°C. The mononuclear layer was removed, washed, and spun twice in RPMI 1640 (Invitrogen). The cells were resuspended in RPMI 1640/10%

21 FBS (HyClone) at a concentration of 5 x 107 cell/ml. Cells were rotated at 70 rpm

on a horizontal rotor for 1 h at 4°C to induce clumping and then sedimented by

gravity for 20 min through FBS at 4°C. The sedimented cells were subsequently

washed twice in RPMI 1640. Purification of neutrophils was adapted from (94).

In brief, approximately 40 mL blood was drawn from a human volunteer into a 60

mL syringe containing 6 mL sodium citrate. Blood was transferred from the

syringe into a graduated cylinder containing 15 mL of 6% dextran in warm saline,

inverted twice, and incubated at room temperature for 30 minutes. Following

phase separation, the top phase (containing neutrophils) was placed in a conical

tube and centrifuged at 150 x g for 10 minutes at room temperature. The pellet

was carefully resuspended in a final volume of 35 mL cold saline. 8 mL of cold

Ficoll-Paque (GE Healthcare, Piscataway NJ) was added to the bottom of the

tube and the tube was centrifuged at 700 x g for 15 min at 4°C. The pellet, containing neutrophils, was resuspended in 1 mL cold saline. Red blood cells were lysed in 20 mL ice cold sterile water for 40 seconds, and osmotic balance was restored by adding 20 mL 1.8% NaCl and mixing gently. Cells were centrifuged at 700 x g for 3 min at 4°C. The pellet was resuspended in 1 mL of cold Hank’s Balanced Salt Solution (HBSS with 10 mM HEPES) and kept on ice.

22 2.3- Immunoblots

For Western blot analyses, cells were lysed for 30 min on ice in lysis buffer (50 mM Tris, 10 mM EDTA 0.5% Nonidet P-40, 10 mM Na- glycerophosphate, 5 mM Na-pyrophosphate, 50 mM NaF, 1 mM orthovanadate,

1 mM DTT, 0.1 mM PMSF, 2 µg/ml of protease inhibitors: chymostatin, pepstatin, antipain, and leupeptin). Cell lysates were centrifuged (14,000 x g for 10 min at

4°C) and the supernatants were stored at -70°C for future analysis. Equal amounts of protein were loaded and separated by SDSPAGE, transferred onto nitrocellulose membranes and probed with antibodies of interest followed by HRP conjugated secondary antibody and visualized by ECL (Amersham Biosciences).

The following antibodies were used: -tubulin (#05-661; Upstate), IkBα (#371;

Santa Cruz), NF-κB p65-phospho-Ser536 (#3033; Cell Signaling), NF-κB p65

(#372; Santa Cruz Biotechnology), IKKα (sc-7218, clone H-744; Santa Cruz

Biotechnology) and IKK (sc-8014, clone H-4; Santa Cruz Biotechnology).

2.4- Immunoprecipitation and in vitro kinase assay

RAW 264.7 macrophages were lysed in buffer L (20 mM Tris pH 8.0, 0.5

M NaCl, 0.25% Triton-X-100, 1 mM EDTA, 1 mM EGTA, 10 mM p-nitrophenyl phosphate (PNPP), 300 µM Na2VO4, 10 mM NaF, 10 mM -glycerophosphate, 1

23 mM benzamidine, 1 mM DTT, 1 mM PMSF, and 2 µg/ml each of chymostatin,

leupeptin, antipain and pepstatin A). Lysates were diluted 1:1 in IP buffer (20 mM

Tris pH 8.0, 250 mM NaCl, 0.05% Nonidet P-40, 3 mM EDTA, 3 mM EGTA

containing DTT, PMSF, protease and phosphatase inhibitors as mentioned

above). 250 µg of protein was immunoprecipitated with 1 µg of anti-IKKγ Abs

(Santa Cruz, clone sc-8330, clone FL-419) and 20 µl of protein A Sepharose beads (#17-0780-01; GE Healthcare Life Sciences). Beads were washed 5 times with IP buffer followed by kinase buffer [KB: 150 mM HEPES (pH 7.6), 20 mM MgCl2, DTT, PMSF, protease and phosphatase inhibitors as described

above]. For overexpression experiments, lysates from cells transfected with

pCMV2- pFLAG IKKα, IKK or vector control and treated with LPS (100 ng/ml)

for 60 min or with LPS and apigenin were used for Western analysis using the

aforementioned antibodies. IKKα and IKK clones were obtained from Drs. R.

Gaynor and Y.T. Kwak (95). Kinase reactions were performed in 45 µl of KB

buffer in the presence of 500 µg of recombinant GST-p65:277–550, 20 µM ATP,

and 5 µCi of [γ-32P]ATP for 30 min at 30°C. In experiments performed to evaluate

the direct effect of apigenin on IKK, different concentrations of apigenin in KB

buffer were added to the immunoprecipitates. Mixtures were incubated for 30 min

at 30°C prior to the addition of GST-p65 and ATP. The reactions were stopped

24 by addition of 5x SDS-PAGE Laemmli buffer and boiling for 5 min.

Phosphorylated proteins were visualized by autoradiography. The same

membranes were immunoblotted with the anti-IKKγ (BD Biosciences; clone C73–

1794) and anti-phospho-p65-ser536 (as above).

2.5- Mice

Male C57/BL6 wild-type mice (aged 6-8 weeks) were purchased from

Jackson Laboratories and housed according to IACUC regulations of the Ohio

State University. Mice were weighed and injected intraperitoneally (i.p.) with 50

mg/kg apigenin or appropriate diluent controls, in 100 µl total volume, 3 h or 1h

prior to, or concurrent with, a lethal dose of LPS (37.5 mg/kg) or DMSO/PBS

control, in 200-300 µl total volume.

2.6- Histology

All tissue samples were fixed in 10% low-odor formalin, embedded in

paraffin, and cut in 4-5 µm sections (HistoTechniques, Powell OH). Sections

were examined under 1000x oil immersion using an Olympus BX40 microscope

(Olympus America, Center Valley PA), and Optronics DEI 750D CE digital output camera and acquisition software (Goleta CA). Data are expressed as number of

25 positive cells per 1000x field (cells per field, cpf). A minimum of 10 fields per

animal were examined.

2.7- Detection of apoptosis in fixed tissues

Mouse spleen and lung tissue, harvested at 24 h, was assayed for

apoptosis using TUNEL (terminal deoxyuridine nick end labeling) and

immunohistochemistry (IHC). TUNEL was performed with the ApopTag Plus

apoptosis detection kit (#S7101, Chemicon/Millipore; Billerica MA) according to

manufacturer’s directions. IHC for active caspase-3 was performed as follows:

sections were de-waxed for 25 min at in a 57°C dry oven followed by a 2 min

xylene rinse, rehydrated in sequential 2 min washes in 100%-95%-80% ethanol

and incubated at room temperature in deionized water until ready for IHC. Slides

were then placed in antigen retrieval solution (#H3300; Vector Labs; Burlingame

CA) in a vegetable steamer for 30 min, then blocked with PBS containing 5% goat serum (Gibco) for 1 h at room temperature in a humid chamber. Slides

were probed with primary antibody against cleaved caspase-3 (#9661, Santa

Cruz Biotechnology) diluted 1:200 in PBS/0.5% goat serum, for 2 h at room temperature in a humid chamber. Slides were then rinsed 3x in PBS/0.1%

Tween-20 followed by 1 rinse in plain PBS, then probed for 30 min with

26 biotinylated secondary antibody (Vectastain ABC secondary antibody kit;

PK6101, Vector Labs) at 1:200 in PBS/5% goat serum. Slides were again rinsed as above and incubated with ABC solution (prepared as 2% reagent A, 2% reagent B, in 1 mL PBS) for 30 min at room temperature in a humid chamber.

Finally, slides were developed in DAB solution containing 2% DAB buffer, 4%

DAB chromogen, and 2% H2O2 in deionized water (DAB staining kit, SK-4100,

Vector Labs). Slides were incubated in working DAB solution for approximately 1

min, or until color developed. Slides were dehydrated in sequential 2 min

washes in 80%-95%-100% ethanol followed by a 2 min xylene wash, then

coverslipped with Permount (Fisher Scientific).

2.8- Detection of neutrophils and macrophages in fixed tissues

Lung tissue was fixed, embedded, and sectioned as above. To identify

neutrophils, IHC was performed using 7/4 antibody (1:100; AbSerotec, Raleigh

NC), and napthol AS-D chloroacetate esterase (CAE) assay was performed

according to manufacturer’s instructions (Sigma, #91C-1KT) (96). Macrophages

were identified using the F4/80 antibody (MCAP497; 1:100; AbSerotec, Raleigh

NC).

27 Slides were examined under 1000x oil as above and results were reported

as cpf. A minimum of 10 fields per animal were examined.

2.9- Mouse bronchoalveolar lavage

Bronchoalveolar lavage fluid (BALF) was collected at various timepoints

as previously described in (97). Briefly, mice were asphyxiated with CO2 and a pneumothorax was performed. The trachea was exposed and cannulated, and lungs were inflated with 0.5 mL cold phosphate buffered saline (PBS). The left lung was immediately ligated and then fixed in formalin after lavage was complete. The remaining lobes were lavaged a total of 3 times with 0.5 mL PBS, then resected, blotted dry, and snap-frozen.

2.10- Extraction of apigenin from mouse liver

Livers were harvested from mice at 24 h after LPS treatment. Livers were resected, rinsed once in 1x cold PBS, blotted on paper towel, and snap-frozen in liquid nitrogen. Tissue was processed as described by (98), in the following manner: 50 mg of tissue was homogenized in 1 mL H2O plus 2 mL 0.1M acetic

acid in acetone. Then, 200 µL of homogenate was removed and centrifuged at

16,000 x g for 10 minutes at room temperature; the supernatant was transferred

28 to a glass vial and dried under nitrogen for approximately 2 h. The resulting

precipitate was redissolved in 1 mL sodium acetate buffer (1.25 M sodium

acetate dehydrate, 135 mM acetic acid in H2O, pH 5.5) by vortexing and

sonication. One mL of 10% -glucuronidase enzyme (#10127060001, Roche;

Bazel, Switzerland) was added to the sample which was then incubated at 37°C

for 3h. After incubation, 5 mL diethyl ether was added to induce phase

separation and the ether layer collected in a clean glass vial. This process was

repeated once, and the combined layers dried under nitrogen for 30 min. The

sample was redissolved in 350 µL HPLC grade methanol by vortexing and

sonication, filtered through a 0.45 µm nylon filter, and analyzed using HPLC.

2.11- Subcellular fractionation

1 x 107 RAW mouse macrophages were harvested and lysed in KPM

buffer (50 mM KCl, 50 mM PIPES, 10 mM EGTA, 1.92 mM MgCl2, pH 7.0, 1 mM

DTT, 0.1 mM PMSF, 10 μg/ml of cytochalasin B and 2 μg/ml of protease

inhibitors: chymostatin, pepstatin, leupeptin, antipain) using a freeze-thaw technique (5 cycles). Lysates were transferred to heavy wall polycarbonate ultracentrifuge tubes (Beckman, #343778) and covered with approximately 100 µl of mineral oil. Samples were centrifuged at 100,000 x g for 1 h at 4°C. Oil was

29 carefully removed with a pipette, and supernatant (cytoplasmic fraction) was

transferred to a clean tube. The pellet (membrane fraction) was resuspended in

50 µl DMSO. Both fractions were stored in -80°C for HPLC analysis.

2.12- Preparation and analysis of samples via HPLC

Mouse urine, cell lysates, and media were prepared for HPLC analysis in

the following manner: 200 µl sample was mixed with 200 µl ice cold acetonitrile

and vortexed. Mixture was centrifuged for 10 min at 10,000 rpm at RT.

Supernatant was evaporated under N2 and reconstituted in 300 µl methanol, and

filtered through a 0.45 µm nylon filter into a glass Waters HPLC vial. The mobile phase consisted of the following solvents: A: 0.1% formic acid in water, and B:

0.1% formic acid in acetonitrile. 20 µl of sample was injected at a flow rate of 0.8

mL/min, using the following method: 95% A:5% B  0% A:100% B over 19 minutes. A 250 mm MacMod C18 column was used, with an inner diameter of 3 mm and a particle size of 5 µm. Samples were analyzed using a Waters Alliance

2695 Separations Module and a Waters 2996 Photodiode Array Detector.

Results were analyzed using Empower Pro 5.0 software.

30 2.13- ELISA

In in vitro studies, ELISAs were performed as described in (30). In mouse studies, BALF was collected at 2, 3, 6, and 12 hrs, and analyzed via enzyme- linked immunosorbent assay (ELISA) for the following cytokines: mouse

CXCL1/KC (R&D DuoSet #DY453), mouse MCP1 (BD OptEIA, BD Biosciences

#555260), mouse CXCL2/MIP2 (R&D DuoSet #452). Analysis was performed using a 4-parameter logistic equation and reported as pg/mL of BALF.

2.14- Mouse echocardiography

Echocardiograms were performed at 24 h post LPS. Mice were anesthetized under 5% isoflurane (IsoFlo, Abbot Laboratories, Chicago IL) and the chests shaved. Cardiac function was assessed using a GE Vivid 7

Dimension ultrasound imaging system via a 13-MHz linear array transducer (GE

Healthcare, Milwaukee, WI; software version 3.4.2). Left ventricular M-mode measurements were taken with a sweep rate of 200 mm/s. Left ventricular (LV) fractional shortening (%FS) was calculated using the following formula:

%FS = (LVIDd – LVIDs)/ LVIDd] x 100

31 where LVIDd = LV end-diastolic internal diameter and LVIDs = LV end-systolic

internal diameter. Each data point represents an average of three cardiac

cycles.

2.15- Splenocyte isolation

Fresh spleens were resected from mice at 24 h post LPS. A 1-mm slice

was cut from the tip of the spleen and flat forceps were used to gently scrape cells out through the opening into a nylon cell strainer (BD Falcon #352360,

Franklin Lakes NJ). Splenocytes were rinsed through the strainer into a Petri dish using ice cold 1x PBS and spun at 200 x g for 5 min at 4°C, then resuspended in 1 mL distilled H2O for 30 seconds to lyse red blood cells. 220 µL

of 10x PBS was then added to re-establish osmotic balance, then cells spun at

200 x g for 5 minutes at 4°C. Cells were resuspended in 1 mL PBS, counted in a

hemacytometer, and aliquotted for flow cytometry.

2.16- Flow cytometry of splenocytes

Cell death in splenocytes was analyzed as described below. T and B cells

were identified with anti-CD3-APC (BD Pharmingen, #553066) or anti-B220-APC

(BD Pharmingen, #553092), and stained with annexin V/propidium iodide

32 (#556570, BD Biosciences, San Jose CA). 2 x 105 cells were resuspended in

100 µL annexin staining buffer + 0.5% fetal bovine serum (FBS). A 100µL master mix containing 3 µL annexin-V, 1 µL PI, and 2 ng/µl of either CD3-APC or

B220-APC was added to the cells, followed by a 15- minute incubation at room temperature, protected from light. Cells were rinsed with 400 µL of 1 x PBS and centrifuged at 800 x g for 3 min at 4°C, resuspended in 400 µL of 1 x annexin staining buffer + 0.5% FBS, and analyzed via flow cytometry (BD Biosciences

FACS ARIA; FCS Express V3 software).

2.17- Real-Time PCR (RT-PCR)

Frozen lung tissue was pulverized in liquid nitrogen-cooled mortar and pestle, and aliquotted for protein and RNA extraction. RNA was extracted with

Trizol (Sigma) and cDNA made using ThermoScript RTPCR system (#11146,

Invitrogen; Carlsbad, CA). The following genes were examined via RT-PCR, with the following primer sets: KC (forward, 5’- GCAGACCATGGCTGGGATT – 3’; reverse, 5’ – CCTGAGGGCAACACCTTCAA – 3’), MCP1 (forward, 5’ –

TCTTCCTCCACCACCATGC – 3’; reverse, 5’ – TCATTGGGATCATCTTCGTGG

– 3’), MIP2 (forward, 5’ – CTCAAGGGCGGTCAAAAAGTT – 3’; reverse, 5’ –

TGTTCAGTATCTTTTGGATGATTTTCTG – 3’), COX2 (forward, 5’ –

33 CAGCCAGGCAGCAAATCC – 3’; reverse, 5’ – ACATTCCCCACGGTTTTGAC –

3’), p-selectin (forward, 5’ – AATGCTCCGAATTGCACATG-3’; reverse,

5’TTCCCCAGGGATTGGAACA – 3’), e-selectin (forward, 5’ –

CTCCTGCGAAGAAGGATTTGA – 3’; reverse, 5’–

CCCCTCTTGGACCACACTGA – 3’), and the GAPDH housekeeping gene

(forward, 5’-ACTTTGGTATCGTGGAAGGACT-3’ and reverse, 5’-

GTAGAGGCAGGGATGATGTTCT-3’). Data are reported as relative copy number (RCN) which was calculated as 100 x 2ΔCt.

2.18- Chemotaxis assay

Neutrophils were pre-incubated with varying doses of apigenin at 1 x 106 cells/mL, in 4 mL cell resuspension buffer (RPMI-1640 with 0.5% BSA) for 30 min in a 37°C water bath. Cells were then spun at 150 x g for 10 minutes and resuspended in warm cell resuspension buffer at a concentration of 250 cells/µL.

Well inserts from a 5 µm-pore 24-well Transwell plate (#3421, Costar; Corning,

NY) were equilibrated in cell resuspension buffer for 30 min, then aspirated dry and set in wells immediately prior to the addition of cells. Recombinant human

CXCL8 (R&D Systems, Minneapolis MN) was used as a chemoattractant, resuspended in chemotaxis buffer (RPMI1640 with 5% BSA) at a final

34 concentration of 20 nM. 500 µL chemotaxis buffer (with chemoattractant) was

placed in each bottom well, and the equilibrated inserts were set into the wells.

200 µL cells were added to each insert and the plates were incubated for 1.5 h at

37°C, 5% CO2. Following incubation, inserts were carefully discarded and the cells in the bottom wells were enumerated microscopically.

2.19- Graphing and statistical analysis

Kaplan-Meier analyses, Student’s T-test, and one-way ANOVA with

Dunnett's or Bonferroni’s post tests were performed using GraphPad Prism version 4.00 for Windows, GraphPad Software, San Diego California USA, www.graphpad.com. Chemical figures were created in ChemSketch, Advanced

Chemistry Development (available at www.acdlabs.com).

35 CHAPTER 3

Apigenin modulates immune cell response to inflammatory agents in vitro

Cells of the immune system are capable of detecting and responding to a wide variety of invading pathogens of bacterial, viral, protozoan, and fungal origins. Specialized receptors on their plasma membrane, called Toll-like receptors (TLRs), allow for this type of diverse response. The ultimate result of

TLR signaling is the expression of pro-inflammatory cytokines which serve to mediate the responses of the innate and acquired immune system. While these pathways are necessary to protect the organism, many human disorders are characterized by an excessive immune response. Apigenin, a plant polyphenolic compound of the flavonoid family, is effective in reducing the expression of pro- inflammatory cytokines in stimulated immune cells. Initial experiments described apigenin’s effects in a model of TLR4 stimulation, and provided preliminary insight into apigenin’s mechanism of action. Thus, the experiments described here will endeavor to more fully characterize apigenin’s molecular mechanism in vitro, and describe its physiological effects in an in vivo model of human sepsis.

36 3.1 Apigenin inhibits release of pro-inflammatory cytokines in vitro

Activation of the TLR4 signaling cascade results in activation of the NF-κB transcription factor, through several aforementioned pathways. NF-κB controls the expression of various pro-inflammatory cytokines including TNFα, IL-1, and

IL-8. In previous work, it has been shown that apigenin is able to inhibit LPS- stimulated production of the pro-inflammatory cytokines TNFα, IL-1, and IL-8

(30). Freshly purified human monocytes and immortalized mouse macrophages were stimulated with LPS and treated with apigenin for 18 h, and the culture media analyzed for release of TNFα, IL-1, and IL-8 protein. Both concurrent treatment and a 1h pre-treatment with apigenin significantly reduced the release of the aforementioned pro-inflammatory cytokines (Figure 3.1). Apigenin treatment alone did not result in release of these proteins, whereas LPS treatment alone stimulated a robust and significant release of all three cytokines.

Subsequent experiments examined the expression level of TNFα, IL-1, and IL-

8, as well as the activation status of NF-κB itself, since it is known that NF-κB controls expression of these cytokines (24, 99). Via RT-PCR, it was shown that

LPS alone induces the expression of TNFα, IL-1, and IL-8, and concurrent treatment with apigenin resulted in decreased expression of all three cytokines

[data not shown; ( 3 0 )]. 37 Figure 3.1.- Apigenin inhibits release of pro-inflammatory cytokines. Cytokines were determined in supernatants of human primary monocytes cultured for 18h left untreated, treated with 10 ng/ml of LPS alone and with different doses of apigenin alone (white bars), with LPS and apigenin administered at the same time (black bars) or LPS added 1h prior to the addition of different doses of apigenin (grey bars). A, IL-1. B, TNF-α. C, IL-8. Values represent means ± SEM (N=5, *p<0.001, #p<0.05 compared with LPS alone).

38 Next, the activity of the NF-κB transcription factor was examined via a reporter assay, showing that LPS alone induces activity of the transcription factor, and co- treatment with apigenin significantly reduces its activity. Since NF-κB activity can be regulated at the level of IκB degradation, DNA binding, and phosphorylation of p65, experiments were performed to test these scenarios. Mouse macrophages were treated with LPS alone or concurrently with apigenin, and the lysates examined via immunoblot for degradation of the inhibitory IκB subunit. LPS treatment resulted in the disappearance of IκB over time, and apigenin co- treatment did not affect the degradation of IκB [data not shown; (30)]. This suggests that, while apigenin appears to affect the activity of NF-κB, it is not through the protection of IκB. Similarly, electrophoretic mobility shift assay

(EMSA) demonstrated that while LPS stimulates binding of NF-κB to DNA, apigenin co-treatment does not affect NF-κB’s ability to bind DNA. As described in the introduction, an alternative NF-κB activation pathway exists which involves phosphorylation of the p65 subunit. Thus, the next experiments aimed to determine whether apigenin modulates NF-κB activity via this phosphorylation event. Mouse macrophages were treated with LPS alone or in combination with apigenin, and the cell lysates examined via immunoblot for total and phospho-

NF-κB-p65 subunit (Figure 3.2A). The results indicate that, while LPS induces

39 phosphorylation of p65-Ser536, co-treatment with apigenin decreased phosphorylation of this residue. This experiment suggests a possible mechanism by which apigenin inhibits the release of inflammatory cytokines through inhibition of the NF-κB transcription factor.

40

FIGURE 3.2- Apigenin affects LPS-mediated activation of p65. A, Lysates of mouse macrophages left untreated (NT), treated with LPS (100 ng/ml), or LPS and apigenin (25 µM) for different lengths of time were immunoblotted with anti-phospho-Ser536 p65 Abs. The same membrane was immunoblotted with anti-p65, and anti--tubulin Abs. B, Macrophage lysates left treated for 60 min with LPS (100 ng/ml) or LPS and apigenin (25 µM) were immunoprecipitated with anti-IKKγ or an isotype control. Immunoprecipitates were subjected to in vitro kinase assays in the presence of GST- p65 and [γ-32P]ATP. Kinase reactions were resolved by SDS-PAGE. Phospholabeled GST-p65 was visualized by autoradiography. The same membrane was immunoblotted with anti-GST Abs and anti- IKKγ Abs. C, Lysates of macrophages treated with LPS (100 ng/ml) were immunoprecipitated with anti-IKKγ or an isotype control. Immunoprecipitates from LPS-stimulated cells were treated with different doses of apigenin for 30 min and subjected to in vitro kinase assays in the presence of GST- p65 and [γ-32P]ATP. Phospholabeled GST-p65 was visualized by autoradiography. The same membrane was immunoblotted with anti-IKKγ Ab. D, Lysates of macrophages expressing a vector control, IKKα or IKK and treated with 100 ng/ml LPS or LPS and 25 µM apigenin for 60 min were immunoblotted with anti-phospho-Ser536 p65 Abs. The same membrane was immunoblotted with anti-p65, anti-IKKα, or IKK Abs. All data shown are representative of three independent experiments.

41 3.2 Apigenin modulates IKK activity in vitro

Apigenin was able to prevent phosphorylation and subsequent activation of the transcription factor NF-κB in LPS-stimulated human monocytes and mouse macrophages. It is known that IKK phosphorylates NF-κB-p65-Ser536, and stimulates transcriptional activity (32-33). Therefore, to determine the effect of apigenin on the NF-κB pathway, mouse macrophages were treated concurrently with 100 ng/mL LPS and 25 µM apigenin for 16 h. The cells were harvested and lysed, and an immunoprecipitation against IKKγ (regulatory subunit of the IKK

α//γ complex) was performed. The IKK complex was used in a subsequent in vitro kinase assay, with GST-tagged NF-κB-p65 subunit as an exogenous substrate. The complex was incubated with [γ-32P]ATP and subject to SDS-

PAGE. We found that as previously published, LPS treatment alone induced IKK kinase activity (Figure 3.2B, lane 2); treatment with apigenin significantly reduced

IKK activity [Figure 3.2B, lanes 2 and 4] (31). Immunoblot using anti-GST indicates equal loading. Thus, it was determined that apigenin inhibits LPS- induced IKK activity.

42 3.3 Apigenin indirectly modulates activity of the IKK kinase

To determine if apigenin had a direct inhibitory effect on the IKK kinase

itself or with an upstream modulator, the IKK complex was immunoprecipitated from mouse macrophages which were stimulated with 100 ng/mL LPS for 90 min.

The immunoprecipitated complex was then incubated for 30 min in the presence of increasing doses of apigenin. Following this incubation, the complexes were subjected to an in vitro kinase assay using [γ-32P]ATP and GST-NF-κB-p65,

followed by SDS-PAGE and autoradiograph. Results show that despite

increasing doses of apigenin, ranging from 0.01 to 50 µM, had no effect on LPS-

stimulated in vitro kinase activity (Figure 3.2C). Immunoblot using anti-IKKγ

antibodies shows equal input. These results suggest that apigenin modulates

activity of the IKK kinase through an indirect mechanism.

3.4 Apigenin modulates IKK kinase activity

The IKK kinase complex consists of two isoforms, IKKα and IKK (32).

We examined apigenin’s effect on both isoforms of IKK. RAW mouse

macrophages were transiently transfected with plasmid constructs containing

either IKKα or IKK, controlled by a constitutively active CMV promoter. Twenty-

four hours after transfection, cells were stimulated with 100 ng/mL LPS

43 concurrently with 25 µM apigenin or diluent control for 1 h to show

phosphorylation of NF-κB-p65-Ser536, then harvested and lysed. In Figure

3.2D, immunoblot against IKKα or IKK in the corresponding cell lines shows

equal expression of both isoforms. To determine activity of each isoform,

immunoblot was performed using anti-NF-κB/p65 and anti- NF-κB-p65-Ser536

antibodies. Results show that, in vector-transfected control cells, LPS induces

phosphorylation at Ser536 of NF-κB, while co-treatment with apigenin attenuates

this phosphorylation. In cells transfected with IKKα, LPS stimulation induces

phosphorylation of p65 and apigenin co-treatment attenuates this

phosphorylation, despite excess IKKα. Conversely, in cells transfected with

IKK, LPS stimulates a significant increase in phosphorylation of p65, but

apigenin is unable to inhibit this phosphorylation in the presence of excess IKK.

Therefore, it is suggested that apigenin modulates the activity of the IKK kinase.

3.5 Apigenin modulates inflammation triggered by various Toll-receptor

ligands in vitro

As mentioned previously, the innate immune system can be stimulated via

various ligands, each able to bind to its own unique TLR. To determine if apigenin modulates release of TNFα induced by different Toll ligands, RAW cells 44 were treated concurrently with various Toll-like receptor ligands (TLR ligands) or diluent controls, and 25 µM apigenin, for 8 h. Cells treated only with diluent controls (shown in Figure 3.3 C, D, and E) show no stimulation. RAW cells demonstrated a dose-dependent increase in TNFα release following treatment with TLR2, 3, 4, 7/8, and 9 ligands, compared to cells treated with diluent controls (Figure 3.3). In cells concurrently treated with 25 µM apigenin and ligands for TLR 2, 3, 4, and 7/8, TNFα release is significantly reduced by 50-

60%. This suggests that apigenin’s intracellular target may be a protein which is shared commonly amongst the four pathways. However, it appears that apigenin failed to modulate cytokine release mediated by the TLR9 ligand. As discussed later, it appears that TLR9 does not utilize IKK, which may explain the lack of effect of apigenin treatment. Since apigenin was effective against a TLR3 ligand, among others, it appears that apigenin may not target MyD88 or the IRAKs, because none of those proteins participate in the TLR3 signaling pathway.

45 Figure 3.3- Apigenin modulates inflammatory response to various Toll-Like Receptor Ligands. RAW mouse macrophages were stimulated with various TLR ligands at the indicated doses, for 8 h, concurrent with 25 µM apigenin or diluent control. A, Pam3cysSK, ligand for TLR2; B, LTA, ligand for TLR2; C, Poly I:C, ligand for TLR3; D, R848, ligand for TLR7/8; E, ODN1826, ligand for TLR9. Data represent mean ± SEM, n≥6. 46 3.6 Naringenin fails to modulate inflammatory response to LPS in vitro

Naringenin and apigenin share nearly identical structures, save for a double bond that exists between the 2- and 3- carbon of apigenin’s C ring.

Published work indicates that, compared to other flavonoids, naringenin is unable to induce apoptosis in several cell types (75, 100). While apigenin has been shown by us and others to reduce the amount of TNFα release following LPS treatment in vitro, we had not yet tested if naringenin was similarly capable.

RAW cells were concurrently treated with LPS and increasing doses of naringenin. After 8 h, cell media was harvested and analyzed for TNFα release.

In Figure 3.4, we see that LPS stimulates a robust release of TNFα, and apigenin attenuates the release of TNFα. Conversely, increasing doses of naringenin fail

to modulate this response. Thus, naringenin, a molecule which is nearly identical

to apigenin, fails to modulate the inflammatory response to LPS. Therefore, it

appears that the ability to modulate inflammatory response may be specifically

related to structure.

47 TNFα

Figure 3.4- Naringenin fails to inhibit release of TNFα. RAW mouse macrophages were treated concurrently with 100 ng/mL LPS and various doses of naringenin or diluent control for 8 h. TNFα release in media was measured via ELISA. Data represent mean ± SEM, n=5.

48 3.7 Modified apigenin molecules and anti-inflammatory activity in vitro

Various apigenin derivatives and metabolites exist, and have been studied

in nutrition and inflammation. As shown partly in Figure 1.3, flavonoids can exist

in nature as glycosylated compounds, and can be further modified through

deglycosylation, methylation, sulfonation, or hydroxylation, by metabolic enzymes

in vivo. Thus, we aimed to determine whether modified derivatives of apigenin

would be equally effective as the aglycone at reducing the inflammatory

response. In Figure 1.3, three types of glycosylated apigenin are shown. RAW

mouse macrophages were treated concurrently with 100 ng/mL LPS and varying

doses of the glucoside isovitexin. Figure 3.5 shows that, while untreated cells release nearly undetectable levels of TNFα over 8 h, LPS stimulated RAW cells show robust TNFα release, and co-treatment with 50 µM apigenin significantly

reduces the amount of TNFα release. Importantly, doses of isovitexin at 50 and

100 µM fail to inhibit TNFα release. Only a dose of 250 µM (five times that of

apigenin aglycone) is able to inhibit the release of the cytokine. A previously

published study reported that isovitexin was able to modulate nitric oxide (NO)

release and NF-κB activity; however, the levels of TNFα were not reported (48).

49 3.8 Modified apigenin molecules and cellular permeability in vitro

Next, RAW cells were stimulated with LPS and treated with isovitexin in order to determine the ability of modified apigenin compounds to enter the cell.

Cells were stimulated for 8 h with LPS and treated concurrently with 50 or 100

µM isovitexin or apigenin, or appropriate diluent controls. Media was harvested and cells were rinsed and fractionated via S100 centrifugation, for subsequent

HPLC analysis. Results show that after 8 h, approximately 50% of the total recovered apigenin is found inside the cell, and 50% in the tissue culture media.

Conversely, between 0 and 10% isovitexin was found inside the cells, and the majority (90-100%) of isovitexin remained in the tissue culture media (Figure

3.6).

50 Figure 3.5- Effect of apigenin derivatives on LPS- stimulated inflammation. RAW mouse macrophages were treated concurrently with 100 ng/mL LPS and various doses of isovitexin (apigenin 6-C glucoside) for 8 h. TNF release in media was measured via ELISA. Data represent mean ± variance, n=2.

51 Figure 3.6- Glycosylation of apigenin modulates subcellular localization. RAW cells were treated with 50 or 100 µM isovitexin, 50 µM apigenin, or diluent control for 8 h. Media was harvested and cells were rinsed and fractionated for subsequent HPLC analysis. Data represent n=1.

52 Apigenin modulates response to inflammatory agents in vivo

3.9 Survival following lethal dose of endotoxin in vivo

Wild-type mice were given a single dose of apigenin (50 mg/kg i.p., or diluent control) 3 h prior to, concurrent with, or 1 h following a lethal dose of LPS

(37.5 mg/kg i.p.) or diluent control. Survival was monitored over 30 d and presented in Figure 3.7. No mortality was observed in mice receiving either apigenin (dashed line) or diluent controls (black line) alone. 100% of mice which received just the lethal dose of LPS died by day 2 (red line). However, apigenin pre-treatment 3 h prior to LPS increased survival to 67% (blue line). Similarly, concurrent administration of apigenin and LPS yielded a survival rate of 60%

(yellow line), and 83% of mice which received apigenin 1 h following a lethal dose of LPS survived to 30 d (green line). Importantly, during the first 48 h, apigenin treatments are able to maintain survival at 80-100%, which represents a critical treatment period in human sepsis disorders. Thus, apigenin rescued

LPS-induced lethality to varying degrees following three different treatment regimes. This highlights the potential of apigenin as both a preventative and therapeutic treatment in sepsis and sepsis-related disorders.

53 3.10- TNFα in mouse serum

It is shown that expression of TNFα is increased in sepsis (51). Mice were

pre-treated with apigenin followed by a lethal dose of LPS or diluent control. At 1 h following LPS treatment, mice were anesthetized and blood drawn for serum via retro-orbital puncture. Serum was analyzed via ELISA for TNFα protein. LPS induced TNFα protein in the serum at 1 h post LPS. Serum of mice which were pre-treated with apigenin showed significantly lower TNFα in serum. Apigenin alone did not increase concentration of TNFα in the serum (Figure 3.8).

3.11 Apoptosis in spleens

Previous studies have suggested a strong correlation between splenocyte apoptosis and mortality (101). Mice were pre-treated for 3 h with apigenin, followed by LPS; spleens were harvested and fixed at 24 h post LPS, and examined for apoptosis in the white pulp by H&E, TUNEL, IHC for active caspase-3, and flow cytometry. As seen in Figure 3.9, there is little to no apoptosis in apigenin- or diluent-treated animals; however, LPS significantly induced splenocyte cell death at 24 h (p<0.01, ANOVA). Of note, animals which received apigenin prior to LPS did not show any decrease in apoptosis in

54 spleens. Therefore, despite its effects on survival, Figure 3.9 shows that apigenin failed to prevent splenocyte apoptosis.

55

100 100% survival

83% 75 67% 60% diluent controls 50 Api

% survival LPS 25 Api -3 h, LPS LPS+Api concurrent 0% survival LPS, Api +1 h 0 0102030 d

Figure 3.7- Apigenin rescues LPS-induced lethality in vivo. Mice received 50 mg/kg apigenin intraperitoneally (ip) 3 h prior to (blue line), concurrent with (yellow line), or 1 h following (green line) a lethal dose (37.5 mg/kg) of LPS. Mice were monitored for 30 days and a Kaplan-Maier survival curve generated. Data represent n≥5.

56

Figure 3.8- Apigenin decreases concentration of TNFα in mouse serum. C57BL/6J mice were injected i.p. with apigenin (50 mg/kg body weight) or vehicle 3 h before injection of LPS. A, Serum level of TNFα was determined 1 h after LPS injection. Results represent the mean ± SEM of three independent experiments (using 12 animals per experimental group, *, p<0.001).

57

Figure 3.9- Apigenin does not modulate apoptosis in spleens. A, representative photographs of H&E morphological stain, TUNEL assay and IHC for active caspase-3 in spleens; quantification of B, H&E, C, TUNEL, D, active caspase-3 in fixed spleens at 24 h. Data represent mean ± SEM, n≥3; E, fresh splenocytes were analyzed for apoptosis via flow cytometry and normalized to control; n≥4, p≥0.2, Student’s t-test of LPS vs. LPS+apigenin. Bar represents 10µm. Representative images taken at 1000x magnification. 58 3.12 Neutrophilia in lungs

In human sepsis-related disorders, loss of lung function is the most frequent clinical observation (37). Previous work has shown that LPS induces neutrophilia in lungs (49, 102-103). Mice received apigenin or diluent controls 3 h prior to a lethal dose of LPS or diluent control. Lung tissue was then harvested at 24 h, fixed, and sectioned. Using enzymatic and IHC assays, we show in

Figure 3.10 that LPS induces lung neutrophilia after 24 h (22.5 cpf; p<0.001 vs control; ANOVA), and neutrophilia is significantly decreased in apigenin pre- treated mice (15.2 cpf; p<0.05 vs LPS; ANOVA). This is evidenced by the use of both an enzymatic assay as well as a neutrophil-specific antibody in fixed lung tissue.

3.13 Cell death in lungs

Lung tissue was harvested and processed as described above, and subjected to TUNEL assay to assess cell death. Though not previously reported, i.p. LPS (but neither apigenin nor diluents alone) significantly induced cell death in lungs at 24 h (p<0.01, ANOVA), as shown in Figure 3.11 by TUNEL assay.

Apigenin pre-treatment significantly attenuated LPS-induced cell death at 24 h

(p<0.01, ANOVA). Though this preliminary experiment does not identify the cell

59 type of the dying cells, it suggests that apigenin is rescuing lung tissue damage.

It is possible that, by preventing neutrophilia in the lungs, apigenin is preventing

ROS-induced epithelial cell death, thereby maintaining lung tissue function.

60 Figure 3.10- Apigenin modulates neutrophilia in the lungs of septic mice. Fixed lung tissue was subjected to A, chloroacetate esterase activity (CAE) assay and B, IHC using 7/4 antibody, to assess the presence of neutrophils in lung tissue. C, quantification of CAE assay. Student’s t-test of LPS vs. LPS+apigenin p=0.02. CAE assay represents n≥9. Large image, 1000x magnification; inset, 400x magnification. 61 Figure 3.11- Apigenin modulates cell death in the lungs of septic mice. Fixed lung tissue, harvested at 24 h post LPS, was subjected to TUNEL assay. Data is expressed as number of positive cells per high- power (1000x magnification) field, as shown in large images. Inset, 400x magnification. Quantification represents mean ± SEM; n ≥ 3; One-Way ANOVA of LPS vs. LPS+apigenin, p<0.01.

62 3.14 Chemokines in lungs

By way of receptors on their cell surface, neutrophils detect and migrate toward soluble proteins called chemokines. Several murine neutrophil-specific chemokines have been discovered, among them, KC [keratinocyte chemoattractant; (104)) and MIP-2 (macrophage inflammatory protein 1; (105)].

Mice received apigenin or diluent controls 3 h prior to a lethal dose of LPS, or diluent control, and were sacrificed at 24 h. BALF was harvested from the lungs and analyzed for levels of chemokines MIP-2 and KC, which are known to mediate neutrophil chemotaxis (106-107), and are also known to be induced by

LPS (108). In Figure 3.12, we show that the expression and secretion of both chemokines are elevated by LPS over time, as measured by ELISA in BALF

(Figure 3.12A) and RT-PCR of lung tissue (Figure 3.12B). Apigenin pre- treatment resulted in the significant reduction of MIP-2, but not KC, at 3 h post

LPS, in both BALF and lung tissue. However, apigenin had no significant effect on expression of either the cell adhesion proteins p- or e-selectin, or the pro- inflammatory protein COX-2. These data suggest that the apigenin-mediated decrease in neutrophils seen at 24 h may be due to a decrease in neutrophil chemokine at an earlier timepoint, and that apigenin modulates levels of MIP-2, but not KC.

63

Figure 3.12- Apigenin modulates chemokines in lung lavage and tissue of septic mice. Mice were pre-treated with apigenin or vehicle control 3h prior to treatment with LPS or vehicle control. Mice were sacrificed, and bronchioalveolar lavage fluid was taken at timepoints shown. A, ELISA of BALF and B, RTPCR in lung tissue of indicated targets. Data represent n≥6, mean ± SEM, Student’s t test. 64 3.15 Cardiac function

Echocardiograms (ECG) were performed on anesthetized mice at 24 h post-LPS, to assess cardiac efficiency via fractional shortening (%FS). i.p. LPS is known to reduce %FS to approximately 25% (109). As shown in Figure 3.13,

%FS was 45% in control mice and 25% in LPS mice at 24h (p<0.001, Student’s t test). At 24 h, apigenin pre-treatment significantly restored cardiac efficiency to

38% (p=0.02, t test). It has been previously reported that lower doses of LPS affect cardiac efficiency at timepoints earlier than 24 h, in our experiments LPS significantly affected efficiency at 24 h. This improvement in cardiac efficiency may also translate to improved blood pressure, as hypotension may be attributed to decreased fractional shortening, and is a prominent feature of severe sepsis and septic shock in humans.

3.16 Bioavailability of apigenin in mice

There are conflicting reports in the literature, concerning bioavailability of

many flavonoids in human studies. In order to explain the physiological

mechanism of apigenin’s anti-inflammatory effects, liver tissue and urine were

harvested from mice 1 h after treatment with apigenin or diluent control (DMSO).

Tissue was homogenized manually and both tissue and urine were subjected to

65 protein precipitation using ice cold acetonitrile. Following removal of proteins, liver tissue and urine were subjected to high-pressure liquid chromatography

(HPLC) to assess levels of apigenin or other flavones. Figure 3.14 indicates a high concentration of apigenin in the liver and urine, while levels of apigenin derivatives luteolin, chrysoeriol, and diosmetin are at background levels.

Additionally, the concentration of apigenin excreted in the urine is thirty times higher than that found in liver tissue. However, this experiment shows that at 1h following apigenin treatment, apigenin can be detected in the liver and urine.

66

Figure 3.13- Apigenin modulates cardiac efficiency in mice. Echocardiograms were performed at 24 h after LPS treatment. %FS, percent fractional shortening. Data represent mean ± SEM, n≥3. p=0.02, Student’s t-test.

67

Figure 3.14 Apigenin is detected in liver and urine of mice. Mice were treated with 50 mg/kg apigenin, or DMSO control, i.p. At 1 h, mice were sacrificed and the liver (A) and urine (B) harvested and frozen for subsequent HPLC/MS analysis of flavonoid content. Data represent n=1.

68 3.17 Apigenin’s effect on chemotaxis in vitro

Apigenin appeared to prevent neutrophilia in mouse lung tissue in response to an inflammatory stimulus, but its mechanism was unclear. In order to determine if apigenin directly affects neutrophils, and if it would be equally

effective on mouse and human neutrophils, human neutrophils were isolated

from a healthy donor. They were then incubated with varying doses of apigenin, and then subject to a migration assay using a modified Boyden chamber and a chemotactic stimulus with 20 nM rhIL-8. Human and mouse neutrophils are known to respond to the interleukin (IL)-8 chemokine in vitro (104, 110). As previously reported, untreated neutrophils migrated toward an IL-8 stimulus. In

this assay, apigenin-treated neutrophils failed to respond to this chemokine.

Apigenin had a dose-dependent effect on chemotaxis as seen in Figure 3.15.

This experiment on its own suggests a direct effect of apigenin on neutrophils.

This observation is either an alternative or parallel mechanism when compared to

apigenin’s effect on lung neutrophilia in mice that received an intraperitoneal

dose of apigenin. Apigenin appears to modulate neutrophil chemotaxis toward

an IL-8 stimulus, in a direct and dose-dependent manner.

69

Figure 3.15- Apigenin inhibits human neutrophil chemotaxis in vitro. Human neutrophils were purified, incubated for 1 h with increasing doses of apigenin. They were then exposed to 20 nM rhIL-8 in a modified Boyden chamber chemotaxis assay for 1 h. The number of cells in the lower wells was evaluated microscopically. Data represent mean SEM, n=3 independent experiments.

70 LPS

diapedesis and extravasation TLR4

activated macrophage activated -integrins and IL-8 receptors inhibits TNFα expression

IL-8 IL-8 TNFα in serum Apigenin IL-8 IL-8

release of IL-8 in serum IL-8 IL-8 via inhibition IL-8 of NF-κB IL-8IL-8 IL-8 IL-8 IL-8 IL-8 inactive -integrins IL-8 IL-8 inhibits IL-8 vascular endothelial cells expression

Figure 3.16- Molecular and physiological mechanisms of apigenin.

71 CHAPTER 4

DISCUSSION

The cells of the innate immune system are considered the “first responders” to invasion by a pathogen. Evolution has provided mammals with a diverse array (13, thus far) of Toll-like receptors which are found on innate immune cells and capable of recognizing generic motifs from bacteria, viruses, and protozoa. Each PAMP activates a unique receptor or combination of receptors, which in turn initiates a signaling cascade resulting in the expression of various inflammatory molecules. Various kinases, ubiquitin ligases, and accessory proteins are involved in these pathways, including IKKs which are responsible for the activation of the NF-κB transcription factor. We showed that apigenin, a polyphenolic plant compound from the flavonoid family, is able to inhibit the IKK kinase, resulting in a decrease in phosphorylation of NF-κB activity

(Figure 3.2). This change in phosphorylation results in a decrease in transcription and release of NF-κB-mediated pro-inflammatory cytokines (Figure

3.1) (3). The IKK complex consists of three subunits – IKKγ (a structural protein) and the catalytic subunits IKKα and  - which form a heterotrimer. IKK is known to phosphorylate Ser536 of the p65 subunit of NF-κB (4), resulting in

72 transcriptional activation; therefore we examined apigenin’s effect on the activity of this kinase. In Figure 3.2 the effect of apigenin on IKK kinase activity in LPS- stimulated RAW mouse macrophages was examined. This result shows that apigenin inhibits IKK activity, suggesting a mechanism for apigenin’s effect on the phosphorylation and activation status of NF-κB. Other structurally dissimilar plant compounds have been shown to physically interact with and inhibit a subunit of IKK (111-112); however, no previous work has addressed the nature of apigenin’s interaction with the IKK complex. Thus, it was unknown whether apigenin’s interaction with IKK was physically direct or indirect. Apigenin has been shown to modulate the activities of several other kinases, though not always through a direct physical association. Apigenin has been shown to inhibit cell cycle progression mediated by CDK1 (cyclin-dependent kinase 1), through preservation of phosphorylation on Tyr15 of the protein (113), and has also been shown to modulate the activity of unspecified isoforms of PKC, though it is unknown whether or not this is through a direct or indirect mechanism (29).

Interestingly, previous reports describe apigenin’s ability to directly inhibit CK2

(caesin kinase 2) through association with CK2’s ATP-binding domain (114).

Therefore, the next experiment aimed at determining whether apigenin affects

IKK directly or indirectly. The IKK complex was immunoprecipitated from

73 untreated cells and then incubated with apigenin (0.01-50 µM) for 30 min, followed by an in vitro kinase assay. Results in Figure 3.2C demonstrate that, despite incubation with increasing concentrations of apigenin, the kinase activity of IKK in vitro was not affected. Therefore, this suggests that apigenin does not interact directly with the kinase, but may rather affect an upstream modulator of

IKK. Previous work has described apigenin’s inhibitory effect on CK2, a kinase which modulates NF-κB activity (28). However, CK2 is shown to phosphorylate both the p65 subunit of NF-κB, and IκB, thereby promoting its degradation. In addition, CK2 activity is shown to increase in RAW mouse macrophages, with

LPS treatment (27). While this activity would clearly suggest a straightforward mechanism of apigenin’s action, we have shown previously that apigenin inhibits

NF-κB activity while degradation of IκB is unaffected (30). If apigenin’s only target were CK2, then we would expect to instead see a protection of the IκB subunit; previously published data indicates that this is not the case (30). In addition, as shown in Figure 3.2B, apigenin clearly impacts the activity of IKK kinase. Emergent reports show that in squamous cell carcinomas, CK2 may target IKK directly (115); this detail may provide the next step to understanding apigenin’s mechanism. However, if this is the case, it is still unknown how

74 apigenin-mediated inhibition of CK2 can modulate IKK activity while degradation

of the IκB subunit remains unaffected.

Since there are two isoforms of IKK, α and , we were interested to

determine if one isoform was affected by apigenin more so than the other. IKKα

and IKK were overexpressed in RAW cells, stimulated with LPS, and treated

with 25 µM apigenin for 8 h. Cells were lysed and subjected to immunoblot for p65-S536 and total p65. In the cells overexpressing IKKα, apigenin was able to

modulate phosphorylation of p65 at S536, despite the excess amount of IKKα

present in the cell, suggesting that IKK was primarily responsible for

phosphorylation at that residue. Conversely, in cells overexpressing IKK,

apigenin was unable to compensate for the excess kinase, and was not able to

modulate phosphorylation of p65 (Figure 3.2A). In previous publications,

apigenin is shown to downregulate the expression of IKKα (116). However, in

this experiment it is shown that in stimulated cells treated with apigenin or

diluents, kinase activity differs even though expression of IKKα is equal. Thus,

apigenin clearly controls IKK beyond the level of transcription. Differential activity

of IKKα versus IKK appears to be to some degree, cell-type specific. In select

immortalized breast cancer cell lines, IKK is solely responsible for NF-κB

activation; this is in contrast with other breast cancer cell lines in which both IKKα 75 and IKK control NF-κB equally (117). Hepatocyte activation of NF-κB in LPS-

induced sepsis, both in vitro and in vivo, appears also to be controlled exclusively by IKK (15).

There are a number of proteins which are found to be common to the signal cascade of every Toll receptor (44). However, there is a subset of proteins and multimeric complexes which differs amongst the Tolls, which suggests a mechanism by which a cell may tailor its response to a specific stimulus/ligand.

For example, the MyD88 protein interacts with every TLR except for TLR3 (118).

MyD88 associates with the cytoplasmic TIR (Toll Interleukin-1 receptor) domain of a TLR, and recruits other proteins (kinases) to the activated receptor (16).

Similarly, TIRAP (Toll Interleukin Receptor Adaptor Protein) associates exclusively with the TIR domain of TLRs 2 and 4, while TRAM (TIR-containing

Adaptor Molecule) associates only with TLR 4 (119-120). We used a panel of

TLR ligands in an attempt to determine if apigenin was effective in reducing inflammatory response in all pathways or just a select group of TLR stimuli. This could ultimately suggest whether the intracellular target of apigenin was unique to a subgroup of pathways or was found in all TLR signal pathways. RAW 264.7 mouse macrophages were treated with ligands specific to TLRs 2, 3, 4, 7/8, or 9, concurrently with apigenin or diluent control. Results in Figure 3.3 show that

76 apigenin was effective at reducing the amount of TNFα release mediated by TLR

2, 3, 4, and 7/8, but not TLR9, suggesting that apigenin targets a protein which is common to all of these pathways, or alternatively, that apigenin targets more than one (or perhaps a family) of proteins. An alternative is that TLR9 may induce expression of apigenin’s direct target, thus resulting in a change in stoichiometry and compensation against apigenin-mediated inhibition of this protein target. However, it has been shown that the TLR9 pathway relies heavily on the activity of IKKα/α homodimer in order to control gene expression (121).

Since we show in Figure 3.2 that apigenin’s inhibitory effect appears to be restricted to IKKβ, this may explain why apigenin fails to modulate expression of

pro-inflammatory cytokines in response to TLR9 activation. Ultimately, the

upstream regulator of IKKβ, targeted by apigenin, is yet unknown.

There is much interest in structures of flavonoids in light of the fact that

compounds which are nearly identical except for one hydroxyl group or a planar versus non-planar shape, show divergent activities as anti-inflammatory as well

as anti-tumor treatments. Apigenin and a related compound called naringenin

are both classified as flavonoids, and have been studied in inflammation.

Apigenin, a flavone, contains an unsaturated C pyrane ring, and hydroxyl groups

at the 3’, 5, and 7 positions. Naringenin, a flavanone, contains hydroxyl groups

77 at the identical positions, but is saturated at positions 2 and 3 of the C ring, thus

lacking a planar double bond between positions 2 and 3 (Figure 1.3). This

renders apigenin a planar molecule, in comparison to naringenin’s angled shape.

While apigenin has been shown by our lab to induce apoptosis in the THP-1

leukemia cell line, naringenin is ineffective in killing THPs (75) and has no effect

on cell populations in whole blood from human donors (100). Quercetin, a

flavonol similar to apigenin, is planar and shows anti-inflammatory properties,

while taxifolin, a flavonol similar to quercetin but with a non-planar structure

(Figure 1.3), shows no effect against TNFα-induced inflammation (72). As is

demonstrated in Figure 3.4, naringenin fails to inhibit LPS-induced inflammatory

response in RAW cells, even at higher doses. Thus, it seems that planarity of

structure may correlate with anti-inflammatory and anti-tumor activity, and may

possibly facilitate an in silico search of three dimensional structures to identify the

target protein.

The members of the flavonoid family are diverse in their structure; most

exist in nature as modified compounds, involving glucose, methyl, sulfonyl, and

hydroxyl groups (122-123). At first glance, the study of these modifications is complicated by the fact that many studies have provided conflicting results, some indicating that aglycones are more readily absorbed, others showing that

78 glycosylated compounds result in higher concentrations of the aglycone in cells

(122, 124). However, it has been proposed that these compounds are

deglycosylated either by intestinal microflora or enzymes in the intestinal

epithelium, thereby converted to a metabolically useful form (123). While this proposed mechanism may maximize the nutrition which an organism obtains from its food, it is difficult to correlate structure and anti-inflammatory effect (125)

since the targets of most of these flavonoids are yet unknown. Since

glycosylated flavonoids are the most abundant source of flavonoids in plant foods

(123), we investigated whether a glycosylated form of apigenin (apigenin 6-C

glucoside; shown in Figure 1.3) is equally effective in the LPS in vitro model of

inflammation. RAW cells were simultaneously stimulated with LPS and treated with varying doses of apigenin 6-C glucoside (isovitexin) or apigenin aglycone.

In Figure 3.5, RAW cells stimulated with LPS alone showed robust TNFα production and cells treated with LPS and apigenin aglycone show a significant decrease in TNFα production, but cells treated with isovitexin show no decrease in TNFα production at any dose. A previously published study reported that isovitexin was able to modulate nitric oxide (NO) release and the activity of the

NF-κB transcription factor, which in turn controls levels of NO through the expression of inducible nitric oxide synthase (iNOS); however, the levels of TNFα

79 were not reported. In the same publication, isovitexin is able to inhibit the

degradation of the inhibitory IκB subunit of the NF-κB complex, but as there are

NF-κB activation pathways which do not involve IκB, it is not clear if isovitexin

could modulate TNFα in these experiments (48).

It was reasoned that a flavonoid compound must be able to enter the cell

in order to elicit an effect and that glycosylated compounds, as evidenced by

isovitexin’s inability to suppress TNFα production, are not able to enter the cell.

In addition, our lab has shown that apigenin aglycone is found in the membrane fraction of THP-1 cells, and in fact co-localizes with a mitochondria-specific fluorochrome (75). Therefore, we performed an identical experiment in RAW cells treated with isovitexin, followed by HPLC analysis. Figure 3.6 demonstrates that the concentration of apigenin aglycone in the media decreased by approximately

50%, and there was a subsequent increase in concentration of aglycone found in plasma and organelle membrane fraction, suggesting that the compound readily associates with or moves across membranes, into the cytoplasm and perhaps into specific organelles. In contrast, the concentration of isovitexin in the tissue culture media remained at 90-100% of the original dose, while only 0-10% of the original dose found in the membrane fraction. This suggests that glycosylated apigenin is not taken up by the cells, and that it must be taken up by an active

80 process or modified prior to uptake. This observation is supported in the literature that glycosylated compounds have generally less efficacy in several different model systems in vitro, each suggesting that effects on metabolism offer partial explanation (126-128). However, more recent reports suggest that this does not always indicate a lack of efficacy in vivo. For example, several human studies show that consumption of foods highest in quercetin glycosides resulted in the highest concentration of quercetin aglycone in vivo (123, 129). However, we return to the idea that glycosylated compounds may first be metabolized by extracellular enzymes before they can be absorbed by the intestinal tract (130).

Thus, it may be crucial to establish the bioavailability and metabolism of flavonoids prior to seeking their intracellular target.

It is interesting to note that apigenin aglycone has been shown to co- localize with mitochondria, through mitochondria and flavonoid-specific fluorescent dyes (75). Thus, these data suggest apigenin’s ability to enter the cell and associate with some portion of the mitochondria. Cytochrome P450

(cyp450) is the major enzyme responsible for flavonoid phase I metabolism and is located on the outer membrane of the mitochondria. It is shown that apigenin is metabolized by cyp450, so it is possible that apigenin is converted to a different compound which in turn may be the true effector of the inflammatory

81 cascade. It has in fact been shown that apigenin is metabolized to luteolin in

human liver microsomes (131), and from several groups we learn that apigenin

may inhibit cyp450 in a direct and competitive manner (132-133).

As previously mentioned, the number of successful treatments available

for human sepsis and sepsis-related disorders are limited, and those available

treatments have a success rate of less than 10%. Thus, it is an urgent task to

find alternative treatments, and natural plant products have shown great promise as anti-inflammatory agents. We examined apigenin’s effect in an in vivo model

of sepsis. Mice which received 50 mg/kg i.p. apigenin, followed by a lethal dose

of i.p. LPS 3h later, achieved significant increase in survival over mice treated

with LPS alone (Figure 3.7). Mice receiving apigenin alone showed no signs of

altered health. However, all mice who received LPS demonstrated an altered

phenotype between 12-24 h following LPS. This included severe lethargy, oily

and unkempt fur, huddling, decreased body temperature (data not shown), and

eye secretions. By 40 h post-LPS, 100% of mice which received only LPS were

dead. In contrast, at this timepoint 100% of mice pre-treated with apigenin were

alive, and showing recovery from the abovementioned phenotype. Survival at

day 4 was reduced to 60% but remained unchanged through 30 d; those of the

mice which survived for 30 d showed no apparent health deficiencies, behaving

82 in a manner consistent with that of a control mouse. Humans that survive sepsis normally spend 7-14 d as ICU patients, followed by 7-14 d of non-ICU inpatient care (37). Thus, it may be encouraging to compare the recovery time of apigenin-treated mice in relative terms, to recovery time in human sepsis patients, suggesting that apigenin may be capable of affecting its target before permanent organ damage is done. Studies of human sepsis traditionally measure survival rates over a 30-day period, and have noted that changes in organ function in early sepsis (days 1-5) are predictors of survival at 30 d (134).

Thus, apigenin treated mice show significantly improved organ function at 24 h and survival rates at 30 d.

It is a longstanding observation that the most prominent feature of sepsis, both in humans and rodents, is splenocyte apoptosis. In addition, prevention of splenocyte cell death correlated with increased survival (60-61, 135). Thus, the next experiment, which aimed to determine the physiological mechanism for apigenin’s apparent effect on survival, involved examination of the spleen. Mice were treated with apigenin or diluent control, followed 3 h later by a lethal dose of

LPS or diluent control, and spleens were harvested at 24 h following LPS. The level of apoptosis in spleens was assessed several ways – via morphological staining (H&E), TUNEL assay, IHC for active caspase-3, and flow cytometry. As

83 seen in Figure 3.9, mice which received only diluent controls showed almost no

cell death in spleens by either TUNEL or active caspase-3. In contrast, mice

which did not receive apigenin but did receive a lethal dose of LPS showed

significant splenocyte apoptosis in both TUNEL and active caspase-3 assays.

Most strikingly, mice pre-treated with apigenin and then treated with LPS showed

the same level of splenocyte apoptosis at 24 h as the mice which received only

LPS. Thus, there exists a paradox between apigenin’s positive effect on survival

and its inability to prevent splenocyte apoptosis. In order to further characterize

sepsis-related cell death in spleens, fresh splenocytes were isolated from

similarly treated mice at 24 h, followed by immunostaining with anti-CD3 (T

lymphocytes) or anti-B220 (B lymphocytes), and annexin V/propidium iodide.

This experiment gave similar results, as no difference was seen in the amount of

apoptosis in mice which did or did not receive apigenin prior to the lethal dose of

LPS (Figure 3.9D). In numerous previous reports, it is demonstrated that

prevention of splenocyte apoptosis rescues sepsis-related mortality. Examples

include improved survival in Bcl-2 transgenic mice which underwent lethal CLP

(cecal ligation and puncture) procedure, in mice treated with inhibitors of caspase-3 (a pro-apoptotic molecule), and in mice treated with siRNA against

Bim (another pro-apoptotic molecule) (59-61). It is possible that the true lethality

84 of splenocyte apoptosis stems from the inability of splenic macrophages to clear apoptotic bodies. Thus, apigenin may modulate the ability of macrophages to recognize or engulf apoptotic bodies. However, if this were the case, it would fail to explain why there is no difference in the number of apoptotic lesions in the spleen, even though 24 h appears to be a point of divergence in survival – one subpopulation dies, while the other recovers and survives. Other explanations may involve different organs, as addressed below.

The most frequent organ to fail in human sepsis is the lung (37).

Additionally, many sepsis-induced lung-related disorders, such as acute respiratory distress syndrome (ARDS) and chronic obstructive pulmonary disease (COPD), also lack treatment options. It is known that in both human sepsis cases and in rodent models of sepsis, neutrophils accumulate in the tissue and alveolar spaces of lungs (49, 102-103). Thus, the lungs were examined next to determine apigenin’s effect on LPS-induced neutrophil infiltration. Lung tissue from apigenin (or diluent) pre-treated, LPS (or diluent) treated mice was harvested at 24 h post-LPS and examined for neutrophilia

using an enzymatic assay to detect neutrophils. As seen in Figure 3.10, in mice

receiving only apigenin or diluent controls, an average of 1-3 cpf were seen.

Conversely, LPS-stimulated mice showed a significant increase in positive cells

85 per field, and apigenin pre-treatment significantly decreased the average

neutrophils per field. The result was confirmed through IHC using a neutrophil-

specific antibody, demonstrating that apigenin pre-treatment significantly

decreased pulmonary neutrophilia. This outcome strongly suggested that the

difference in survival may be explained through improved organ function.

Neutrophils are necessary for effective clearance of bacteria, and impaired

neutrophil infiltration correlates with poor clearance and prognosis (106, 136).

Neutrophils have a diverse impact on their surrounding tissues; they secrete

cytokines to amplify the inflammatory response and activate other immune cells

and secrete reactive oxygen species (ROS) for the purpose of killing invading

bacteria (136) but whose side-effect is epithelial tissue damage. Neutrophils

have also been implicated in lung thrombocytophilia, attracting excess platelets

to the fragile microvasculature of the lungs in a TLR4-dependent manner (102,

137), suggesting another mechanism of tissue damage. There are a myriad of events which contribute to neutrophilia. In brief, circulating neutrophils must first detect an inflammatory stimulus and its location, overcome circulatory velocity to bind to the vascular endothelium (‘rolling’), insert themselves between endothelial cell junctions (‘diapedesis’), and move through the extracellular space

86 (‘chemotaxis’) to the site of infection, following a gradient of signaling molecules

(chemokines).

Apigenin may modulate neutrophilia in lungs at any one or more of these stages. Various chemokines, including MIP2, ENA-78, LIX/GCP2, Gro-α/KC

(106, 138-140), are secreted by alveolar macrophages or nasal and bronchial epithelium or endothelium in response to pathogens, in order to attract neutrophils to the site of infection. The second stage, neutrophil rolling, is shown to be mediated by selectin receptors and integrins, which help the activated cells adhere to the vessel wall; certain plant compounds have been shown to cleave these receptors from the cell surface, preventing neutrophil adhesion and diapedesis. Interestingly, diapedesis may be promoted through the activation of

IL-8 receptors (CXCR1 and CXCR2) which induce a change in morphology and increased affinity between neutrophil and endothelial integrins (141).

Additionally, vascular endothelial cells store IL-8 in vesicles and release it in response to activation with TNFα (107).Thus, we examined the levels of chemokines including KC (CXCL1; mouse ortholog of IL-8) and MIP2/CXCL2 in the lung tissues and BALF in order to explain the difference in neutrophils present in the lung tissue. BALF and lung tissue samples were harvested over a timecourse, from animals treated with apigenin or diluent control, followed 3h

87 later by stimulation with LPS or diluent control. Cells were eliminated from the

BALF, and sandwich ELISAs performed in order to measure KC and MIP2.

Similarly, RNA was isolated from lungs of treated mice which were snap-frozen

at 24h. ELISAs for KC and MIP2 revealed that, while neither chemokine was

elevated in control mice, LPS stimulation produced a robust increase in both KC

and MIP2 concentration over time in the BALF. Interestingly, pre-treatment with

apigenin produced divergent results; apigenin appeared to have no effect on the

levels of KC at any timepoint (2, 3, 6, 12 h post LPS) but levels of MIP2 were

significantly decreased at 3 h in mice which received apigenin prior to LPS

(Figure 3.12A). mRNA from lung tissue was examined via Q-RTPCR, and examination of KC and MIP2 expression levels revealed a similar pattern; LPS stimulated the expression of both chemokines to between 20-80 fold above background. Apigenin pre-treatment downregulated the expression of MIP2, but not KC, at 3 h post LPS. These results provide insight into the chemokine response, both in terms of the timing of expression as well as stability of the protein. For example, both KC and MIP2 are expressed at their highest levels by

3 h, and decline sharply at 6 h and 12 h. The pattern of both MIP2 expression and protein levels exactly mimic one another, suggesting that MIP2 is translated immediately upon transcription; additionally, the MIP2 protein is relatively

88 unstable, since decrease of protein level is synchronous with decrease in

expression, implying that expression control is the primary means of regulation.

Interestingly, KC behaves differently, in that peak protein concentration lags behind the peak expression level by at least 3 h, in our experiments. However,

there may be two contributing factors in this observation; translation of KC is

much slower in comparison to that of MIP2, and that the KC protein is more

stable because, despite the precipitous decline in expression between 3 h and 6

h, protein levels in fact increase. While further experiments are necessary to test

these possibilities, it is also important to note that previous work has shown that

both KC and MIP2 appear to bind and activate the same receptor in mice (104).

Thus, these proteins may work together to sustain an immune response over

long periods of time, despite differences in rate of translation and protein stability.

Over all, it is suggested by the aforementioned experiments that modulation of

chemokine levels during early timepoints result in differences in neutrophil

accumulation at later timepoints.

It has been shown that neutrophils themselves secrete IL-8 in response to

TNFα stimulation (142-143). Thus, it is reasonable to postulate that the

difference in IL-8 is simply due to the difference in the number of neutrophils

present. However, the difference in IL-8 cytokine was detected at 6 h, at a

89 timepoint at which there was no difference in the number of neutrophils in the

lung tissue between mice which received a pre-treatment of apigenin or not (data

not shown). Thus, it is to be concluded that the difference in IL-8 chemokine is

not due to a difference in the number of neutrophils but due to a difference in its

expression or translation.

Since neutrophils have been shown to be involved in tissue damage, cell

death in lungs was assessed. In a preliminary experiment, lung tissue from

treated mice was harvested at 24 h and the lung sections were examined for cell

death via TUNEL assay. In Figure 3.11, while control mice are found to have

almost no DNA cleavage to indicate cell death, LPS induced significant increase

in cell death. Most noteworthy, apigenin treatment resulted in a significant

decrease in cell death in lungs. A preliminary explanation is that with fewer neutrophils present, there are fewer damaged epithelial cells, thus organ function is maintained. However, an alternative hypothesis is that apigenin modulates

VEGF, a vascular growth, permeability, and reported anti-apoptotic factor, explaining the decrease in both cell death and neutrophilia (56). Yet another explanation is that with the decrease in neutrophils comes a subsequent decrease in activation of the LOX1 receptor, a vascular endothelial cell protein that has been shown to be involved in neutrophil adhesion, NF-κB activation, and

90 ROS-mediated apoptosis in lung epithelium (144). It is important to note that,

while the preliminary result is significant, the next task would be to confirm the

identity of the apoptotic cells.

It has been shown previously by others that LPS-induced inflammation

results in severe deficits in cardiac function. One method of quantifying cardiac

function is to determine, via echocardiogram (ECG), the output efficiency of

every heartbeat. In short, an ultrasound video shows the movement of the walls

of the heart during contraction (systole) and relaxation (diastole) periods. The

wave forms seen in each frame of the video are measured to determine the

distance travelled by the inner walls of the heart during each contraction and

relaxation cycle. Mathematical measurements of a healthy heart reveal that inner wall movement [described as percent fractional shortening (%FS)] is approximately 50%. In mice stimulated with i.p. LPS, %FS decreases to approximately 25% (109). Therefore, it was of interest to measure the cardiac efficiency of mice treated with apigenin or diluent control, followed by LPS or diluent control, at 24 h post LPS. Mice were anesthetized one by one and an

ECG reading was recorded. Subsequent wave form measurements, expressed in Figure 3.13, revealed that the mice which received only diluent controls had a

%FS of approximately 45%. Mice which received only i.p. LPS showed a

91 significant reduction in %FS, to approximately 24%, but mice which received

apigenin pre-treatment indicated a significant improvement in cardiac efficiency,

with %FS of 38%. This result indicates that apigenin has definite pro-survival,

anti-inflammatory effects within the first 24 h of experimentally induced sepsis,

and that cardiac efficiency could possibly be used as a target of intervention, or

at the very least, a predictor of survival. In addition, the rescue of cardiac

efficiency may also indicate an improvement in blood pressure; this is highly relevant due to the fact that hypotension is a major symptom of severe sepsis

and septic shock in humans.

Since the preceding experiments demonstrated that apigenin is able to

modulate neutrophilia in lungs, an in vitro experiment was performed to further

test apigenin’s potential effect on neutrophil chemotaxis. Human neutrophils

were purified from a healthy donor and exposed to varying doses of apigenin for

1 h in tissue culture media, then subjected to a chemotaxis assay using a

modified Boyden chamber and human IL-8 as a chemotactic stimulus. Results

show that apigenin is able to inhibit neutrophil chemotaxis in a dose-dependent

manner. These results are striking for several reasons. Firstly, they indicate that

apigenin has an affect on both murine and human neutrophils, suggesting that its

benefits may translate well to human clinical applications. While the preceding

92 experiments highlighted apigenin’s potential effect on chemokine production in vivo, it is of interest that this experiment suggests a more direct effect of apigenin on neutrophils. It is important to recall aforementioned study which suggests that other types of plant molecules are capable of cleaving integrin receptors from the surface of cells, thus inhibiting the diapedesis and extravasation of neutrophils in response to a stimulus. Another explanation is that apigenin may actually interfere with dimerization of the IL-8 receptor or its subsequent effects on integrin binding/affinity. These possibilities indicate that it may be fruitful to examine the expression and activation of receptors including IL-8, and find a connection between these receptors and the effect of apigenin on NF-κB activity.

We have shown here that apigenin easily enters cells in culture and affects inflammatory response in vitro and in vivo. Yet another important goal is to determine the bioavailability of apigenin when it is injected or ingested. As mentioned previously, many human studies have addressed the issue of obtaining different flavonoids from foods, but there is persistent disagreement between the results. It has been shown that in several animal studies, flavonoids can be detected at varying concentrations in the liver, urine, and serum, indicating that these compounds may either be stored or metabolized in vivo.

Thus, we examined the liver and urine of mice which had received apigenin 1 h

93 prior to sacrifice. Liver tissue was harvested and rinsed carefully to avoid contamination from residual apigenin in the peritoneal cavity. Urine was collected peri-mortem in a sterile dish; both tissues were analyzed using HPLC-

MS analysis. We determined that, at 1h following apigenin treatment, apigenin is detected in both the urine and liver tissue (Figure 3.14). Though the amount of apigenin excreted in the urine was 30 times that found in the liver tissue, it is important to note that the concentration in urine is only 0.6% of the total dose administered to the animal. These results suggest that apigenin may elicit its anti-inflammatory effects without being metabolized, or that metabolism is a crucial step, but only a portion of the total administered dose (that which was found in the liver) is actually needed in order to achieve a protective effect in mice. If apigenin must be metabolized in order to inhibit the inflammatory response, it is suggested by these data that a major metabolite, luteolin, may not be essential due to the fact that it was found in both the liver and urine in only small concentrations. Chrysoeriol and diosmetin are two methylated forms of luteolin, which are the result of phase II metabolism. It is entirely possible that apigenin may have an effect on inflammation and other cellular processes, not due to the presence of its metabolites (since they appear in comparatively very small quantities) but instead due to its ability to bind and inhibit either phase I

94 enzymes such as cytochrome P450, or phase II enzymes. This has been

suggested in a few preliminary projects, and may be of great clinical importance

to patients who receive other drug treatments which require these enzymes to be

fully active (131-132).

The experiments described here have supplemented our understanding of

apigenin’s molecular and physiological effects, in vitro and in vivo. It is now

known that apigenin inhibits the kinase which is responsible for one type of NF-

κB activation. It is also shown that apigenin aglycone can enter into cells of the

innate immune system, in contrast to glycosylated forms which are excluded from

the cell. Apigenin is shown to have a positive effect, in an in vivo model of

sepsis-related disease, on overall health and survival, cardiac function, and

infiltration in the lungs. Experiments here suggest that apigenin-mediated

chemokine decrease in vivo is responsible for this decrease in lung infiltration;

parallel in vitro experiments show that apigenin may also have a direct effect on

neutrophils and their reaction to a chemotactic stimulus (Figure 3.15). Apigenin’s

effect on NF-κB activity can be linked to its effect on neutrophilia when we consider the model proposed in Figure 3.16. Based on the experiments outlined here, as well as published studies showing links between TNFα, IL-8, and chemotaxis, apigenin can inhibit LPS-stimulated NF-κB activation indirectly

95 through IKK. This reduces the amount of TNFα secreted by immune cells. Since

TNFα has been shown to stimulate IL-8 release from endothelial cells, lower

serum concentration of TNFα may suggest lower serum concentration of IL-8

(107). Furthermore, other studies have suggested that binding and activation of

IL-8 receptors results in increased affinity between integrin molecules on the

surface of both neutrophils and vascular endothelial cells (141). Thus, through

reduction in NF-κB activity, levels of TNFα are reduced, resulting in lower IL-8

concentrations in vivo and less extravasation of neutrophils. A related possibility

is that apigenin may physically interact with chemokine receptors on the cell

surface or may modulate their expression. Ultimately, understanding the details

of apigenin’s molecular mechanism will help to explain how cells of the innate

immune system detect and respond to inflammatory stimuli, and suggest new

targets for clinical intervention in sepsis and other inflammatory diseases.

96 BIBLIOGRAPHY

1. Alberts B. Molecular biology of the cell. 5th edition. New York: Garland Science; 2008. pp. 1450-1463.

2. Cline MJ. Monocytes, macrophages, and their diseases in man. J Invest Dermatol 1978;71:56-58.

3. Janeway CA, Jr., Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197-216.

4. McDowell JM, Simon SA. Molecular diversity at the plant-pathogen interface. Dev Comp Immunol 2008;32:736-744.

5. Nurnberger T, Brunner F, Kemmerling B, Piater L. Innate immunity in plants and animals: Striking similarities and obvious differences. Immunol Rev 2004;198:249-266.

6. Kumar H, Kawai T, Akira S. Toll-like receptors and innate immunity. Biochem Biophys Res Commun 2009;388:621-625.

7. Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to drosophila Toll. Proc Natl Acad Sci U S A 1998;95:588-593.

8. Turin L, Riva F. Toll-like receptor family in domestic animal species. Crit Rev Immunol 2008;28:513-538.

9. Yamagata M, Merlie JP, Sanes JR. Interspecific comparisons reveal conserved features of the drosophila Toll protein. Gene 1994;139:223-228. 97 10. Shi Z, Cai Z, Wen S, Chen C, Gendron C, Sanchez A, Patterson K, Fu S, Yang J, Wildman D, Finnell RH, Zhang D. Transcriptional regulation of the novel toll-like receptor TLR13. J Biol Chem 2009;284:20540-20547.

11. Akira S, Takeda K, Kaisho T. Toll-like receptors: Critical proteins linking innate and acquired immunity. Nat Immunol 2001;2:675-680.

12. Underhill DM, Ozinsky A. Toll-like receptors: Key mediators of microbe detection. Curr Opin Immunol 2002;14:103-110.

13. Kopp EB, Medzhitov R. The Toll-receptor family and control of innate immunity. Curr Opin Immunol 1999;11:13-18.

14. Edwards DN, Towb P, Wasserman SA. An activity-dependent network of interactions links the Rel protein dorsal with its cytoplasmic regulators. Development 1997;124:3855-3864.

15. Means TK, Golenbock DT, Fenton MJ. Structure and function of Toll-like receptor proteins. Life Sci 2000;68:241-258.

16. Windheim M, Stafford M, Peggie M, Cohen P. Interleukin-1 (IL-1) induces the lys63-linked polyubiquitination of IL-1 receptor-associated kinase 1 to facilitate NEMO binding and the activation of IkappaB alpha kinase. Mol Cell Biol 2008;28:1783-1791.

17. Kanakaraj P, Schafer PH, Cavender DE, Wu Y, Ngo K, Grealish PF, Wadsworth SA, Peterson PA, Siekierka JJ, Harris CA, Fung-Leung WP. Interleukin (IL)-1 receptor-associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production. J Exp Med 1998;187:2073-2079.

98 18. Lomaga MA, Yeh WC, Sarosi I, Duncan GS, Furlonger C, Ho A, Morony S, Capparelli C, Van G, Kaufman S, van der Heiden A, Itie A, Wakeham A, Khoo W, Sasaki T, Cao Z, Penninger JM, Paige CJ, Lacey DL, Dunstan CR, Boyle WJ, Goeddel DV, Mak TW. TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling. Genes Dev 1999;13:1015-1024.

19. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ. Tak1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 2001;412:346-351.

20. Viatour P, Merville MP, Bours V, Chariot A. Phosphorylation of NF-κB and IκB proteins: Implications in cancer and inflammation. Trends Biochem Sci 2005;30:43-52.

21. Dunne A, O'Neill L. New insights into the post-translational modification of Toll-like receptor signaling molecules. J Endotoxin Res 2005;11:325-332.

22. Dunne A, O'Neill LA. The interleukin-1 receptor/toll-like receptor superfamily: Signal transduction during inflammation and host defense. Sci STKE 2003;2003:re3.

23. Dejardin E. The alternative NF-κB pathway from biochemistry to biology: Pitfalls and promises for future drug development. Biochem Pharmacol 2006;72:1161-1179.

24. Brasier AR, Recinos A, 3rd, Eledrisi MS. Vascular inflammation and the renin-angiotensin system. Arterioscler Thromb Vasc Biol 2002;22:1257-1266.

25. Chen ZJ. Ubiquitin signalling in the NF-κB pathway. Nat Cell Biol 2005;7:758-765.

26. Hayden MS, Ghosh S. Signaling to NF-κB. Genes Dev 2004;18:2195- 2224. 99 27. Lodie TA, Savedra R, Jr., Golenbock DT, Van Beveren CP, Maki RA, Fenton MJ. Stimulation of macrophages by lipopolysaccharide alters the phosphorylation state, conformation, and function of pu.1 via activation of casein kinase II. J Immunol 1997;158:1848-1856.

28. Singh NN, Ramji DP. Protein kinase ck2, an important regulator of the inflammatory response? J Mol Med 2008;86:887-897.

29. Gamet-Payrastre L, Manenti S, Gratacap MP, Tulliez J, Chap H, Payrastre B. Flavonoids and the inhibition of PKC and PI3-kinase. Gen Pharmacol 1999;32:279-286.

30. Nicholas C, Batra S, Vargo MA, Voss OH, Gavrilin MA, Wewers MD, Guttridge DC, Grotewold E, Doseff AI. Apigenin blocks lipopolysaccharide- induced lethality in vivo and proinflammatory cytokines expression by inactivating NF-κB through the suppression of p65 phosphorylation. J Immunol 2007;179:7121-7127.

31. Dajani R, Sanlioglu S, Zhang Y, Li Q, Monick MM, Lazartigues E, Eggleston T, Davisson RL, Hunninghake GW, Engelhardt JF. Pleiotropic functions of TNFα determine distinct IKK-dependent hepatocellular fates in response to LPS. Am J Physiol Gastrointest Liver Physiol 2007;292:G242-252.

32. Yang F, Tang E, Guan K, Wang CY. IKK plays an essential role in the phosphorylation of RelA/p65 on serine 536 induced by lipopolysaccharide. J Immunol 2003;170:5630-5635.

33. Sasaki CY, Barberi TJ, Ghosh P, Longo DL. Phosphorylation of RelA/p65 on serine 536 defines an IκBα-independent NF-κB pathway. J Biol Chem 2005;280:34538-34547.

100 34. Schletter J, Heine H, Ulmer AJ, Rietschel ET. Molecular mechanisms of endotoxin activity. Arch Microbiol 1995;164:383-389.

35. Zhou HR, Harkema JR, Yan D, Pestka JJ. Amplified proinflammatory cytokine expression and toxicity in mice coexposed to lipopolysaccharide and the trichothecene vomitoxin (deoxynivalenol). J Toxicol Environ Health A 1999;57:115-136.

36. Bowler RP, Nicks M, Tran K, Tanner G, Chang LY, Young SK, Worthen GS. Extracellular superoxide dismutase attenuates lipopolysaccharide-induced neutrophilic inflammation. Am J Respir Cell Mol Biol 2004;31:432-439.

37. Martin GS, Mannino DM, Eaton S, Moss M. The epidemiology of sepsis in the United States from 1979 through 2000. N Engl J Med 2003;348:1546-1554.

38. Schlichting D, McCollam JS. Recognizing and managing severe sepsis: A common and deadly threat. South Med J 2007;100:594-600.

39. van Ruler O, Schultz MJ, Reitsma JB, Gouma DJ, Boermeester MA. Has mortality from sepsis improved and what to expect from new treatment modalities: Review of current insights. Surg Infect (Larchmt) 2009;10:339-348.

40. Hoyert DL, Arias E, Smith BL, Murphy SL, Kochanek KD. Deaths: Final data for 1999. Natl Vital Stat Rep 2001;49:1-113.

41. Barriere SL, Lowry SF. An overview of mortality risk prediction in sepsis. Crit Care Med 1995;23:376-393.

42. Wheeler AP. Recent developments in the diagnosis and management of severe sepsis. Chest 2007;132:1967-1976.

101 43. Marshall JC. Clinical trials of mediator-directed therapy in sepsis: What have we learned? Intensive Care Med 2000;26 Suppl 1:S75-83.

44. Carmody RJ, Chen YH. Nuclear factor-κB: Activation and regulation during Toll-like receptor signaling. Cell Mol Immunol 2007;4:31-41.

45. Krishnan J, Selvarajoo K, Tsuchiya M, Lee G, Choi S. Toll-like receptor signal transduction. Exp Mol Med 2007;39:421-438.

46. Shen SC, Lee WR, Lin HY, Huang HC, Ko CH, Yang LL, Chen YC. In vitro and in vivo inhibitory activities of rutin, wogonin, and quercetin on lipopolysaccharide-induced nitric oxide and prostaglandin E(2) production. Eur J Pharmacol 2002;446:187-194.

47. Ezoulin MJ, Liu Z, Dutertre-Catella H, Wu G, Dong CZ, Heymans F, Ombetta JE, Rat P, Massicot F. A new acetylcholinesterase inhibitor with anti- PAF activity modulates oxidative stress and pro-inflammatory mediators release in stimulated Raw 264.7 macrophage cells. Comparison with tacrine. Int Immunopharmacol 2007;7:1685-1694.

48. Lin CM, Huang ST, Liang YC, Lin MS, Shih CM, Chang YC, Chen TY, Chen CT. Isovitexin suppresses lipopolysaccharide-mediated inducible nitric oxide synthase through inhibition of NF-κB in mouse macrophages. Planta Med 2005;71:748-753.

49. Kaplan JM, Cook JA, Hake PW, O'Connor M, Burroughs TJ, Zingarelli B. 15-deoxy-delta(12,14)-prostaglandin j(2) (15d-PGJ(2)), a peroxisome proliferator activated receptor gamma ligand, reduces tissue leukosequestration and mortality in endotoxic shock. Shock 2005;24:59-65.

50. Kotanidou A, Xagorari A, Bagli E, Kitsanta P, Fotsis T, Papapetropoulos A, Roussos C. Luteolin reduces lipopolysaccharide-induced lethal toxicity and

102 expression of proinflammatory molecules in mice. Am J Respir Crit Care Med 2002;165:818-823.

51. Smolinski AT, Pestka JJ. Modulation of lipopolysaccharide-induced proinflammatory cytokine production in vitro and in vivo by the herbal constituents apigenin (chamomile), ginsenoside rb(1) (ginseng) and parthenolide (feverfew). Food Chem Toxicol 2003;41:1381-1390.

52. Antonini JM, Roberts JR, Stone S, Chen BT, Schwegler-Berry D, Frazer DG. Short-term inhalation exposure to mild steel welding fume had no effect on lung inflammation and injury but did alter defense responses to bacteria in rats. Inhal Toxicol 2009;21:182-192.

53. Lane SR, Sewell RD. The bacterial profile of cotton lint from worldwide origins, and links with occupational lung disease. Am J Ind Med 2007;50:42-47.

54. Wakayama F, Fukuda I, Suzuki Y, Kondo N. Neutrophil elastase inhibitor, sivelestat, attenuates acute lung injury after cardiopulmonary bypass in the rabbit endotoxemia model. Ann Thorac Surg 2007;83:153-160.

55. Yeh CC, Lin CC, Wang SD, Hung CM, Yeh MH, Liu CJ, Kao ST. Protective and immunomodulatory effect of gingyo-san in a murine model of acute lung inflammation. J Ethnopharmacol 2007;111:418-426.

56. Koh H, Tasaka S, Hasegawa N, Yamada W, Shimizu M, Nakamura M, Yonemaru M, Ikeda E, Adachi Y, Fujishima S, Yamaguchi K, Ishizaka A. Protective role of vascular endothelial growth factor in endotoxin-induced acute lung injury in mice. Respir Res 2007;8:60.

57. Felmet KA, Hall MW, Clark RS, Jaffe R, Carcillo JA. Prolonged lymphopenia, lymphoid depletion, and hypoprolactinemia in children with nosocomial sepsis and multiple organ failure. J Immunol 2005;174:3765-3772.

103 58. Hotchkiss RS, Tinsley KW, Swanson PE, Schmieg RE, Jr., Hui JJ, Chang KC, Osborne DF, Freeman BD, Cobb JP, Buchman TG, Karl IE. Sepsis-induced apoptosis causes progressive profound depletion of B and CD4+ T lymphocytes in humans. J Immunol 2001;166:6952-6963.

59. Schwulst SJ, Muenzer JT, Peck-Palmer OM, Chang KC, Davis CG, McDonough JS, Osborne DF, Walton AH, Unsinger J, McDunn JE, Hotchkiss RS. Bim sirna decreases lymphocyte apoptosis and improves survival in sepsis. Shock 2008;30:127-134.

60. Hotchkiss RS, Swanson PE, Knudson CM, Chang KC, Cobb JP, Osborne DF, Zollner KM, Buchman TG, Korsmeyer SJ, Karl IE. Overexpression of Bcl-2 in transgenic mice decreases apoptosis and improves survival in sepsis. J Immunol 1999;162:4148-4156.

61. Hotchkiss RS, Chang KC, Swanson PE, Tinsley KW, Hui JJ, Klender P, Xanthoudakis S, Roy S, Black C, Grimm E, Aspiotis R, Han Y, Nicholson DW, Karl IE. Caspase inhibitors improve survival in sepsis: A critical role of the lymphocyte. Nat Immunol 2000;1:496-501.

62. Sarkar A, Hall MW, Exline M, Hart J, Knatz N, Gatson NT, Wewers MD. Caspase-1 regulates escherichia coli sepsis and splenic B cell apoptosis independently of interleukin-1 and interleukin-18. Am J Respir Crit Care Med 2006;174:1003-1010.

63. Venet F, Chung CS, Kherouf H, Geeraert A, Malcus C, Poitevin F, Bohe J, Lepape A, Ayala A, Monneret G. Increased circulating regulatory T cells (CD4(+)CD25 (+)CD127 (-)) contribute to lymphocyte anergy in septic shock patients. Intensive Care Med 2009;35:678-686.

64. Zeidler D, Zahringer U, Gerber I, Dubery I, Hartung T, Bors W, Hutzler P, Durner J. Innate immunity in arabidopsis thaliana: Lipopolysaccharides activate

104 nitric oxide synthase (NOS) and induce defense genes. Proc Natl Acad Sci U S A 2004;101:15811-15816.

65. Leulier F, Parquet C, Pili-Floury S, Ryu JH, Caroff M, Lee WJ, Mengin- Lecreulx D, Lemaitre B. The drosophila immune system detects bacteria through specific peptidoglycan recognition. Nat Immunol 2003;4:478-484.

66. Zipfel C, Felix G. Plants and animals: A different taste for microbes? Curr Opin Plant Biol 2005;8:353-360.

67. Wink M. Functions of plant secondary metabolites and their exploitation in biotechnology. Sheffield, England; Boca Raton, FL: Sheffield Academic Press; CRC Press; 1999. pp. 8-13.

68. Crozier AMNCHA. Plant secondary metabolites: Occurrence, structure and role in the human diet. Blackwell Publishing; 2006.

69. Meeran SM, Katiyar SK. Cell cycle control as a basis for cancer chemoprevention through dietary agents. Front Biosci 2008;13:2191-2202.

70. Chen D, Landis-Piwowar KR, Chen MS, Dou QP. Inhibition of proteasome activity by the dietary flavonoid apigenin is associated with growth inhibition in cultured breast cancer cells and xenografts. Breast Cancer Res 2007;9:R80.

71. Piantelli M, Rossi C, Iezzi M, La Sorda R, Iacobelli S, Alberti S, Natali PG. Flavonoids inhibit melanoma lung metastasis by impairing tumor cells endothelium interactions. J Cell Physiol 2006;207:23-29.

72. Ruiz PA, Braune A, Holzlwimmer G, Quintanilla-Fend L, Haller D. Quercetin inhibits TNF-induced NF-κB transcription factor recruitment to proinflammatory gene promoters in murine intestinal epithelial cells. J Nutr 2007;137:1208-1215. 105 73. Ruiz PA, Haller D. Functional diversity of flavonoids in the inhibition of the proinflammatory NF-κB, IRF, and AKT signaling pathways in murine intestinal epithelial cells. J Nutr 2006;136:664-671.

74. Takahashi K, Morikawa A, Kato Y, Sugiyama T, Koide N, Mu MM, Yoshida T, Yokochi T. Flavonoids protect mice from two types of lethal shock induced by endotoxin. FEMS Immunol Med Microbiol 2001;31:29-33.

75. Vargo MA, Voss OH, Poustka F, Cardounel AJ, Grotewold E, Doseff AI. Apigenin-induced-apoptosis is mediated by the activation of PKCδ and caspases in leukemia cells. Biochem Pharmacol 2006;72:681-692.

76. Zheng PW, Chiang LC, Lin CC. Apigenin induced apoptosis through p53- dependent pathway in human cervical carcinoma cells. Life Sci 2005;76:1367- 1379.

77. Schiff PB, Fant J, Horwitz SB. Promotion of microtubule assembly in vitro by taxol. Nature 1979;277:665-667.

78. Wani MC, Taylor HL, Wall ME, Coggon P, McPhail AT. Plant antitumor agents. VI. The isolation and structure of taxol, a novel antileukemic and antitumor agent from taxus brevifolia. J Am Chem Soc 1971;93:2325-2327.

79. Landis-Piwowar KR, Kuhn DJ, Wan SB, Chen D, Chan TH, Dou QP. Evaluation of proteasome-inhibitory and apoptosis-inducing potencies of novel (- )-EGCG analogs and their prodrugs. Int J Mol Med 2005;15:735-742.

80. Cai H, Sale S, Schmid R, Britton RG, Brown K, Steward WP, Gescher AJ. Flavones as colorectal cancer chemopreventive agents--phenol-o-methylation enhances efficacy. Cancer Prev Res (Phila Pa) 2009;2:743-750.

106 81. Hertog MG, Kromhout D, Aravanis C, Blackburn H, Buzina R, Fidanza F, Giampaoli S, Jansen A, Menotti A, Nedeljkovic S, et al. Flavonoid intake and long-term risk of coronary heart disease and cancer in the seven countries study. Arch Intern Med 1995;155:381-386.

82. Kang HK, Ecklund D, Liu M, Datta SK. Apigenin, a non-mutagenic dietary flavonoid, suppresses lupus by inhibiting autoantigen presentation for expansion of autoreactive Th1 and Th17 cells. Arthritis Res Ther 2009;11:R59.

83. Knekt P, Jarvinen R, Seppanen R, Hellovaara M, Teppo L, Pukkala E, Aromaa A. Dietary flavonoids and the risk of lung cancer and other malignant neoplasms. Am J Epidemiol 1997;146:223-230.

84. Matsuno H, Nakamura H, Katayama K, Hayashi S, Kano S, Yudoh K, Kiso Y. Effects of an oral administration of glucosamine-chondroitin-quercetin glucoside on the synovial fluid properties in patients with osteoarthritis and rheumatoid arthritis. Biosci Biotechnol Biochem 2009;73:288-292.

85. Panes J, Gerritsen ME, Anderson DC, Miyasaka M, Granger DN. Apigenin inhibits tumor necrosis factor-induced intercellular adhesion molecule-1 upregulation in vivo. Microcirculation 1996;3:279-286.

86. Ujiki MB, Ding XZ, Salabat MR, Bentrem DJ, Golkar L, Milam B, Talamonti MS, Bell RH, Jr., Iwamura T, Adrian TE. Apigenin inhibits pancreatic cancer cell proliferation through G2/M cell cycle arrest. Mol Cancer 2006;5:76.

87. Xu L, Zhang L, Bertucci AM, Pope RM, Datta SK. Apigenin, a dietary flavonoid, sensitizes human T cells for activation-induced cell death by inhibiting PKB/AKT and NF-κB activation pathway. Immunol Lett 2008;121:74-83.

88. Crespo I, Garcia-Mediavilla MV, Almar M, Gonzalez P, Tunon MJ, Sanchez-Campos S, Gonzalez-Gallego J. Differential effects of dietary flavonoids

107 on reactive oxygen and nitrogen species generation and changes in antioxidant enzyme expression induced by proinflammatory cytokines in chang liver cells. Food Chem Toxicol 2008;46:1555-1569.

89. Kumazawa Y, Kawaguchi K, Takimoto H. Immunomodulating effects of flavonoids on acute and chronic inflammatory responses caused by tumor necrosis factor alpha. Curr Pharm Des 2006;12:4271-4279.

90. Zheng W, Wang SY. Antioxidant activity and phenolic compounds in selected herbs. J Agric Food Chem 2001;49:5165-5170.

91. Mattila P, Astola J, Kumpulainen J. Determination of flavonoids in plant material by HPLC with diode-array and electro-array detections. J Agric Food Chem 2000;48:5834-5841.

92. Schutz K, Kammerer D, Carle R, Schieber A. Identification and quantification of caffeoylquinic acids and flavonoids from artichoke (cynara scolymus l.) heads, juice, and pomace by HPLC-DAD-ESI/MS(n). J Agric Food Chem 2004;52:4090-4096.

93. Harnly JM, Doherty RF, Beecher GR, Holden JM, Haytowitz DB, Bhagwat S, Gebhardt S. Flavonoid content of U.S. Fruits, vegetables, and nuts. J Agric Food Chem 2006;54:9966-9977.

94. English D, Andersen BR. Single-step separation of red blood cells. Granulocytes and mononuclear leukocytes on discontinuous density gradients of Ficoll-Hypaque. J Immunol Methods 1974;5:249-252.

95. Liu L, Kwak YT, Bex F, Garcia-Martinez LF, Li XH, Meek K, Lane WS, Gaynor RB. DNA-dependent protein kinase phosphorylation of IκBα and IκB regulates NF-κB DNA binding properties. Mol Cell Biol 1998;18:4221-4234.

108 96. Fernandez M, Medina A, Santos F, Carbajo E, Rodriguez J, Alvarez J, Cobo A. Exacerbated inflammatory response induced by insulin-like growth factor I treatment in rats with ischemic acute renal failure. J Am Soc Nephrol 2001;12:1900-1907.

97. Baran CP, Opalek JM, McMaken S, Newland CA, O'Brien JM, Jr., Hunter MG, Bringardner BD, Monick MM, Brigstock DR, Stromberg PC, Hunninghake GW, Marsh CB. Important roles for macrophage colony-stimulating factor, CC chemokine ligand 2, and mononuclear phagocytes in the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med 2007;176:78-89.

98. Cai H, Boocock DJ, Steward WP, Gescher AJ. Tissue distribution in mice and metabolism in murine and human liver of apigenin and tricin, flavones with putative cancer chemopreventive properties. Cancer Chemother Pharmacol 2007;60:257-266.

99. Han Y, Runge MS, Brasier AR. Angiotensin II induces interleukin-6 transcription in vascular smooth muscle cells through pleiotropic activation of nuclear-factor κB transcription factors. Circ Res 1999;84:695-703.

100. Hougee S, Sanders A, Faber J, Graus YM, van den Berg WB, Garssen J, Smit HF, Hoijer MA. Decreased pro-inflammatory cytokine production by LPS- stimulated PBMC upon in vitro incubation with the flavonoids apigenin, luteolin or chrysin, due to selective elimination of monocytes/macrophages. Biochem Pharmacol 2005;69:241-248.

101. Hotchkiss RS, Tinsley KW, Swanson PE, Chang KC, Cobb JP, Buchman TG, Korsmeyer SJ, Karl IE. Prevention of lymphocyte cell death in sepsis improves survival in mice. Proc Natl Acad Sci U S A 1999;96:14541-14546.

102. Andonegui G, Kerfoot SM, McNagny K, Ebbert KV, Patel KD, Kubes P. Platelets express functional Toll-like receptor-4. Blood 2005;106:2417-2423.

109 103. Andonegui G, Goyert SM, Kubes P. Lipopolysaccharide-induced leukocyte-endothelial cell interactions: A role for CD14 versus Toll-like receptor 4 within microvessels. J Immunol 2002;169:2111-2119.

104. Bozic CR, Gerard NP, von Uexkull-Guldenband C, Kolakowski LF, Jr., Conklyn MJ, Breslow R, Showell HJ, Gerard C. The murine interleukin 8 type b receptor homologue and its ligands. Expression and biological characterization. J Biol Chem 1994;269:29355-29358.

105. Wolpe SD, Sherry B, Juers D, Davatelis G, Yurt RW, Cerami A. Identification and characterization of macrophage inflammatory protein 2. Proc Natl Acad Sci U S A 1989;86:612-616.

106. Greenberger MJ, Strieter RM, Kunkel SL, Danforth JM, Laichalk LL, McGillicuddy DC, Standiford TJ. Neutralization of macrophage inflammatory protein-2 attenuates neutrophil recruitment and bacterial clearance in murine klebsiella pneumonia. J Infect Dis 1996;173:159-165.

107. Huber AR, Kunkel SL, Todd RF, 3rd, Weiss SJ. Regulation of transendothelial neutrophil migration by endogenous interleukin-8. Science 1991;254:99-102.

108. Stapleton CM, Jaradat M, Dixon D, Kang HS, Kim SC, Liao G, Carey MA, Cristiano J, Moorman MP, Jetten AM. Enhanced susceptibility of staggerer (roralphasg/sg) mice to lipopolysaccharide-induced lung inflammation. Am J Physiol Lung Cell Mol Physiol 2005;289:L144-152.

109. Ramana KV, Willis MS, White MD, Horton JW, DiMaio JM, Srivastava D, Bhatnagar A, Srivastava SK. Endotoxin-induced cardiomyopathy and systemic inflammation in mice is prevented by aldose reductase inhibition. Circulation 2006;114:1838-1846.

110 110. Yoshimura T, Matsushima K, Tanaka S, Robinson EA, Appella E, Oppenheim JJ, Leonard EJ. Purification of a human monocyte-derived neutrophil chemotactic factor that has peptide sequence similarity to other host defense cytokines. Proc Natl Acad Sci U S A 1987;84:9233-9237.

111. Pandey MK, Sandur SK, Sung B, Sethi G, Kunnumakkara AB, Aggarwal BB. Butein, a tetrahydroxychalcone, inhibits nuclear factor (NF)-κB and NF-κB- regulated gene expression through direct inhibition of IκBα kinase  on cysteine 179 residue. J Biol Chem 2007;282:17340-17350.

112. Lorenzo P, Alvarez R, Ortiz MA, Alvarez S, Piedrafita FJ, de Lera AR. Inhibition of IκB kinase- and anticancer activities of novel chalcone adamantyl arotinoids. J Med Chem 2008;51:5431-5440.

113. Casagrande F, Darbon JM. Effects of structurally related flavonoids on cell cycle progression of human melanoma cells: Regulation of cyclin-dependent kinases Cdk2 and Cdk1. Biochem Pharmacol 2001;61:1205-1215.

114. Sarno S, de Moliner E, Ruzzene M, Pagano MA, Battistutta R, Bain J, Fabbro D, Schoepfer J, Elliott M, Furet P, Meggio F, Zanotti G, Pinna LA. Biochemical and three-dimensional-structural study of the specific inhibition of protein kinase ck2 by [5-oxo-5,6-dihydroindolo-(1,2-a)quinazolin-7-yl]acetic acid (IQA). Biochem J 2003;374:639-646.

115. Yu M, Yeh J, Van Waes C. Protein kinase casein kinase 2 mediates inhibitor-κB kinase and aberrant nuclear factor-κB activation by serum factor(s) in head and neck squamous carcinoma cells. Cancer Res 2006;66:6722-6731.

116. Yamagata K, Miyashita A, Matsufuji H, Chino M. Dietary flavonoid apigenin inhibits high glucose and tumor necrosis factor alpha-induced adhesion molecule expression in human endothelial cells. J Nutr Biochem 2009.

111 117. Romieu-Mourez R, Landesman-Bollag E, Seldin DC, Traish AM, Mercurio F, Sonenshein GE. Roles of IKK kinases and protein kinase ck2 in activation of nuclear factor-κB in breast cancer. Cancer Res 2001;61:3810-3818.

118. Akira S, Hoshino K. Myeloid differentiation factor 88-dependent and - independent pathways in Toll-like receptor signaling. J Infect Dis 2003;187 Suppl 2:S356-363.

119. Yamamoto M, Takeda K, Akira S. Tir domain-containing adaptors define the specificity of TLR signaling. Mol Immunol 2004;40:861-868.

120. Oshiumi H, Sasai M, Shida K, Fujita T, Matsumoto M, Seya T. Tir- containing adapter molecule (TICAM)-2, a bridging adapter recruiting to Toll-like receptor 4 TICAM-1 that induces interferon-. J Biol Chem 2003;278:49751- 49762.

121. Hoshino K, Sugiyama T, Matsumoto M, Tanaka T, Saito M, Hemmi H, Ohara O, Akira S, Kaisho T. IκB kinase-α is critical for interferon-alpha production induced by Toll-like receptors 7 and 9. Nature 2006;440:949-953.

122. Ross JA, Kasum CM. Dietary flavonoids: Bioavailability, metabolic effects, and safety. Annu Rev Nutr 2002;22:19-34.

123. Nemeth K, Plumb GW, Berrin JG, Juge N, Jacob R, Naim HY, Williamson G, Swallow DM, Kroon PA. Deglycosylation by small intestinal epithelial cell beta- glucosidases is a critical step in the absorption and metabolism of dietary flavonoid glycosides in humans. Eur J Nutr 2003;42:29-42.

124. Liu Y, Hu M. Absorption and metabolism of flavonoids in the Caco-2 cell culture model and a perused rat intestinal model. Drug Metab Dispos 2002;30:370-377.

112 125. Yao LH, Jiang YM, Shi J, Tomas-Barberan FA, Datta N, Singanusong R, Chen SS. Flavonoids in food and their health benefits. Plant Foods Hum Nutr 2004;59:113-122.

126. Kuhnau J. The flavonoids. A class of semi-essential food components: Their role in human nutrition. World Rev Nutr Diet 1976;24:117-191.

127. Landolfi R, Mower RL, Steiner M. Modification of platelet function and arachidonic acid metabolism by bioflavonoids. Structure-activity relations. Biochem Pharmacol 1984;33:1525-1530.

128. Moroney MA, Alcaraz MJ, Forder RA, Carey F, Hoult JR. Selectivity of neutrophil 5-lipoxygenase and cyclo-oxygenase inhibition by an anti-inflammatory flavonoid glycoside and related aglycone flavonoids. J Pharm Pharmacol 1988;40:787-792.

129. Hollman PC, de Vries JH, van Leeuwen SD, Mengelers MJ, Katan MB. Absorption of dietary quercetin glycosides and quercetin in healthy ileostomy volunteers. Am J Clin Nutr 1995;62:1276-1282.

130. Setchell KD, Brown NM, Zimmer-Nechemias L, Brashear WT, Wolfe BE, Kirschner AS, Heubi JE. Evidence for lack of absorption of soy isoflavone glycosides in humans, supporting the crucial role of intestinal metabolism for bioavailability. Am J Clin Nutr 2002;76:447-453.

131. Breinholt VM, Offord EA, Brouwer C, Nielsen SE, Brosen K, Friedberg T. In vitro investigation of cytochrome p450-mediated metabolism of dietary flavonoids. Food Chem Toxicol 2002;40:609-616.

132. Kimura Y, Ito H, Ohnishi R, Hatano T. Inhibitory effects of polyphenols on human cytochrome p450 3A4 and 2C9 activity. Food Chem Toxicol 2009.

113 133. Si D, Wang Y, Zhou YH, Guo Y, Wang J, Zhou H, Li ZS, Fawcett JP. Mechanism of cyp2C9 inhibition by flavones and flavonols. Drug Metab Dispos 2009;37:629-634.

134. Russell JA, Singer J, Bernard GR, Wheeler A, Fulkerson W, Hudson L, Schein R, Summer W, Wright P, Walley KR. Changing pattern of organ dysfunction in early human sepsis is related to mortality. Crit Care Med 2000;28:3405-3411.

135. Hotchkiss RS, McConnell KW, Bullok K, Davis CG, Chang KC, Schwulst SJ, Dunne JC, Dietz GP, Bahr M, McDunn JE, Karl IE, Wagner TH, Cobb JP, Coopersmith CM, Piwnica-Worms D. Tat-bh4 and tat-Bcl-xl peptides protect against sepsis-induced lymphocyte apoptosis in vivo. J Immunol 2006;176:5471- 5477.

136. Benjamim CF, Ferreira SH, Cunha FQ. Role of nitric oxide in the failure of neutrophil migration in sepsis. J Infect Dis 2000;182:214-223.

137. Haselmayer P, Grosse-Hovest L, von Landenberg P, Schild H, Radsak MP. TREM-1 ligand expression on platelets enhances neutrophil activation. Blood 2007;110:1029-1035.

138. Watanabe K, Iida M, Takaishi K, Suzuki T, Hamada Y, Iizuka Y, Tsurufuji S. Chemoattractants for neutrophils in lipopolysaccharide-induced inflammatory exudate from rats are not Interleukin-8 counterparts but Gro-gene- product/melanoma-growth-stimulating-activity-related factors. Eur J Biochem 1993;214:267-270.

139. Proost P, De Wolf-Peeters C, Conings R, Opdenakker G, Billiau A, Van Damme J. Identification of a novel granulocyte chemotactic protein (Gcp-2) from human tumor cells. In vitro and in vivo comparison with natural forms of Gro, IP- 10, and IL-8. J Immunol 1993;150:1000-1010.

114 140. Inoue K, Takano H, Yanagisawa R, Hirano S, Kobayashi T, Fujitani Y, Shimada A, Yoshikawa T. Effects of inhaled nanoparticles on acute lung injury induced by lipopolysaccharide in mice. Toxicology 2007;238:99-110.

141. Fitzhugh DJ, Shan S, Dewhirst MW, Hale LP. Bromelain treatment decreases neutrophil migration to sites of inflammation. Clin Immunol 2008;128:66-74.

142. Dunican AL, Leuenroth SJ, Grutkoski P, Ayala A, Simms HH. TNFalpha- induced suppression of PMN apoptosis is mediated through Interleukin-8 production. Shock 2000;14:284-288; discussion 288-289.

143. Kim JY, Lee DH, Joo JK, Jin JO, Wang JW, Hong YS, Kwak JY, Lee KS. Effects of peritoneal fluid from endometriosis patients on interferon-gamma- induced protein-10 (CXCL10) and interleukin-8 (CXCL8) released by neutrophils and CD4+ T cells. Am J Reprod Immunol 2009;62:128-138.

144. Shin HK, Kim YK, Kim KY, Lee JH, Hong KW. Remnant lipoprotein particles induce apoptosis in endothelial cells by NAD(p)H oxidase-mediated production of superoxide and cytokines via lectin-like oxidized low-density lipoprotein receptor-1 activation: Prevention by cilostazol. Circulation 2004;109:1022-1028.

115