Sumaira Sharif DOCTOR of PHILOSOPHY in BIOCHEMISTRY

Biochemical and Nutraceutical Analysis of Wild and Commercial Mushrooms

By Sumaira Sharif

M.Phil. (UAF)

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

in

BIOCHEMISTRY

DEPARTMENT OF BIOCHEMISTRY

FACULTY OF SCIENCES UNIVERSITY OF AGRICULTURE, FAISALABAD PAKISTAN 2016

DECLARATION I hereby declare that the contents of the thesis, “Biochemical and Nutraceutical Analysis of Wild and Commercial Mushrooms” are product of my own research and no part has been copied from any published source (except the references, standard mathematical or genetic models/equations/formulae/protocols etc). I further declare that this work has not been submitted for award of any diploma/degree. The University may take action if the information provided is found inaccurate at any stage.

Sumaira Sharif 2002-ag-727

The Controller of Examinations, University of Agriculture, Faisalabad.

―We, the Supervisory Committee, certify that the contents and form of thesis submitted by Ms. Sumaira Sharif, Regd. No. 2002-ag-727 have been found satisfactory and recommend that it be processed for evaluation, by the External

Examiner(s) for the award of degree‖.

Supervisory Committee

1. Chairman ______Dr. Muhammad Shahid

2. Member ______Prof. Dr. Munir Ahmad Sheikh

3. Member ______Prof. Dr. Sajjad-ur-Rahman

DEDICATED

To

My loving and caring Abu Ammi and G Who always provide me compassion, unparalleled and unconditional love and support

ACKNOWLEDGEMENTS

In the name of Allah, the merciful, the beneficent

Words are bound and knowledge is limited to praise Allah Subhanahu WA Taala, the omnipotent, the beneficent and merciful. It is by His grace and mercy alone, that I have come so far and achieved so much. Peace and blessings be upon Holy Prophet Muhammad (SAW), the everlasting source of guidance and knowledge for humanity. With genuine humanity, I acknowledge your aid, God. Please bless this work with your acceptance. I have a pleasure to ensure my sincere gratitude and deepest thanks to Dr. Muhammad Shahid, whose stimulating supervision, guidance and support made this work possible. I am grateful to him for holding me to a high standard thus enriching me with the skills and motivations to refine my research approach. I heartily thank him very much for his valuable help and kindness. I express my gratitude to Dr. Connie M. Weaver, who guided me during my research work in PURDUE University, West Lafayette, USA. Her support, encouragement, inspiring attitude and enthusiasm were impressive. The support, help and company of the whole group are appreciated. I wish to thank Prof. Dr. Munir A. Sheikh, (Ex. Dean Faculty of Sciences) Department of Biochemistry and Prof. Dr. Sajjad-UR-Rahman, Institute of Microbiology University of Agriculture, Faisalabad, for their guidance, encouragement, and help throughout my PhD studies. I am also thankful to my genius friends and fellows, Saira Mohsin, Mohsin Bhai, Dr. Ali Raza, Aisha, Dr. Sumia Akram, Nazia Kanwal, Dr. Sammar Abbas, Salman Bhai, Dr. Muhammad Mushtaq, Dr. Abid Ali, Ali bhai and shamshad Sb and especially to Dr. Asia Atta, Ghulam Mustafa and Dr. Mazhar Abbas for their love providing amenities and friendship. Many thanks are due to my nephews M. Faateh, M. Mahad, M. Haad, M. Ateeb and my nice‘s Wardah, Irha, Maryam and Abeeha for giving me so much joy and happiness. Special thanks to my uncle Iqbal Hussain Qureshi for guidance at each and every fraction of my life. I owe immense feelings of love and thanks for my affectionate and kind Mother and Father, asserts of my life whose prayers will never die whose love will never mitigate, as their prayers are always behind my each success. Thanks to my Brothers, Imran Babar and Farhan Ahmad and Sisters Humaira, Nadia, Guria and Nazia for their care and support. In last but not least I pay my cordial thanks to the special one who lives in my mind and soul, who is nearest, deepest and dearest to me for being there in time of need, for continuous support and encouragement for the fulfillment of my study. Sumaira Sharif

TABLE OF CONTENTS

Sr. No. TITLE Page No. 1 INTRODUCTION 1 2 REVIEW OF LITERATURE 5 2.1 Selected commercial and wild mushrooms 5

2.1.1 Pleurotus ostreatus 5

2.1.1.1 Scientific classification 5

2.1.1.2 Distribution, nutritional and medicinal uses 5

2.1.2 Lentinus edodes 6

2.1.2.1 Scientific classification 6

2.1.2.2 Distribution, nutritional and medicinal uses 6

2.1.3 Hericium erinaceus 7

2.1.3.1 Scientific classification 7

2.1.3.2 Distribution, nutritional and medicinal uses 7

2.1.4 Volvariella volvacea 8

2.1.4.1 Scientific classification 8

2.1.4.2 Distribution, nutritional and medicinal uses 8

2.1.5 Ganoderma lucidum 9

2.1.5.1 Scientific classification 9

2.1.5.2 Distribution, nutritional and medicinal uses 9

2.2 Nutritional analysis of mushrooms 11

2.2.1 Proximate composition 11

2.2.2 Protein contents 11

i

2.2.3 Carbohydrates and fiber contents 12

2.2.4 Fat contents 13

2.2.5 Ash contents 13 2.3 Mineral contents of mushrooms 13 2.4 Amino acids composition of different mushrooms 14 2.5 Nutraceutical contents of mushrooms 17

2.5.1 Tocopherols 17

2.5.2 Alkaloids 18

2.5.3 Saponins and tannins 18

2.5.4 Carotenoids 18

2.5.5 Lycopene 19

2.5.6 Terpenoids 19 2.6 Antimicrobial potential of mushrooms 20 2.7 Antioxidant potential of mushrooms extracts 21 2.8 Anticancer potential of mushrooms 23 2.9 Lipid lowering effects of mushrooms 24 2.10 Phenolic acids profile of different mushrooms 25 2.11 Sugar contents of mushrooms 26 2.12 Fatty acids composition of mushrooms 26 2.13 Polysaccharides composition 28 3 MATERIALS AND METHODS 29 3.1 Standards, chemicals and reagents 29 3.2 Analytical instruments used in the research 30 3.3 Sample collection and preparation 31

ii

3.4 Selected mushrooms 32 3.5 Molecular identification of Ganoderma lucidum 32 3.5.1 Selection of fungi 32 3.5.2 Preparation of fungal mycelia 33

3.5.3 DNA isolation 33

3.5.3.1 Confirmation of isolated DNA by agarose gel electrophoresis 34

3.5.3.2 DNA quantification 34 3.5.4 Polymerase chain reaction (PCR) 35 3.5.4.1 Primers 35 3.5.4.2 Reaction mixture setup 35 3.5.4.3 Temperature cycling 35

3.5.4.4 Recovery of amplified gene from agarose gel 36 3.5.5 DNA Sequencing and Alignment Search (BLAST) 36 3.6 Proximate analysis of selected mushrooms 36 3.6.1 Estimation of crude fat 36

3.6.2 Estimation of crude protein 37

3.6.3 Estimation of crude fiber 37 3.6.4 Determination of ash contents 37 3.6.5 Determination of total carbohydrates 38 3.6.6 Total energy 38 3.7 Protein estimation by Bradford assay 38 3.8 Amino acids analysis 38 3.9 Minerals analysis 39 3.9.1 Instrumentation 39 3.10 Classical organic solvent extraction (COSE) 39 3.10.1 Extraction of selected mushrooms 40 3.11 Antimicrobial activity 40

iii

3.11.1 Antimicrobial activity by disc diffusion method 40 3.11.2 Minimum inhibition concentration (MIC) 41

3.11.3 Antibacterial activity by well diffusion method 41

3.11.4 Inhibition of microbial biofilm 42 3.12 Phenolic contents and antioxidant activity 42 3.12.1 Folin-Ciocalteu assay 42

3.12.2 Total flavonoid contents 43

3.12.3 DPPH scavenging activity assay 43

3.12.4 Reducing power 43 3.13 Brine shrimp lethality assay 44 3.13.1 Lethality concentration determination 44 Thrombolytic activities of selected mushrooms 3.14 44 extracts and fractions 3.14.1 Sample preparation 45

3.14.2 Collection of blood samples 45 3.14.3 Preparation of clot 45 3.14.4 Weight of clot before lysis 45 3.14.5 Addition of mushrooms extracts and fractions 45

3.14.6.1 Effect of concentration of sample 46

3.14.6.2 Effect of incubation time 46

3.14.6.3 Effect of the amount of sample 46 3.15 Anticancer potential of selected mushrooms 46 3.15.1 In vitro cell proliferation assay 46 α-Glucosidase and tyrosinase inhibition activities of 3.16 46 selected mushrooms 3.16.1 α-Glucosidase inhibition activity 46 3.16.2 Tyrosinase inhibition activity 47

iv

3.17 Phytochemical analysis 47 3.17.1 Qualitative analysis 47 3.17.1.1 Tests for alkaloids (Mayer‘s Test) 47 3.17.1.2 Test for detection of flavonoids (Alkaline reagent test) 47

3.17.1.3 Test for tannins 47

3.17.1.4 Test for saponins by froth test 48

3.17.2 Quantitative analysis 48

3.17.2.1 Alkaloid determination 48 3.17.2.2 Saponins determination 48 3.17.2.3 Flavonoids determination 48 3.17.2.4 Determination of tannins 49 3.17.2.5 Determination of β-carotenes 49 3.18 Analysis of phenolic acids by HPLC 49 3.18.1 Sample extraction and preparation 49 3.18.2 Instrumentation and chromatography 49 3.19 Tocopherols analysis of selected mushrooms 50 3.19.1 Sample preparation 50 3.19.2 HPLC analysis 51 3.20 Fatty acids analysis of selected mushrooms 52 3.20.1 Extraction 52 3.20.2 Instrumentation and chromatography 52 3.21 Determination of monosaccharide by alditol acetates 53 3.21.1 Hydrolysis 53 3.21.2 Reduction 53 3.21.3 O-Acetylation 53 3.22 Partially methylated alditol acetates (PMAA) 53 3.22.1 Methylation 53 3.22.2 Hydrolysis 54

v

3.22.3 Reduction 54 3.22.4 Acetylation 54 3.23 Glucan analysis of selected mushrooms 54 3.23.1 Extraction of crude polysaccharides 54 3.23.2 Purification procedures 55 3.23.3 Fractionation and purification 55 3.23.4 Phenol sulfuric acid assay 55 3.23.5 Characterization of glucans 56 3.23.6 Ultraviolet Visible Spectroscopy (UV/VIS) 56 3.23.7 Fourier Transformation Infrared Spectroscopy (FT-IR) 56 3.23.8 Scanning Electron Microscopy (SEM) 56 3.23.9 Preparation of silver nano-particles using polysaccharides 57 3.24 Statistical analysis 57 4 RESULTS AND DISCUSSION 58 4.1 Molecular Studies of Ganoderma lucidum 59 4.1.1 Isolation of genomic DNA 59 4.1.1.1 Quantification of isolated DNA 59 4.1.2 Polymerase Chain Reaction 59 4.1.3 Sequencing and BLAST results 60 Ganoderma lucidum internal transcribed spacer 1 (ITS), 4.1.4 60 partial sequence 4.2 Proximate analysis of selected mushrooms 62 4.2.1 Proximate composition of wild G. lucidum 63 4.3 Protein determination from selected mushrooms 64 4.4 Mineral profile of selected mushrooms 65 4.4.1 Mineral analysis of wild G. lucidum by ICP-OES 67 Analysis of micro/ macro elements of commercial 4.5 68 mushrooms by LIBS 4.5.1 Analysis of micro/ macro-elements of G. lucidum by LIBS 69 Amino acid analysis of selected commercial 4.6 70 mushrooms 4.6.1 Amino acid analysis of selected wild G. lucidum 72

vi

4.7 Extraction of selected mushrooms 73 Ethanol based extract yields (%) and their fractions with 4.7.1 73 different solvents 4.8 Antimicrobial potential of selected mushrooms 74 Antimicrobial activity of selected mushrooms by disc 4.8.1 75 diffusion method 4.8.2 Antimicrobial activity of wild G. lucidum by disc diffusion 78 Minimum Inhibitory Concentration (MIC) of selected 4.8.3 79 mushrooms 4.8.4 Minimum inhibitory concentration of wild G. lucidum 81 Antibacterial potential of mushrooms methanolic and 4.8.5 83 ethanolic extracts 4.8.6 Biofilm inhibition 84 Thrombolytic activity of mushrooms extracts and 4.9 86 fractions Effect of concentration, volume and time of incubation of 4.9.1 88 selected mushrooms on thrombolysis 4.10 Antioxidant potential of selected mushrooms 90 4.11 Anticancer potential of studied mushrooms 96 α-Glucosidase and antiyrosinase inhibition activities of 4.12 97 selected mushrooms Toxicological screening of selected mushrooms 4.13 99 fractions Phytochemical screening of selected mushrooms 4.14 101 species Qualitative and quantitative phytochemical analysis of wild G. 4.14.1 102 lucidum 4.15 HPLC analysis of phenolic acids 103 4.15.1 HPLC analysis of phenolic acids in G. lucidum 107 4.16 HPLC analysis of tocopherols and carotenoids 107 4.16.1 γ-Tocopherol and Lutein composition of G. lucidum 110 4.17 Fatty acid analysis of mushrooms by GC/MS 110 4.17.1 Fatty acid analysis of wild G. lucidum by GC/MS 113 GC/MS analysis of sugars (monosaccharide and 4.18 disaccharides) composition of selected mushrooms by 114 derivitization to alditol acetate

vii

4.18.1 GC/MS analysis of sugars composition of wild G. lucidum 117 Monosaccharide linkage composition of selected 4.19 mushrooms by partially methylated alditol acetates 118 (PMAAs) Monosaccharide linkage composition of wild G. lucidum by 4.19.1 122 PMAAs Characterization of polysaccharides from selected 4.20 123 mushrooms 4.20.1 Extraction and purification of polysaccharide 123 4.20.2 Scanning Electron Microscopy (SEM) 124 4.20.3 Fourier transformation infrared spectroscopy (FTIR) 126 UV-Vis spectroscopic analyses of polysaccharide based silver 4.20.4 131 nano-particles 5 SUMMARY 136 Literature Cited 139

viii

LIST OF TABLES

Table No. Title Page No. 2.1 Mineral profile of different mushrooms 15 2.2 The comparative amino acid composition of different mushrooms 16 2.3 The comparative phenolic acids profile of different mushrooms 27 2.4 The fatty acids composition of different mushrooms 27 3.1 Standards, chemicals and reagents 29 3.2 Information about the studied mushrooms 32 3.3 Composition of Potato Dextrose Agar (PDA) medium 33

3.4 Composition of Extraction Buffer 34

3.5 Composition of CTAB Buffer 34

3.6 Composition of 50 X TAE buffer 34 Reaction mixture setup of PCR for amplification of ITS from G. 3.7 35 lucidum 3.8 PCR cycling conditions used to amplify ITS from G. lucidum 36

4.1 Proximate composition of selected mushrooms (% DW) 62 Quantification of soluble proteins from different whole mushrooms 4.2 65 powder by Bradford method 4.3 Mineral analysis (mg/100g) of selected mushrooms by ICP-OES 66 Mineral contents of selected mushrooms by Laser Induced 4.4 69 Breakdown Spectroscopy (LIBS) Mineral contents of G. lucidum by Laser Induced Breakdown 4.5 70 Spectroscopy (LIBS) Essential amino acid profile of selected commercial mushrooms 4.6 71 (mg/100 g) by amino acid analyzer Non-essential amino acids profile of selected commercial 4.7 72 cultivated mushrooms (mg/100 g) by amino acid analyzer Essential and non-essential amino acid profile of wild G. lucidum 4.8 73 (mg/100 g) by amino acid analyzer Minimum inhibitory concentration (µg/mL) of selected mushrooms 4.9 80 against bacterial species (Mean ± SD) Minimum inhibitory concentration (µg/mL) of selected mushrooms 4.10 81 against fungal species (Mean ± SD)

ix

Minimum inhibitory concentration (µg/mL) of wild G. lucidum 4.11 82 against selected microbes Antibacterial testing of mushrooms extracts through determination 4.12 83 of zone of inhibition (mm) against the selected bacterial strains Bacterial biofilm inhibition percentage by selected mushrooms 4.13 85 extracts 4.14 Thrombolytic activities of selected mushrooms fractions (mg/mL) 87 Thrombolytic activities of selected mushrooms ethanolic and 4.15 88 methanolic extracts 4.16 Thrombolytic activity of G. lucidum 88 Thrombolytic activities of selected mushrooms extracts at varying 4.17 89 concentrations, incubation time and volume 4.18 Antioxidant potential of selected mushrooms fractions 91

4.19 Antioxidant potential of wild G. lucidum fractions 93 Antioxidant activity of selected mushrooms methanolic and 4.20 94 ethanolic extract α-Glucosidase and tyrosinase inhibition activities of selected 4.21 98 mushrooms (%DW) α-glucosidase and tyrosinase inhibition activity of G. lucidum 4.22 99 (%DW) Cytotoxic activity of selected mushrooms fractions against Brine 4.23 100 shrimp nauplii at concentration tested 3000,1000,100,10 (µg/mL) Cytotoxic activity of G. lucidum fractions against Brine shrimp 4.24 100 nauplii at concentration tested 3000,1000,100,10 (µg/mL) 4.25 Qualitative analysis of phytochemicals of selected mushrooms 101

4.26 Quantitative analysis of phytochemicals of selected mushrooms 102 HPLC analysis of phenolics (µg phenolics/g dry mushroom) in 4.27 107 selected mushrooms (mean ± standard deviation) γ-Tocopherol and Lutein composition (µg/g DW) of the mushroom 4.28 109 (mean±SD) 4.29 Fatty acid chemical finger print of selected mushrooms (mg/g DW) 112

4.30 Fatty acid chemical finger print of wild G. lucidum (mg/g DW) 114 Monosaccharide and disaccharide composition of selected 4.31 117 mushrooms (%) Monosaccharide linkage composition of selected wild and 4.32 121 commercial mushrooms (% DW)

x

Calculation of polysaccharide composition based on linkage 4.33 121 analysis Monosaccharide linkage composition of selected wild G. lucidum 4.34 122 (% DW)

xi

LIST OF FIGURES

Fig No. Title Page No.

2.1 The lifecycle of typical Basidiomycetes 10 Mechanism of antitumor and immunomodulating activity of 2.2 24 lentinan as a β-D-glucan A general mechanism of mushrooms effect on cholesterol and lipid 2.3 25 metabolism in human Ganoderma lucidum grown on tree trunk collected from Jinah 3.1 32 Garden, Faisalabad 3.2 Standard curve for Folin-Ciocalteu assay 43

3.3 Standard curves of phenolic acids 50

3.4 Standard curves for (a) γ-tocopherol, (b) lutein 51

3.5 Glucose standard curve for phenol sulfuric acid assay 56

4.1 Agarose gel (0.8%) showing genomic DNA from G. lucidum 59

4.2 PCR amplification of ITS region from G. lucidum 60 BLAST results showing subject sequences with significant 4.3 61 alignments 4.4 Proximate composition of wild G. lucidum (% DW) 64

4.5 Mineral profile (mg/100 g) of wild G. lucidum by ICP-OES 67 Spectra of mineral contents by laser induced breakdown 4.6 68 spectroscopy Spectrum of mineral contents of G. lucidum by laser induced 4.7 70 breakdown spectroscopy 4.8 The % age yield (w/w) of mushrooms in different solvents 73 Antibacterial activities of selected mushrooms‘ fractions by disc 4.9 76 diffusion method Antifungal activities of selected mushrooms‘ fractions by disc 4.10 77 diffusion method Antibacterial (a) and antifungal (b) activities of G. lucidum fractions 4.11 78 by disc diffusion method Antibacterial activity of methanolic and ethanolic extracts of 4.12 selected mushrooms against B. subtilis by agar well diffusion 84 method

xii

4.13 Micrscopy results of native and treated biofilm 86

4.14 Thrombolytic activity of mushrooms extracts 90 Viability (%) of water fractions of selected mushrooms at different 4.15 97 concentrations 4.16 HPLC chromatograms of selected mushrooms 106

4.17 HPLC fluorescence chromatograms of selected mushrooms 109

4.18 Mass spectra for the representative fatty acids by GC/MS 112 Mass spectra of G. lucidum for the representative fatty acids by 4.19 113 GC/MS 4.20 GC/MS chromatograms representing monosaccharides composition 116 GC/MS chromatogram representing monosaccharides composition 4.21 117 of G. lucidum GC/MS chromatograms representing monosaccharide linkage 4.22 120 composition GC/MS chromatogram representing monosaccharide linkage 4.23 122 composition of G. lucidum Polysaccharide concentration after ion exchange chromatography in 4.24 124 selected mushrooms Scanning Electron Microscopy (SEM) of crude and purified 4.25 126 polysaccharide from selected mushrooms 4.26 FT-IR Spectra of crude and purified polysaccharides 130 UV-Vis spectra of polysaccharides and polysaccharides based silver 4.27 134 nano-particles of mushrooms

xiii

Biochemical and Nutraceutical Analysis of Wild and Commercial Mushrooms ABSTRACT The increasing demand for nutraceuticals indicates that consumers are more concerned about a particular diet associated with good health and lower risk for certain ailments. Mushrooms can be used as functional food and as a source of nutraceuticals. The present study on the nutritional and biochemical characterization of wild and commercial mushrooms collected from Pakistan. Wild Ganoderma lucidum was collected from Jinnah garden Faisalabad, while two commercial locally cultivated mushrooms Pleurotus ostreatus and Volvariela volvacea and two commercially available exotic mushrooms Lentinus edodes and Hericium erinaceus were collected from local market. Proximate analysis of the selected mushrooms showed that protein, carbohydrate and fiber contents were present in significant amounts whereas the values were low for fats and energy. Crude protein contents were higher in V. volvacea and fiber contents were much higher in G. lucidum. Bioaccumulation capabilities studies of mushrooms revealed that the selected mushrooms are good bioaccumulators of macro and micronutrients; making them good source of essential and non-essential minerals. Phosphorous, potassium, magnesium and Iron were prevalent in V. volvacea whereas calcium and sodium were significantly higher in P. ostreatus. Wild G. lucidum contained more potassium and low sodium. Amino acid profile showed eight essential and nine non-essential amino acids were present in all the selected mushrooms. Glutamine, aspratate, arginine and tyrosine were found in significant amount in P. ostreatus whereas V. volvacea contained proline, cystine and alanine in high concentration. For the assessment of antioxidant, antimicrobial, cytotoxic (brine shrimp) studies the mushrooms were extracted in ethanol and further fractionated in different solvents with ascending polarity (n-hexane, dichloromethane, ethyl acetate and water). The water fractions exhibited good antioxidant and antimicrobial potential. V. volvacea and H. erinaceus had high phenolic contents while flavonoid contents were observed higher in P. ostreatus. Selected mushrooms were found nontoxic against Brine shrimps nauplii (Artemiasalina). Mushrooms extracts and fractions showed activity indicative of thrombolytic and anticancer properties, which were directly proportional to concentration, time of incubation and amount of extract. Mushrooms showed inhibition against tyrosinase and α-glucosidase enzymes. P. ostreatus was the best tyrosinase inhibitor xiv

with least IC50 value among the selected commercial mushrooms whereas α-glucosidase activity was very high in G. lucidum. Phyto-constituents (phenolic acids, tocopherol and lutein) were also identified and quantified by HPLC. Gallic acid, chlorogenic acid, p. cumaric acid, caffeic acid and ferulic acids were more frequent in H. erinaceus and V. volvacea. Fatty acids profile by GC/MS recorded that unsaturated fatty acids were more prevalent over the saturated fatty acids except G. lucidum, which contained more saturated fatty acids. Monosaccharide linkage analysis showed that glucose is the main sugar, while small amounts of D-galactose and D-mannose were also present. Methylation analysis revealed the presence of (1,3;1,4)-β-glucan as major components and xyloglucan and glucosamannan as minor components. The results from our studies confirm similar reports by others as well as showed indicator compounds that could have been responsible for their activity against infectious diseases caused by microbes, acclaimed traditional system of medicine. Further studies to substantiate our findings and their development into healthy nutritious food are recommended.

xv

List of abbreviations

Sr. No. Full Name Abbreviation 1 Lentinus edodes L. edodes 2 Pleurotus ostreatus P. ostreatus 3 Hericium erinaceus H. erinaceus 4 Volvariella volvacea V. volvacea 5 Ganoderma lucidum G. lucidum 6 Minimum Inhibitory Concentration MIC 7 1-1, diphenyl -2-picryl hydrazine DPPH 8 Tota phenolic contents TPC 9 High Performance Liquid Chromatography HPLC 10 Gas Chromatography/Mass Spectrometer GC/MS 11 Scanning Electron Microscopy SEM 12 Ultraviolet Visible Spectroscopy UV-Vis 13 Amino Acid Analyzer AA 14 Fourier Transformation Infrared Spectroscopy FTIR 15 Inductivity Coupled Plasma Optical Emission Spectrometry ICP-OES

16 Laser Induced Breakdown Spectroscopy LIBS 17 Silver nano-particles Ag-particles 18 Dry weight DW

xvi

CHAPTER # 1 INTRODUCTION

One of the world‘s biggest challenges is food insecurity that is common in developing countries which have poor food production systems and suffer from serious malnutrition (Muleta et al., 2013). Current food production systems are insufficient due to population growth. Studies on the production of non-conventional protein as an alternative source of dietary supplement have increased with growing global demands for good quality food (Mukhopadhyay and Guha, 2015). The modern food technology can also extend a great deal for the production of certain kinds of food from mushrooms and related species (Mosisa et al., 2015). Mushrooms represent one of the world‘s greatest untapped sources of highly nutritious food because of their functional, organoleptic, medicinal properties and economic significance hence would be a possible source to meet the protein supplement of world‘s supply (Kolar et al., 2011; Vilares et al., 2014). Mushrooms contain significant amount of nutraceuticals dietary fiber, polyunsaturated fatty acids (PUFA), proteins, peptides, amino acids, ketoacids, minerals, antioxidative vitamins and other antioxidants such as polyphenols and tocopherols. Cultivation of mushrooms using agricultural and industrial residues provides very cheap and eco-friendly alternatives (Babu and Subhasree 2010). Mushrooms are the demonstration of a general saying, ―Medicines and foods have a same origin‖. Mushrooms can be used in functional food and are a useful source of medicinal values (Mishra and Singh, 2010). Nutraceuticals are plant derived nutrients, food supplements or genetically engineered components that provide pharmaceutical or health benefits including the prevention and treatment of diseases (Barros et al., 2008). Currently nutraceuticals from mushrooms are becoming popular due to consumers awareness regarding their health promoting potentials (Leal et al., 2013). The use of mushrooms is as old as civilization. In the past, Chinese, Mexicans, Greeks, Romans and Egyptians preferred mushrooms only for their culinary characteristics, while their nutritional and functional values were recognizedvery late (Petkovsek and Pokorny, 2013). Almost 140,000 species of mushrooms are present in nature; however a smaller amount is being extensively used for food and little have gained the rank of business item (Sun, 2011). China was the world‘s major producer and consumer of mushrooms and output in 2011 accounted for more than 75% of the global supply (Wu et al., 2010; Xing and Zhao, 2014). In China, Yunnan province is a specific region abundant in wild-grown mushrooms

1

Chapter # 1 Introduction and over 880 species are identified as edible which accounts for 80% of the edible species identified in China and around 40% in the world (Wang et al., 2014). In Pakistan, fifty six edible species of mushrooms have been reported including four from Balochistan, three from Sindh, five from Punjab and forty four from Khyber Pakhtoon khan (KPK) and Kashmir (Sultana et al., 2007). Mushrooms contain high amounts of crude proteins, carbohydrates, fibers, low fat, bioactive vitamins and vitamin precursors. They are considered as low energy well-designed food that could contribute to a healthy dietary pattern. Free amino acids are the foremost constituents of functionally essential compounds found in mushrooms. Substantial amount of essential and non-essential amino acids have been reported from several species which are very important and involved in many crucial biological reactions (Kıvrak et al., 2014). Organisms require minerals as they play a vital role in cell and tissue functions. The macronutrient minerals maintain acid base balance, osmotic regulation of fluid and oxygen transport in the body and on the other hand micronutrient mineral play role in the catalytic processes within the enzyme systems (Koyyalamudi et al., 2013). Mushrooms have bioaccumulation capabilities and have been studied with the purpose of enriched food with minerals essential to human health (Falandysz et al., 2012). In this way mushrooms can be used in mineral deficiency therapy and can be used in the management of degenerative diseases (Vieira et al., 2013). Trans fatty acids (TFA) are getting rapidly expanding importance in human health due to the increased risk of cardiovascular diseases where they are negatively correlated with plasma HDL-cholesterol concentration and positively correlated with plasma LDL-cholesterol (Ergonul et al., 2013). The previous reports on fatty acids composition of mushrooms showed that unsaturated fatty acids were predominate over the saturated ones. This knowledge of fatty acid profile would serve as a useful database for nutritional and medicinal evaluation of mushroom species (Lee et al., 2011; Mkrtchyan, 2014). The use of natural antioxidants particularly the phenolics and flavonoids in foods as well as therapeutic and preventive medicines are gaining much recognition because of their health improving efficiency (Barros et al., 2007). Recent epidemiological studies have shown that natural antioxidants such as mushrooms polyphenols, falvonoids, and vitamin C are correlated with reduced incidence of chronic diseases, cancer and cardiovascular diseases.

2

Chapter # 1 Introduction

Several such natural antioxidants are believed to play a potential role to interfere with oxidation process through reaction with free radicals, chelating with metals and scavenging oxygen species in food and biological system (Palascios et al., 2011; Mishra et al., 2013). Synthetic antioxidants have been widely used for preventing oxidation and enhancing shelf life of foods. However, the use of synthetic antioxidants in food is discouraged due to their perceived carcinogenic potential (Ren et al., 2014). Mushrooms are also considered a significant and potent source of phytoconstituents including tocopherols, flavonoid, ascorbic acid, β-carotene, glycosides, saponins, alkaloids and tannins that vary among species renowned for their pharmaceutical properties (Egwim et al., 2011; Unekwu et al., 2014). Continuous search for novel chemical compounds by expanding natural products is essential to combat the adaptability of infectious microbes and to keep pace with the ever-increasing need for new drugs to cure various infections (Sharma et al., 2015). The rich diversity of fungal species offers potential sources of new antibiotics. Several antimicrobial agents including griseofulvin and penicillin have also been explored and isolated from different species of fungi (Ren et al., 2014). Edible mushrooms may be an ideal food for dietary prevention of atherosclerosis due to their low fat and high fiber contents and also serves as a predominant source of thrombolytic agents (Kim et al., 2006; Schneider et al., 2011). Polysaccharides from mushrooms have no toxic side effects unlike the existing anticancer medications and are supposed to prolong the life span of cancer patients (Liu et al., 2013). β-D-glucans act on number of immune receptors and activate immune cells such as monocytes, natural killer cells and dendrite cells (Volman et al., 2008; Jeff et al., 2013). Solvent extraction is the most frequently used technique for extraction and isolation of antioxidants however, the antioxidant efficiency and the yield of resulting extract are affected by the polarity of extracting solvent and solubility of isolated compounds (Degenhardt et al., 2002; Sicilia et al., 2003). Polar solvents such as methanol, ethanol, and water are often used for extraction of phenolics (Kaul, 1985; Chatha et al., 2006; Smolskaite et al., 2015). Two main approaches can be used for the isolation of various components from biological material namely parallel extraction of initial material with different solvents and sequential fractionation. The later approach involves non-polar cyclohexane followed by polar solvents

3

Chapter # 1 Introduction such as dichloromethane, ethyl acetate and water to assess the effects of various solvents on the solubility of different compounds (Kitzberger et al., 2007; Smolskaite et al., 2015). In Pakistan, mushrooms cultivation has not been given importance however there is favourable environment including huge quantity of waste material (decaying plant matter, organic disposals of food industries, wood logs) suitable for use in the production of beneficial food like mushrooms. To the best of our knowledge there is little information about nutraceutical properties of wild and commercial cultivated mushrooms of Pakistan. Therefore keeping in view the importance, wild locally grown (Ganoderma lucidum) and commercial locally cultivated (Pleurotus ostreatus, Volvariella volvacea) mushrooms in Pakistan and commercially available exotic mushrooms (Lentinus edodes, Hericium erinaceus) were evaluated and compared for their nutrients and nutraceutical potential. Antimicrobial potential was assessed against set of bacterial and fungal species. The selected mushrooms were screened for their phytochemicals, antioxidants along with thrombolytic and anticancerous potential. Polysaccharides were purified and characterized by scanning electron microscopy, furrier transformation infrared spectroscopy, and UV-VIS spectroscopy. The effect of different solvents on the isolation of mushrooms components was also assessed. The principle objectives of the present study are:

 To determine compounds of nutritional and nutraceutical importance in wild and commercial mushrooms in Pakistan

 To screen for antioxidant, antimicrobial, thrombolytic, anticancerous and cytotoxic activities of extracts from selected mushrooms of Pakistan

 To purify and characterize polysaccharides from selected mushrooms

4

CHAPTER # 2 REVIEW OF LITERATURE

The consumption of enriched and biologically important food continues to increase and mushrooms are becoming more and more importan in diet for their nutritional, organoleptic, and medicinal characteristics. In developing countries malnutrition is a major problem and edible mushrooms are excellent foods that can be incorporated into well-balanced diet due to superb dietary value, low contents of fat, high contents of fiber, functional compounds and high productivity per unit area to lessen the problem of malnutrition. 2.1. Selected commercial and wild mushrooms 2.1.1. Pleurotus ostreatus 2.1.1.1. Scientific classification Kingdom: Fungi Phylum: Basidyomycota Class: Agaricomycetes Order: Agaricales Family: Pleorotaceae Genus: Pleurotus Species: Pleurotus ostreatus 2.1.1.2. Distribution, nutritional and medicinal uses Pleurotus ostreatus (Jacq. Ex. Fr.) Kumm., commonly referred to as ―oyster mushroom‖, is the 3rd largest cultivated mushroom in the world (Upadhyay, 2011) and its popularity has been increasing due to ease of cultivation, high yield potential and high nutritional and medicinal values (Jose and Janardhanan, 2000; Imran et al., 2011; Jayakumar, 2011). These mushrooms could be grown commercially in the sub-tropical and in temperate zones of many countries of the world. In Pakistan wild oyster mushroom species grow on logs and stumps of trees in the forests of KPK and Azad Kashmir regions and other plantations in the plains of Punjab and Sindh during rainy season of monsoon (Rashid et al., 2007). Among the Pleurotus species, Pleurotus ostreatus is one of the edible mushrooms, called ―Meat of the Forest‖ and reported to contain higher concentrations of amino acids like, cystine, methionine and aspartic acid compared to other edible mushrooms (Jayakumar et al., 2011). Oyster mushrooms are considered as the health promoting foods because they are low in 5

Chapter # 2 Review of Literature calories and fats, contain higher amount of protein, chitin, vitamins and minerals Ca, P, Fe, K and Na. They also contain vitamins, like vitamin C and vitamin B complex (thiamine, riboflavin, folic acid) a good source of dietary fiber, other valuable nutrients, amino butyric acid (GABA) and ornithine (Chirinang and Intarapichet, 2009; Patil et al., 2010). P. ostreatus species have been used by human cultures all over the world for their nutritional significance, medicinal properties and other valuable effects (Mishra et al., 2013). Levostatin, a cholesterol-lowering drug derived from Pleurotus ostreatus are reported to be the best therapeutic agent for correcting hypercholestremia, thus it reduces the risk of high blood pressure and atherosclerosis (Jayakumar et al., 2007). The antimicrobial and antioxidant effects of this mushroom have also been well documentd (Gregori et al., 2007). In addition to these properties, that crude oyster extracts showed potent cytotoxic effect on PC-3 (prostatic cancer cells) and H-29 cell lines (colon cancer cells) (Jedinak and Sliva, 2008). 2.1.2. Lentinus edodes 2.1.2.1. Scientific classification Kingdom: Fungi Phylum: Basidyomycota Class: Agaricomycetes Order: Agaricales Family: Marasmiaceae Genus: Lentinus Species: Lentinus edodes 2.1.2.2. Distribution, nutritional and medicinal uses Lentinus edodes (Berk.) Sing., commonly known as shiitake mushroom, is the second most cultivated mushroom in the world (Jiang et al., 2010). Its production has been reached upto 7.5 million tons annually and is faster than for any other mushroom specie (Furlani and Godoy, 2008). Its importance is ascribed to both its nutritional value and medicinal applications, particularly their antitumor properties (Hatvani et al., 2001; Jeff et al., 2013). For pharmaceutical uses L. edodes mushrooms have been served as a model for investigating functional fungi properties and for the isolation of pure compounds (Maity et al., 2013; Bisen et al., 2010). L. edodes mushrooms contain a number of bioactive compounds including, ditary fiber, vitamin B1, B2 and C, ergosterol, folates, minerals and amino acids (Chen et al.,

6

Chapter # 2 Review of Literature

2012). Recently, (1-3, 1-6)-β-glucans enriched material developed from L. edodes and utilized as a wheat flour substitute to prepare low calorie and high fiber food (Kim et al., 2011). Because of their high β-glucan contents, it seems worthwhile to extend their use in wide variety of foods such as noodles that are the most consumed food next to bread (Heo et al., 2014). Polysaccharides from these mushrooms are reported to be the most important bioactive compound, For instance, Lentinan, (1-3)-α-d-glucan, is the most important polysaccharide isolated from L. edodes, having immunomodulating and antitumor effects (Xu et al., 2012). Fucomannogalactan (Carbonero et al., 2008), Mannoglucan (Zhang et al.,

2007), Glactoglucomannan (Fata et al., 2007), α-D-glucan (Pingyi et al., 2002) and β-D- glucan (Yu et al., 2010) have also been isolated from its mycelium, basidiocarp and culture. Various extracts from L. edodes have also been investigated for many other immunological benefits, which range from antiviral properties to possible treatment for several allergies, as well for arthritis (Jeff et al., 2013). 2.1.3. Hericium erinaceus 2.1.3.1. Scientific classification Kingdom: Fungi Phylum: Basidyomycota Class: Agaricomycetes Order: Russulales Family: Hericiaceae Genus: Hericium Species: Hericium erinaceus 2.1.3.2. Distribution, nutritional and medicinal uses Hericium erinaceus (Bull.) Pers., mushroom is known as ―Yamabushitake‖ and ―Houtou‖ in Japan and China respectively (Byung et al., 2003). It was reported that the culture and extracts of H. erinaceus have been used for the cure of gastricism and gastric ulcer (Lu et al., 2002; Bing-Ji et al., 2012). In recent times, Hericium erinaceus is receiving high attention due to its antioxidant and antimicrobial potential, anti-tumor activities, promotion synthesis of neurogrowth factor, cytotoxic and immunomodulatory effects (Kim et al., 2000; Lee et al., 2000; Liu et al., 2002; Mau et al., 2002).

7

Chapter # 2 Review of Literature

In addition, H. erinaceus derived polysaccharides are known to have no toxic side effects, unlike the existing anti-cancer chemical medications. When used in cancer remedy, these polysaccharides were able to prolong the life span of cance patients (Lee et al, 2009). The polysccharide produce an anti tumor effect by stimulating natural killer cells, B- cells, T- cells and macrophage dependent immune system responses (Wasser, 2002). In innate and adaptive immune reponses, the activated macrophages play an important role by producing interleukins-1-beta (IL-1b), cytokines, tumor necrosis factor-alpha (TNF-a), and nitric oxide (NO). The production of all these (TNF-a, IL-1b, NO) is an important part of the immune system response to the inflammatory stimuli (Porcheray et al., 2005). 2.1.4. Volvariella volvacea 2.1.4.1. Scientific classification Kingdom: Fungi Phylum: Basidyomycota Class: Agaricomycetes Order: Agaricales Family: Pleorotaceae Genus: Volvorielle Species: Volvorielle volvacea 2.1.4.2. Distribution, nutritional and medicinal uses V. volvacea (Bull, ex. Fr.) Sing., the Chinese straw mushroom is grown on an industrial scale in many tropical and subtropical regions, ranked fifth among the cultivated mushrooms in term of annual world wide production and cultivation (Wang et al., 2008). Unlike other commercial and cultivated mushrooms, V. volvacea grows poorly on the substrate with high lignin contents (Zhao et al., 2010). V. volvacea mushrooms cultivated on an array of agroindustrial residued due to cellulolytic characteristics, but low biological efficiency (conversion of growth substrate into mushrooms fruiting body) has limit its production (Ding et al., 2006). In recent years, there is increasing market demand due to its unique taste and flavor and high nutritional value (Mau et al., 1997). Antitumor polysaccharides, water and alkali extracted β glucans, and immunomodulatory lectins have also been isolated and purified (Liu et al., 2011). V. volvacea cell walls are composed of β-glucan, chitin and other polymers, (Adams, 2004; Bowman and Free, 2006; Latge, 2007). The fugal

8

Chapter # 2 Review of Literature immunomodulatory proteins a new family of bioactive compounds of small molecular weight proteins, isolated and identified from V. volvacea mushrooms, play an important role in antiallergy, antitumor and immunomodulating actions (Sun et al., 2014). 2.1.5. Ganoderma lucidum 2.1.5.1. Scientific classification Kingdom: Fungi Phylum: Basidyomycota Class: Agaricomycetes Order: Polyporales Family: Ganodermataceae Genus: Ganoderma Species: Ganoderma lucidum 2.1.5.2. Distribution, nutritional and medicinal uses Ganoderma lucidum (Fr.) P. Karst., are known by the common names Ling Zhi and Reishi or Mannentake in in China and Japan respectively (Saltarelli et al., 2009). The genus Ganoderma composed of more than fifty species, which had very significant interactions with human beings over the centuries (Chen et al., 2010; Ma et al., 2013). In the Chinese folklore, Ganoderma lucidum is considered to be a universal remedy to cure all kinds of diseases and known as ‗mushroom of immortality‘ (Smina et al., 2011). Ganoderma species don‘t have the fleshy texture, and are not listed among the group of edible mushrooms, because the fruiting bodies are thick, tough and corky. Although Ganoderma species could not be eating directly, they have been known all over the world as highly medicinal mushroom (Jonathan and Awotona, 2010). It is commercially cultivated and a diversity of remedies in the forms of extracts, tea and powder are available in the market (Xuanwei et al., 2007; Askin et al., 2010). There are almost more than 400 different bioactive compounds of which 150 triterpenoids and more than 100 different types of glucans are present in the different parts (mycelia, spores and basidiocarp) of this mushroom are potent immune-modulators, antioxidants, chemo-preventive and tumoricidal (Sanodiya et al., 2009; Cukalovic et al., 2010).

9

Chapter # 2 Review of Literature

There are more than 400 different bioactive compounds (triterpenoids and glucans) present in different parts (mycelia, spores and basidiocarp) of G. lucidum. These compounds have antioxidative, immune-modulating, chemo-preventive and tumoricidal properties (Sanodiya et al., 2009; Cukalovic et al., 2010). Ganoderic acid A was the first triterpenoid reported by Kubota et al. (1982) due to their unique structures, they were and are very useful in the chemotaxonomy of this genus. Triterpenoids, give the mushrooms its bitter taste, confers on it various health benefits, such as antioxidants and lipid lowering effects (Wu et al., 2010). Various polysaccharides have been extracted from the different part of G. lucidum; Structural analysis of polysaccharides showed that glucose is their major sugar component (Bao et al., 2001; Wang et al., 2002). But, Ganoderma lucidum polysaccharides are hetropolymers and contain mannose, fucose and xylose in different confirmations; it includes 1-3, 1-4 and 1-6 β and α-D–Glucans are the major source of biological activities and therapeutic potential (Lee et al., 1999; Bao et al., 2002). Mushrooms are heterotrophic eukaryotic organisms; classified in the kingdom of fungi. Mushrooms are the fleshy, spore-bearing fruiting body of a macro fungus, typically produced above ground on its food source, large enough to be seen with the naked eye and to be picked by hand. The word "mushroom" is most often applied to basidiomycetes and agaricomycetes that have a stem (stipe), a cap (pileus), and gills (lamellae) or pores on the underside of the cap. Basidiomycetes are named for their characteristic structure or cell, the basidium, which is involved in sexual reproduction. A basidium is produced at the tip of hyphae and normally is club shaped. Two or more basidiospores are produced by the basidium and basidia may be held within fruiting bodies called basidiocarps (Chang, 2008).

Fig 2.1. The lifecycle of typical Basidiomycetes (internet source)

10

Chapter # 2 Review of Literature

The early civilization of the Greek, Egyptian, Roman, Chinese, and Mexicans appreciated mushroom as delicacy, knew something about their therapeutic value, and often used them in religious ceremonies (Jahan et al., 2010). However, the mushroom cultivation did not come into existence until A. D. 600, when Auricularia auricula was cultivated in china on wood log. The biggest advancement in mushroom cultivation came in France about 1600 when Agaricus bisporus was cultivated upon a composted substrate (Aida et al., 2009). Cultivation of mushrooms is an economical and advantageous business on agriculture side. Different organic substrates especially waste materials produced by farms, plantations and factories can be used for the growth of the mushrooms. There is a plenty of agro-wastes in the forests and agriculture lands e.g. straw, corncobs, grass, sawdust, sugarcane bagasse, cotton waste, oil palm waste, coffee pulp, water hyacinth plants, coconut husk, tree leaves, branches and logs. All of these waste materials separately or in combination with each other can be used to produce a substrate with appropriate composition and suitable pH for the growth of mushrooms. Growth, yield and quality of mushrooms are dependent upon the quality of substrate (Nasreen et al., 2008; Babu et al., 2010). The literature regarding different features of the current work has been piled under the following headings 2.2. Nutritional profile of mushrooms 2.2.1. Proximate composition The knowledge of the proximate composition of cereals, grains, fruits, and vegetables being essential ingredients of human diet is of so much importance, especially when determining their functional food applications. The edible mushrooms are admired due to their low contents of fat and energy, elevated level of dietary fibers and functional compounds. Proximate composition of mushrooms also varies within and among species due to agro climate conditions and environmental factors (Falandysz et al., 2012; Nnorom et al., 2013). 2.2.2. Protein contents Mushrooms include edible, medicinal and poisonous species. The nutritional value of mushrooms is primarily related to their protein contents and is considered to have higher nutritional quality than that of plant proteins (FAO, 1991). The protein contents of mushrooms are not only dependent on environmental factors and stage of fruiting body

11

Chapter # 2 Review of Literature maturity but also on many other factors, such as mushrooms species, location, the part of mushroom selected for biochemical profiling, level of available nitrogen (Colak and Sesli, 2009). Mushrooms usually contain proteins 12.0-29.3% on dry weight basis (Wang et al., 2014). Some authors reported even higher protein contents e.g. 54% and 59% for Cantharellus cibarius and Lepista nuda respectively (Barros et al., 2008). Sabir et al. (2003) analyzed 11 mushrooms from the forests of Azad Kashmir and found that the total protein in these samples was in the range of 15.56-30.65%, while the protein contents in some wild mushrooms varied in the ranges of 24.32-76.63 g/100 g (Heleno et al., 2009; Beluhan and Ranogajec, 2011). 2.2.3. Carbohydrates and fiber contents Non-digestible carbohydrates form a large portion of the total carbohydrates of mushrooms; major compounds are oligosaccharides and non-starch polysaccharides (chitin, β-glucans and mannans) whereas dietary carbohydrates are primarily mannitol, glucose and glycogen (Cheung, 2010; Vaz et al., 2011). The carbohydrate contents of mushrooms collected in Azad Jammu and Kashmir ranges from 24-55% on dry weight basis (Sabir et al., 2003). Liu et al. (2012) reported the carbohydrate contents of five wild edible mushrooms collected from south west China (Clitocybe maxima, Catathelasma ventricosum, Stropharia rugoso- annulata, Craterellus cornucopioides and Laccaria amethystina) which were in the range of 57-65% of dry matter. Kim et al. (2009) reported the average total carbohydrates concentration (46.67 mg/g) in 10 species of mushrooms, the edible mushrooms contained 66.68 mg/g and the medicinal mushrooms contained 26.65 mg/g carbohydrates. Boletus regius was the species with the highest levels of carbohydrates 88.79 g/100 g on dry weight basis (Leal et al., 2013). Crude fiber is a group of indigestible carbohydrates that is not hydrolyzed by the enzymes in either the stomach or small intestine and it includes polysaccharides such as cereals, fruits and vegetables that originate from cell wall of plant material (Pettolino et al., 2012). It has key role in defining microbial population in our intestine. It can improve the function of the alimentary tract and also lower blood glucose and cholesterol levels, thus reduces the risk of serious and wide spread diseases diabetese, colorectal cancer and cardiovascular diseases (Kalac, 2009; Pettolino et al., 2012).

12

Chapter # 2 Review of Literature

Mushrooms cell walls components can also be considered as dietary fibers which contain a mixture of fibriller and matrix components which includes chitin (1→4)-β-linked polymer of

N-acetyl-glucosamine) and polysaccharides (1→3)-β-D-glucans and mannans). Some mushrooms were found to be low in crude fiber contents e.g. for C. aureus and S. aspratus values were 5%, while for many others up to 40% were reported (Wang et al., 2014). Crude fiber contents varied from 5.43-17.44% in mushroom species collected from Azad Jammu and Kashmir whereas the fiber contents of five mushrooms species from Nigeria were in the range of 3.24-8.70% (Sabir et al., 2003; Okoro and Achuba, 2012). The difference in carbohydrate contents of different species could be due to the differences in carbon contents of substrates, substrate combinations and variations in selected species (Mosisa et al., 2015). 2.2.4. Fat contents Crude fat contents of mushrooms are usually low and in the range of 1.0-6.7% for certain species collected in China (Wang et al., 2014). Croatian mushrooms contain low fat contents e.g. 1.34-6.45 g/100 g (Beluhan and Ranogajec, 2011) whereas Vietnamese edible mushrooms contain fat contents ranged from 1.7 to 3.0% on dry weight basis, in which A. polytricha contain (1.7%) the lowest and G. lucidum had the highest (3.0%) fat contents, V. volvacea, P. ostreatus and L. edodes contain 2.3, 2.4, 2.3% fat contents respectively (Hung and Nhi, 2012). 2.2.5. Ash contents The ash contents of these mushrooms were ranged from1.4-9.0% on dry weight basis. The highest ash contents were 9% observed in Volvariella volvacea, following by 7.6% in Pleurotus ostreatus, 6.3% in Lentinula edodes and thelowest were 1.4% in Ganoderma lucidum. Mattila et al. (2002) also reported that ash contents of Pleurotus ostreatus and Lentinula edodes grown in Finland were 8.0% and 5.8% respectively on a dry weight basis. Ash content of edible fruiting bodies is actually the least studied parameter and considered an insignificant constituent for assessment of the quality of mushroom flesh (Falandysz et al., 2008). 2.3. Mineral contents of mushrooms Minerals in the diet are required for metabolic reactions, transmission of nerve impulses, rigid bone formation, and regulation of water and salt balance (Okoro and Achuba, 2012). Since 1970, extensive research has been carried out on the occurrence of trace elements in

13

Chapter # 2 Review of Literature mushrooms. Fruiting bodies are bioindicator of environmental pollution as they can accumulate some heavy metals from the environment (Sarikurkcu et al., 2011). The accumulation of metals has been found to be affected by environmental and fungal factors, such as the development of mycelium, biochemical composition, nutritional needs, and substrate decomposition activity (Gursoy et al., 2009; Ku-ldo et al., 2014). Most of the mushrooms contain considerably high amounts of minerals and the levels of mineral elements are within the recommended dietary allowances (RDA) (Zahid et al., 2010). The high prevalence of potassium and the low concentration of sodium suggest the utilization of mushrooms in an anti-hypertensive diet (Kalac, 2009). The comparative mineral profile of different mushrooms is shown in Table 2.1. 2.4. Amino acids composition of different mushrooms Previous studies have indicated that edible mushroom species are highly nutritious, their nutritional value comparing favourably with that of meat, eggs and milk (Mdachi et al., 2004). Thus, the amino acid composition of some of the mushroom species, such as Boletinus cavipes (seven essential amino acids), compares favourably with the amino acid composition of Alfalfa (Mendicago sativa), which is the most nutritious plant known so far, as it contains all the eight essential amino acids (Mdachi et al., 2004). Essential amino acids that are not synthesized by humans can be supplied with mushrooms (Wang et al., 2014). Lysine and threonine are the major essential amino acids found in common mushrooms and both amino acids are very important and involved in many essential biological reactions. Considerable amount of non-essential amino acids are present in mushroom proteins such as: arginine, alanine, glutamic acid, glycine, serine and aspartic acid (Heleno et al., 2009). Hence, the ratio of essential amino acids (EAA) to total amino acids (TAA) gives an idea about the nutritional quality of proteins in foods (Wang et al., 2014). The amino acid composition of different mushrooms is described in Table 2.2.

14

Table 2.1. Mineral profile of different mushrooms Minerals (mg/g) References Mushrooms Ca Mg P K Na Fe Zn Mn Cu Pb Cd Vieira et al., 2013 P. ostreatus 0.29 0.95 3.64 12.16 Nd 1.49 0.57 0.05 0.13 Nd Nd L. trigrinus 24.8 1.4 Nd 9.8 3.73 3.62 0.49 0.06 0.12 Nd Nd A. polytricha 60.7 13.6 Nd 58.8 85.84 1.63 0.1 0.13 0.03 Nd Nd Manjunathan et al., 2011 V. volvacea 41.2 5.3 153.7 132.1 23.0 43.2 Nd Nd Nd Nd Nd L. edodes 17.4 4.07 76.9 130.2 32.7 1.48 0.94 0.1 0.14 Nd Nd L. cladopus 12.9 2.1 10.05 5.93 2.22 3.53 0.15 0.05 0.09 Nd Nd Okoro and Achuba, 2012 P. florida 0.82 3.59 64.02 247.2 3.05 0.62 0.50 0.06 0.1 Nd Nd P. djamor 3.42 3.16 74.2 363.4 6.16 1.48 0.92 0.11 0.14 Nd Nd Mallikarjuna et al., 2013 G. lucidum 9.44 4.48 Nd 8.46 Nd 0.11 0.27 0.17 Nd Nd Nd C. indica 0.05 5.1 6.18 Nd Nd 0.18 0.07 0.05 0.09 Nd Nd Zahid et al., 2009 P. sajor-caju 0.16 3.0 6.2 Nd Nd 0.094 0.06 0.01 0.03 Nd Nd L. polychrous 9.06 17.7 3.1 10.4 3.77 0.31 Nd Nd Nd Nd Nd Ravikrishnan et al., 2015

15

Table 2.2. The comparative amino acid composition of different mushrooms Amino acids (mg/g) References Mushrooms Ala Arg Asp Glu Gly His Iso Luc Lys Met Phy Ser Thr Tyr Tryp Val Pro G. lucidum 1.28 0.05 0.06 0.11 0.03 Nd 1.08 1.32 3.96 1.04 1.85 0.04 0.03 0.48 1.69 0.76 Nd Mau et al., 2001 G. tsuage 0.15 0.03 0.22 0.06 0.04 0.03 0.54 2.40 3.66 1.14 1.59 0.06 0.03 0.32 1.75 0.68 Nd Yang et al., 2001 P. ostreatus 2.13 0.08 0.13 0.71 0.12 0.12 0.19 Nd 0.19 0.16 0.09 0.03 6.99 0.01 Nd 1.21 Nd P. cystidiosus 3.94 Nd 0.05 1.16 0.14 Nd 0.23 Nd 0.32 Nd 0.28 0.51 0.42 0.14 0.05 0.09 Nd L. edodes 1.92 0.93 0.40 1.53 0.51 0.29 0.21 Nd 0.37 0.92 0.16 0.88 2.11 Nd Nd 0.27 Nd Tsai et al., 2008 F. velutipes(Y) 7.06 1.71 0.24 6.82 1.94 Nd 0.93 2.73 1.03 2.73 0.19 0.87 3.73 0.32 Nd 1.17 Nd F. velutipes(w) 5.54 1.42 0.03 1.54 Nd Nd 0.42 1.41 0.76 2.14 Nd 0.68 4.28 0.10 Nd 0.89 Nd A. blazei 1.09 0.65 1.11 3.29 0.44 1.63 0.49 0.76 1.19 0.32 0.42 0.82 0.27 Nd 1.61 0.46 Nd Lee et al., 2009 B. edulis 0.63 0.54 0.65 .59 0.18 0.44 0.48 0.58 2.17 0.41 1.04 0.35 0.19 Nd 0.61 Nd Nd A. blazi 0.31 0.57 0.94 2.18 0.25 0.44 0.54 0.69 1.05 Nd 1.01 0.56 Nd Nd 0.79 Nd Nd Beluhan and Renogajec, 2011 H. marmoreus 11.03 8.26 1.91 14.23 3.47 2.94 4.08 6.73 3.98 0.86 4.50 7.61 1.73 5.6 2.83 4.25 Nd P. ferulae 1.30 1.30 0.36 1.40 Nd 0.39 0.72 0.32 0.75 1.04 8.68 8.6 8.06 Nd 3.29 11.8 5.66 M. elata 2.38 0.18 Nd 38.29 0.31 3.61 Nd 0.85 2.97 0.68 0.12 0.09 4.21 0.05 Nd 1.81 Nd Liu et al., 2012 M. procera 2.21 0.29 0.12 3.3 0.09 3.29 0.19 0.38 4.11 0.69 Nd Nd Nd Nd Nd Nd Nd C. gigantean 0.43 1.65 0.23 0.13 0.67 0.24 2.8 1.12 0.25 0.11 1.45 0.65 0.66 3.0 1.5 1.7 Nd Kivrak et al., 2014 L. polychrous 1.12 0.33 1.0 1.31 0.55 0.18 0.36 0.76 0.17 0.22 0.32 1.05 0.43 0.55 0.52 Nd 0.76 Ravikrishnan et al., 2015

16

Chapter # 2 Review of Literature

2.5. Nutraceutical contents of mushrooms One of the most apparent influences of recent times is that people have brought their understanding back to the basics and to the natural or organic sources. Though the improvements brought by technology has made life relaxed to the people but many are still looking for improved herbal substitutes that are proven to be more effective in their utmost natural form (Sanodiya et al., 2009). This matter had set the ideology of functional and nutraceuticals as the food that exerts beneficial effects beyond nutrition thereby reducing various ailments (Sohaimy, 2012). Phytoremedies have been in practice since centuries and also becoming popular in the recent era due to their natural origin and safe status. Considering the importance, scientists and researchers are gradually focusing their attention to explore the phytochemicals for health managements and enhancement. Numerous molecules synthesized by macrofungi are known to be bioactive including polysaccharides, glycoproteins, terpenoids, lectins, phenol, amino acids, steroids, lignin, vitamins, myocins, nucleosides and nucleotides (Santos-Neves et al., 2008; Beluhan and RenogaJec, 2011; Murphy et al., 2012; Liu, 2013). 2.5.1. Tocopherols Tocopherols are methyl substituted hydroxychroman with a polar chromanol ring and polar phytyl side chain that occur in vegetables and plants (Kamal-Eldin and Appelqvist, 1996; Saha et al., 2013). They are powerful antioxidants (Barros et al., 2010) known under the generic name vitamin E, have different isomeric forms (α, β, γ and δ), which can be distinguished by the location and number of methyl groups on their rings. Due to its role as a scavenger of free radicals, tocopherols may protect our bodies against oxidative stress induce diseases, degenerative malfunctions, mainly cancer and cardiovascular diseases (Heleno et al., 2010). Tocopherols react with peroxyl radicals produced from polyunsaturated fatty acids in membrane phospholipids or lipoproteins to yield a stable lipid hydro-peroxide. They act as antioxidants by donating a hydrogen atom to peroxyl radicals of unsaturated lipid molecules, forming a hydro-peroxide and a tocopheroxyl radical, that reacts with other peroxyl or tocopheroxyl radicals forming more stable adducts (Lampi et al., 1999).

LH + Oxidantinitiator L

L + O2 LOO LOO+ Tocopherols LOOH + Tocopherols

17

Chapter # 2 Review of Literature

Barros et al. (2008) reported that the total tocopherols in selected wild and commercial mushrooms from Portugal and they found α- tocopherols in wild species, and γ-tocopherols in commercial species (Barros et al. 2008). 2.5.2. Alkaloids Alkaloids are a group of naturally occurring chemical compounds that contain mostly basic N atoms. This group also includes some related compounds with neutral and even weak acidic properties. The valuable pharmacological properties of many mushrooms have been attributed to the presence of alkaloids on the autonomic nervous system, blood vessels, respiratory system, gastrointestinal tract and uterus. They are effective against malignant diseases, infections and malaria (Treas and Evan 1989). Alkaloids in some Nigerian mushrooms were observed in the range of 8.12-135-57 µg/g (Unekwu et al., 2014). 2.5.3. Saponins and tannins Saponin comprises a large family of structurally related compounds such as steroids or triterpenoid aglycone. Saponins are well reported to have pharmacological properties like anti-inflammatory, anti-diabetic and anti-hemolytic (Udu-Ibiam et al., 2014). Saponins inhibit Na+ efflux in the cell by blocking the influx of concentration and activate Na+, Ca2+ antiporter in cardiac muscles. This increase in the Ca2+ influx strengthens the contraction of heart muscles (Egwim et al., 2011). Tannins possess antibacterial activity via cell membrane lysis, proteolysis enzymes and protein inhibition (Dulger et al., 2002). Physiological effects of tannins have also been reported such as anti-parasitic, anti-irritant and anti-secretolytic, and are also used to treat diarrhea and inflammation of mouth (Westerndarp, 2006). Tannin and saponin contents of Nigerian mushrooms were found in the range of 59.27-170.56 and 10.17-150.41 mg/g respectively (Unekwu et al., 2014). 2.5.4. Carotenoids Carotenoids is a class of more than 600 naturally occurring pigments synthesized by fungi, plants, algae, yeast and photosynthetic bacteria. Fruits and vegetables provide most of the carotenoids in the human diet. They are prominent for their distribution, structural diversity and various functions. Carotenoids can broadly be classified into two classes, carotenes (α- carotene, β-carotene or lycopene) and xanthophylls (β-cryptoxanthin, lutein or zeaxanthin). These compounds show antioxidant and immunomodulating activities and can be used in the

18

Chapter # 2 Review of Literature management of degenerative diseases such as cardiovascular diseases, diabetes and several types of cancers especially prostate and digestive-tract tumors. β-carotene is a red-orange pigment abundant in plants and fruits, an organic compound chemically classified as a hydrocarbon and specifically as a terpenoid (isoprenoid) reflecting its derivation from isoprene units. Twenty four mushrooms were screened for their β-carotene contents, the maximum contents were found in methanolic extract of Tricholoma equestre 18.649±0.024 µg/g (Robaszkiewicz et al., 2010). β-carotene and lycopenes in wild edible Portuguese mushroom species L. giganteus, S. imbricatusand A. arvensis were 1.88±0.09, 2.53±0.1 and 2.97±0.12 µg/g and 0.69±0.03, 1.3±0.07 and 1.0±0.04 µg/g respectively (Barros et al., 2007).

2.5.5. Lycopene Lycopene is a bright red carotene and carotenoid pigment found in tomatoes and other red fruits and vegetables. The foods that are not red may contain lycopene as well. Robaszkiewicz et al. (2010) analyzed 24 mushrooms for their lycopene contents, the maximum contents were found in methanolic extract of S. bovinus 15.38±0.99 µg/g. 2.5.6. Terpenoids Triterpenoids are commonly found in mushrooms and widely used as flavor and odor enhancers (Novaes et al., 2003). Terpenoids have complex molecular structures and are able to adopt different cyclic or polycyclic conformations, thus comprising numerous stereoisomeric and enantiomeric forms. Terpenes are classified according to the number of isoprene units, as follows: C5; hemiterpenoids, C10; monoterpenoids, C15; sesquiterpenoids,

C20; diterpenoids, C30; triterpenoids, and C40; carotenoids. Triterpenes and other derivatives including steroids have a wide variety of functions such as: protection against herbivores, antimitotic activity, and induction of seed germination and inhibition of root growth. Monoterpenes, diterpenes, and sesquiterpenes have many different roles (Tholl, D. 2006). Cholesterol, vitamins A, D and E, and sex hormones (estradiol and testosterone) are especially important triterpenes. Steroids with C27 and C29 belong to the terpene group but are not true terpenes, since they are synthesized from the same precursor squalene which has 30 carbon atoms in its structure (Roy, A. and S. Saraf. 2006; Novaes et al., 2007;). Considering their antitumor activity triterpenes are the most important group among the terpenoids (Novaes et al., 2007).

19

Chapter # 2 Review of Literature

2.6. Antimicrobial potential of mushrooms Antimicrobial drugs derived from microorganisms have long been used for prophylactic and therapeutic purposes. However, misuse of antimicrobial agents for a long period may cause resistance in microorganisms (Ren et al., 2014). Natural products have played an important role since 1940s, and continually served as an important source and inspiration to produce new drugs (Shrma et al., 2015). The rich diversity of different fungal species offers a potential source of new antibiotics. Various antimicrobial agents including penicillin and griseofulvin have been isolated from micro-fungi (Yamac and Bilgili, 2006). Mushrooms that possess macroscopic reproductive structures among a diverse range of basidiomycete fungi have been utilized for curative and medicinal purposes since ancient times (Ren et al., 2014). Several mushrooms by-products have been used against human pathogens for the activation of immunologic system and to improve human health against different ailments (Kitzberger et al., 2007). Hearst et al. (2009) tested the aqueous extracts of L. edodes against a panel of bacterial and fungal pathogens to check microbial inhibition. The extracts were found to have extensive antimicrobial activity against 85% of the organisms including 50% of the yeast and mold species in trial and compared favorably with the results from both the positive control ciprofloxacin and oyster mushroom. Acetone extract of Ganoderma lucidum was evaluated against six bacterial strains which was most inhibitory against K. pneumonia with zone of inhibition 31.60±0.10 mm, the extract was equally inhibitory against E. coli (27.40±0.19 mm), B. subtilis (21.00±0.00 mm) and S. typhi (20.60±0.14 mm) but it was greatly reduced in case of S. aureus (18.00±0.20 mm) and P. aeruginosa (10.20±0.14 mm) at the same concentration. The lowest MIC values by acetone extract against K. pneumoniae were 4.33±0.33, followed by E. coli 8.17±0.48 and B. subtilis 14.00±0.46 mg/mL; moderate values in case of S. aureus 19.00±0.00 and the highest MIC values were exhibited against P. aeruginosa 21.30±0.34 and S. typhi 20.80±0.87 mg/mL (Quereshi et al., 2010). Aqueous extracts of eight edible mushroom species were tested for their ability to inhibit the growth of five common bacterial strains. Aqueous extract from C. sinensis inhibited the growth of Bacillus subtilis and Streptococcus epidermidis with minimum inhibitory concentration (MIC) values of 938 and 469 μg/mL respectively. P. australis extract had the MIC value 469 µg/mL against S. epidermidis (Run et al., 2014). A. essettei, A. bitorquis and A. bisporus were investigated against six species of Gram-positive bacteria, seven species of Gram-

20

Chapter # 2 Review of Literature negative bacteria and two species of yeast, inhibition zones were obtained in the range of 7- 22 mm. All the extracts were found to be effective against Gram-positive bacteria especially against M. luteus, M. flavus, B. subtilis and B. cereus (Oztürk et al., 2011). This might be due to Gram-positive bacteria are more susceptible to any antimicrobial agent such as antibiotics and mushrooms, while the cell wall of Gram-negative is less susceptible to antimicrobial action due to the presence of inter-peptide bridge. 2.7. Antioxidant potential of mushrooms Reactive oxygen species are continuously generated in aerobic cells and aerobic organisms. Any deficiency in endogenous antioxidant defense system may result in oxidative stress which might be associated with various health problems and ailments (Smolskaite et al., 2015). Many synthetic antioxidants, such as butylated hydroxyanisole and butylated hydroxytoluene, have side effects and are thought to be responsible for liver damage and carcinogenesis. Currently, there is a great interest in using dietary supplements containing natural antioxidants such as vitamins A, C and E, carotenoids, flavonoids and other simple phenolic compounds that can prevent human body from oxidative damage (Jayakumar et al., 2011). Antioxidant activity has been reported to be in correlation with the amount of phenolic compounds; hence antioxidant activity can be predicted by determining the total phenolics in the sample (Becker et al., 2004; Palacios et al., 2011). Total phenolic contents are usually an important source which is used to explain or predict the antioxidant activity. Folin Ciocalteu assay works on the basis of electron transfer in alkaline medium from phenolic compounds to the phosphotungstic acid/ phosphomolybdic acid to form blue colored complexes that are consequently determined at 760 nm (Singleton et al., 1965). Radical scavenging activity is very important parameter in determining the antioxidant capacity of a sample. It primarily functions through direct measurement of transfer of electron to the free radical or by the transfer of hydrogen atom. Free radical scavenging activity assays are widely used for the measurement of in vitro antioxidant activity of plant materials (Porto et al., 2000). The extent of reaction in DPPH radical assay mainly depends on the hydrogen donating ability of the antioxidants which is predominantly governed by their structure and degree of hydroxylation (Woldegiorgis et al., 2014).

21

Chapter # 2 Review of Literature

Estimation of reducing power of antioxidants is very informative in context to provide their ranking as reducing agents and prediction of the possibility of the transfer of electrons to reactive oxygen. Assessment of the radical reactions and antioxidant interactions depend on the difference of reduction powers. The reducing power assay is based on the ability of phenolics to reduce Fe+3 to Fe+2 by donating electron to Fe+3 (Pulido et al., 2000). Mushrooms have significant antioxidant potential due to various compounds it contains and are also used as important source of home remedy in Asia to protect human body from various diseases elicited by oxidative stress (Chen et al., 2012). Positive correlation is found between total phenolic contents in the mushroom extracts and their antioxidant activities (Becker et al., 2004). Cheung et al. (2003) observed that most soluble components in mushroom fruiting bodies have high polarity and the antioxidant activities of mushrooms are seemed to be relatively based on the polarity of the solvent used in extraction. Extracts using polar solvents such as methanol and water have higher total phenolic contents (TPC) than those extracted with hexane (Kang et al., 2003). In a study by Tsai et al. (2009) the major antioxidant components in the selected mushrooms were phenols and the total contents were in the range of 5.10-11.1 mg GAE/g, whereas the total phenolic contents of the wild edible mushrooms collected from Poland were ranged between 1.64-13.53 mg GAE/g (Nowacka et al., 2014). Total phenolic contents of two cultivated (P. ostreatus and L. edodes) and five wild (Laetiporus sulphureus, Agaricus campestris, Termitomyces clypeatus, Termitomyces microcarpus and Termitomyces letestui were in the range of 3.39-14.6 mg GAE/g, this difference in phenolic contents may be related to extraction method and the solvent used (Woldegiorgis et al., 2014). Ethanolic extract of A. bisporus was administered to the mice for 30 days, and the activities of antioxidant enzymes in serum, liver and heart was significantly increased (Liu et al., 2013). When the ethanolic extract of P. ostreatus was administered to the aged rats, elevated levels of reduced glutathione, vitamins C and vitamin E were observed. The values of CAT, SOD, and Gpx in old rats were not found to be much different when observed in young rats. In addition, the level of malondialdehyde (MDA), a lipid peroxidation product was lowered on administration of mushroom extract to aged rats (Jayakumar et al., 2007). Aqueous extracts of L. edodes and P. sajor-caju exert inhibitory activity against the proliferation of the human tumor cell lines laryngeal carcinoma (Hep-2) and cervical adenocarcinoma (HeLa).

22

Chapter # 2 Review of Literature

Substantial morphological modifications in cells were confirmed by Giemsa staining after treatment with mushrooms extracts. This result suggests inhibition of proliferation and induction of apoptosis with increasing concentrations, indicating that the aqueous extracts are potential sources of antioxidants (Finimundy et al., 2013). 2.8. Anticancer potential of mushrooms According to the American Cancer Society more than 1.6 million people were reported to contract cancer in 2014 among which death cases were about 0.6 million in the United states (Siegel et al., 2014). The global increase of cancer incidence were estimated by GLOBOCAN, an international agency for cancer research reported 12.7 and 8.2 million deaths in 2008 and 2012 respectively, and 14.1 million new cases in 2012, 64% of which belonged to developed countries due to cancer causing behavioral life style especially smoking (Ferlay et al., 2010; Ferlay et al., 2015). Currently available anticancer drugs are not target specific and pose several side effects and some complications in clinical management which encourage the urgent need for novel, effective and non toxic therapeutic approaches. Recently, a number of bioactive compounds from natural resources had been investigated and identified as inhibitors to various cancer cells (Patel and Goyal, 2012). The search for new anticancer agents resulted in the isolation and purification of number of bioactive compounds from various mushroom species that were shown to have antitumor activity (Brochers et al., 2008). A large number of compounds like lectins, polysaccharides, polysaccharide peptides, polysaccharide protein complexes have been isolated from mushrooms and many of these compounds have immunomodulatory and anticancer effects. The elevated antioxidant enzyme activities trim down the levels of different biomarker parameters related to cervical cancer (Zhu et al., 2007). Sarangi et al. (2006) purified water- soluble proteoglycan fractions from P. ostreatus mycelia and tested for in vitro and in vivo immunomodulatory and anticancer effects on Sarcoma-180-bearing mouse model, as a result mice decreased the number of tumor cells. These proteoglycans elevated natural killer (NK) cell cytotoxicity and stimulated macrophages to produce nitric oxide. Both in vitro and in vivo experiments on animals and humans have also shown that polysaccharides from G. lucidum and other different components are potential anticancer agents (Yuen and Gohel, 2008). The dried powder of G. lucidum suggested as a cancer chemotherapy agent in traditional Chinese medicines is currently being used worldwide as dietary supplement

23

Chapter # 2 Review of Literature

(Stanley et al., 2005). Polysaccharides extracted from G. lucidum exert anticancer effects through the modulation of immune system and retarded growing sarcoma cells in mice, inhibits cell proliferation, suppresses cell motility, suppresses angiogenesis and induces apoptosis of highly invasive human prostate and breast cancerous cells. Lentinan, schizophyllan and krestin have been accepted as immunoceuticals in several oriental countries (Stanley et al., 2005; Hua et al., 2007).

Fig 2.2. Mechanism of antitumor and immunomodulating activity of lentinan as a β-D- glucan. Mac, macrophages; TL(H), Tlymphocyte (helper); NK, natural killer cells; IL-1, -2 and -13, interleukin-1, -2, -13; CSF, colony-stimulating factor; MAF, macrophageactivating factor; PC-TL, precytolytic T lymphocyte; CTL, cytolytic (cytotoxic) T lymphocyte; BL, B lymphocyte (Modified from: Bisen et al., 2010) Augmentations of NK, cytotoxic T lymphocytes and delayed-type hypersensitivity responses against tumor antigen were observed after administration of Lentinan (Li et al., 2008). 2.9. Lipid lowering effects of mushrooms Epidemiological studies suggested that the risk factors for cardiovascular diseases including hypercholesterolemia are largely influenced by diet. Edible mushrooms and their constitutive active compounds have been reported to have beneficial effects on hypercholesterolemia due to their low fat and high soluble fiber contents. Hypercholestrolemia and lipid accumulation effectively retarded by the supplementation of the diet by mushrooms. Additionally, the HMG-CoA-reductase inhibitor mevinolin (lovastatin) was detected in P. ostreatus which could lead to a lipid lowering effect. The mechanisms of hypocholesterolemic effect of mushrooms include delayed absorption of cholesterol followed by reduced production of

24

Chapter # 2 Review of Literature cholesterol-rich very-low-density lipoproteins (VLDL). This effect could be mediated by mushroom fibrous matter that is able to sequester bile acids thus inducing acceleration of cholesterol catabolism (Jeong et al., 2010; Schneider et al., 2011). Several studies have demonstrated serum cholesterol–lowering effects of many types of mushrooms such as G. frondosa, L. edodes, F. velutipes, P. ostreatus, P. confluens, G. lucidum, A. auricula, T. fuciformis and V. volvacea (Mori et al., 2008).

Fig 2.3. A general mechanism of mushrooms effect on cholesterol and lipid metabolism in human (Gulillamon, 2010) 2.10. Phenolic acids profile of different mushrooms Natural phenolics are aromatic hydroxylated compounds possessing one or more aromatic ring with one or more hydroxyl groups. Phenolic acids can be sub divided into two major groups, hydroxybenzoic and hydroxycinnamic acid. Hydroxybenzoic acids include p. hydroxybenzoic, protocatechuic, gallic, vanilic and syringic acids and hydroxycinnamic acid include p. cumaric, ferulic and caffeic acids. Antioxidant properties of phenolic compounds commonly found in fruits, vegetables and other plant derived foods play a role in the stability of food products and also in the antioxidative defense mechanism of biological system. Phenolics are most potent and useful substances providing health benefits and associated with reduced risk of chronic and degenerative diseases which may relate to their ability to reduce agents by donating hydrogen and quenching singlet oxygen (Barros et al., 2009). The edible mushrooms could be directly used in the human diet to combat oxidative stress while inedible species could represent a source of extractable phenolic compounds to be used as additives in the food industry or as components in pharmaceutical and cosmetic formulations

25

Chapter # 2 Review of Literature due to their well-known antioxidant properties (Vaz et al., 2011). The comparative phenolic acid composition of different mushrooms is assembled in Table 2.3. 2.11. Sugar contents of mushrooms Sweet taste of certain species of mushrooms is thought to be perceived due to presence of soluble sugars in fruiting bodies. The most frequently present sugars in mushrooms are glucose, myo-inositol, arabitol, trehalose, mannose, galactose, arabitol, ribose, mannitol, and fucose (Lee et al., 2009). Li et al. (2014) analyzed five commercial mushrooms species from China, trehalose and mannitol were considered as the major sugar, whereas low levels of glucose and fructose were also recorded, mannose and ribose were also found in some extracts but arabitol was not found. 2.12. Fatty acids composition of mushrooms Lipids are essential nutrients that play an important role in all organisms especially to human. Biologically active lipids act like hormones or their precursors regulate body functions, help in digestion process, work as structural and functional components of biomembranes, even as constituents of biomembrane of myelin sheath and as thermal insulators (Ribeiro et al., 2009; Jing et al., 2012). Therefore, lipids are mandatory components of human body composition and necessary in our daily food intake. However, when a high dietary lipid is consumed, there might be an increased risk of some chronic diseases such as diabetes, hypertension, atherosclerosis, and cardiovascular dysfunctions (Jing et al., 2012). Polyunsaturated fatty acids (PUFA), which are valuable healthy compounds for humans, predominate over saturated fatty acids in different mushroom species. In general, oleic, linoleic, palmitic and stearic acids are present in high concentration in mushrooms (Leal et al., 2013). Barros et al. (2007) reported that the major fatty acids of Agaricus arvensis, Lactarius delisiosis, Leucopaxillus giganteus, Sarcodon imbricatus and Tricoloma portentosum were linoleic acid and oleic acid and contribute significant share (27.4%) of its total fatty acids. In another report by Lee et al. (2011) linoleic acid, a member of PUFA was the major component in A. charsxingu (69.3% of total fatty acids), the second highest component of fatty acids was palmitic acid (13.7%).

26

Table 2.3. The comparative phenolic acids profile of different mushrooms Phenolic acids (µg/g) References Mushrooms p-coumaric Cinnamic Gallic Caffeic Ferulic Protocatechuic P. hydroxybenzoic A. bisporus 2.31 0.38 62.76 - - Nd Nd P. ostreatus 0.81 0.23 13.0 7.80 - 0.77 1.56 Reis et al., 2012 L. edodes 0.02 Nd 61.62 0.79 0.89 0.36 1.57 F. hepatica Nd 0.2 - - - 0.66 0.41 H. agathosmus 0.86 0.46 - - - 0.17 Nd Vaz et al., 2011 S. collinitus - 0.13 - - - 0.51 1.4 T. letestuiti 10.1 Nd 58.9 0.73 7.04 Nd 18.2 T. miccrocarpus 15.8 Nd 71.4 Nd 12.7 Nd 9.38 Woldegiorgis et al., 2014 L. sulphureus Nd - 67.4 2.53 Nd - 0.46

Table 2.4. The fatty acids composition of different mushrooms Fatty acids (%) References Mushrooms Palmitic acid Oleic acid Linoleic acid Linolenic acid Arachidonic acid P. ostreatus (%) 17.21 0.07 0.09 0.27 0.04 Ergonul et al., 2013 F. velutipes 14.56 0.06 0.05 0.01 0.19 A. arvenus 16.7 2.4 59.08 0.0 6.2 Marekov et al., 2012 P. dryinus 17.9 15.4 56.07 0.0 0.1 B. edulis 9.48 36.1 42.2 0.17 0.34 Pedneault et al., 2006 S. granulates 12.0 25.2 54.4 0.08 0.15 C. Comatus mg/10 g 14.88 9.41 49.34 0.77 0.24 Jing et al., 2012 P. eryngii 6.49 5.17 27.17 0.2 0.12

27

Chapter # 2 Review of Literature

2.13. Polysaccharides composition Polysaccharides extensively exist in nature including plants, animals, mushrooms and algae, polysaccharides not only play support and storage functions in the body but also participate in the process of life activities (Kogan, 2000; Freimund et al., 2003). A special group of β- 1,3-linked polyglucoses usually named ‗glucan‘ or ‗β-glucan‘ is widespread in many bacteria, fungi, mushrooms, algae and higher plants and has attracted attention because of bioactive and medicinal properties (Volman et al., 2008). Recently, polysaccharides from edible mushrooms have attracted much attention due to various health attributes (Liu et al., 2014). Leukocytes isolated from animals treated with β-glucans suggest that β-glucans enhance the immune response in leukocytes and epithelial cells. Since they influence the immune response of the host, β-glucans are recognized as biological response modifier (BRM) and used for the treatment of cancer and various infectious diseases (Bohn and BeMiller 1995; Wasser, 2002; Nandi et al., 2014). Kozarski et al. (2012) investigated the polysaccharide extracts of G. applanatum, G. lucidum, L. edodes and T. versicolor. G. applanatum samples contained both α- and β-glucans, total glucan contents varied considerably from 35% for G. applanatum to 83% for G. lucidum. Chihara et al. (1992) isolated and purified (1-3) β-Glucan named ―Lentinan‖ with antitumor activity from L. edodes, and reported their antitumor activities and immunomodulating activities associated with T-cell mediating responses (Fig 2.1). So far lots of work has been been done on different species of mushrooms but no brief data is available on the nutritional and nutraceutical composition of mushrooms cultivated in Pakistan and on wild grown species. This work contributes to the chemical composition of mushrooms available in Pakistan.

28

CHAPTER # 3 MATERIALS AND METHODS

The research work presented in this dissertation was performed in Medicinal Biochemistry Lab, Department of Biochemistry, University of Agriculture, Faisalabad, Pakistan with collaboration of Medicinal Mushrooms Lab, Institute of Horticultural Sciences, University of Agriculture, Faisalabad Pakistan and Departments of Nutrition Science and Food Science, PURDUE University, USA. 3.1. Standards, chemicals and reagents Table 3.1. Standards, chemicals and reagents

Sr. No. Name of Chemicals Chemical Supplier Formula

1 Linoleic acid C18H32O2 Merck Darmstadt, Germany 2 Gallic acid C7H6O5 Merck Darmstadt, Germany 3 Catechin C15H14O6 Merck Darmstadt, Germany 4 Folin ciocalteu reagent Merck Darmstadt, Germany 5 DPPH (2, 2-Diphenyl-1- C18H12N5O6 Merck Darmstadt, Germany picrylhydrazyl) 6 Quercetin C15H10O7 Sigma Aldrich Chemical Co. (St. Louis, MO, USA) 7 Absolute methanol CH3OH Merck Darmstadt, Germany 8 Sodium phosphate buffer Merck Darmstadt, Germany 9 Penicillin/streptomycin Merck Darmstadt, Germany solution 10 Streptokinase C11H19NO2 Merck Darmstadt, Germany 11 Ammonium thiocyanate NH4SCN Merck Darmstadt, Germany 12 Ferrous chloride FeCl2 Merck Darmstadt, Germany 13 Butylated hydroxytoluene C15H24O Merck Darmstadt, Germany 14 n-butanol C4H10O Merck Darmstadt, Germany 15 Potassium ferricyanide C6N6FeK3 Merck Darmstadt, Germany 16 Trichloroacetic acid C2HCl3O2 Merck Darmstadt, Germany 17 Trifloroacetic acid C2HF3O2 Merck Darmstadt, Germany 18 Sodium borodeuteride NaBD4 Merck Darmstadt, Germany 19 Methyl iodide CH3I Merck Darmstadt, Germany 20 Methylene chloride CH2Cl2 Merck Darmstadt, Germany 21 Ferric chloride FeCl3 Merck Darmstadt, Germany 22 Absolute ethanol C2H6O Merck Darmstadt, Germany 23 Nitric acid HNO3 Merck Darmstadt, Germany 24 Sodium hydroxide NaOH Merck Darmstadt, Germany 25 Sodium nitrite NaNO2 Merck Darmstadt, Germany 26 Sodium carbonate Na2CO3 Merck Darmstadt, Germany 29

Chapter # 3 Materials and Methods

27 D-glucose C6H12O6 Merck Darmstadt, Germany 28 Bromocresol purple C21H16Br2O5S Merck Darmstadt, Germany 29 D-biotin C10H16N2O3S Merck Darmstadt, Germany 30 L-histidine C6H9N3O2 Merck Darmstadt, Germany 31 Sodium azide NaN3 Merck Darmstadt, Germany 32 Potassium dichromate K2Cr2O7 Merck Darmstadt, Germany 33 Potassium acetate CH3CO2K Merck Darmstadt, Germany 34 n-hexane C6H14 Merck Darmstadt, Germany 35 Dimethyl sulfoxide C2H6OS Merck Darmstadt, Germany 36 Ethyl acetate C4H8O2 Merck Darmstadt, Germany 37 Hydogen peroxide H2O2 Merck Darmstadt, Germany 38 Sodium chloride NaCl Merck Darmstadt, Germany 39 Hydrochloric acid HCl Merck Darmstadt, Germany 40 Chloroform CHCl3 Merck Darmstadt, Germany 41 Potassium carbonate K2CO3 Merck Darmstadt, Germany 42 Potassium chloride KCl Merck Darmstadt, Germany 43 RPMI-1640 media Oxoid (Hampshire, UK) 44 MTT Reagent (3-(4,5- C18H16BrN5S Oxoid (Hampshire, UK) Dimethylthiazol-2-yl)-2,5- Diphenyltetrazolium Bromide) 45 Potato dextrose agar Oxoid (Hampshire, UK) 46 Muller Hinton broth Oxoid (Hampshire, UK) 47 Myoinositol C6H12O6 Oxoid (Hampshire, UK) 48 Sterile resazurin tablets C12H7NO4 BDH Laboratory

3.2. Analytical instruments used in the research  Chopper and grinder NR-56X  Rotary Vacuume Evaporator (EYELA, N-N Series, Rikakikai Co. Ltd. Japan)  Vortex Velp, Europe  Centrifuge H-200nR (kokusan)  Autoclave Omron, Japan  Incubator Sanyo, Germany  Water Bath Pamico, Pakistan  Electric Balance Ohyo, Japan  Magnetic Stirrer GallenKamp, England  Orbital Shaker Gallenkamp, UK  Muffle Furnace EYELA (Electric furnace TMF 2100)

30

Chapter # 3 Materials and Methods

 Commercial Blander (TSK-949, WestPoint France)  Hot Air Oven IM-30, Irmec, Germany  Spectrophotometer PG-T60 Hitachi Japan  96 wells plate reader 755nm (Biotek-MQX-200, BioTek Ind, Highland Park, USA)  Small Volume Batch Centrifuge (IEC Centra 4 Tabletop, Fisher Scientific)  Large Batch Centrifuge (Beckman J20XP, Beckman, Scientific)  Magnetic Stirring Hot Plates (PC101, Corning)  High performance Liquid Chromatography (HPLC) Hewlett-Packard model 1090A  Gas Chromatography Mass Spectrometry (GCMS) Hewlette-Packard (Wil-mington, DE) model 6890  Inductivity Coupled Plasma (ICP-OES) (Perklin Elmer, optima 4300Dv) 3.3. Sample collection and preparation The wild locally grown Ganoderma lucidum (Fr.) P. Karst., was isolated from the stem of Salmalia malabarica plant collected from Jinah garden, Faisalabad. Nasim et al. (2010) also isolated and chractrized G. lucidum from Lahore region of Pakistan. Commercial locally cultivated Pleurotus ostreatus (Jacq. Ex. Fr.) Kumm., Volvariella volvacea (Bull, ex. Fr.) Sing., were collected from Horticulture Department, University of Agriculture Faisalabad, and exotic commercially available mushrooms Lentinus edodes (Berk.) Sing., Hericium erinaceus (Bull.) Pers., (imported from China) were collected from local market. All the selected mushrooms were collected in dry form. Taxonomic identification was made by Prof. Dr. M. Asif Ali from medicinal mushroom lab, Institute of Horticultural Sciences, University of Agriculture Faisalabad, Pakistan. The specimen of each species was grounded in a domestic blender immediately and reduced to fine dried powder and stored at 4 oC before the extractions. Nasim et al., (2010)

31

Chapter # 3 Materials and Methods

(a) (b) Fig 3.1. Ganoderma lucidum grown on tree trunk collected from Jinah Garden, Faisalabad (a) in growing phase (b) in mature form 3.4. Selected mushrooms Table 3.2. Information about the studied mushrooms

Scientific name (Species) Vernacular name Family name

Lentinus edodes Shiitake Marasmiaceae Hericium erinaceus Monkey head Hericiaceae Pleurotus ostreatus Oyster Hericeaceae Volvariella volvacea Straw Pluteaceae

Ganoderma lucidum Lingzhi Ganodermataceae

3.5. Molecular identification of Ganoderma lucidum 3.5.1. Selection of fungi Morphologically identified fungus Ganoderma lucidumwas isolated from the stem of Salmalia malabarica plant collected from Jinah garden, Faisalabad, Pakistan. Before further studies on selected fungus it was gone through molecular identification.

32

Chapter # 3 Materials and Methods

3 .5.2. Preparation of fungal mycelia The fungus was maintained on potato dextrose agar (PDA) slant and incubated at 25 °C for 7 days and then stored at 4 °C for further studies. Initially, the fungus was grown on PDA medium in a petri plate at 25 °C for 7 days and then incubated in a 100 mL flask containing 25 mL liquid culture medium (Table 3.3). The flask was kept in a rotary shaker at 180 rpm for 4 days at 25 °C. The mycelia were collected after 3-day culture at 25 °C and washed with sterile distilled water and stored at −20 °C overnight for DNA extraction. Table 3.3. Composition of Potato Dextrose Agar (PDA) medium Serial No. Ingredients Quantity g/L 1 Glucose 40 2 Peptone 5 3 Yeast extract 2

4 KH2PO4 1

5 MgSO4 0.5

6 Distilled H2O To make volume up to 1L

3.5.3. DNA isolation Total genomic DNA from fungus was isolated following the method given by Graham et al. (1994) with some modifications. Frozen mycelia (about 100 mg) were ground into a fine powder in a pestle and mortar in the presence of liquid nitrogen and taken in a microcentrifuge tube. Then 0.5 mL extraction buffer (Table 3.4) was added and incubated at 37 °C for 1 hr. The tube was centrifuged at 10,000 rpm for 5 min and the upper aqueous layer was moved to a fresh sterile microcentrifuge tube. Then 1 mL CTAB (Cetyl-Trimethyl Ammonium Bromide) buffer (Table 3.5) was added in the mixture and in a water bath at 65 °C for 15 min. The upper aqueous phase was extracted twice with equal volume of a mixture of phenol, chloroform and isoamyl alcohol in 25:24:1 ratio. The microfuge tube was centrifuged at 12,000 rpm for 10 min and extracted with chloroform and isoamyl alcohol in a ratio of 24:1. The upper layer containing DNA was transferred to a new microfuge tube and DNA was precipitated with an equal volume of isoprop anol at −20 °C for 12 hrs. Then DNA pellet was washed with 70% (v/v) ice-cold ethanol and absolute ethanol, air dried the pellet and finally the pellet was dissolved in TE buffer (10 mMTris–HCl, 1 mM EDTA, pH 8.0). The quantity of DNA was checked by a UV spectrophotometer.

33

Chapter # 3 Materials and Methods

Table 3.4. Composition of Extraction Buffer Serial No. Ingredients Concentration

1 NaCl 100 mM

2 Tris-HCl 200 mM (pH 8.0)

3 EDTA 25 mM

4 SDS 0.5% (w/v)

Table 3.5. Composition of CTAB Buffer Serial No. Ingredients Concentration

1 CTAB 2% (w/v)

2 Tris-HCl 100 mM(pH 8.0)

3 NaCl 1.4 M

3.5.3.1. Confirmation of isolated DNA by agarose gel electrophoresis DNA isolation was confirmed by agarose gel electrophoresis. The agarose gel (0.8%) was prepared in 1X TAE (Tris Acetate EDTA) electrophoresis buffer (prepared from 50X; Table. 3.6). Ethidium bromide was added to give 50 µL (0.05 g/100 mL) of concentration. The DNA samples containing loading dye were loaded on the gel and ran it at 60 V for 45 min. DNA bands were observed on gel documentation system (Syngene, UK). Table 3.6. Composition of 50 X TAE buffer Serial No. Reagents Quantity 1 Tris base 24.2 g 2 Glacial acetic acid 5.71 mL

3 EDTA (0.5 M, pH 8) 10 mL

4 Distilled H2O To make volume up to 100 mL

3.5.3.2. DNA quantification DNA was quantified by taking absorbance at 260 nm.

Conc. (μg/mL) = A260 x 50 x Dilution Factor

34

Chapter # 3 Materials and Methods

(One absorbance unit = 50 μg/mL dsDNA)

Purity of the DNA was checked by measuring the ratio A260/A280. 3.5.4. Polymerase chain reaction (PCR) 3.5.4.1. Primers Universal primers were used for the amplification of ITS region (Cumagun et al., 2000) and purchased from Shanghai Bioasia Biotechnology, Inc., China. Sense primer used was: ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3′) and antisenseprimer: ITS4 (5′- TCCTCCGCTTATTGATATGC-3′) (White et al., 1990). The amplified DNA sequence using this primer pair includes the whole sequence of ITS1, 5.8S rDNA and ITS2, and the partial sequence of 18SrDNA and 28S rDNA. 3.5.4.2. Reaction mixture setup Internal transcribed spacer region (ITS) was amplified in 50 µL reaction mixture with reaction setup shown in Table 3.7. Table 3.7. Reaction mixture setup of PCR for amplification of ITS from G. lucidum Sr. No. Reagents Quantity for 50 µL Final concentration

1 10 x PCR Taq buffer 5 μL 1 x

2 2 mMdNTPs 5 μL 0.2 mM of each 3 Primer I (10 ρmoles/μL) 1 μL 0.2 µM (0.05–1 µM) 4 Primer II (10 ρmoles/μL) 1 μL 0.2 µM (0.05–1 µM) 5 TaqDNA polymerase (u/μL) 0.3-0.5 μL 1.25 U/50 µL (Promega) 6 25 mM MgCl2 Variable 1 – 4 mM 7 Template DNA Variable 1 μg

8 Sterile deionized H2O Variable To make volume 50 µL

3.5.4.3. Temperature cycling PCR cycling used in the reaction is given in Table 3.8. Amplification was carried out in EppendorfMastercycler Gradientthermocycler.

35

Chapter # 3 Materials and Methods

Table 3.8. PCR cycling conditions used to amplify ITS from G. lucidum Steps Temp (ºC) Time (min)

1 reaction of denaturation 94 5 30 cycles of repeated: Denaturation 94 1 Annealing 56 1 Extension 72 1 One reaction of extension 72 10

The PCR products were run on 1% agarose gel as discussed earlier (3.5.4.1.). 3.5.4.4. Recovery of amplified gene from agarose gel After confirmation of the results, PCR samples were run on agarose gel (1%) at 60 V for 45 min. The gel containing the required amplified fragment was excised into small slices and placed in a microcentrifuge tube. The DNA was isolated by using QIAquick gel extraction following manufacture‘s protocol. The eluent was stored at -20 °C. 3.5.5. DNA Sequencing and Alignment Search (BLAST) The resulted amplified samples were sequenced from DNA sequencing facility of Centre of Excellence in Molecular Biology (CEMB), Lahore, Pakistan. The sequences were refined by DNA star software and analyzed for molecular identification with the help of basic local alignment search tool (BLAST) (http://blast.ncbi.nlm.nih.gov/Blast.cgi). 3.6. Proximate analysis of selected mushrooms The dried mushrooms powder was analyzed for crude proteins, crude fats, crude fibers, total carbohydrates, and ash contents by the following methods. 3.6.1. Estimation of crude fat Crude fat of dried mushroom powder was determined by the method described by Barros et al. (2007). For the estimation of crude fat 3 g of dried mushroom powder was taken in a thimble and placed in extraction tube of Soxhlet apparatus. It was placed in a water bath and the temperature was so adjusted that continuous drops of water fell on the mushroom sample placed in extraction tube.

36

Chapter # 3 Materials and Methods

The process of extraction was carried out with petroleum ether (boiling point 40-60 °C) for 16 hours. Then the sample was removed from the extraction tube and the solvent was allowed to evaporate by placing the flask in water bath at 100 °C. The extract was placed in hot air oven at 105 °C for 30 minutes and it was completely dried. It was allowed to cool in a desiccators and weight of dried extract was recorded. Crude fat percentage was calculated with the help of following formula: Crude fat (%) = Wt. of fat in sample (g) × 100/ Wt. of sample 3.6.2. Estimation of crude protein Crude protein was determined by Macrokjeldahl apparatus according to Barros et al., (2007). Protein percentage of mushrooms was determined by the following formula: Crude protein (%) = 6.25 × Nitrogen (%) 3.6.3. Estimation of crude fiber Crude fiber of dried mushrooms was determined according to Pushpa and Purushothama, (2010). In a one liter beaker, 3 g of dried and fat free sample was taken (see under 3.6.1).

Then 200 mL of 1.25% H2SO4 was added to it and level of beaker was marked and allowed to boil for 30 minutes with constant stirring. These contents were filtered while warmed giving 2 to 3 washings with hot water until it became acid free. The residue was transferred in another 1000 mL beaker and 200 mL of 1.25% NaOH was added. This was again boiled for 30 minutes and volume was made up during boiling. These contents were filtered again giving 2 to 3 washings with hot water until it became alkali free. The residue was carefully transferred in a crucible and dried in hot air oven at 100 °C for 3 to 4 hours until constant weight was obtained. These contents were heated on an oxidizing flame until the smoke ceased to come out. Then this sample was put in a muffle furnace at 550 °C for 4 hours until grey color ash was obtained. This was allowed to cool in a desiccator and weighed. Percentage of crude fiber was calculated by the following formula: Crude fiber (%) = 100 (crucible wt. before ash–crucible wt. after ash)/wt. of sample 3.6.4. Determination of ash contents Ash contents of the dried mushroom sample were determined (AOAC, 1995; Ayuba et al., 2011). Dried mushroom sample 3 g was placed in a crucible and heated on an oxidizing

37

Chapter # 3 Materials and Methods flame until the smoke was stopped. The crucible was placed in a muffle furnace for 6 hrs at 550 °C until ash was obtained. This sample was allowed to cool in a desiccator and weighed. Ash contents were calculated with the help of following formula: Ash (%) = wt. of ash in sample (g) × 100/ wt. of sample (g) (AOAC, 1995) 3.6.5. Determination of total carbohydrates Total carbohydrates were calculated by difference as follows: Total carbohydrates = 100 – (Total protein + Total fat + Total ash) (Manjunathan et al., 2011; Okoro and Achuba, 2012) 3.6.6. Total energy Total energy was calculated according to the following equations: Energy (Kcal) = 4× (g protein + g carbohydrate) + 9 × (g lipid) Energy (kJ) = 17 × (g protein + g carbohydrate) + 37× (g lipid) (Barros et al., 2008) 3.7. Protein estimation by Bradford assay In 200 μL mushroom extract, 0.2 mL of dye concentrate (Biorad USA) was added. These were mixed by vortex and left to stand at room temperature for at least 5 min before measurement of absorbance at 595 nm (Haider et al., 2013). Bovine serum albumin was used as standard for confirmation of standard error. 3.8. Amino acids analysis

Homogenized mushrooms samples (± 23 mg) were taken in test tubes and 5 mL of 6N HCl was added to hydrolyze amino acids from protein. Nitrogen gas was passed from the samples for about 1 min to make them oxygen free. Test tubes were sealed with the help of a welding torch and kept for 18-24 h at 110 oC under vacuum for hydrolysis. Then the sealed test tubes were broken and the hydrolyzed samples were evaporated to dryness in a water bath at 65 oC.

Final volume was made up to 1 mL with 0.06N HCl. Samples were filtered through syringe filter (0.22 micron) in a sample vial, prior to injection (20 µL) into the amino acid analyzer. Amino acid analysis was conducted on the Shimadzu Amino Acid Analyzer with Shim-Pack Amino-Na column (4.6 mm, I.D x100 mm) containing strong acidic cation exchanger resin (styrene divinyl benzene copolymer with sulphonic groups). Sample is injected by the auto injector SIL-10ADVP.The mobile phase consisted of 0.2N sodium citrate pH 3.2 (mobile

38

Chapter # 3 Materials and Methods phase A, MA), 0.6N sodium citrate and 0.2 M boric acid pH 10 (Mobile phase B, MB), and

0.2M NaOH (Mobile phase C, MC). A gradient program of 72 min was set for mobile phase A, B, C with the initial flow rate of 0.4 mL/min at 100% MA followed by MB 0-100% for 14-53 minutes; MC100% for 53.01 to 58 minutes; MA 100% for 59-72 min. Ammonia trap column is used prior to column elution (Shim-pack ISC-30/SO504 Na). System controller was SCL-10A VP, while degasser used was DGU-14A. Reaction solutions were kept at a flow rate of 2 mL/min at 60 °C. Fluorescence detector RF-10A XL was adjusted at Ex = 350 nm, Em = 450 nm. The column oven CTO-10AV VP was set at 60 °C. Flow rate of reaction solution was kept constant by peristolic pump (PRR-2A) (Igwe et al., 2012). 3.9. Minerals analysis One gram of dry powdered sample was placed in a porcelain crucible and ashes at 450 oC for

5-6 hrs; then the ash was dissolved in 1 mL 70% HNO3(Merck), then cooled and centrifuged and adjusted to 10 mL volume with distilled water. A blank was also prepared using similar experimental procedure. Three such replicates were maintained for each of the mushroom species studied (Mallikarjuna et al., 2013). 3.9.1. Instrumentation The mineral contents were determined employing Inductively Coupled Plasma (ICP/OES) optical Emission Spectrometer (Perklin Elmer, optima 4300Dv) with Argon plasma. Instrument: ICP-OES (Perklin Elmer, optima 4300Dv, USA), Power: 40 MHZ (Free running solid state RF generator) Plasma gas flow: 15 L/min Auxillary gas flow: 0.8 L/min Reading time: 3 sec The concentrations of all analyzed minerals were expressed as mg/100 g dry weight of sample. 3.10. Classical organic solvent extraction (COSE)

Different solvents, n-hexane (Hx), dichloromethane (DCM) and ethyl acetate (EtAc), in ascending polarity of 0, 3.1 and 4.4 were used to fractionate soluble compounds from selected mushrooms. The COSE method used to obtain the extracts consisted in a cold maceration of the mushrooms to avoid thermal degradation. The extraction was performed

39

Chapter # 3 Materials and Methods with dried mushrooms powder (100 g) placed in ethanol for six days. The resulting extract was evaporated at reduced pressure up to 10% of the initial volume to obtain the crude extract (CE), the ethanolic fraction. The CE was partitioned with n-hexane, dichloromethane, ethyl acetate and water using 60 mL of each. The organic solvents used were 99% pure (Sigma-Aldrich, USA) (Kitzberger et al., 2007). 3.10. 1. Extraction of selected mushrooms The selected mushrooms were extracted in methanol and ethanol according to the method with slight modification (Gangadevi et al., 2008). Briefly, dried mushroom powder 20 g was extracted with 200 mL of 80% methanol and ethanol using an orbital shaker (Gallenkamp, UK) for 8 h at room temperature. The extracts were separated from solid residue by filtering through Whatman No. 1 filter paper. The extract was evaporated in rotary evaporator (EYELA, N-N Series, Rikakikai Co. Ltd. Japan) to yield the residue and stored at 4 oC for subsequent analysis. 3.11. Antimicrobial activity The mushrooms fractions obtained with COSE were subjected to evaluate their antimicrobial activities with the bacterial species: Escherichia coli, Staphylococcus aureus, Bacillus subtilis, and Pasteurella multocida. The cultures were incubated at 37 oC for 24 hrs and then diluted in culture broth to contain 106 spores/mL. Agar Mueller–Hinton and culture broth were used for the bacterial growth. All bacterial cultures were incubated in aerobic conditions. The fungal species: i.e. Aspergillus niger, Aspergillus flavus, Fusarium solani and Helminthosporium maydis were also challenged in this study to ascertain the antimicrobial activities of mushrooms fractions. The cultures were incubated at 28 oC for 48 hrs and then diluted in culture broth to contain 106 CFU/mL. Potato–dextrose agar and culture broth were used for fungal cultivation. All fungal cultures were incubated in aerobic conditions (Hearst et al., 2009). 3.11.1. Antimicrobial activity by disc diffusion method The agar diffusion method was performed using filter paper discs of size 8 mm for each bacterial suspension (106 CFU/mL) and inoculated onto plates, where the bacterial cultures 100 µL were spread uniformly on the agar surface. The discs were aseptically loaded (100

40

Chapter # 3 Materials and Methods

µL) with the various mushrooms fractions. The fractions were used in the concentration of 10 mg extract/mL of DMSO (dimethylsulphoxide) because DMSO does not offer inhibition to the microorganism‘s growth. The plates were incubated at 37 oC for 24 hrs before evaluation for bacteria growth inhibition. A positive result was defined as an inhibition zone around the discs therefore, indicating the presence of antibacterial substances in thetested extracts (Sharif et al., 2013). 3.11.2. Minimum inhibition concentration (MIC) The fractions were also evaluated through the Minimum Inhibition Concentration (MIC refers to minimum concentration of the extract that is effective to inhibit the growth of selected microorganisms) by the microdilution method in culture broth to inhibit microbial growth (Sarker et al., 2007). The mushrooms fractions (10 mg/mL) that showed inhibition zone in the disc diffusion method were dissolved in 200 µL of DMSO and the solution added to 1800 µL of Muller–Hinton broth for bacterial growth and sabouraud broth for fungi. Plates were prepared under aseptic condition in laminar air flow. A sterile 96 well plate was labeled. A volume of 100 µL of test material was pipetted into the first row of the plate. To all other wells 50 µL of broth was added. Serial dilutions were performed and tips were discarded after use such that each well had 50 µL of the test material in serially descending concentration. To each well 10 µL of resazurin indicator solution was added and finally 10 µL of bacterial suspension (5x106 CFU/mL) was added to achieve a concentration of 5x105 CFU/mL. Each plate had a set of control i.e. a column with a broad spectrum antibiotic as positive control, a column with all solutions except test compound and a column with all solutions except bacterial solution added 10 µL of broth instead. Each plate was wrapped to ensure that bacteria did not become dehydrated. The plates were then incubated at 28 oC for fungus for 48 hrs and at 37 oC for bacteria for 24 hrs. The absorbance was taken at 620 nm by micro plate reader for fungus and at 500 nm for bacteria; any color change from purple to pink or colorless was recorded as positive. The lowest concentration at which color changes occur was taken as MIC value. The results were expressed in µg/mL (Sarker et al., 2007). 3.11.3. Antibacterial activity by well diffusion method Antibacterial activity of methanolic and ethanolic extracts was determined by the agar well diffusion method against set of bacterial species, B. subtilis, S. aureus and E. coli. (The

41

Chapter # 3 Materials and Methods methanol extracts were dissolved in 10% dimethylsulfoxide (DMSO) to a final concentration of 1 mg/mL, Small wells (6 mm) were made in the agar plates by sterile cork borer. 100 µL of the extract of each isolate was loaded into the different wells. All the preloaded plates with respective extract and test organism were incubated at 37°C, for 24 hours. After incubation period, zone of inhibition was measured in millimeters. All the tests were carried out in triplicate and averaged (Valgas et al., 2007). 3.11.4. Inhibtion of microbial Biofilm Inhibition of microbial biofilm was performed according to the method (Salman et al., 2014). Each well of 96 well plates was filled with 100 µL nutrient broth and sample and 10 µL bacteria, and for control added nutrient broth and bacteria. The plate was incubated at 37°C for 24 hours. Then washed with phosphate buffer saline (PBS) and 99% methanol, and stained with 7% crystal violet. After washing 33% glacial acetic acid was added for resolublization of bound dye to the wells. The absorbance was taken at 630 nm against negative control. The collected data was presented in percent inhibition calculated by taking the difference of optical density (O. D) of control and optical density (O. D) of sample using following eq:

3.12. Phenolic contents and antioxidant activity 3.12.1. Folin-Ciocalteu assay Total phenolic contents (TPC) were determined by using Folin-Ciocalteu reagent method as described by Ainsworth and Gillespie (2007). In 1 mL of each sample 200 µL of F-C reagent was added and vortex thoroughly. Then 800 µL of 700 mM Na2CO3 added into each sample and incubated at room temperature for 2 hrs. Sample (200) µL was transferred to a clear 96- well plate and absorbance of each well was taken at 765 nm. Amount of TPC was calculated using a calibration curve for gallic acid. The results were expressed as gallic acid equivalent (GAE) per g of extract.

42

Chapter # 3 Materials and Methods

2.5

) 2 1.5 y = 0.0205x R² = 0.9958 1 0.5 0

0 20 40 60 80 100 120 Absorbance nm (765Absorbance Concentration of Gallic acid

Fig 3.2. Standard curve for Folin-Ciocalteu assay 3.12.2. Total flavonoid contents The flavonoids compound concentration from the mushrooms samples were evaluated by the method according to Barros et al., (2008). Mushroom fraction 250 µL of was mixed with

1.25 mL of distilled water. Then 75 µL of 5% NaNO2 solution was added in it. It was allowed to stand for 5 min, and 150 µL of 10% AlCl3 was added in to the mixture. It was mixed well and the intensity of the appeared pink color was measured at 510 nm. Catechin was used as standard for flavonoids quantification. The results were expressed as mg of catechin equivalents per gram of fraction. 3.12.3. DPPH scavenging activity assay The DPPH assay was carried out as described by Bozin et al. (2006). The antioxidant activity of mushrooms were assessed by measuring their scavenging abilities to 2,2-diphenyl-1-1- picrylhydrazyl stable radical. The 50 µL aliquot of the samples was added to 5 mL of a 0.004% methanol solution of DPPH. After 30 min incubation period at room temperature, the absorbance was taken against a blank at 517 nm. The assay was carried out in triplicate.

I % = (A blank –A sample /A blank) ×100

Where Ablank is the absorbance of the control reaction (containing all reagents except the test compound) and A sample is the absorbance of the test compound. Extract concentration providing 50% inhibition (EC 50) was calculated from the graph plotted inhibition percentage against extract concentration. The assay was carried out in triplicate. 3.12.4. Reducing power The reducing power was determined according to the method of Chen et al. (2012) with minor changes. Mushroom fractions (1 mL) were mixed with 1 mL of 200 mM sodium

43

Chapter # 3 Materials and Methods

phosphate buffer (pH 6.6) and 0.5 mL of 1% potassium ferricyanide [K3Fe(CN6)] (w/v). The mixture was incubated at 50 oC for 20 min, an equal volume of 10% TCA (w/v) was added and centrifuged at 3000 g for 10 min. The upper layer (2 mL) was mixed with 2 mL of deionized water and 0.4 mL of 0.1% of ferric chloride (FeCl3), and the absorbance at 700 nm was taken by using microplate reader (BioTek, USA). Increased absorbance of the reaction mixture indicated increased reducing power; BHT was used as positive control while absence of extracts of the mushroom was the negative control. 3.13. Brine shrimp lethality assay Brine shrimp lethality bioassay was carried out to investigate the cytotoxicity of mushrooms fractions. Brine shrimps (Artemia salina) were hatched using brine shrimp eggs in a conical shaped vessel (2 L), filled with sterile artificial sea water (prepared using sea salt 38 g/L and adjusted to pH 8.5 using 1N NaOH) under constant aeration for 48 hrs. Afterhatching, active nauplii free from egg shells were collected from brighter portion of the hatching chamber and used for the assay. Twenty nauplii were drawn through a glass capillary and placed in each vial containing 4.5 mL of brine solution. In each experiment, 0.5 mL of the mushrooms fractions were added to 4.5 mL of brine solution and maintained at room temperature for 24 hrs under the light. Surviving larvae were counted. Experiments were conducted along with control, four different concentrations (10, 100, 1000, 3000 µg/mL) of the fractions were used to check their toxicity and the experiment was repeated three times (Manilal et al., 2009). 3.13.1. Lethality concentration determination The percentage lethality was determined by comparing the mean surviving larvae of the test and control tubes. LC50 values were obtained from the best fit line plotted concentration versus percentage lethality, methanol (95%) was used as a positive control in the bioassay. 3.14. Thrombolytic activities of selected mushrooms extracts and fractions Clot lysis activity was checked by using different mushrooms extracts and fractions (Prasad et al., 2006). The streptokinase was used as a positive control for in vitro clot lysis. In commercially available lyophilized streptokinase (SK) vial, 5 mL phosphate buffered saline (PBS) was added and assorted properly. This suspension was used as a stock from which proper dilutions were made to examine the anti-clot activity.

44

Chapter # 3 Materials and Methods

3.14.1. Sample preparation Each fraction (10 mg) was suspended in 1 mL dimethylsulfoxide (1%) and the suspension was shaken vigorously on a vortex. 3.14.2. Collection of blood samples Blood samples of different healthy volunteers were collected from different hospitals and laboratories of Faisalabad, Pakistan. Venous blood was drawn from healthy human volunteers without a history of oral contraceptive or anticoagulant therapy and irrespective of gender. Blood (500 µL) was transferred to the previously weighed micro-centrifuge tubes. 3.14.3. Preparation of clot Preweighed micro-centrifuge tubes which contain blood were incubated at 37 ⁰C for 45 min. Blood clot was formed at the bottom of each centrifuge tube. The serum was removed with the help of micro- pipette from each centrifuge tube above the clot carefully and completely without disrupting the clot. 3.14.4. Weight of clot before lysis After removing the serum, the tubes which contained clot were weighed again to calculate weight of clot before lysis. Weight of clots (Wc) was determined by taking the difference between weight of micro-centrifuge tubes (Wm) containing clot and weight of empty micro- centrifuge tubes (We). wc = wm - we 3.14.5. Addition of mushrooms extracts and fractions Each mushroom extract (100 µL) was added in tubes with the help of micro-pipette, where streptokinase and distilled water were applied as positive and negative controls respectively. All the micro-centrifuge-tubes were again incubated at 37 °C for 90 min for clot lysis. Then tubes were inverted and left overnight. Microcentrifuge tubes were taken out of the incubator and the fluid obtained after lysis along with the applied agents (extract, streptokinase and distilled water) was removed carefully and completely from the centrifuge tubes. Tubes were weighed to calculate the weight of clot after lysis. The weights of clots were determined by taking difference between weight of clot after lysis (W1) and weight of empty tubes (We). wc = wl - we

45

Chapter # 3 Materials and Methods

Then percentage of clot lysis activity of different mushrooms extracts was determined by the difference between weight of clots before (Wb) and after lysis (W1) dividing by weight of clot before lysis and multiplied by 100.

Clot lysis % = wb – wl/ wb x 100 3.14.6.1. Effect of concentrations of sample Mushrooms extracts of different concentrations (1%, 0.6% and 0.3%) were used to determine the effect on thrombolysis. 3.14.6.2. Effect of incubation time Mushrooms extracts were added in to the clot and incubated at different time inrervals (30 min. 60 min. and 90 min.) for the determination of clot lysis. 3.14.6.3. Effect of the amount of sample 30 µL, 60 µL and 100 µL of each concentration (1%, 0.6% and 0.3%) of mushroom fractions were tested for clot lysis. 3.15. Anticancer potential of selected mushrooms 3.15.1. In vitro cell proliferation assay The in vitro cell proliferation assay was conducted as described by Jeff et al. (2013). The number of living cells at the end of incubation period was determined by colorimetric assay based on the tetrazolium salt MTT. In this assay, the tested samples were compared with control (without sample). All the experiments were performed in triplicate and cell proliferation under each condition was expressed as a percentage of the control, which was set at 100%. All in vitro results were expressed as the proliferation ratio of tumor cells calculated as follows: Growth inhibition ratio (%) = (1-B/A) x 100 WhereA and B are the average numbers of viable tumor cells for the control and samples respectively (Jeff et al., 2013). 3.16. α-Glucosidase and tyrosinase inhibition activities of selected mushrooms 3.16.1. α-Glucosidase inhibition activity The α-glucosidase inhibition activity was performed according to the slightly modified method of Kwon et al. (2008) and Dong et al. (2012). Total volume of the reaction mixture of 100 µL contained 70 µL 50 mM phosphate buffer saline, pH 6.8, 10 µL (0.5 mM) test

46

Chapter # 3 Materials and Methods compound, followed by the addition of 10 µL (0.057 units) enzyme. The contents were mixed, preincubated for 10 minutes at 37 ºC and pre-read at 400 nm. The reaction was initiated by the addition of 10 µL of 0.5 mM substrate (p-nitrophenyl glucopyranoside). Acarbose was used as a positive control. After 30 min of incubation at 37ºC, absorbance was taken at 400 nm using microplate reader (BioTek-USA). The percent inhibition was calculated by the following equation: Inhibition (%) = (Abs. of control – Abs. of test solution) × 100 Abs. of control

IC50 values (concentration at which there is 50% in enzyme catalyzed reaction) of compounds were calculated using EZ-Fit Enzyme Kinetics Software (Perrella Scientific Inc. Amherst, USA). 3.16.2. Tyrosinase inhibition activity The antityrosinase effect of mushrooms was determined by calculating the hydroxylation of L-tyrosine to L-DOPA. Inhibition assay was conducted in 96 well micro-plates, a spectrophotometer reader was used to determine the absorbance at 490 nm. Acarbose was used as a positive control (Chen et al., 2010). 3.17. Phytochemical analysis 3.17.1. Qualitative analysis 3.17.1.1. Tests for alkaloids (Mayer’s Test) In 5 mL of extract, few drops of Mayer‘s reagent were added along the side of the test tube. White creamy precipitate indicated the test as positive (Modi et al., 2014). 3.17.1.2. Test for detection of flavonoids (Alkaline reagent test) To the test solution few drops of NaOH solution were added; formation of an intense yellow color, turning to colorless on addition of few drops of dil. acid, indicated the presence of flavonoids (Modi et al., 2014). 3.17.1.3. Test for tannins To obtain the the extract 0.5 g sample (powder) was boiled in 10 mL of water in a test tube for 5 min. The mixture was filtered and then to 5 mL of filtrate, few drops of 0.1% ferric chloride were added and observed for brownish green or a blue-black coloration (Menghani et al., 2012).

47

Chapter # 3 Materials and Methods

3.17.1.4. Test for saponins by froth test 5 mL of the extract was vigorously shaken with 8 mL of distilled water in a test tube for 30 sec and was left undisturbed for 20 min. Persistent froth indicated the presence of saponins (Modi et al., 2014). 3.17.2. Quantitative analysis 3.17.2.1. Alkaloid determination Sample (5 g) was weighed and added into a 250 mL volumetric flask and 200 mL of 10% acetic acid in ethanol (i.e. 20 mL of acetic acid added in 180 mL of ethanol) was added and covered. The mixture was allowed to stand for 4 hrs, filtered and the extract was concentrated on a water bath to one-quarter of the original volume. Concentrated ammonium hydroxide was added drop wise to the extract until the precipitation was complete. The whole solution was allowed to settle and the precipitates were collected and washed with dilute ammonium hydroxide and then filtered. The residue was the alkaloid which was dried and weighed (Sutharsingh et al., 2011). 3.17.2.2. Saponins determination Ground sample (20 g) was taken in a conical flask (500 mL) and 100 mL of 20% aqueous ethanol was added. The flask was heated on a hot water bath for 4 hrs at about 55°C with constant stirring. The mixture was then filtered and the residue was again extracted with another 200 mL of 20% ethanol. The combined extract was reduced to 40 mL on a hot water bath at about 90°C. The concentrate was transferred into a 250 mL separator funnel containing 20 mL of diethyl ether, followed by vigorous shaking. The aqueous layer was recovered while the ether layer was discarded. Then 60 mL of n-butanol was added and combined n-butanol extracts were washed twice with 10 mL of 5% aqueous sodium chloride. The remaining solution was heated in a water bath, after evaporation the samples was dried in an oven and weighed (Khan et al., 2011). 3.17.2.3. Flavonoids determination Colorimetric method with slight modifications was used to determine flavonoids contents. Mushroom extract (1 mL) in methanol was mixed with 1 mL of methanol, 0.5 mL aluminium chloride (1.2%) and 0.5 mL potassium acetate (120 mM). The mixture was allowed to stand for 30 min a room temperature and absorbance was taken at 415nm.

48

Chapter # 3 Materials and Methods

Quercetin was used as a standard. Flavonoids contents were expressed in terms of quercetin equivalent (mg-1 of extracted compounds) (Vaghasiya et al., 2011). 3.17.2.4. Determination of tannins A known weight (1.0 g) of each sample was dispersed in 10 mL of distilled water and agitated and left to stand for 30 minutes at room temperature, being shaken every 5 min. Thesolution was centrifuged and the supernatant decanted. 2.5 mL of the supernatant extract was dispensed into 50 mL volumetric flask. Similarly, 2.5 mL of standard tannic acid solution was dispensed into a separate 50 mL flask. A 1.0 mL Folin-Denis reagent was measured into each flask followed by 2.5 mL of saturated Na2CO3 solution. The mixture was diluted to 50 mL mark in the flask, and incubated for 90 min at room temperature. The absorbance was taken at 250 nm (Udu-Ibiam et al., 2014). 3.17.2.5. Determination of β-carotenes In 100 µL of extract, 10 µL of acetone–hexane mixture (4:6) was added in eppendorf and vortexed for 1 min. Then it was filtered through Whatman No.4 filter paper and absorbance was measured at 453, 505 and 663 nm. β-carotene contents were calculated by using the following equations:

β- Carotene = 0.216 A663 - 0.304 A505 + 0.452 A453

(Barros et al., 2008) 3.18. Analysis of phenolic acids by HPLC 3.18.1. Sample extraction and preparation Freeze dried mushroom powder (0.20 g) was extracted with 2 mL of 0.1% formic acid/methanol and sonicated for 20 min. The mixture was centrifuged at 3000 rpm for 10 min. Then residues were re-extracted twice and extracts were combined and evaporated to dryness under vacuum. Samples were re dissolved in 0.1% formic acid/ water and filtered through a 0.20 μm disposable LC filter disk prior to HPLC analysis. 3.18.2. Instrumentation and chromatography Samples were injected in a Waters 2695 separations module equipped with a Waters Xterra reverse phase C18 3.5 μm 2.1 × 100 mm column in a heated chamber set at 35 °C. A linear biphasic gradient with a flow rate of 0.30 mL/min with mobile phase A, 2% formic acid in MS grade water, and mobile phase B, 0.1% formic acid in acetonitrile, at 0, 10, 30, and 31

49

Chapter # 3 Materials and Methods min, the solvent composition was 95, 90, 75, and 95% mobile phase A. Directly tandem to the column, the flow was split so that half of it went to a Waters 2996 photodiode array detector and half to a Waters Micromass ZQ mass spectrometer (Song et al., 2013).

8000000 y = 7E+15x - 1E+06 4000000 y = 3E+15x - 6883.1 6000000 3000000 4000000 2000000 2000000 0 1000000 0 5E-10 1E-09 1.5E-09 0 0 5E-10 1E-09 1.5E-09

(a) (b)

4000000 2500000 y = 3E+15x + 141948 y = 2E+15x + 213029 2000000 3000000 1500000 2000000 1000000 1000000 500000 0 0 0 5E-10 1E-09 1.5E-09 0 5E-10 1E-09 1.5E-09

(c) (d)

5000000 y = 4E+15x + 8133 4000000 3000000 2000000 1000000 0 0 5E-10 1E-09 1.5E-09

(e)

Fig 3.3. Standard curves of phenolic acids. (a) chlorogenic acid, (b) gallic acid, (c) p. cumaric acid, (d) ferulic acid, (e) caffeic acid X-axis represents µMoles on column and Y-axis represents peak area 3.19. Tocopherols analysis of selected mushrooms 3.19.1. Sample preparation Tocopherol contents were determined following a procedure previously optimized and described by Barros et al. (2008). BHT (butylhydroxyltoluene) solution in n-hexane (10 mg/mL; 100 µL) and IS solution in n- hexane (tocopherol; 2.0 µg/mL; 250 µL) were added

50

Chapter # 3 Materials and Methods to the sample prior to the extraction procedure. The samples (500 mg) were homogenized with methanol (4 mL) using vortex mixer (1 min). Subsequently, hexane (4 mL) was added and again vortex mixed for 1 min. After that, saturated NaCl aqueous solution (2 mL) was added, the mixture was homogenized (1 min), centrifuged (5 min, 4000 g) and the clear upper layer was carefully transferred to a vial. The sample was re-extracted twice with n- hexane. The combined extracts were dried under a nitrogen stream, re-dissolved in 5 mL of ethyl acetate, 0.5 mL of methanol, filtered through a 0.22 µm disposable LC filter disk, transferred into a dark injection vial and analyzed by HPLC. 3.19.2. HPLC analysis Carotenoids and tocopherols analyses were completed with a Hewlett-Packard model 1090A HPLC system equipped with a model 79880A diode array detector. Separations were achieved using a YMC carotenoid reversed phase (2.0 × 250 mm) polymeric C30 column with a guard column containing the same stationary phase (Waters Corp., Milford, MA). A gradient elution profile based on a binary mobile phase system consisting of methanol/1 M ammonium acetate (98:2 v/v) in phase A and ethyl acetate in phase B was used. A flow rate of 0.37 mL/min was utilized with initial conditions set at 100% A with a linear gradient to 80:20 A/B over 6 min. The gradient was held for 2 min followed by a 3 min linear gradient back to 100% A and equilibration at initial conditions for 3 min for a total analysis time of 14 min. Detection and tentative identification of carotenoids and tocopherols were accomplished using inline diode array data between 250 and 600 nm.

γ-Tocopherol Lutein

12 100 y = 0.0304x + 0.6999 10 y = 0.0761x - 0.2324 80 R² = 0.9985 8

R² = 0.9974 6 60 4 40 2 0

20 Peak Area -2 0 50 100 150 0 0.00 1000.00 2000.00 3000.00 4000.00 PICOmoles on Column

(a) (b)

Fig 3.4. Standard curves for (a) γ-tocopherol, (b) lutein

51

Chapter # 3 Materials and Methods

Quantifications of carotenoids and tocopherols were accomplished using multilevel response curves constructed at 450 nm with authentic standards for lutein and gamma tocopherol. Tocopherol contents in mushrooms samples are expressed in µg per g of dry mushroom (Kean et al., 2008). 3.20. Fatty acids analysis of selected mushrooms 3.20.1. Extraction The sample (200 mg) was weighed and transferred to a 12 cm x 1.5 cm tube. 1 mL of chloroform, 1 mL of absolute chloroform and 3 mL of fresh 5% methanolic HCl (prepared by slowly adding 10 mL of acetyl chloride to 100 mL of anhydrous methanol) were added. Tubes were caped and vortexed slowly for 1 min, heated at 100 oC for 1 hr. After cooling to room temperature, 5 mL of 6% K2CO3 and 4 mL of chloroform were added and again vortexed for half minute and centrifuged at 2500 rpm for 10 min. Different layers were formed, the bottom organic layer was removed with pasture pipette and washed with 4 mL of chloroform to completely remove the organic compounds. It was dried under nitrogen and resupended in 2 mL of n- hexane and 4 mL of KCL (0.88%), two layers were formed and the upper layer was transferred to a GC vial for gas chromatography analysis (Clapham et al., 2005). 3.20.2. Instrumentation and chromatography Chromatographic separation of fatty acids methyl esters was accomplished with a Hewlette- Packard (Wil-mington, DE) model 6890 GC equipped with electronic pneumatics control, a model7683 automatic liquid sampler, and a flame ionization detector. Sample (2 µL) was introduced by split injection (50:1 ratio) onto a WCOT fused silica, chemically bonded capillary column (Chrompack CP-select CB for FAME, 100 m long, 0.25 mm inside diameter, 0.39 mm outside diameter, 0.25-μm film thickness; Varian Walnut Creek, CA). Helium 3 mL was used as carrier gas. The temperature gradient (70-250 oC) consisted of the following steps: 70 oC for 1 min; increased to 135 oC at 90 oC min-1, hold for 1 min; increased to 160 oC at 1.5 oC min-1; hold for 0.5 min, increased to 185 oC at 1 oC min-1, hold for 0.5 min, increased to 195 oC at 60 oC min-1, hold for 5.5 min, increased to 250 oC at 90 oC/ min, hold for 3 minute, total run time was 54.7 min. Injector temperature was 280 oC; detector temperature was 300 oC. Fatty acids were identified according to their retention time

52

Chapter # 3 Materials and Methods using reference standard GLC-63B, Nu-Check- Prep, Elysian, MN) and quantified using a Hewlette-Packard Chem station data system. Fatty acids quantified on dry matter basis were lauric (C12:0), myristic (C14:0), palmitic (C16:0), palmetoleic (C16:1), stearic (C18:0), oleic (C18:1), linoleic (C18:2) and α-linoleic (C18:3). Hepatodecanoic acid (C17:0, 0.4 mg/mL in n-hexane; Matreya, pleasant Gap, PA) was used as an internal standard (Clapham et al., 2005). 3.21. Determination of monosaccharide by alditol acetates 3.21.1. Hydrolysis Sample (3 mg) was weighed and transferred to Teflon-lined screw capped tubes. 2 μL of inositol and tri fluroacetic acid (TFA) were added and vortexed, heated at 121oC for 1 hr and removed acid under a slow flow of nitrogen and air. Traces of acid were removed by addition of isopropanol (3x250 μL) followed by blowing to dryness with nitrogen and air. 3.21.2. Reduction

Hydrolyzed samples were dissolved in 100 µL of 1M NH4OH. 0.5 mL of DMSO containing 20 mg/mL of sodium borodeuteride was added to the mixture and kept for 90 min at 40 oC. Then glacial acetic acid was added drop wise until bubbling stopped (6-9 drops). 3.21.3. O-Acetylation 100 µL of 1-methylimidazole and 0.5 mL of acetic anhydride were added, vortexed the mixture and let it stand for 10 min at RT. Then of 4 mL H2O/1 mL CH3Clwas added to the mixture, vortexed and the bottom layer was removed to clean the tubes and repeated for two more times. Methylene chloride layer was washed twice with 2 mL of water and removed the

CH3Cl layer, and blew to dryness (Pettolino et al., 2012).The Final residues were dissolved in 1mL of acetone and injected into the GC for analyses. 3.22. Partially methylated alditol acetates (PMAA) 3.22.1. Methylation 0.2-0.8 mg of totally dried sample was weighed and 20 µL of methanol was added and dried with the stream of nitrogen. 50 µL DMSO was added and sonicated for 30 min. 75 µL slurry of NaOH in DMSO (120 mg NaOH/1 mL of DMSO) was added and sonicated for 50 min. 20

µL CH3I was added and sonicated for 10 min and repeated the same for one more time, added 30 µL CH3I and sonicated for 20 min.500 µL DCM and 1000 µL water were added

53

Chapter # 3 Materials and Methods and vortexed well, centrifuged at 2000 rpm for 2 min and discarded the water layer (two times). DCM layer was washed twice with 1 mL water and finally DCM layer was dried with nitrogen stream (Pettolino et al., 2012). 3.22.2. Hydrolysis o The 100 µL of 2 M TFA was added and hydrolyzed for 90 min at 121 C. After cooling the sample 20 µL myoinositol was added as an internal standard (2.5 mg of myoinositol per mL of 2 M TFA) then dried with stream of nitrogen. Methanol 150 µL was added and dried with nitrogen (repeated one more time). 3.22.3. Reduction

Residues were dissolved in 50 µL of 2 M NH4OH followed by 50 µL of freshly prepared

NaDB4 (42 mg of NaDB4/1 mL of 2 M NH4OH) sonicated for 1 minute and incubated at room temperature for 2.30 hrs. Then 23 µL of glacial acetic acid was added and dried with nitrogen stream, further evaporated twice with 250 µL of 5 % (v/v) glacial acetic acid in methanol and twice with 250 µL of methanol (Pettolino et al., 2012). 3.22.4. Acetylation Residues were dissolved in 250 µL of acetic anhydrate, sonicated for 5 min and incubated at 100 oC for 2.3 hrs. Added 2 mL water vortex well and waited for 10 min. Added 1 mL of DCM, vortexed and centrifuged at 2000 rpm for 2 min and discarded the water layer then washed DCM layer twice with 2 mL of water (Pettolino et al., 2012). Finally dried the DCM phase. Redissolved in 500 µL acetone and analyzed on GC. 3.23. Glucan analysis of selected mushrooms 3.23.1. Extraction of crude polysaccharides 100 grams of dry powder from mushroomswas extracted with hot water (60 °C, 3 hr, 1: 30 w/w). Extract was filtered and concentrated at 60 °C in a rotary evaporator under reduced pressure, precipitated by 95% ethanol in 1:3 ratio (extract: ethanol, v/v) and kept overnight at 4 °C then centrifuged (5000 × g, 20 min). Resulted precipitates were freeze dried and tagged as crude polysaccharides (Novak et al., 2011).

54

Chapter # 3 Materials and Methods

3.23.2. Purification procedures Natural polysaccharides contain small amounts of other biomacromolecules like protein, fats and fiber materials as impurities. For the isolation of pure polysaccharides from mushrooms, the following method was used. 3.23.3. Fractionation and purification Crude polysaccharide was fractionated and purified by anion-exchange chromatography. Crude polysaccharide (500 mg) was dissolved in 10 mL distilled water and loaded on the DEAE-cellulose 52 column (2.6 × 40 cm). The column was eluted with distilled water, followed by a 0 to 1 mol/L linear gradient of NaCl at a flow rate of 4 mL/6 min. The elution of polysaccharide was monitored using phenol-sulfuric acid assay. The four fractions containing polysaccharide were pooled, dialyzed and then freeze dried respectively. Two major fractions were further purified by gel permeation chromatography on a superdex-75HR column performed on AKTA basic system (Amersham Biosciences), with distilled water as eluent at a flow rate of 0.5 mL/min. Two homogeneous polysaccharides fractions were obtained respectively and lyophilized for further investigation (Zhang et al., 2012). 3.23.4. Phenol sulfuric acid assay In this method, sample was taken into a boiling test tube, hydrolyzed it by keeping it in water o bath for 3 hrs at 100 Cwith 5 mL of 2.5N HCl and refrigerated at room temperature. After that it was neutralized with Na2CO3 until the effervescence ceased. Volume was made up to 100 mL. Working solution of standard glucose was taken as 0.2, 0.4, 0.6, 0.8 mL and 1 mL, 0.1 mL and 0.2 mL of the sample solution were made in separate test tubes, and their volumes were taken upto 1 mL. In each test tube 1 mL of phenol solution was added along with 5 mL of 96% sulfuric acid and shaked well. After 10 min, test tubes were placed in water bath at 25-30 oC for 20 min. The absorbance was taken at 490 nm (Dubois et al., 1956).

55

Chapter # 3 Materials and Methods

4.5 4 y = 0.0039x 3.5 R² = 0.9908 3 2.5 2 1.5 1

Concentration 0.5 0 0 200 400 600 800 1000 1200 Absorbance (490 nm)

Fig 3.5. Glucose standard curve for phenol sulfuric acid assay 3.23.5. Characterization of glucans The entire samples including crude and purified polysaccharides were characterized by the following techniques.

3.23.6. Ultraviolet Visible Spectroscopy (UV/VIS) UV/VIS spectroscopic analysis was carried out using the Ultraviolet Visible Spectrophotometer. The solution of polysaccharide was prepared using distilled water. The wavelength was calculated in the range of 190-500 nm in order to get UV-VIS measurements. The spectra of the sample were recorded in the above mentioned range (Zhang et al., 2012).

3.23.7. Fourier Transformation Infrared Spectroscopy (FT-IR) FT-IR analysis was performed on crude and purified glucan samples to determine their functional groups. Studies of infrared spectra were performed on Fourier transform infrared spectrometer in the presence of dry air, at room temperature. Fourier-transform infrared (FTIR) spectra were recorded from the samples in Potassium Bromide (KBr) pellet on a FT- IR spectrophotometer (Zhang et al., 2012).

3.23.8. Scanning Electron Microscopy (SEM) All the crude and purified glucan samples were morphologically characterized by using scanning electron microscope (JEOL, JSM5910, Japan). The observation of the SEM of the glucan granules was carried out by using the method given by Fujita et al. (2003).

56

Chapter # 3 Materials and Methods

3.23.9. Preparation of silver nano-particles using polysaccharides α-amylase from Bacillus sp. (1:500 v/v) at pH: 7 was added in the polysaccharide extracts, incubated for 30 min to remove α-glucans. Then Sevag reagent (chloroform/ butanol 4:1, v/v) was added in to it for deproteinization. The deproteinized supernatant was separated and dialyzed (Synytsya et al., 2009). Silver nitrate (AgNO3) and sodium hydroxide (NaOH) were purchased from Merck, (Cat. No. 567530) and used without further purification. All glassware was cleaned in a bath of freshly prepared aqua regia solution (HCl–HNO3, 3:1) and rinsed first thoroughly with double distilled water and then acetone prior to use. Silver nitrate solution (0.01 M) was prepared by adding AgNO3 in Millipore water. Then, the silver nitrate solution was mixed with polysaccharide extract followed by the addition of 0.4 mL of very dilute solution of sodium hydroxide (0.001 M) at room temperature. The transparent and colorless solution was converted to the characteristics pale yellow color indicating the formation of silver nanoparticles. It was observed that the aqueous solution of silver nanoparticles was stable at room temperature (Philip et al., 2009). 3.24. Statistical analysis Minitab software was used for computation and analysis of different parameters. Differences were analyzed by considering p<0.01 statistically significance. The collected data was analyzed by means and standard deviation. A statistician was consulted for the statistical analysis of the data from Department of Mathematics and Statistics, University of Agriculture, Faisalabad.

57

CHAPTER # 4 RESULTS AND DISCUSSION

Natural products obtained from plants and other sources have been used as a prominent source of prophylactic agents for the prevention and treatment of diseases. Mushroom production is profitable and can play an important role in country‘s stride towards ensuring food security. Mushrooms have continued to generate a lot of interest particularly in their consumption as food and considered to possess a great potential for both nutrition and therapeutic uses. The main target of the current study was to draw attention to the current perspective, evidences, advances, challenges, and further development of mushrooms science in 21st century. The present study will contributes to the nutritional and chemical characterization of local cultivated (Pleurotus ostreatus and Volvariella volvacea) and exotic commercial (Lentinus edodes and Hericium erinaceus) mushrooms species and locally grown wild mushroom (Ganoderma lucidum) with special focus on their proximate, antioxidant, anticancer, antithrombotic and antimicrobial potential making available an inventory to be disseminated to promote the consumption of wild and commercial mushrooms in Pakistan. The results are discussed under these headings.  Molecular studies of wild Ganoderma lucidum  Proximate, amino acids and mineral composition of selected mushrooms  Extraction and fractionation of mushrooms  Antimicrobial assay and minimum inhibitory concentration (MIC) of mushrooms fractions  Antioxidant and thrombolytic activities of selected mushrooms  Anticancer potential of selected mushrooms using cell lines  Toxicological evaluation of mushrooms by Brine shrimp/ lethality assay  Qualitative and quantitative phytochemicals analyses of selected mushrooms  Phenolic acids, tocopherols and carotenoids quantification by HPLC  GC-MS analysis of monosaccharide sugars and fatty acids  Extraction, purification and characterization of glucans from selected mushrooms

58

Chapter # 4 Results and Discussion

4.1. Molecular Studies of Ganoderma lucidum

4.1.1. Isolation of genomic DNA Freeze-dried mycelia were re-suspended and ground in liquid nitrogen and treated with extraction buffer that not only brought about lysis of membranes but also helped to free the DNA from polysaccharides. Proteins, polysaccharides and cell debris were precipitated by NaCl solution followed by phenol/chloroform extraction to denature proteins. The DNA was precipitated in ethanol and dissolved in TE buffer after washing with 70% ice-cold ethanol. Good quality DNA was obtained from G. lucidum (Fig 4.1).

Fig 4.1. Agarose gel (0.8%) showing genomic DNA from G. lucidum (Lane 1) Lane M: DNA ladder (Fermentas, 1 kb) 4.1.1.1. Quantification of isolated DNA

The isolated DNA was quantified at A260 as the DNA bases absorb radiation in this region.

Purity of DNA sample was also checked by taking A260/A280 ratio as λ-max for proteins is 280 nm due to absorption by tyrosine and tryptophan. Quantification of DNA isolated from the fungus was found 960 µg/mL with A260/A280 ratio equal to 1.71. 4.1.2. Polymerase Chain Reaction PCR was performed on DNA isolated from the fungus and successful amplification was achieved for the desired part i.e. ITS region with universal pair of primers. For ITS region the sample showed gene amplification of 544 bp fragment (Fig 4.2). The amplified product was recovered from agarose gel. Then purified fragment was re-loaded on agarose gel for confirmation.

59

Chapter # 4 Results and Discussion

Fig 4.2. PCR amplification of ITS region from G. lucidum Lane 1 and 2 are showing PCR amplified ITS region and Lane M is showing DNA ladder (Fermentas, 1 kb)

From this experiment, it was concluded that 2 mM MgCl2 and 10 ρmoles of each primer, were suitable for amplification of ITS from the fungus. 4.1.3. Sequencing and BLAST results The purified samples were sequenced from Centre of Excellence in Molecular Biology (CEMB), Lahore, Pakistan. The sequence was analyzed by BLAST (Altschul et al., 1990) using a data base National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov). From sequencing result, Ganoderma lucidum was confirmed successfully through ITS region having 100% query coverage, 0.0 E-value and 99% identity with subject sequences (Fig 4.3). 4.1.4. Ganoderma lucidum internal transcribed spacer 1 (ITS), partial sequence

AGGATCATTATCGAGTTTTGACTGGGTTGTAGCTGGCCTTCCGAGGCATGTGCAC GCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGACGCCGTGA AGCGGGCTCTTTACGGGGCTTGTAGAGCGTGTCTGTGCCTGCGTTTATCACAAAC TCTATAAAGTATTAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCA GCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAG TAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCT CCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACTTACA AACCTTTGCGGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTTTTCGGTC GGCTCCTCTTAAATGCATTAGCTTGATTCCTTGCGGATCGGCTCTCGGTGTGATA ATGTCTACGCCGTGACCGTGAAGCGTTTTGGCGAGCTTCTAACCGTCTCG

60

Fig 4.3. BLAST results showing subject sequences with significant alignments

61

Chapter # 4 Results and Discussion

4.2. Proximate analysis of selected mushrooms Mushrooms have been food supplement in various cultures as they fall between the best vegetables and animal protein sources (Manjunathan et al., 2011). Apart from the former knowledge focusing on the therapeutic potential of bioactive compounds, a very few data is available on the nutritional composition of wild and commercial mushrooms of Pakistan. Therefore, the revalorization of food material is an important strategy to improve the diversity of available foods and their composition, to facilitate health intervention research and programming, which is receiving the focus of renewed attention today (Burlingame et al., 2009). Prior to the extraction, the mushroom species were analyzed for their proximate composition. The data obtained from proximate analysis is assembled in Table 4.1. Table 4.1. Proximate composition of selected mushrooms (% DW) Mushrooms Crude Crude Fiber Carbohydrate Energy Ash Protein Fat Kcal/100g L. edodes 22.61±.02b 0.78±.01a 9.38±.03a 70.62±.03b 374.30±.02b 5.99±.02b H. erinaceus 18.80±.02a 2.01±.01d 7.10±.05a 76.50±.02c 386.30±.02c 7.51±.02c P. ostreatus 21.14±.04b 2.02±.02d 6.11±.02a 69.86±.02a 378.51±.02b 7.02±.04c V. volvacea 24.12±.03d 0.67±.02a 9.33±.03a 65.34±.03a 363.80±.03a 9.09±.04d Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary (p<0.05) with 95% confidence

The above data showed that crude protein contents in selected commercial exotic and local mushrooms were in the range of 18 to 24%. V. volvacea was observed to have a highest protein contents followed by L. edodes, P. ostreatus and H. erinaceus on dry weight basis. The results of the present investigation were in line with Wang et al., (2014). Ouzouni et al. (2009) reported protein contents of C. cibarius 21.57 and A. caesaria 34.77% respectively, however the contents are lower than those reported for C. cibarius and L. nuda 54% and 59% respectively (Barros et al., 2008). According to Hung and Nhi, (2012) protein contents of the V. volvacea were 36.5% which were the highest following by the P. ostreatus (28.6%), L. edodes (26.3%), G. lucidum (13.3%) on dry weight basis. Analysis of crude fat in selected mushrooms species ranges from 0.67% to 2.02% (Table 4.1), crude fat contents were recorded similar in P. ostreatus and H. erinaceus, whereas V. 62

Chapter # 4 Results and Discussion volvacea showed low fat contents. Crude fat contents of mushrooms are usually low and ranges from 1.0% to 6.7% for certain Chinese and Croatian species (Beluhan and Ranogajec 2011; Wang et al., 2014). While A. mellea contains 2.10% and H. russula contain 6.0% fat (Ouzouni et al., 2009). The fiber contents for the selected mushrooms were observed in the range of 6.11-9.38% (Table 4.1). Some mushrooms were established to be low in crude fiber e.g. C. aureus and S. aspratus values were 5% on dry weight basis while for many others up to 40% was reported (Wang et al., 2014). Crude fibers varied from 5.43-17.44% in 10 mushroom species collected from Azad Jammu and Kashmir (Sabir et al., 2003). Total carbohydrates varied in a range of 65.34% to 76.50% on dry weight basis in selected commercial mushrooms. The higest %age was observed in H. erinaceus and lowest was observed in V. volvacea. The carbohydrate contents of V. volvacea, P. ostreatus and L. edodes were found higher in current study as compared to results of Hung and Nhi (2012) on same species. Mushrooms are foods with a very moderate energy values most providing around 363–386 kcal/100 g. Calorie value was found to be highest in H. erinaceus (386.30 kcal/100g) and lowest in V. volvacea (363.5 kcal/100g). Mushrooms are regarded as low calorie foods, this low calorie value is attributable to the contents of high fiber, low fat, no cholesterol and no free fatty acids in mushrooms. Our results are in line with Manjunathan et al. (2011). Total ash in the tested mushrooms was highest in the V. volvacea (9.09%), the ash contents of P. ostreatus and H.erinaceus were 7.02% and 7.51% respectively (Table 4.1). Our results are also comparable with the ash contents (10%) of four edible mushrooms collected from Nigeria by Adejumo and Awosanya (2005). In another report of Hung and Nhi (2012) the ash contents of five edible Vietnamese mushrooms (P. ostreatus, V. volvacea, L. edodes, A. polytricha and G. lucidum) were ranged from 1.4% to 9.0% on dryweight basis, which are not significantly different from our findings in this study. 4.2.1. Proximate composition of wild G. lucidum The wild G. lucidum was also analyzed for proximate analysis. Our findings depict that the selected mushroom contained 82.47% carbohydrate which was found similar with the study of Hung and Nhi (2012). Crude protein was present at 15.4%, low ash contents (2.01%) and low fat contents (0.53%) were obserd in G. lucidum (Fig 4.4).

63

Chapter # 4 Results and Discussion

100 82.47 80 54.12 60 % DW 40 15.04 20 0.53 2.01 0 CP (%) C. Fat (%) C. Fib. (%) Carb. (%) Ash (%) G. lucidum

Fig 4.4. Proximate composition of wild G. lucidum (% DW) Our results for crude protein, fat and ash were lower when compared with five wild mushrooms collected from south west China by Liu et al., (2012) but carbohydrate contents were higher in our studied mushrooms. Calorie value in G. lucidum was found 394.8 kcal/100 g. Study of Kalac (2009) also indicated that low dry matter and low fat contents result in the low energy value of mushrooms (Heleno et al., 2009). G. lucidum contained ash 1.8%, 26–28% carbohydrate, 7–8% crude protein, 3-5% crude fat, 59% crude fiber, reflecting that G. lucidum has high fiber contents but low level of lipids and low calorie value (Mau et al., 2001). In this study, we found that the contents of crude proteins, fats, carbohydrates, dietary fibers, total ash and calorie values were in approximate ranges with each other and with the values as reported in previous studies. But these values were significant in local cultivated mushrooms as compared to the exotic species. These values may differ due to different environment, drying method, substrate and species of mushrooms. 4.3. Protein determination from selected mushrooms Mushroom protein is considered to have higher nutritional quality than that of plant proteins (FAO, 1991). The protein contents of mushrooms not only dependent on environmental factors and stage of fruiting body, but also on species (Colak and Sesli, 2009). The results for protein contents of selected mushrooms by Bradford method are depicted in Table 4.2. The Bradford protein assay is a spectrophotometric analytical procedure which is used to measure the concentration of protein in a solution. It is subjective on the amino acid composition of the measured proteins. The protein concentration of mushrooms is depicted in Table 4.2. V. volvacea showed maximum concentration of the protein 182.06 mg/g followed

64

Chapter # 4 Results and Discussion by H. erinaceus, L. edodes and P. ostreatus whereas the wild G. lucidum had 50.72 mg/g of protein. Table 4.2. Quantification of soluble proteins from different whole mushrooms powder by Bradford method Sr. No. Mushrooms mg/g 1 Lentinus edodes 48.09±0.3 3 Hericium erinaceus 52.38±0.2 2 Pleurotus ostreatus 44.84±0.7 4 Volvariella volvacea 182.06±0.6 n=3±Standar deviation This analysis also revealed that local V. volvacea had high concentration of soluble protein as compared to other selected mushrooms. 4.4. Mineral profile of selected mushrooms Mushrooms are able to assimilate and accumulate large amounts of both macro and micro elements in their fruiting bodies; which are essential to fungi and their consumers (Rabinovich, et al., 2007; Silva et al., 2010 Assunção et al., 2012). Mushrooms can also bioaccumulate toxic elements such as As, Hg, Cd and Pb, whereas Potassium (K) and phosphorus (P) are usually very high elements in fruiting bodies, followed by Ca, Mg, Na and Fe (Falandysz et al., 2012). The essential macro-nutrient minerals are Mg, K, Na and Ca and known essential micro-nutrient minerals are Fe, Zn, Se, Mn, Cu, Co, Cr and Mo (McDowell, 2003; Koyyalamudi et al., 2013). The Functions of the macro-nutrient minerals are to maintain acid-base balance, the osmotic regulation of fluid and oxygen transport in the body (Tomkins, 2002; Keen et al., 2004). The micro-nutrient minerals (Se, Zn, Mo, Fe, V, Cu, Co and Cr) play an important role in the catalytic processes within the enzyme system that includes a wide range of enzyme activities associated with the metabolic, endocrine and immune systems. These micro/micro-elements are essential but can be toxic when taken in excess (Koyyalamudi et al., 2013). Metals such as aluminum, cadmium and lead are found throughout the environment and are present virtually in all foods at the extremely low levels (Demirel et al., 2008). The ingestion of heavy metals (Cd, Ni, Pb) can cause depletion of some essential nutrients in the body which in turn causes a decrease in immunological defenses, intra-uterine growth retardation, psychosocial dysfunctions, disabilities associated

65

Chapter # 4 Results and Discussion with malnutrition and a high prevalence of upper gastro-intestinal cancer (Akinyele and Shokunbi, 2015). The results obtained from mineral analysis of selected mushrooms are presented in Table 4.3. Table 4.3. Mineral analysis (mg/100g) of selected mushrooms by ICP-OES Minerals Abbrev. L. edodes H. erinaceus P. ostreatus V. volvacea Aluminum Al 2.820±0.003a 2.501±0.001a 3.310±0.001b 5.10±0.001c Boron B 2.430±0.001c 0.601±0.001a 3.050±0.001c 0.40±0.001a Barium Ba Nd Nd Nd Nd Beryllium Be Nd Nd Nd Nd Calcium Ca 12.106±0.01a 11.002±0.02a 61.33±0.001c 32.80±0.03b Copper Cu 1.101±0.001a 0.900±0.00a 1.420±0.001c 1.90±0.001d Cadmium Cd Nd Nd Nd Nd Cobalt Co Nd Nd Nd Nd Iron Fe 6.901±0.003a 11.200±0.008c 10.20±0.001c 17.70±0.001d Lithium Li 0.202±0.01a 0.900±0.000c 0.80±0.001c 1.40±0.001d Magnesium Mg 102.01±0.10b 75.810±0.001a 125.40±0.001c 145.60±0.02d Manganese Mn 1.30±0.007d 0.80±0.02c 0.4±0.00a 0.6±0.001b Sodium Na 16.810±0.03a 32.000±0.010a 395.80±0.070d 42.10±0.020a Zinc Zn 6.710±0.005c 3.410±0.002b 4.600±0.001b 7.50±0.001d Phosphorous P 867.40±1.30b 770.80±1.020a 833.00±0.200b 1221.01±0.2d Lead Pb Nd Nd Nd Nd Potassium K 2174.08±1.2c 2912.3±0.010d 2395.04±0.50c 3547.01±1.2d Antimony Sb Nd Nd Nd Nd Arsenic As Nd Nd Nd Nd Molybdenum Mo Nd Nd Nd Nd Selenium Se Nd Nd Nd Nd Arsenic Sn Nd Nd Nd Nd Values are mean ± SD of carefully conducted triplicate experiments as mg/100 g, Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidence, Nd- for not detected. The above table is showing the overview of the values of minerals composition and it is important to be noted that all selected mushroom species are rich source of Fe, Mg, Na, Zn, Ca, P and K. Aluminium contents of the studied mushrooms were observed in the range of 2.5-5.10 mg/100 g. Among these four selected species of mushrooms V. volvacea proved to be relatively richer in concentrations of K, P, Mg, Fe and Zn (Table 4.3). These values were in good agreement with some of the previous reports on mineral contents of mushrooms (Adejumo and Awosanya, 2005; Mallikarjuna et al., 2013). In our study Pb, Cd, As, Sb, Mo, Sn, Se, Be and Ba were below detection levels and can be compared with the results of

66

Chapter # 4 Results and Discussion

Vieira et al. (2013) and Falandysz (2008) that the cultivated mushrooms A. bisporus, P. ostreatus and L. edodes are usually relatively poor in Se. Some recent reports on trace elements like Cr, Ni, Li, Sr and Sb in mushrooms from China also support our findings that these trace elements are present in low amount (Xu et al., 2012; Zhang et al., 2012). Statistical analysis revealed that Na is significantly high in P. ostreatus, whereas P, K and Fe are more prevalent in V. volvacea. It is concluded that the selected local and exotic mushrooms may supply a great deal of both macro and micro nutrients especially the local cultivated P. ostreatus and V. volvacea mushrooms are more affluent in mineral supplying. 4.4.1. Mineral analysis of wild G. lucidum by ICP-OES Fig 4.5 presents the results of mineral composition of G. lucidum. Mean values of contents of minerals were in the order: K > P > Ca > Mg > Na > Fe > Al > B > Zn > Cu > Li. Potassium was the most abundant mineral (742.1 mg/ 100 g), whereas Na was found in low amount (20.5 mg/100 g). This agrees with the previous report of Liu et al., (2012) that the potassium was observed in the range of 16-36 mg/g in five species of wild mushrooms.

800 742.1 700 600

502.5

500 g DW g

400 300 200 mg/100 109.2 89.1 100 8.001 6.001 1.2 12.1 0.2 1.1 20.5 2.2 0 Al B Ca Cu Fe Li Mg Mn Na Zn P K Minerals

Fig 4.5. Mineral profile (mg/100 g) of wild G. lucidum by ICP-OES The contents of Ca and Mg were also observed in significant amounts. Li, Cu, Mn and Zn were present in low concentrations. Pb, Cd, As, Sb, Mo, Sn, Se, Be and Ba were also analyzed in wild G. lucidum that were below detection levels. It was concluded that this wild mushroom is wealthier source of functional elements especially potassium and phosphorous and safe for consumption from its investigated region.

67

Chapter # 4 Results and Discussion

4.5. Analysis of micro/ macro elements of commercial mushrooms by LIBS Laser-induced breakdown spectroscopy (LIBS) enables to obtain the atomic emission spectrum of a sample (solid, liquid or gas) from which qualitative and quantitative information of the sample can be derived through an adapted spectra processing (Miziolek et al., 2006).

(a) (b)

(c) (d) Fig 4.6. Spectra of mineral contents by laser induced breakdown spectroscopy (a) L. edodes (b) P. ostreatus (c) H. erinaceus (d) V. volvacea A very common application of LIBS is measurement of concentration of a specie or analyte present in a sample from the intensity of a related spectral line. In the process of element identification, spectral information of the sample such as atomic emission wavelengths, intensities of the adjacent emission lines and line shapes were gathered to search for

68

Chapter # 4 Results and Discussion correspondence between elements and their specific spectral lines (Cremers and Radziemski 2006).

Table 4.4. Mineral contents of selected mushrooms by Laser Induced Breakdown Spectroscopy (LIBS) Mushroom Absorbance (nm) Element Name

393.3347 Sc I Scandium 500.5300 Co II Cobalt L. edodes 567.8823 Pd I Palladium 589.0394 C II Carbon 656.3798 Mn II Manganese 399.4944 Ti II Titanium

500.4624 Ir I Iradium H. erinaceus 567.8317 Ca I Calcium 656.3358 Xe II Xenon 746.91808 V I Vanadium 399.5694 Ti II Titanium 500.2598 N II Nitrogen P. ostreatus 567.9128 Zn I Zinc 656.3998 Mn II Manganese 746.8646 N I Nitrogen 388.2786 Ti I Titanium 493.4077 Ba II Barium V. volvacea 563.5761 Ca I Calcium 588.9695 C II Carbon 656.2718 H I Hydrogen I*= atomic, II*= ionic

4.5.1. Analysis of micro/ macro-elements of G. lucidum by LIBS G. lucidum was analyzed by LIBS. Fig 4.7 shows the spectrum of G. lucidum.

69

Chapter # 4 Results and Discussion

Fig. 4.7. Spectrum of mineral contents of G. lucidum by laser induced breakdown spectroscopy The spectrum of G. lucidum shows the spectral lines for titanium, copper, xenon, iodine and nitrogen. Table 4.5. Mineral contents of G. lucidum by Laser Induced Breakdown Spectroscopy (LIBS) Mushroom Absorbance (nm) Element Name

388.2786 Ti I Titanium 500.3274 Cu II Copper G. lucidum 567.8008 I II Iodine 656.3358 Xe II Xenon 786.8646 N I Nitrogen I*= atomic, II*= ionic

LIBS analysis also revealed that the selected commercial local, exotic and wild mushrooms are good source of Ca, iodine, Mn and Zn. 4.6. Amino acid analysis of selected commercial mushrooms Edible mushrooms are valuable in improving the nutritive provision of diet when they are consumed as a vegetable in daily life (Kıvrak et al., 2014). Considerable amount of essential and non-essential amino acids are present in mushroom proteins (Heleno et al., 2009). Hence, the ratio of essential amino acids (EAA) to total amino acids (TAA) gives an idea on the nutritional quality of proteins in foods (Wang et al., 2014). Our results of amino acid analysis showed that mushroom protein is an affluent source of nutritionally functional essential and non-essential amino acids. A total of seventeen amino acids (nine essential and eight nonessential) were detected and quantified by amino acid analyzer. Lysine ranges from 4.60-24.92, histidine 0.13-0.80, threonine 0.44-10.61, valine 2.11-3.52 and methionine 0.56- 2.45 mg/100 g on dry weight basis. Lysine was present in high concentration in P. ostreatus,

70

Chapter # 4 Results and Discussion threonine and valine in V. volvacea, whereas histidine, methionine and phenylalanin were observed at high levels in L. edodes. Leucine was present approximately in same range in L. edodes and V. volvacea (6.17 and 6.15 mg/100 g). Tryptophan was not detected in the selected studied mushrooms whereas isoleucine was not observed in H. erinaceus. The results are summarized in Tables 4.6-7. Table 4.6. Essential amino acid profile of selected commercial mushrooms (mg/100 g) by amino acid analyzer

Amino acids Abbr. L. edodes H. erinaceus P. ostreatus V. volvacea

a c d b Lysine Lys 4.60±0.03 17.57±0.02 24.92±0.11 9.34±0.01 d a b a Histidine His 0.80±0.10 0.18±0.13 0.22±0.02 0.13±0.30 a a a d Threonine Thr 0.67±0.05 0.72±0.22 0.44±0.05 10.61±0.02 b c b d Valine Val 2.11±0.70 2.92±0.02 2.58±0.06 3.52±0.12 d a b b Methionine Met 2.45±0.09 0.56±0.20 1.89±0.23 1.83±0.4 c d d Isoleucine Ile 2.12±0.02 Nd 2.43±0.15 2.43±0.13 c b b d Leucine Leu 6.17±0.50 4.03±0.10 4.32±0.10 6.15±0.60 c a b b Phenylalanin Phe 3.10±0.02 1.24±0.09 2.50±0.07 2.84±0.10 Tryptophan Trp Nd Nd Nd Nd Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidenceNd=not detected

Glutamine, proline, glycine, and alanine were the most abundant non-essential amino acids detected in the analyzed mushrooms. Glutamine (27.57), aspratate (10.6), arginine (4.60), and tyrosine (3.68 mg/100 g) were there in significant amount in P. ostreatus. V. volvacea contain proline 23.30, cystine 4.41 and alanine 13.4 mg/100 g in elevated concentrations. In another study of Kıvrak et al. (2014) eighteen free amino acids were examined in C. gigantean mushroom and all the essential and non-essential amino acids were detected with the exception of cystein. Lee et al. (2011) analyzed A. chaxingu an edible mushroom for amino acid composition, the fruiting body contained leucine 0.61 g/100 g of edible weight, while those of P. ostreatus and F. velutipes contained leucine 0.53 g and 0.38 g/100 g of edible weight respectively, while glutamate ranged from 1.00-1.20 g/100 g of edible weight.

71

Chapter # 4 Results and Discussion

Table 4.7. Non-essential amino acids profile of selected commercial cultivated mushrooms (mg/100 g) by amino acid analyzer

Amino Acids Abbr. L. edodes H. erinaceus P. ostreatus V. volvacea

b b d a Glutamine Glu 11.4±0.20 11.10±0.05 27.57±0.18 3.48±0.20 d c cd a Serine Ser 2.72±0.13 2.07±0.02 2.61±0.70 0.42±0.10 d b d a Aspartate Asp 4.52±0.10 4.53±0.08 10.6±0.02 0.89±0.02 b c a d Proline Pro 11.62±0.05 16.00±0.09 3.66±0.05 23.30±0.13 d b b b Glycine Gly 24.96±0.09 11.70±0.19 11.03±0.02 11.50±0.07 d a d d Alanine Ala 12.26±0.03 7.15±0.03 12.10±0.10 13.4±0.10 b a c d Cysteine Cys 3.08±0.01 1.73±0.40 3.48±0.02 4.41±0.03 a b d d Tyrosine Tyr 0.70±0.08 1.83±0.10 3.68±0.05 3.04±0.20 c a d b Arginine Arg 3.27±0.03 1.44±0.08 4.60±0.40 2.62±0.06 Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidence

4.6.1. Amino acid analysis of G. lucidum A total of nineteen amino acids were examined in G. lucidum. Essential amino acids lysine, histidine, threonine, valine, methionine, isoleucine, leucine, and phenylalanine with the exception of tryptophan and non essential amino acid glutamine, serine, aspartate, proline, glycine, alanine, cysteine, tyrosine and arginine were detected. The results are summarized in Table 4.8. Our findings are consistent with the previous report in which sixteen amino acids except isoleucine were identified in the Tanzanian wild mushroom (Mdachi et al., 2004). Mau et al. (2001) analyzed G. lucidum for amino acid composition. A total of fifteen amino acids were detected except glycine, all the essential amino acids were detected including Leu, Ile, His, Phe, Thr, Lys and Try. From this part of study it is evident that the nutritional value of commercial cultivated and wild mushrooms are comparable with mushrooms reported in the literature and the variation in nutritional components may be due to different environment, growing conditions, and species of mushrooms.

72

Chapter # 4 Results and Discussion

Table 4.8. Essential and non-essential amino acid profile of wild G. lucidum (mg/100 g) by amino acid analyzer Essential amino acids

Lys His Thr Val Met Ile Leu Phe Try

3.34±0.02 0.10±0.50 0.03±0.2 1.76±0.40 1.04±0.22 1.17±0.90 3.61±0.07 3.52±1.02 Nd

Non essential amino acids

Glu Ser Asp Pro Gly Ala Cys Tyr Arg

0.48±0.09 1.22±0.2 0.09±0.40 4.58±0.07 7.14±0.02 9.01±0.12 3.1±0.08 2.31±0.20 1.3±0.03 Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidence Nd=not detected 4.7. Extraction of selected mushrooms 4.7.1. Ethanol based extract yields (%) and their fractions with different solvents Biologically active molecules and antioxidants extraction require the use of solvents of various polarities. Some antioxidant compounds are better soluble in polar solvents such as dichloromethane and ethyl acetate (Less polar and polar flavonoids, tannins and terpenoides) and water (phenolic acid, polar flavonoids, glycosides and alkaloids) while n-hexane is preferred for the isolation of lipophilic compounds (Kaul, 1985). Two approaches are mainly used for the isolation of various compounds from the biological material, 1st one is the parallel extraction of initial material with different solvents, and the 2nd one is the sequential fractionation with solvents of ascending polarity.

100 L. edodes P. ostreatus 0 H. erinaceus V. volvacea G. lucidum

Fig 4.8. The % age yield (w/w) of mushrooms in different solvents

73

Chapter # 4 Results and Discussion

The later technique was used in the current study; first the whole mushrooms powder was extracted with 80% ethanol then fractioned with non polar n- hexane followed by polar dichloromethane, ethyl acetate and water. It is clear that from the point of view of their solubility the mushrooms are composed of different classes of substances. Yield results for mushroom extraction showed that the percentage yield (w/w) of L. edodes extract and fractions was found in the range of 10-73 g/100g, for P. ostreatus 11-71 g/100 g, for H. erinaceus 10-69 g/100 g, for V. volvacea it is 10-70 g/100 g and for G. lucidum 8-65 g/100 g of dry mushrooms. The maximum yield was observed in water fraction then in n-hexane followed by dichloromethane and the minimum yield was observed for ethyl acetate fraction (Kitzberger et al., 2007). For comparison with previously reported methanol and ethanol yields, extracts of P. ostreatus were 16.9% and 12.01% respectively (Arbaayah and Kalsom, 2013). Sequential extraction of A. bisporus with n- hexane, ethylacetate and aqueous methanol was also applied previously and the yields were 0.68%, 0.65% and 5.84% respectively (Ozturk et al., 2011; Smolskaite et al., 2015). 4.8. Antimicrobial potential of selected mushrooms Since their discovery in 20th century, antibiotic agents have been largely and extensively effective against diseases. Currently, multi-drug resistant pathogens offer an increased global challenge to both human and veterinary medicine. So, it is now extensively accepted that there is a need to develop novel antimicrobial agents to minimize the threat of further antimicrobial resistance in human and animals (Hearstet al., 2009). Lenthionine, a sulphur containing peptide from L. edodes (shiitake) has antibacterial and antifungal activity and bis [(methylsulfonyl) methyl] disulphidea derivative of lenthionine, has strong inhibitory effects against Staphylococcus aureus, Bacillus subtilis and Escherichia coli (Yasumoto et al., 1971). Such an approach may thus be used to examine the antimicrobial properties of mushrooms, as novel sources of such agents, as well as the employment of such novel compounds limit the use of conventional antibiotics. Keeping this in mind, this study was conducted to examine the antimicrobial potential of selected commercial and wild mushrooms as a novel source of such agents.

74

Chapter # 4 Results and Discussion

4.8.1. Antimicrobial activity of selected mushrooms by disc diffusion method Preliminary screening of antimicrobial properties of mushrooms fractions was tested against four bacterial species E. coli, P. multocida, B. subtilis and S. aureus and four fungal species A. niger, A. flavus, F. solani and H. maydis. Our data quantitatively showed that the mushrooms had moderate antimicrobial activities against these selected microorganisms. The mushrooms fractions gave zone of inhibition ranging from 9-16 mm against selected bacteria. The maximum activities were observed in ethyl acetate and water fractions (16 mm) against P. multocida and S. aureus as compared to dichloromethane and n-hexane fractions. The order of antibacterial activities of different fractions were observed as ethyl acetate > water > dichloromethane > n. hexane. The significant activity was shown by the fractions against P. multocida followed by S. aureus, E. coli, and B. subtilis. n-hexane fractions showed the weakes inhibitory activity for all selected microbial species (Fig 4.9).

20

15 n-hexane Dichloromethane 10 Ethyl acetate 5 Water

Zone Zone of inhibition (mm) 0 E. coli P. multocida B. subtilis S. aureus

(a)

20 )

15

10 n-hexane Dichloromethane 5 Ethyl acetate Water

Zone Zone of inhibition (mm 0 E. coli P. multocida B. subtilis S. aureus

75

Chapter # 4 Results and Discussion

(b)

20

15 n-hexane Dichloromethane 10

Ethyl acetate of inhibition inhibition of (mm) 5 Water

Zone Zone 0 E. coli P. multocida B. subtilis S. aureus

(c)

) 20 n-hexane 15 Dichloromethane Ethyl acetate 10 Water

5 Zone Zone of inhibition (mm 0 E. coli P. multocida B. subtilis S. aureus (d) Fig 4.9. Antibacterial activities of selected mushrooms’ fractions by disc diffusion method (a) L. edodes, (b) P. ostreatus, (c) H. erinaceus, (d) V. volvacea

Our results can be compared with the Hearst et al., (2009), who tested exotic L. edodes and P. ostreatus aqueous extracts qualitatively against 29 bacterial and 10 fungal species and the extracts showed extensive antimicrobial activity against 85% of the organisms in the trial. Smolskaite et al. (2015) screened antimicrobial properties of mushrooms extracts sequentially isolated by cyclohexane dichloromethane, methanol and water from eight mushrooms species. It was observed that the fractions isolated from I. hispidus obsessed antimicrobial activity against two bacterial and one yeast species, the fractions of P. schweinitzii inhibited tested microorganism, methanol fractions showed the largest zone of inhibition ranging from 15-17 mm against P. aeruginosa and B. cereus.

76

Chapter # 4 Results and Discussion

20

n-hexane 15

Dichloromethane

(mm)

10 Ethyl acetate Water 5

0

Zone Zone inhibition of A. niger A. flavus F. solani H. maydis

(a)

20

15 n-hexane 10 Dichloromethane 5 Ethyl acetate Water 0 Zone of inhibition (mm) inhibitionof Zone A. niger A. flavus F. solani H. maydis

(b)

20

15 n-hexane 10 Dichloromethane

5 Ethyl acetate of inhibition (mm) inhibitionof Water 0

Zone A. niger A. flavus F. solani H. maydis

(c)

20 n-hexane 15 Dichloromethane 10 Ethyl acetate Water 5

Zone of inhibition (mm) inhibitionof Zone 0 A. niger A. flavus F. solani H. maydis (d) Fig 4.10. Antifungal activities of selected mushrooms’ fractions by disc diffusion method (a) L. edodes, (b) P. ostreatus, (c) H. erinaceus, (d) V. volvacea

77

Chapter # 4 Results and Discussion

When these fractions were tested against fungal species, moderate activity was observed with the zone of inhibition in the range of 9-14 mm. The maximum antifungal activity was observed by ethyl acetate fractions of H. erinaceus and P. ostreatus (14 mm) against F. solani, poor activities were observed against A. flavus and A. niger. Overall, the trivial antimicrobial activity was shown by n- hexane fractions against selected microbes. Refampicin and fluconazol were used as positive controls for bacterial and fungal species respectively. The order of antimicrobial activity of selected mushrooms was H. erinaceus > V. volvacea > P. ostreatus > L. edodes. 4.8.2. Antimicrobial activity of wild G. lucidum by disc diffusion The G. lucidum fractions also demonstrated antibacterial activity against the selected bacterial species with zone of inhibition ranges from (9-15mm) is shown in Fig 4.11. The maximum activity was shown by dichloromethane fraction against P. multocida (15 mm)

followed by ethyl acetate against B.subtilis and E. coli (14 mm).

20

15 n-hexane 10 Dicloromethane Ethyl acetate

of inhibition inhibition of (mm) 5 Water

0 Zone E. coli P. multocida B. subtilis S. aureus

(a)

20

15 n-hexane

10 Dicloromethane Ethyl acetate

5 Water

of inhibition inhibition of (mm)

0

Zone A. niger A. flavus F. solani H. maydis

(b) Fig 4.11. Antibacterial (a) and antifungal (b) activities of G. lucidum fractions by disc diffusion method

78

Chapter # 4 Results and Discussion

These fractions were tested against fungal species, poor activity was observed with maximum zone of inhibition 12 mm against A. flavus and F. solani by water fractions. Nowacka et al. (2014) investigated nineteen polished wild edible mushrooms; the results showed that mushrooms extracts possess moderate antimicrobial activity. B. subtilis and P. aeruginosa were quite sensitive to mushrooms extracts, no significant difference was observed against Gram positive and Gram negative bacteria. Here it is concluded that the ethyl acetate, dichloromethane and water fractions showed better results. The exotic mushrooms showed more potential against selected microbes as compared to the local cultivated mushrooms. 4.8.3. Minimum Inhibitory Concentration (MIC) of selected mushrooms The prevalence of infectious diseases is becoming a worldwide problem; antimicrobial drugs have long been used for prophylactic and therapeutic purposes, but the drug-resistant bacterial strains have creating serious treatment problems (Klein et al., 2007; Steinkraus et al., 2007). Trindade et al. (2009) reported that bacteria develop resistance to antibiotics through genome mutations that are crucial for their survival. Therefore, despite the impossibility to avoid bacterial evolution, it is important to choose the most adequate antibiotics to control such evolution in favour of human host. Natural resources have been exploited in last few years and among them mushrooms could be an alternative source of new antimicrobials (Alves et al., 2012). Microdilution assay was performed to measure the MIC values of the fractions that showed antimicrobial activities by disc diffusion method. Minimum inhibitory concentration (MIC) was evaluated by diluting the fractions. As measuring the MIC is the important indicator of antimicrobial activity; the lowest MIC values were observed for ethyl acetate and water fractions. Most MIC values were ranging from 294-580 µg/mL. The minimum inhibitory concentrations were also observed in ethyl acetate and water fractions against P. multocida and S. aureus (Table 4.9). The maximum values were observed against E. coli and B. subtilis. L. edodes and H. erinaceus showed better results against selected bacterial species as compared to the local cultivated mushrooms.

79

Chapter # 4 Results and Discussion

Table 4.9. Minimum inhibitory concentration (µg/mL) of selected mushrooms against bacterial species (Mean ± SD) Mushrooms Solvents E. coli P. multocida B. subtilis S. aureus n-hexane - 348±0.74 330±0.44 - Dichloromethane 526±0.26 527±0.36 - 330±0.46 L. edodes Ethyl acetate 348±0.71 317±1.1 526±0.86 526±0.33 Water - 330±0.46 580±0.48 - n-hexane 330±1.2 306±0.71 - - Dichloromethane 525±0.39 318±0.9 332±0.58 550±0.48 H. erinaceus Ethyl acetate 306±0.9 296±1.6 301±1.4 348±0.68 Water 546±0.83 524±0.70 294±0.27 546±0.83 n-hexane 307±0.46 - - 332±1.2 Dichloromethane - 526±0.47 305±0.47 317±0.56 P. ostreatus Ethyl acetate 295±0.86 302±0.53 306±0.71 348±0.43 Water 306±0.46 349±0.26 - 330±0.92 n-hexane 544±0.67 - 348±1.05 526±0.34 Dichloromethane 342±0.48 306±0.41 - 525±0.40 V. volvacea Ethyl acetate 306±0.72 296±0.8 526±0.43 306±0.78 Water 524± 0.3 548±0.56 520±0.90 308±0.93 n-hexane Ethyl acetate Dichloromethane Water +ive control Rifampicin 112±0.47 196±0.27 84±0.54 201±0.46 E. coli= Escherchia coli, P. multocida= Pasteurella multocida, S. aureus= Staphylococcus aureus, B. subtilis= Bacillus subtilis. Results are expressed as n=3, means±standard deviation Ethyl acetate fractions of H. erinaceus and V. volvacea showed low Minimum inhibitory concentration of 296±1.6 mg/mL against P. multocida. Water fraction of H. erinaceus also showed lowest MIC value of 294 mg/mL against B. subtilis. When determined against fungal species the MIC values were in the range of 295-660 µg/mL and the maximum values were observed against H. Maydis by P. ostreatus and lower values were observed for H. erinaceus against A. niger ranges from 306-480 µg/mL. The results are presented in Table 4.10. In a previous study the MIC values for P. ostreatus ethanolic extracts were 1.25 mg/mL against C. albicans, 2.5-20 mg/mL against P. aeruginosa, 2.5-12.5 mg/mL against B. cereus (Vamanu, 2012). MIC values for C. sinensis against B. subtilis were determined as 938 μg/ mL and for both C. sinensis and P. australis against S. epidermidis was 469 μg/mL (Ren et al., 2014).

80

Chapter # 4 Results and Discussion

Table 4.10. Minimum inhibitory concentration (µg/mL) of selected mushrooms against fungal species (Mean ± SD) Mushrooms Fractions A. niger A. flavus F. solani H. maydis n-hexane 526±0.71 526±0.56 - 548±0.67 Dichloromethane 548±0.37 526±0.44 486±0.73 - L. edodes Ethyl acetate - 308±0.58 302±0.6 526±0.53 Water 580±1.4 546±0.74 525±0.74 - n-hexane 306±0.36 - 526±0.9 306±0.58 Dichloromethane 306±0.48 302±1.0 548±1.2 482±0.83 H. erinaceus Ethyl acetate 306±0.63 306±0.45 480±0.41 295±0.41 Water 480±0.46 - 306±0.53 520±0.92 n-hexane 524±1.1 - 306±0.38 317±0.45 Dichloromethane 548±0.49 524±1.2 - - P. ostreatus Ethyl acetate 580±0.81 480±0.49 520±0.52 660±0..73 Water - 330±0.84 580±0.36 548±0.48 n-hexane 308±0.82 - 520±0.81 - Dichloromethane 542±0.76 306±0.9 330±0.38 347±0.74 V. volvacea Ethyl acetate 348±0.63 330±0.84 580±0.61 307±0.43 Water - - 307±0.35 327±0.46 Fluconazole n-hexane Dichloromethane Ethyl acetate Water 190±0.34 174±0.45 112±0.34 96±0.47 A. niger= Aspergillus niger, A. flavus= Aspergillus flavus, F. solani= Fusarium solani, H. maydis= Helminthosporium maydis. Results are expressed as n=3, means ± standard deviation; Acetone extract of G. lucidum was most inhibitory against K. pneumonia having MIC values 4.33±0.33 mg/mL, against E. coli 8.17±0.48 mg/mL, against B. subtilis 14.00±0.46 mg/mL and moderate values against S. aureus 19.00±0.00, the highest MIC values were exhibited against Ps. Aeruginosa 21.30±0.34 mg/mL and S. typhi 20.80±0.87 mg/mL (Quereshi et al., 2010). Lower the MIC value more sensitive and promising the extracts. 4.8.4. Minimum inhibitory concentration of wild G. lucidum The MIC values for G. lucidum fractions were observed in the range of 306-548 µg/mL against bacteria, minimum value was observed for dichloromethane and ethyl acetate fraction against E. coli and B.subtilis. G. lucidum fractions showed better result against A. flavus, the MIC values against selected fungal species were observed in the range of 346-580 µg/mL. The results are summarized in Table 4.11.

81

Chapter # 4 Results and Discussion

Table 4.11. Minimum inhibitory concentration (µg/mL) of wild G. lucidum against selected microbes MIC against bacterial species E. coli P. multocida B. subtilis S. aureus n-hexane 348±1.03 - 526±0.56 - G. Dichloromethane - 352±0.67 306±0.43 548±0.51 lucidum Ethyl acetate 306±0.64 526±0.49 548±0.90 526±0.42 Water 526±0.80 - 548±0.41 - Fractions n-hexane Dichloromethane Ethyl Water acetate + ive Rifampicin 112±0.47 196±0.27 84±0.54 201±0.46 (control) MIC against fungal species G. A. niger A. flavus F. solani H. maydis lucidum n-hexane 348±0.91 580±0.6 329±0.54 - Dichloromethane - 578±0.94 - - Ethyl acetate 626±0.87 346±0.76 - 520±0.63 Water - 416±0.83 346±0.46 - Fractions n-hexane Dichloromethane Ethyl Water acetate +ive (control) Fluconazole 190±0.34 174±0.45 112±0.34 96±0.47 E. coli= Escherchia coli, P. multocida= Pasteurella multocida, S. aureus= Staphylococcus aureus, B. subtilis= Bacillus subtilis A. niger= Aspergillus niger, A. flavus= Aspergillus flavus, F. solani= Fusarium solani, H. maydis= Helminthosporium maydis. Results are expressed as n=3, means ± standard deviation; In an in vitro study a chloroform extract of G. lucidum was investigated for its antibacterial effect on gram-positive bacteria (Bacillus subtilis, Staphylococcus aureus, Enterococcus faecalis) and gram-negative bacteria (E. coli, Pseudomonas aeruginosa). The extract had growth-inhibitory effects on two of the gram-positive bacteria with a minimal inhibitory concentration (MIC) of 8 mg/mL for S. aureus and B. subtilis (Keypour et al. 2008). The aquoues extracts of G. lucidum showed MIC 750 μg/mL against Micrococcus luteus (Ren et al., 2014). It is concluded from the above analysis that all the selected mushrooms extracts exhibited good antimicrobial agents.

82

Chapter # 4 Results and Discussion

4.8.5. Antibacterial potential of mushrooms methanolic and ethanolic extracts Drug-resistance is considered to be a key indicator of problematic bacterial strains because of the failure of available antimicrobials in treating infectious diseases; many researchers have focused on the investigation of natural products as source of new bioactive lead molecules. Determination of antimicrobial activity of mushrooms extracts indicated considerable potential against all selected bacteria revealing zone of inhibition ranged from 6±0.3 to 32±0.3 mm (Table 4.12). Table 4.12. Antibacterial testing of mushroom extracts through determination of zone of inhibition (mm) against the selected bacterial strains Sr No Mushrooms S. aureus E. coli B. subtilis Methanolic extracts 1 G. lucidum 12± 0.2 6±0.7 18±0.1 2 H. erinaceus 8±0.1 10±0.2 20±0.1 3 L. edodes 16±0.3 12±0.1 32±0.3 4 P. ostreatus 14±0.5 6±0.3 28±0.6 5 V. volvacea 13±0.1 16±0.4 30±0.5 Ethanolic extracts 1 G. lucidum 10±0.5 8±0.2 6±0.7 2 H. erinaceus 12±0.3 10±0.8 16±0.4 3 L. edodes 8±0.2 6±0.6 22±0.6 4 P. ostreatus 14±0.8 10±0.3 30±0.2 5 V. volvacea 16±0.3 12±0.2 25±0.4 Rifampicin (Positive 28 25 30 control) Data presented as mean ±SD of three independent replicates

Methanolic extracts of L. edodes showed maximum zone of inhibition (32±0.3) followed by V. volvacea (30±0.5), P. ostreatus (28±0.6), H. erinaceus (20±0.1) and G. lucidum (18±0.1). Methanolic extracts showed excellent inhibition as compared to ethanolic extracts. Ethanolic extract of P. ostreatus showed maximum zone of inhibition (30±0.2) against B. subtilis (Fig 4.12). Selected mushrooms also showed good inhibition against S. aureus with zone of inhibition ranges from (16±0.3- 8±0.2). B. subtilis was found to be the most susceptible to the extracts whereas E. coli was the least. Therefore, the mushrooms extracts showed better activity against Gram positive bacteria (B. subtilis and S. aureus) as compared to Gram negative (E. coli), this might be due that Gram positive bacteria are more susceptible to any

83

Chapter # 4 Results and Discussion antimicrobial agent, such as antibiotics, mushrooms etc. (While the cell wall of gram negative is less susceptible to antimicrobial action due to the presence of interpeptide bridge. The previous studies (Hatvani, 2001; Dulger et al., 2002 ; Gezer et al., 2006; Turkoglu et al., 2006; ) regarding of the antimicrobial activity also showed that Gram-negative bacteria have less susceptibility as compared to Gram-positive strains because of more peptidoglycan in their cell wall.

(a) (b) Fig 4.12. Antibacterial activity of methanol and ethanol extracts of selected mushrooms against B. subtilis by agar well diffusion method Antimicrobial potential of 19 polished wild edible mushrooms was investigated; the results showed that mushrooms extracts possess antimicrobial activity against B. subtilis and P. aeruginosa (Nowacka et al., 2014). Antibacterial action of A. essettei, A. bitorquis and A. bisporus against six species of Gram-positive bacteria, seven species of Gram-negative bacteria and two species of yeast was explored. Inhibition zones of Agaricus species which were obtained against all test microorganisms were in the range of 7–22 mm, extracts were found to be more effective against Gram positive bacteria, especially against M. luteus, M. flavus, B. subtilis and B. cereus (Oztürk et al., 2011). 4.8.6. Biofilm Inhibition The use of natural products has been extremely successful in the discovery of new medicine and rich diversity of different fungal species offers a potential source of new antibiotics. The results showed that all tested mushrooms extracts inhibited bacterial biofilm production against selected microorganism. Among the tested extracts ethanolic extracts of P. ostreatus 84

Chapter # 4 Results and Discussion and methanolic G. lucidum extract showed 65% inhibition of B. subtilis, whereas the least inhibition was shown by L. edodes 35.3%, G. lucidum 36.2% agains E. coil. The results of the present study are summarized in Table 4.13. Table 4.13. Bacterial biofilm inhibition percentage by selected mushrooms extracts

Sr. No. Sample S. aureus E. coli B. subtilis Methanolic extracts 1 G. lucidum 15.1 36.2 65.5 2 H. erinaceus 55.4 26.9 41.1 3 L. edoded 57.7 35.3 61.7 4 P. ostreatus 38.2 41.2 43.9 5 V. volvacea 46.4 46.4 43.4 Ethanolic extracts 6 G. lucidum 32.4 40.8 51.6 7 H. erinaceus 50.5 32.5 40.9 8 L. edoded 37.1 24.2 57.3 9 P. ostreatus 49.3 29.2 69.2 10 V. volvacea 29.2 27.9 39.2 Control 2.491

E. coli with the lowest receptiveness to mushroom extracts inhibitory effect on biofilm production with maximum 46.4% inhibition. P. ostreatus inhibited biofilm production 69.2 % showing the best performance among the all tested extracts. The extracts having the best inhibitory effect upon B. subtilis biofilm formation were L. edoeds (61%), P. ostreatus (69%) and G. lucidum (65%). Our results are in line with the previous study, author‘s studied the five wild mushrooms extracts against four Gram negative bacteria, all the extracts showed some extent of inhibition of biofilm production (Alves et al., 2014).

L. edodes and other edible mushroom extracts could minimize the preformed biofilm of S. mutans and S. saborinus in the presence of dextranase. Author‘s also observed that the α- glucanase activities of L. edodes extract and their effect on biofilm formation. The extracts possessed α-glucanase activity and degrade water insoluble glucans from mutant streptococci. In the presence of dextranase, the extracts inhibited the sucrose dependent formation of biofilm by S. mutant and S. sobrinus (Yano et al., 2010). Results of the present study also suggested that some components of mushrooms inhibit the formation of biofilms.

85

Chapter # 4 Results and Discussion

(a) (b)

(c) (d)

(e) (f)

Fig 4.13. Microscopy results of treated and native biofilm. Inhibitory effect of P. ostreatus extract on the formation of biofilm by (a) Bacillus subtilis (b) Staphylococcus aureus (c) Escherichia coli (d) Positive control (biofilm treated with rifampicin) (e) E.coli control biofilm (f) Bacillus subtilis control biofilm 4.9. Thrombolytic activity of mushrooms extracts and fractions According to the World Health Organization (WHO), cardio-vascular diseases (CVD) (acute myocardial infarction, cerebrovascular disease and peripheral arterial thrombosis) are the causes of approximately 30% of deaths worldwide (Palomo et al., 2012). In normal body process coagulation and fibrinolysis processes are controlled properly. The dysfunction of fibrinolysis process or myocardial or cerebral infarction is a serious consequence of the thrombus formed in blood and thus blockage of blood vessels due to blood clot (fibrin clot) results in vascular disorders such as deep-vein thrombosis, stroke, myocardial infarction and

86

Chapter # 4 Results and Discussion pulmonary embolism (Choi et al., 2014). Thrombolytic agents are used to dissolve the already formed clots in the blood vessels (Ansari et al., 2012). Currently available thrombolytic agents are streptokinase (SK), tissue plasminogen activator (t-PA) and urokinase (UK). They might cause serious bleeding complications along with reinfarction and reoccolution and therefore secure and effective thrombolytic agents that can lyse a blood clot are desirable (Prasad et al., 2006). The use of natural extracts in folk medicine suggests an economic and safe alternative to treat cardiovascular disease and infectious diseases (Mahboubi et al., 2012). Thrombolytic activity of mushrooms extracts and fractions was determined to check the efficacy of natural extracts as thrombolytic agent. Results obtained are summarized in Tables (4.14-4.17). Table 4.14. Thrombolytic activities of selected mushrooms fractions (mg/mL) Mushrooms Fractions % lysis n- hexane 9.8 Dichloromethane 16.9 L. edodes Ethyl acetate 10.8 Water 18.2 n- hexane 11.1 Dichloromethane 12.5 H. erinaceus Ethyl acetate 15.8 Water 20.0 n- hexane 10.6 Dichloromethane 9.1 P. ostreatus Ethyl acetate 11.4 Water 16.7 n- hexane 12.3 Dichloromethane 11.4 V. volvacea Ethyl acetate 14.6 Water 16.7 + ive control Streptokinase 66.7 - ive control Water 0.0

The maximum percentage of clot lysis was shown by H. erinaceus followed by V. volvacea, L. edodes and P. ostreatus (Table 4.14). Water fraction of H. erinaceus showed 20% lysis followed by L. edodes (18%) whereas P. ostreatus and V. volvacea exhibited 16% lysis.

87

Chapter # 4 Results and Discussion

Water fractions, methanolic and ethanolic extracts of the selected mushrooms showed good clot lysis activity. Streptokinase was used as positive control and water as negative control. Table 4.15. Thrombolytic activitis of selected mushrooms ethanolic and methanolic extracts Mushrooms Solvents % lysis L. edodes Methanol 25.0 Ethanol 27.4 P. ostreatus Methanol 19.4 Ethanol 16.1 H. erinaceus Methanol 21.3 Ethanol 27.9 V. volvacea Methanol 20.0 Ethanol 16.2 G. lucidum Methanol 12.8 Ethanol 9.4

The clot lysis percentage for methanolic and ethanolic extracts was in the range from 9-27%, whereas for n-hexane, ethyl acetate, dichloromethane and water fractions it was observed in the range of 3-20% (Table 4.15). As compared to fractions better thrombolytic activities were observed in methanolic and ethanolic extracts. Table 4.16. Thrombolytic activity of G. lucidum Mushroom Fractions % lysis n- hexane 2.7 Dichloromethane 3.8 Ethyl acetate 5.9 G. lucidum Water 13.0 Methanol 12.8 Ethanol 9.4 The results of the thrombolytic activity of G. lucidum depict that water fraction, methanol and ethanol extracts showed good clot lysis activity as compared to other fractions tested. 4.9.1. Effect of concentration, volume and time of incubation of selected mushrooms on thrombolysis The percentage values of clot lysis of mushrooms extracts and fractions were directly proportional to concentrations, time of incubation and amount of extract. The extracts and fraction which showed high percentage lysis were further investigated for kinetic study. The percentage values of clot lysis for L. edodes (ethanol) at concentration of 0.3%, 0.6% and 1% were 13.9, 20.8 and 27.4% respectively, and for H. erinaceus (ethanol) at 0.3%, 0.6% and

88

Chapter # 4 Results and Discussion

1% were 14.04%, 18.4% and 27.1% respectively. The percentage values of clot lysis at different concentrations were ranged from 13-27% showing that percent lysis is directly proportional to concentration and the maximum activity was shown at 1% concentration. Table 4.17. Thrombolytic activities of selected mushroom extracts at varying concentrations, incubation time and volume Mushrooms Conc. (%) %lysis L. edodes 0.3 13.8 (Ethanol) 0.6 20.9 1 27.4 0.3 16.7 H. erinaceus 0.6 18.4 (Ethanol) 1 27.1 Amount (µL) % lysis L. edodes 30 14.3 (Water) 60 16.3 100 18.2 30 7.4 L. edodes 60 12.1 (Dichloromethane) 100 17.6 30 11.1 V. volvacea 60 13.0 (Ethanol) 100 16.9 Time (min) Absorbance (nm) H. erinaceus 30 1.326 (Ethanol) 60 1.874 90 1.953 V. volvacea 30 0.596 60 1.276 (Ethanol) 90 1.568

The percentage values of clot lysis for L. edodes (water) at different amounts of 30, 60 and 100 µL were 14.3%, 16.3% and 18.2% respectively. For L. edodes (dichloromethane) at 30, 60 and 100 µL the values were 7.4%, 12.10% and 17.6% respectively, the percentage of clot lysis at different amounts were ranges from 7-17%. Ethanolic extractsof V. volvacea showed the percentage values of clot lysis 11.11%, 13.04% and 14.9 % at 30, 60 and 100 µL respectively (Table 4.17). Increase in percentage clot lysis was observed by increasing amount of extract. The absorbances for H. erinaceus (ethanol) recorded at different times of incubation at 30, 60 and 90 mins were 1.326, 1.874 and 1.953 nm respectively. The absorbance of clot lysis at each time of incubation differs from each other. In case of V. volvacea (ethanol) the

89

Chapter # 4 Results and Discussion absorbances of clot lysis were 0.596, 1.276 and 1.568 nm respectively at 30, 60 and 90 mins of incubation (Table 4.17). There was an increase in absorbance with increase in incubation time. The average percentage lysis values of natural extracts were close to synthetic compounds.

Fig. 4.14. Thrombolytic activity of mushrooms extracts Upto our knowledge no study has been conducted on thrombolytic potential of these selected mushrooms. This study showed that L. edodes and H. erinaceus extracts have significant thrombolytic activity as compared to the local cultivated mushrooms. Wild G. lucidum also showed moderate thromboltytic potential. 4.10. Antioxidant potential of selected mushrooms The consumption of natural food provides protection against oxidative stress induce diseases. Oxidative stress emerges as a result of reactive oxygen species associated with a change in cellular redox status, in which biological macromolecules (proteins, nucleic acids and lipids) can go thorough oxidative damage causing tissue injury assorted to various diseases such as cancer, coronary heart diseases, neuronal disorders, diabetes and arthritis (Ozyurek et al., 2014). The therapeutic and medicinal potentials of mushrooms are well known because they contain various polyphenolic compounds with ability to scavenge free radicals by single electron transfer (Mishra et al., 2013). So, the dietary antioxidants are supposed to maintain good health as well as important in the management of various diseases (Smolskaite et al., 2015). The total phenolic contents of the analyzed mushrooms were evaluated by Folin-Ciocalteau method and results were expressed as mg of gallic acid equivalents per g of mushrooms fractions. Among the studied species, H. erinaceus and V. volvacea showed the highest phenolic contents followed by P. ostreatus and L. edodes. Water fractions of all the studied 90

Chapter # 4 Results and Discussion mushrooms showed the highest phenolic contents as water is preferable solvent in term of toxicity and availability. Our study showed water might be a useful solvent for the extraction of remaining antioxidants from some mushroom species after applying different solvents of varying polarity. Table 4.18. Antioxidant potential of selected mushrooms fractions Solvents Antioxidants Antioxidant activity

TPC (mg/g) TFC (mg/g) DPPH (EC50) Reducing Power

(mg/g) (Λ max 700 nm) L. edodes n-hexane 0.76 ±.02a 1.103±0.18b 34.00±0.08d 0.50±0.07a Dichloromethane 0.79±0.12 a 0.85±1.00a 29.00±.050c 0.85±0.10b Ethyl acetate 1.87±0.06b 2.54±0.09d 26.00±1.20c 1.98±0.06d Water 2.21±0.05d 1.21±0.07b 11.50±0.07a 1.86±0.08d H. erinaceus n-hexane 0.82±0.18a 0.62±0.20a 24.30±0.25d 0.96±0.02a Dichloromethane 2.69±0.50b 1.83±0.40b 16.50±0.80c 1.04±0.25a Ethyl acetate 5.61±0.10c 2.64±0.10d 11.70±0.50a 1.80±0.42b Water 8.36±1.08d 1.77±0.60c 9.90±0.18a 1.82±0.53d P. ostreatus n-hexane 1.26±0.70 a 1.03±0.15a 46.50±1.40d 0.75±0.05a Dichloromethane 1.94±0.34 a 0.86±0.21a 29.80±1.60c 0.75±0.05a Ethyl acetate 4.70±0.06d 1.52±0.09b 24.70±1.90c 1.57±0.74c Water 5.19±1.01d 2.06±0.24d 13.20±1.20a 1.89±1.15d V. volvacea

n-hexane 1.52±0.40a 0.69±0.17a 23.60±0.30d 0.93±0.65a Dichloromethane 1.97±0.09a 0.66±0.31a 18.20±0.18d 0.61±0.33a Ethyl acetate 5.10±0.70c 1.33±0.09b 7.80±0.20a 1.75±0.74d Water 7.59±1.03d 2.58±0.07d 4.70±0.40a 1.91±0.28d Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidence EC50 (mg/mL) = Effective concentration at which 50 % of the DPPH radicals are scavenged

The n-hexane and dichloromethane fractions were weaker radical scavengers than polar water and ethyl acetate fractions and it is an agreement with many previously published results showing that polar solvent extracts are more antioxidants from botanicals than lower 91

Chapter # 4 Results and Discussion polarity solvents (kang et al, 2003; Brahmi et al., 2012). Thus, the TPC (total phenolic contents) values in all the fractions were present in following decreasing order water > ethyl acetate > dichloromethane > n- hexane (Table 4.18). The total phenolic contents in different fractions of L. edodes were in the range of 0.76-2.21 mg/g, in P. ostreatus 1.26-5.19 mg/g, H. erinaceus 0.82-8.36 mg/g, V. volvacea 1.52-7.59 mg/g. Previously reported TPC in X. chrysenteronwere 36.28±0.5 mg GAE/g extract (methanol/water) by Heleno et al. (2012) is greater than TPC obtained from all the species in our study. However, the difference is reasonable as phenolics may vary depending on cultivar, harvesting time, sample collection, preparation and climatic conditions. Our results are consistent with the finding of Smolskaite et al. (2015) the TPC values in different extracts of commercial mushrooms P. ostreatus and A. bisporous were in the ranges of 4.21-4.64 and 4.26-5.67 mg GAE/g respectively. Jayakumar et al. (2009) investigated ethanolic extract of P. ostreatus and found TPC 5.49 g/100 g. In order to obtain more information about the nature of the phenolic substances present in the mushrooms, total flavonoid contents were also measured the results were expressed as catechin equivalent per g of mushrooms fractions. The total flavonoid contents do not correlate with total phenolic contents and concentration varied depending on the mushroom species. Thus flavonoid contents were highest in P. ostreatus followed by L. edodes, H. erinaceusand V. volvacea. According to report of Sarikurkcu et al. (2015) the flavonoid contents of methanolic extracts of G. clavatus were 0.97 and for L. perlatum 0.90 µg QEs/mg of extract whereas for water extract the flavonoid contents were observed 3.78 µg QEs/mg of extract for L. perlatum. The radical scavenging ability of mushrooms fractions was tested against DPPH, a stable free radical of purple color that generally fades or disappears when an antioxidant is present in the medium with characteristic absorption at 515 nm. As antioxidants donate protons to these radicals the absorbance decreases. This decrease in absorbance is taken as a measure of radical scavenging (Woldegiorgis et al., 2014). The scavenging activity of the DPPH radical due to its reduction by different mushrooms fractions are illustrated in Table 4.18. Among all fractions, water fractions of the studied mushrooms showed the highest activity with lower

EC50 values, the highest radical scavenging activity was shown by V. volvacea followed by H. erinaceus, L.edodes and P. ostreatus. Heleno et al. (2012) reported DPPH scavenging

92

Chapter # 4 Results and Discussion

concentration EC50 of X. chrysentron methanol/water extract was 2.06±0.46 mg/mL. Our results are consistent with EC50 values for P. ostreatus (8.4 mg/mL) and L. edodes (9.8 mg/mL) measured by Woldegiorgis et al. (2014). The radical scavenging ability (RSA) was consistent with the total phenolic contents, the higher TPC the better RSA (Mishra et al., 2013. The antioxidant potential of mushrooms was also considered by reducing power assay. In this assay the yellow color of test solution changes to various shades of green and blue depending on the reducing power of the test compound. The presence of reducing compounds (antioxidants) causes the conversion of Fe+3/ferricyanide complex to the ferrous form. Therefore, by measuring the formation of Perl‘s Prussian blue at 700 nm we can observe Fe+2 concentrations, a higher absorbance indicate a higher reducing power. The reducing power of mushrooms fractions increased with increase in polarity of solvents. At 1 mg/mL the absorbance for reducing power of mushrooms fractions were in the range of 0.524-1.916 nm. The maximum absorbance was observed for water fractions and minimum for n-hexane. Our results are agreed with the study of Sarikurkcu et al. (2015), methanolic extracts of G. clavatus exhibited the highest absorbance value 2.650 nm followed by L. perlatum 1.35 nm, whereas P. sulphereus showed the lowest absorbance 0.69 nm. From the results regarding the reducing power it can be inferred that mushrooms fractions are capable to convert the free radicals to stable products by donating the electrons. Hence, having the great ability to terminate the reactions initiated due to the presence of free radicals. Table 4.19. Antioxidant potential of wild G. lucidum fractions G. lucidum Antioxidants Antioxidant activity

Solvents TPC (mg/g) TFC (mg/g) DPPH (EC50) Reducing Power

(mg/g) (Λ max 700 nm) n-hexane 0.82±0.26b 0.47±0.30a 66.30±0.55d 0.52±0.11a Dichloromethane 0.56±0.11a 0.54±0.19d 39.7±0.30c 0.72±0.13a Ethyl acetate 2.28±0.23c 1.42±0.21c 23.20±0.42b 1.50±0.07d Water 5.39±0.92d 1.82±0.60d 19.60±0.70c 1.82±1.01d

Table 4.19 indicates the total phenolic and flavonoid contents of wild G. lucidum analyzed as mg equivalent of gallic acid and catechin per gram of mushroom fraction respectively. Water

93

Chapter # 4 Results and Discussion fraction has the highest phenolic contents 5.39 mg GAE/g followed by ethyl acetate, dichloromethane and n-hexane. A study on wild mushrooms reported total phenolics ranges from 3.39-14.7 mg GAE/g from which A. campestris has the highest phenolic content whereas L. sulphureus has the lowest (Woldegiorgis et al., 2014). Water fraction also had the highest antioxidant activity with least IC50 value 19.60 mg/g and highest absorbance for reducing power 1.82 nm. Barros et al. (2007) reported the absorbance for reducing power of methanolic extracts of wild edible mushrooms at 5 mg/mL was 0.67-1.47 nm and at 1 mg/mL was 0.072 - 0.26 nm. It is concluded that both local and exotic mushrooms contain considerable amount of phenolics, the flavonoid contents were observed in excess in V. volvacea and P. ostreatus whereas wild G. lucidum showed less phenolic and flavonoid contents and moderate antioxidant activity was observed. Table 4.20. Antioxidant activity of selected mushrooms methanolic and ethanolic extract Solvents TPC (mg/g) TFC (mg/g) DPPH (% Reducing Power

inhibition) (Λ max 700 nm) L. edodes Methanol 13.32±.12 7.09±.17 75.02±.06 0.65±31 Ethanol 12.37±.08 5.40±.06 62.91±.39 0.46±.09 P. ostreatus Methanol 12.70±.16 5.72±.20 63.65±.22 0.59±.20 Ethanol 14.01±.53 7.02±.42 63.33±.25 0.77±.19 H. erinaceus Methanol 9.38±.36 8.196±.11 82.46±.31 0.88±.18 Ethanol 10.12±.41 6.26±.09 70.71±.14 1.11±.37 V. volvacea

Methanol 13.59±.33 7.92±.52 79.80±.18 1.22±.14 Ethanol 14.15±.56 7.82±.29 56.32±.26 1.03±.09 G. lucidum

Methanol 14.32±.09 3.52±.81 73.75±.35 1.28±.07 Ethanol 12.01±.86 6.96±.73 73.43±.28 1.01±.15 Data presented as mean ±SD of three independent replicates.

94

Chapter # 4 Results and Discussion

The total phenolic contents of the analyzed mushrooms were evaluated by Folin-Ciocalteau method; results were expressed as mg of gallic acid equivalents per g of mushrooms extracts. The total phenolic contents were observed in the range of 9.32-14.32 mg/g of extracts. V. volvacea extracts showed maximum phenolic contents followed by G. lucidum, P. ostreatus, L. edodes and H. erinaceus. Results are in good agreement with the total phenolic contents of two (cultivated) P. ostreatus and L. edodes and five wild mushrooms L. sulphureus, A. campestris, T. clypeatus, T. microcarpus and T. letestui were found in the range of 3.39-14.6 mg GAE/g (Woldegiorgis et al., 2014). In order to obtain more information about the nature of the phenolic substances present in the mushrooms, total flavonoid contents were also measured, the results were expressed as catechin equivalent per g of mushrooms extracts, The total flavonoid contents do not correlate with total phenolic contents and concentration varied depending on the mushroom species. Thus flavonoid contents were higher in H. erinaceus followed by V. volvacea, P. ostreatus, L. edodes and G. lucidum. The DPPH radical scavenging assay is a widely accepted model to assess free radical-scavenging activity, the ability of antioxidants to scavenge DPPH is attributed to their hydrogen donating activity (Liu et al., 2013). Antioxidant activity was evaluated by DPPH and reducing power methods, all mushrooms extracts showed scavenging activity of DPPH radical. Positive DPPH test suggests that methanolic extracts of all the samples were best scavengers of free radicals. The maximum scavenging %age was observed by methanolic extract of H. erinaceus (82%), followed by V. volvacea 79% and L. edodes 75%. From the results regarding the reducing power it can be inferred that mushrooms extracts are capable to convert the free radicals to stable products by donating the electrons. Hence, having the great ability to terminate the reactions initiated due to the presence of free radicals. High reducing power values were observed for V. volvacea (1.22) nm and G. lucidum (1.28 nm). Methanolic extracts of G. clavatus exhibited the highest absorbance value 2.650 nm followed by L. perlatum 1.35 nm, whereas P. sulphereus showed the lowest absorbance 0.69 nm (Sarikurkcu et al., 2015). The antioxidant activities detected here justify the investigation of mushrooms for their potential to improve human health, and application as dietary supplements.

95

Chapter # 4 Results and Discussion

4.11. Anticancer potential of studied mushrooms Cancer diseases are one of the main causes of death worldwide (Liu et al., 2013). The discovery of new molecules from natural origin is a global trend currently for the less toxicity of natural products (Wang et al., 2012). A number of bioactive compounds from natural resources had been investigated, identified and isolated as inhibitor to various cancer cell lines (Ma et al., 2013). In this study the anticancer activity of water fractions of selected mushrooms were subjected to in vitro cytotoxicity assay in certain cancer cell lines including HT-29 colon and H-1299 lungs carcinoma cell lines. It was found that higher the concentration the lower was the cell viability percentage (Thetsrimuang et al., 2011). The antiproliferative effect was in a dose-dependent manner, and the maximum inhibition was observed at the concentration of 200 µg/mL. The inhibitory acitivities of the water fractions on these cell lines are shown in Fig 4.15. All the mushrooms exhibited inhibition against HT-29 cell lines. G. lucidum fraction showed 29% viability of cells at 200 µg/mL followed by H. erinaceous 66%, L. edodes 68%, V.volvacea 83% and P. ostreatus 84%. Whereas in case of H-1299 cell lines again the G. lucidum fractions showed 24% viability of cells followed by P. ostreatus 61% and H. erinaceus 72%.

β-D-glucan and monogalactoglucan isolated and purified from basidiocarps of L. edodes showed antitumor activity against S-180, HCT-116 and H-29 cell lines with a dose dependent manner (Jeff et al., 2013). In another in vivo study the polysaccharide fraction extracted from the Ganoderma was shown to retard the growing sarcoma cells in mice (Hua et al., 2007). G. lucidum dried powder is recommended as a cancer chemotherapy agent in traditional Chinese medicine (TCM) and currently being utilized worldwide as dietary supplement (Stanley et al., 2005). It is concluded that the anticancer potential of G. lucidum might be due to high percentage of fiber contents that is 54% in our study. As dietary fibers are the carbohydrates in the diet that are not hydrolyzed by enzymes in either the stomach or small intestine therefore have importance for the management of different ailments. The anticancer potential of wild G. lucidum might be due to this attribute in addition to its antioxidant potential.

96

Chapter # 4 Results and Discussion

120.00 100.00 V. volvacea 80.00 H. erinaceus 60.00 L. edodes 40.00 G. lucidum

Viability (%) 20.00 P. ostreatus 0.00 0 50 100 150 200 250 Concentration (µg/mL)

(a)

120.00

100.00 G. lucidum

80.00 P. ostreatus 60.00 L. edodes 40.00 H. erinaceus 20.00 Viability(%) V. volvacea 0.00 0 50 100 150 200 250

Concenration (µg/mL)

(b) Fig 4.15. Viability (%) of water fractions of selected mushrooms at different concentrations against (a) colon tumor cells (HT-29), (b) lung tumor cells (HT-1299)

4.12. α-Glucosidase and antiyrosinase inhibition activities of selected mushrooms In the synthesis of melanin pigments, tyrosinases are responsible for coloring hairs, skin and eyes and also for the treatments of some dermatological hyper pigmentation illness connected with overproductions of melanin (Chen et al., 2010). Skin hyper pigmentation can be depends on either an increased number of melanocytes or activity of melanogenic enzymes. Tyrosinase is a copper containing enzyme that catalyzes the oxidation of tyrosine in to dopa and subsequently into dopaquinon. Natural inhibitors to tyrosinase such as mushrooms may consequently be functional and important in cosmetic business for skin whitening (Yoon et al., 2011). The results from the above analysis showed that P. ostreatus is the best tyrosinase

97

Chapter # 4 Results and Discussion inhibitor (80.9%) among the selected commercial mushrooms followed by L. edodes (42.82%) whereas the H. erinaceus and V. volvacea exhibited less activities. Similarly, the

IC50 values were lower for P. ostreatus 34.78 μmoles/L (Table 4.21). Table 4.21. α-Glucosidase and tyrosinase inhibition activities of selected mushrooms (%DW) Anti-tyrosinase activity α-Glucosidaseactivity Mushrooms Activity (%) IC50 (μmoles/L) Activity (%) IC50 (μmoles/L)

L. edodes 42.82±0.69c 52.49±0.95b 83.38±0.91d 39.96±0.74a

H. erinaceus 19.00±0.17a 115.43±1.02d 32.85±1.04a 96.81±0.83d

P. ostreatus 80.91±0.82d 34.78±0.92a 71.29±1.17c 46.04±0.81b V. volvaceae 25.4±0.85a 89.61±0.06d 36.74±1.07a 82.4±1.03c

30.25±0.46a Standard 95.52±0.46d 49.90±0.12b 90.23±0.14d

Standards used in the current study along with their concentration: Acarbose (0.5 mM) α- Glucosidase. Values are mean ± SD of carefully conducted triplicate experiments. Furthermore, mean carrying different superscripted alphabets vary significantly (p<0.05) with 95% confidence

Our results are in agreement with the study of Yoon et al., (2011), tyrosinase inhibitory activities of L. edodes acetonic, methanolic and hot water extracts at concentration of 0.125-1 mg/mL were in the rage of 11.94-54.22, 15.12-54.61 and 3.09-47.32% respectively. The inhibition of tyrosinase activity might be due to hydroxyl group of phenolic compounds of the mushrooms extracts that could form a hydrogen bond at the active site of enzyme, leading to a lower enzymatic activity (Baek et al., 2008). α-glucosidase delays the breakdown of carbohydrates in small intestine and diminish the postprandial blood glucose excursion. It is effective and helps people with type 2-diabetes, when blood sugar is elevated after eating complex carbohydrate. The results showed that α- glucosidase inhibition activity was observed highest in L. edodes 83.38% and P. ostreatus

71.29% whereas moderate activity was observed in H. erinaceus and V. volvacea. IC50 values were also lower for L. edodes and P. ostreatus 39.96 and 46.4 μmoles/L respectively, and can be compared with the positive control which showed the IC50 value 30.25%, whereas the IC50

98

Chapter # 4 Results and Discussion values for H. erinaceus and V. volvacea were observed 96.81 and 82.4 μmoles/L respectively. Our results are consistent with Su et al. (2013), n-hexane extract of Grifola frondosa showed a strong α-glucosidase inhibitory activity. They also observed that α-glucosidase inhibiting activity varied with the levels of oleic acid and linoleic acid present in the extracts. As a result of these properties, mushrooms could be used as natural food source for the management of blood glucose level in diabetic patients. Table 4.22. α-glucosidase and tyrosinase inhibition activity of G. lucidum (%DW) Mushroom Antityrosinase activity α-glucosidase activity

Activity (%) IC50 (μmoles/L) Activity (%) IC50(μmoles/L)

36.47±0.82a G. lucidum 78.51±0.26d 39.43±0.89a 87.27±0.87d

Standard 30.25±0.46a 95.52±0.46d 49.90±0.12b 90.23±0.14d

As it is clear from the results (Table 4.22) that G. lucidum is best tyrosinase inhibitor and showed inhibition 78.51% with lower IC50 values 39.43 μmoles/L. The results also depicts that α-glucosidase inhibition activity was observed very high in G. lucidum 87.27% and as a result had lower IC50 values 36.47 μmoles/L. It is concluded from the above experiment that wild mushroom showed best tyrosinase and α-glucosidase inhibition activities. Among the selected commercial mushrooms locally cultivated P. ostreatus was the best tyrosinase and α-glucosidase inhibitor as compared to the exotic commercial mushrooms. 4.13. Toxicological screening of selected mushrooms fractions The brine shrimp lethality assay is simple, inexpensive and rapid bioassay for testing extracts and other samples bioactivity. It is considered a useful tool for preliminary assessment of toxicity as it has been used for the detection of pesticides; plant extracts toxicity, fungal toxins, heavy metals and cytotoxicity testing of different materials (Sam et al., 2010; Badshah et al., 2015). In this experiment the mushrooms cytotoxicity was evaluated by brine shrimp assay. The maximum LC50 and LC90 values were observed for water fractions in case of all the studied mushrooms (Table 4.23). Faridur et al. (2010) investigated the cytotoxic effects of P. ostreatus extracts and fractions using brine shrimp nauplii and LC50 for hot water extract, methanol chloroform extract,

99

Chapter # 4 Results and Discussion

Petrolium ether and residual fractions were found to be 20.89, 18.62, 6.91, 15.84 µg/mL respectively. Table 4.23. Cytotoxic activity of selected mushrooms fractions against Brine shrimp nauplii at concentrations tested 3000, 1000, 100, 10 (µg/mL)

95% confidence interval Mushrooms Solvents LC50 (µg/mL) LC90 (µg/mL) L. edodes n- hexane 582.826 27664 Dichloromethane 56.3617 3051.58 Ethyl acetate 1523.47 33650.3 Water 2257.65 106338 H. erinaceus n- hexane 747.933 10872 Dichloromethane 143.399 119386 Ethyl acetate 180.111 19823.9 Water 946.69 4635.82 P. ostreatus n- hexane 813.163 8431.28 Dichloromethane 128.069 15738.9 Ethyl acetate 221.275 2642.09 Water 1443.4 2345.8 V. volvacea n- hexane 827.075 201226 Dichloromethane 332.331 30168.9 Ethyl acetate 547.232 8871.37 Water 1129.18 11430.4 95% confidence interval=Estimation of possible values for the population parameter LC50= lethal concentration at which 50 percent of shrimps died LC90= lethal concentration at which 90 percent of shrimps died Table 4.24. Cytotoxic activity of G. lucidum fractions against Brine shrimp nauplii at concentrations tested 3000,1000,100,10 (µg/mL) 95% confidence interval Fractions LC50 (µg/mL) LC90 (µg/mL) n- hexane 662.646 26599.3 G. lucidum Dichloromethane 61.789 6668.77 Ethyl acetate 115.068 11754.8 Water 900.031 18227 95% confidence interval=Estimation of possible values for the population parameter LC50= lethal concentration at which 50 percent of shrimps died LC90= lethal concentration at which 90 percent of shrimps died

Badshah et al. (2015) assessed the cytotoxic effects of methanolic extract of Astraeus hygrometricus, Calvatia gigantea and Morchella esculenta by brine shrimp lethality test.

100

Chapter # 4 Results and Discussion

Higher LC50 value was recorded for methanolic extract of A. hygrometricus (19.0 ± 0.32 μg/mL) followed by M. esculenta (17.0 ± 0.2 μg/mL) and C. gigantea (16.0 ± 0.22 μg/mL).

The water fractions for all the selected mushrooms showed higher LC50 and LC90 values so they are non toxic and safe for consumption. The dichloromethane fraction of G. lucidum showed slight toxicity against brine shrimp (Artemia salina) nauplii, though different mortality rate at different concentration was observed. No more reports available on the toxicological screening of these mushrooms by Brine shrimp method so it is evident that these mushrooms are non-toxic and safe for consumption. 4.14. Phytochemical screening of selected mushroom species Phytoconstituents have a significant role in the pharmaceutical properties of mushrooms. Saponins have a wide range of medicinal properties such as anti-inflammatory and anti- diabetic effect (Unekwu et al., 2014). It is also known that saponins inhibit Na+ efflux in the cell, activating Na+ Ca+2 antiporters in heart muscles which strengthen the cardiac muscles (Egwim et al., 2011). Falvonoid possess biological activities like radical scavenging, anti- allergy, anti-inflammatory and provide protection against oxidative stress induced diseases, whereas alkaloids are effective against malignant diseases, malaria and infections (Unekwu et al., 2014). Table 4.25. Qualitative analysis of phytochemicals of selected mushrooms Phytochemicals L. edodes H. erinaceus P. ostreatus V. volvacea Alkaloids + ive + ive + ive + ive Flavonoids + ive + ive + ive + ive Tannins + ive + ive + ive + ive Saponins + ive + ive + ive + ive β-carotene + ive + ive + ive + ive

The results obtained from the qualitative phytochemicals analysis of the selected mushrooms showed the presence of alkaloids, tannins, saponins, β-carotene and flavonoids (Table 4.25). Our results are in agreement with previous work on mushrooms phytochemicals (Schneider and Wolfling, 2004; Egwim et al., 2011). Our results of quantitative analysis showed that alkaloids ranged between 0.042-0.093 mg/g, tannins contents were present in the range of 48.34-87.63 mg/g, flavnoids 8.31-13.42 mg/g, saponins 8.89-38.25 mg/g and β-carotene ranged from 0.008 to 0.013 mg/g (Table 4.26). Flavonoids, alkaloids and saponins were present in high concentration in P. ostreatus. From

101

Chapter # 4 Results and Discussion the quantitative analysis it was evident that these phytoconstituents are present in selected mushrooms in varying concentration. Table 4.26. Quantitative analysis of phytochemicals of selected mushrooms

Phytochemicals L. edodes H. erinaceus P. ostreatus V. volvacea (mg/g) Alkaloids 0.042±0.21 0.093±0.42 0.074±0.53 0.052±0.31 Flavonoids 11.51±0.50 9.45±0.27 13.42±0.81 8.31±0.72 Tannins 71.94±0.73 48.34±0.57 82.78±0.48 87.63±1.04 Saponins 17.68±0.2 8.89±0.91 38.25±0.22 20.37±1.09 β-carotene 0.011±0.9 0.009±0.8 0.013±1.1 0.008±0.78

These findings are in accordance with previous investigations (Kumari et al., 2011; Unekwu et al. 2014), they reported that mushrooms are rich in phytoconstituents, flavonoids ranging from 6.41 to 42.63 mg/g, alkaloids 8.12-135.57 µg/g, saponins 10.17-150.41 mg/g, tannins 59.27 - 170.56 mg/g and β-carotene were in the range of 9.88 - 13.7 µg/g. Modi et al. (2014) screened P. ostreatus , A. bisporous, C. comatus and V. volvacea for phytochemicals and analysis revealed that these mushrooms were rich source of phytoconstituents containing carbohydrates, phenols, cardiac glycosides, flavonoid, saponins, terpenoids and anthraquinones. A study on P. ostreatus by Iwalokun et al. (2007) also exposed the presence of tannins, terpenoids, sterioglycosides and carbohydrates. 4.14.1. Qualitative and quantitative phytochemical analysis of wild G. lucidum Qualitative and quantitatively phytochemical screening of wild G. lucidum discloses the presence of alkaloids, flavonoids, tannins, saponins and tannins. Alkaloids 0.027±.25, Flavonoids 11.64±0.67, Tannins 102.82±0.82, Saponins 22.35±0.46 mg/g followed by very low concentration of β-carotene 0.007±0.93 mg/g were observed. Kumari et al. (2011) investigated three wild cantharellus species for phytochemicals, flavonids were ranged from 1.23-1.97 mg/g and β-carotenes were in the range of 9.88-13.70 µg/g. Wandati et al. (2013) reported some wild edible and commercial mushrooms form Kenya and found the selected mushrooms were good source of phytochemicals. It is concluded from the above analysis that locally cultivated mushrooms are better source of flavonids, alkaloids and saponins as compared to the commercial exotic mushrooms.

102

Chapter # 4 Results and Discussion

4.15. HPLC analysis of phenolic acids Mushrooms have developed chemical defense mechanism against insects and microorganisms similar to those in plants such as the production of phenolic compounds to protect their cell wall during pathogenic, UV and salt stress etc. (Vaz et al., 2011). In this study the selected mushrooms were analyzed for different phenolics, chlorogenic acid, p. cumaric acid, gallic acid and ferulic acid were identified and quantified in these analyzed samples by HPLC, comparing their chromatographic characteristics, absorption spectra and retention time with the corresponding standard compounds (Fig 4.16).

(a)

(b)

103

Chapter # 4 Results and Discussion

(c)

(d)

(e)

104

Chapter # 4 Results and Discussion

(f)

(g)

(h)

105

Chapter # 4 Results and Discussion

(i)

Fig 4.16. HPLC chromatograms of selected mushrooms (a) caffeic acid standard, (b) caffeic acid in P. ostreatus, (c) chlorogenic acid standard, (d) chlorogenic acid in H. erinaceus, (e) gallic acid standard, (f) gallic acid in H. erinaceus, (g) p. cumaric acid standard, (h) p. cumaric acid in H. erinaceus, (i) ferulic acid standard, (j) ferulic acid in H. erinaceus Chlorogenic acid, RT= 8; Ferulic acid, RT= 11.2; p. cumaric acid, RT= 10.10; Gallic acid, RT= 2; Caffeic acid, RT= 1 The results from the above analysis showed that the H. erinaceus had the highest concentration of phenolic acids. Caffeic acid was present in all the studied mushrooms though the concentrations vary considerably among the species. P. ostreatus contains the highest amount of caffeic acid 6.51±8.7 µg/g of DW, whereas the other studied mushrooms have low caffeic acid contents ranges from 0.14-0.75µg/g of DW. V. volvacea and H. erinaceus contain chlorogenic acid 6.63 and 11.49 µg/g respectively. H. erinaceus showed high concentration of ferulic acid (7.84±0.7 µg/g) and p. cumaric acid (3.18±0.2 µg/g) on dry weight basis. Chlorogenic acid, p. cumaric acid and Gallic acid were not detected in L. edodes and P. ostreatus whereas ferulic acid was not there in P. ostreatus (Table 4.27).

106

Chapter # 4 Results and Discussion

Table 4.27. HPLC analysis of phenolics (µg phenolics/g dry mushroom) in selected mushrooms (mean ± standard deviation) Phenolics (µg/g) L. edodes H. erinaceus V. volvacea P. ostreatus Chlorogenic acid ND 11.49 ± 0.1 6.63 ± 0.09 ND Ferulic acid 1.41 ± 1.9 7.84 ± 0.7 1.41 ± 1.9 ND

p. cumaric acid ND 3.18 ± 0.2 ND ND Gallic acid ND 0.77 ± 0.1 0.13 ± 0.1 ND Caffeic acid 0.38 ± 0.01 0.75 ± 0.04 0.14 ± 0.1 6.51 ± 8.7

Our findings are consistent with the previous studies on phenolics composition from different mushrooms (B. edulis, A. bisporous, C. cibarius, L. deliciosus and P. ostreatus) reported by (Barros et al. 2009; Ferreira et al. 2009). Tannic acid, gallic acid and protocatechuic acids were also reported in mushrooms collected from India (Puttaraju et al., 2006). Our findings can also be compared with the study of Woldegiorgis et al. (2014), they reported two cultivated and five wild mushrooms contain caffeic acid in highest concentration 7.80 µg/g in P. ostreatus, chlorogenic acid 4.55 µg/g in T. letestui and p. cumaric acid 15.8 µg/g in T. microcarpus. 4.15.1. HPLC analysis of phenolic acids in G. lucidum Wild G. lucidum showed chlorogenic acid 4.81±0.09, Ferulic acid 0.91±0.03 and Caffeic acid 0.031±0.01 µg/g on dry weight basis whereas p. cumaric acid and Gallic acid were not detected. Analysis of phenolic compounds in seventeen Portuguese wild mushroom species showed the highest phenolic acids concentration (111.72 mg/Kg) in Fistulina hepatica (Vaz et al., 2011). The selected mushrooms have significant amount of phenolics, the specific and characteristic composition of each mushroom may be associated with the environmental factors of their harvest conditions and species of the mushrooms. 4.16. HPLC analysis of tocopherols and carotenoids The interest in natural antioxidants is growing for their potential in the prevention of oxidative stress induced diseases because of synthetic antioxidants are being questioned due to carcinogenic activity (Fukushima and Tsuda, 1985; Barros et al., 2008). Natural antioxidants, tocopherols and carotenoid pigments are having a great significance in the

107

Chapter # 4 Results and Discussion protection against lipid oxidation (Barros et al., 2008). In Present study the tocopherol and lutein composition of selected mushrooms were analyzed by HPLC and shown in fig. 4.17.

(a)

(b)

(c)

108

Chapter # 4 Results and Discussion

(d)

(e)

Fig 4.17. HPLC fluorescence chromatograms of selected mushrooms (a) V. volvacea, (b) G. lucidum, (c) H. erinaceus, (d) L. edodes, (e) P. ostreatus (BHT RT: 3.2; Internal standard RT: 3.90; γ tocopherol RT: 4.38; Lutein RT: 7.50) The analysis showed that V. volvacea had the highest contents of γ- tocopherol 74.25 µg/g of DW (Table 4.28). The order for γ- Tocopherol in selected mushroom species was V. volvacea > H. erinaceus > P. ostreatus > L. edodes. Table 4.28. γ-Tocopherol and Lutein composition (µg/g DW) of the mushroom (mean±SD) Mushrooms P. ostreatus L. edodes H. erinaceus V. volvacea Compounds γ-Tocopherol 49.21±2.03 39.22±1.1 57.99±0.5 74.25±3.01

Lutein 1.50±0.07 1.27±0.04 2.42±0.08 2.26±0.1

109

Chapter # 4 Results and Discussion

Carotenoides can be classified it two classes i.e. carotenes (carotene or lycopene) and xanthophylls (lutein and cryptoxanthene). The lutein contents in mushrooms were highest in H. erinaceus 2.42 and V. volvacea 2.26 µg/g followed by P. ostreatus 1.50 and lowest were observed in L. edodes 1.27 µg/g of DW. In contrast, tocopherol contents of five agaricus sp. were determined, α and β-tocopherol were found in all the species but γ-tocopherol was not detected (Barros et al., 2008). In the literature there are studies on tocopherol composition of mushrooms (Elmastas et al., 2007; Ferreira et al., 2009; Jayakumar et al., 2009). It is concluded that V. volvacea and H. erinaceus are very good source of γ- Tocopherol and lutein as compared to L. edodes and P. ostreatus. 4.16.1. γ-Tocopherol and Lutein composition of G. lucidum G. lucidum contained γ- Tocopherol 29.65±1.2 and Lutein contents 1.64±0.05 µg/g on dry weight basis. Pereira et al. (2012) investigated some wild mushrooms for tocopherols, α- tocpherol was present in the range of 0.01-0.48, β-tocopherol 0.01-0.10 and γ-tocopherol 0.01-0.19 and δ-tocopherol was 0.01-0.07 mg/g. 4.17. Fatty acid analysis of mushrooms by GC/MS Lipids are the least studied components in mushrooms since their overall content in the species is hardly higher than 6–8% of the dry weight. However, the low lipid content is one of the advantages of mushrooms as healthy nutrients. The knowledge of the composition of lipids as primary metabolites is of interest both because it adds to the general nutritional value and it may characterize the special place of mushrooms in terrestrial life forms (Marekov et al., 2012). The selected mushrooms were also analyzed for their fatty acid composition. The results for fatty acid composition, total saturated fatty acids (SFA), monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA) in selected mushrooms are shown in the Table 4.26. This analysis identified over 25 different FAs; linoliec acid (18':2n6c), oleic acid (18':1n9c), palmitic acid (C16:0), steric acid (C18:0), linolenic (18':3n3) and nonadecanoic acid (C19-0), were the main fatty acids found in the mushrooms. Linoliec acid was found in highest concentration in V. volvacea1 6.013 mg/g followed by P. ostreatus 10.257, L. edodes 7.547 and H. erinaceus 7.865 mg/g on dry weight basis. Only the linolenic acid was not detected in L. edoded. The main fatty acids in selected mushrooms were linoliec acid > oleic acid > palmitic acid and are consistent with previous studies (Wang, 2004; Lei et al., 2007; Wang et 110

Chapter # 4 Results and Discussion al., 2010). Palmitic acid was present in higher amount in all the studied mushrooms, only the linolenic acid was not detected in L. edodes.

(a)

(b)

(c)

111

Chapter # 4 Results and Discussion

(d) Fig 4.18. Mass spectra for the representative fatty acids by GC/MS (a) H.erinaceus, (b) L.edodes, (c) V. volvacea, (d) P. ostreatus Total fatty acids were higher in V. volvacea > H. erinaceus > P.ostreatus > L. edodes >G. lucidum. Unsaturated fatty acids (UFA) predominated over the saturated fatty acids in all the studied mushrooms (Diez and Alvarez, 2001). V. volvacea and P.ostreatus contained the highest number of unsaturated fatty acids (UFA), leading to an increase in HDL cholesterol and decrease in LDL cholesterol, triacylglycerol, lipid oxidation and LDL susceptibility to oxidation (Kanu et al., 2007). Table 4.29. Fatty acid chemical finger print of selected mushrooms (mg/g DW) Fattay acids H. erinaceus L. edodes V. volvacea P. ostreatus 16':0 4.229 2.321 3.809 2.671 18':0 1.193 0.128 0.979 0.413 18':1n9c 6.075 0.253 2.0103 3.544 18':2n6c 7.547 7.865 16.013 10.257 19':00 0.487 0.442 0.482 0.491 18':3n3 0.196 Nd 0.036 0.0202 Total fatty acids 19.73 11.01 23.33 17.40 SFA 30.33 27.96 20.77 24.65 MUFA 28.64 1.53 7.77 18.26 PUFA 37.31 63.86 62.51 54.06 Palmitic acids (C16:0), Steric acid (C18:0), Linoliec (18':2n6c), Oleic (18':1n9c), Linolenic (18':3n3) and Nonadecanoic acid (C19-0) Nd- Not Detected; C-carbon atoms; SFA- saturated fatty acids; MUFA- mono unsaturated fatty acids; PUFA- poly unsaturated fatty acids As unsaturated fatty acids are essential in human diet so, the finding of high proportion of unsaturated fatty acids and especially the high percentage of linoleic acids in these

112

Chapter # 4 Results and Discussion mushrooms is a significant factor in regarding mushrooms as a healthy food (Lawrence, 2010; Kavishree et al., 2008). Our results are consistent with the finding of Jing et al. (2012) total free fatty acids were in the range of 27.94-54.06 mg/g in one wild and four cultivated mushrooms. SFA and USF were simultaneously present but USFA were predominating over the SFA. Linoleic (C18:2n6c) was the most abundant varying from 17.64–32.02 mg/g. Our results are also in agreement with the previous reports that many mushrooms species had high proportion of unsaturated fatty acids (linoleic acid) in P.ostreatus 65.29%, L. salmonicolor 59.44% and in F. velutipes 40.87% (Ergonul et al., 2013: Shao et al., 2010). In another study qualitative analysis of fatty acids from mycelial extracts obtained from 18 species and 30 strains of coprenoid mushrooms revealed that linoleic acid was detected in all tested species and strains (Mkrtchyan, 2014). Linoleic acid is the precursor of 1-octen-3-ol that is known as alcohol of fungi and principal aromatic compound in most of the fungi contributing to mushroom flavor and also implicated to be a potent cytotoxic agent against HeLa cell, possessing antibacterial activity (Lee et al., 2002). 4.17.1. Fatty acid analysis of wild G. lucidum by GC/MS Regarding the fatty acids analysis of wild G. lucidum, saturated fatty acids (SFA) were higher over polyunsaturated and monounsaturated fatty acids (Fig 4.19).

Fig 4.19. Mass spectra of G. lucidum for the representative fatty acids by GC/MS With respect to SFA, palmitic acid and steric acid were found higher in the investigated mushrooms, although linoliec acid (C18:2n6c), Oleic acid (C18:1n9C) and Linolenic (18':3n3) were also present in G. lucidum.

113

Chapter # 4 Results and Discussion

Table 4.30. Fatty acid chemical finger print of wild G. lucidum (mg/g DW) 16':0 18':0 18':1n9c 18':2n6c 19':00 18':3n3 TFA SFA MUFA PUFA 1.24 0.25 1.17 1.42 0.45 0.03 4.58 48.7 5.85 30.5 Palmitic acids (C16:0), Steric acid (C18:0), Linoliec (18':2n6c), Oleic (18':1n9c), Linolenic (18':3n3) and Nonadecanoic acid (C19-0) Nd- not detected; C-carbon atoms; SFA- saturated fatty acids; MUFA- mono unsaturated fatty acids; PUFA- poly unsaturated fatty acids, TFA; total fatty acid With respect to saturated fatty acid abundant Moreover, the results indicated that selected commercial local and exotic mushrooms contain polyunsaturated fatty acids predominated over the monounsaturated and saturated fatty acids due to the high contribution of linoleic acid. Whereas, the wild G. lucidum contain more saturated fatty acids over the unsaturated ones. So, the mushrooms are whealthy source of essential fatty acids and therefore should be added in diet. 4.18. GC/MS analysis of sugars (monosaccharide and disaccharides) composition of selected mushrooms by derivitization to alditol acetate Monosaccharides are the most basic units of biologically important macromolecular polysaccharides. The conjunct monosaccharides that frequently occur in natural polysaccharides can serve as the identification of basal chemical characteristic of commercial polysaccharides (Hua et al., 2014). Previous studies have shown that polysaccharide possess higher physiological activity which is closely related to the level of monosaccharide compositions (Zhang et al., 2007). In particular, the monosaccharide composition analysis of polysaccharides is the most important step for further discovery of its physicochemical properties, structure and structure–bioactivity relationship (Jian-Hua et al., 2013). The chromatograms representing sugar compositions are shown in Fig 4.20.

114

Chapter # 4 Results and Discussion

A b u n d a n c e

T IC: 2014-7-18_15.D \data.m s 2 2 0 0 0 0 0

2 0 0 0 0 0 0

1 8 0 0 0 0 0

1 6 0 0 0 0 0

1 4 0 0 0 0 0

1 2 0 0 0 0 0 2 4 .4 9 0

1 0 0 0 0 0 0

8 0 0 0 0 0

6 0 0 0 0 0

4 0 0 0 0 0 2 2 .9 0 6

2 0 0 0 0 0 2 3 .5 9 3 1 6 .1 8 3 2 0 .5 5 5

1 6 .0 0 1 7 .0 0 1 8 .0 0 1 9 .0 0 2 0 .0 0 2 1 .0 0 2 2 .0 0 2 3 .0 0 2 4 .0 0 2 5 .0 0 T im e --> (a)

A b und a nc e

TIC: 2014-7-18_17.D\data.ms 24.503 2000000

1800000

1600000 18.565 1400000

1200000

1000000

800000

600000

400000 22.902

200000 23.666 16.116 20.544

16.00 17.00 18.00 19.00 20.00 21.00 22.00 23.00 24.00 25.00 T im e --> (b)

A b u n d a n c e

T IC: 2014-7-18_19.D\data.ms 2 4 .5 0 9 2 2 0 0 0 0 0

2 0 0 0 0 0 0

1 8 0 0 0 0 0

1 6 0 0 0 0 0

1 4 0 0 0 0 0

1 2 0 0 0 0 0 2 2 .9 1 7 1 0 0 0 0 0 0

8 0 0 0 0 0

6 0 0 0 0 0

4 0 0 0 0 0

2 0 0 0 0 0 2 3 .6 0 9 2 0 .5 6 2

1 6 .0 0 1 7 .0 0 1 8 .0 0 1 9 .0 0 2 0 .0 0 2 1 .0 0 2 2 .0 0 2 3 .0 0 2 4 .0 0 2 5 .0 0 2 6 .0 0 T im e --> (c)

115

Chapter # 4 Results and Discussion

A b u n d a n c e

TIC: 2014-7-18_21.D \data.ms

1 8 0 0 0 0 0

1 6 0 0 0 0 0 2 4 . 4 9 9

1 4 0 0 0 0 0

1 2 0 0 0 0 0 2 2 . 9 2 3 1 0 0 0 0 0 0

8 0 0 0 0 0

6 0 0 0 0 0

4 0 0 0 0 0 1 8 . 5 6 1 2 3 . 6 5 6 2 0 0 0 0 0

1 6 . 1 7 2 2 0 . 5 5 6 1 6 . 0 0 1 7 . 0 0 1 8 . 0 0 1 9 . 0 0 2 0 . 0 0 2 1 . 0 0 2 2 . 0 0 2 3 . 0 0 2 4 . 0 0 2 5 . 0 0 2 6 . 0 0 T i m e - - > (d)

A b u n d a n c e

T IC: 2014-6-30_standard.D\data.ms 1 8 .6 4 3 2 3 .7 3 6 2 2 0 0 0 0 0 2 3 .0 1 9 2 0 .6 4 4 2 4 .6 0 0 2 5 .5 9 1

2 0 0 0 0 0 0

1 8 0 0 0 0 0 1 6 .2 1 1

1 6 0 0 0 0 0

1 4 0 0 0 0 0

1 5 .8 1 9 1 2 0 0 0 0 0

1 0 0 0 0 0 0

8 0 0 0 0 0

6 0 0 0 0 0

4 0 0 0 0 0

2 0 0 0 0 0

1 5 .0 0 1 6 .0 0 1 7 .0 0 1 8 .0 0 1 9 .0 0 2 0 .0 0 2 1 .0 0 2 2 .0 0 2 3 .0 0 2 4 .0 0 2 5 .0 0 2 6 .0 0 T im e --> (e) Fig 4.20. GC/MS chromatograms representing monosaccharides composition (a) V. volvacea, (b) H. erinaceus, (c) P. ostreatus, (d) L. edodes, (e) standard monosaccharides mixture solution (Rhamnose, RT: 15.819; Fucose RT: 16.211; Arabinose, RT: 18.643; Mannose, RT: 23.019; Galactose, RT: 23.73; Glucose, RT: 24.6; Inositol, RT: 25.591).

Our results for sugar composition showed that glucose, galactose and mannose were present in high amount in the studied mushrooms. Glucose was observed in higher concentration in V. volvacea (76.7±8.4%) followed by P. ostreatus (66.2±0.1%), L. edodes (49.4±1.0 %) and H. erinaceus (45.5±7.7%). Mannose was observed highest in L. edodes 34.2±0.7% then in P. ostreatus, V. volvacea and H. erinaceus. Rhamnose was not detected in all the studied species, fucose and arabinose were not detected in only P. ostreatus (Table 4.31). Our results are in agreement with the study of Smiderle et al. (2012). They analyzed Pleurotus pulmonarius EPS (expopolysaccharide) and mycelia for monosaccharide and

116

Chapter # 4 Results and Discussion disaccharide contents, both the expopolysaccharide and mycelia showed glucose, galactose and mannose as major components. Guan et al. (2010), evaluated ten monosaccahrides in natural and cultured cordyceps and their results showed that natural C. cinesis contained free glucose, glactose and mannose. Table 4.31. Monosaccharide and disaccharide composition of selected mushrooms (%) Sugars L. edodes H. erinaceus P. ostreatus V. volvacea Rhamnose Nd Nd Nd Nd Fucose 0.3±0.1 0.5±0.1 Nd 1.3±0.4 Arabinose 10.6±0.8 41.1±6.9 Nd Nd Xylose 1.0±0.2 0.8±0.1 1.0±0.3 0.8±0.2 Mannose 34.2±0.7 8.4±0.3 29.2±0.4 16.3±6.9 Galactose 4.5±0.4 3.6±0.4 3.7±0.1 4.9±0.9 Glucose 49.4±1.0 45.5±7.7 66.2±0.1 76.7±8.4 Inositol 41.54±3.04 32.78±2.46 38.24±4.21 54.32±2.39 Nd= not detected, n=3 mean±SD 4.18.1. GC/MS analysis of sugars composition of wild G. lucidum Results for sugar analysis showed that glucose was observed at high level 86.1±2.8% whereas mannose (6.5±0.1), xylose (4.3±2.0), galactose (2.2±0.8) and fucose (1.0±0.0) were observed in low concentration (Fig. 4.21). Rhmnose and arabinose were not detected in the investigated mushroom.

A b u n d a n c e

T IC: 2014-7-18_24.D \data.ms 2 0 0 0 0 0 0

1 8 0 0 0 0 0

1 6 0 0 0 0 0

1 4 0 0 0 0 0

1 2 0 0 0 0 0 2 4 .4 8 1 1 0 0 0 0 0 0

8 0 0 0 0 0

6 0 0 0 0 0

4 0 0 0 0 0

2 0 0 0 0 0 2 2 .9 0 6 1 6 .1 7 7 2 0 .5 4 3 2 3 .7 6 5

1 6 .0 0 1 7 .0 0 1 8 .0 0 1 9 .0 0 2 0 .0 0 2 1 .0 0 2 2 .0 0 2 3 .0 0 2 4 .0 0 2 5 .0 0 T im e --> Fig 4.21. GC/MS chromatogram representing monosaccharides composition of G. lucidum

117

Chapter # 4 Results and Discussion

The sugar composition of 10 wild edible mushrooms showed the presence of mannitol, trehalose, glucose and mannose. The highest amounts of mannitol, mannose and glucose were found in A. campestris16.34, 65.61 and 15.21 g/100g respectively (Beluhan and Ranogajec, 2011). Results showed that Glucose is the main sugar in all the selected commercial local, exotic and wild mushrooms. Locally cultivated P. ostreatus, V. volvacea and wild G. lucidum contain higher amount of glucose and also a rich source of monosaccharide sugars. 4.19. Monosaccharide linkage composition of selected mushrooms by partially methylated alditol acetates (PMAAs) Monosaccharide composition and monosaccharide linkage composition analyses are complementary techniques that can provide details of glycan-containing material. One advantage of obtaining monosaccharide linkage composition by methylation analysis is the potential to estimate relative proportion of different polysaccharides from a single analysis (Prabasari et al., 2011). The procedure covers the preparation of cell walls together with gas chromatography–mass spectrometry (GC-MS)-based methods for both the analysis of monosaccharides as their volatile alditol acetate derivatives and for methylation analysis to determine linkage positions between monosaccharide residues as their volatile partially methylated alditol acetate derivatives. Alditol acetates monosaccharide composition can be determined both quantitatively and qualitatively by derivatization to alditol acetates after hydrolysis and reduction. Two of the most common reagents used for hydrolysis were TFA (triflouroacetic acid), which is volatile and used to hydrolyze soluble samples and to analyze noncellulosic components of the cell wall and the other one is H2So4 (sulfuric acid) for complete hydrolysis because it is more harsh than TFA (Pettolino et al., 2012).

118

Chapter # 4 Results and Discussion

Abundance

TIC: 2014-7-18_36.D\data.ms

450000

400000

350000

300000

250000

200000

150000 13.183 100000 15.785 18.998 22.382 50000 17.05817.413 20.11320.828 20.682 23.896 19.399 21.579

13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00 21.00 22.00 23.00 24.00 25.00 Time--> (a)

A b u n d a n c e

TIC: 2014-7-18_43.D\ data.ms 6 0 0 0 0 0 1 3 . 1 5 3 5 5 0 0 0 0

5 0 0 0 0 0

4 5 0 0 0 0

4 0 0 0 0 0

3 5 0 0 0 0

3 0 0 0 0 0 1 7 . 4 0 0 2 5 0 0 0 0

2 0 0 0 0 0 1 5 . 7 9 4 1 5 0 0 0 0 1 6 . 9 6 0 1 8 . 9 5 2 1 0 0 0 0 0 2 0 . 1 2 9 22 0 0 . 6 . 7 1 6 6 1 2 2 . 4 0 4 5 0 0 0 0 2 3 . 8 8 0 1 3 . 8 6 6 1 9 . 4 6 0 2 1 . 5 8 1 2 2 . 9 0 7

1 3 . 0 0 1 4 . 0 0 1 5 . 0 0 1 6 . 0 0 1 7 . 0 0 1 8 . 0 0 1 9 . 0 0 2 0 . 0 0 2 1 . 0 0 2 2 . 0 0 2 3 . 0 0 2 4 . 0 0 2 5 . 0 0 T im e --> (b)

Ab und a nce

TIC: 2014-7-18_39.D\data.ms

340000 320000 300000 280000 260000 240000 220000 200000 180000 160000 140000 120000 100000 80000

60000 15.861 40000 17.437 13.276 17.029 19.096 20.156 20000 20.841 18.364 20.703 22.407 23.964 0 13.00 14.00 15.00 16.00 17.00 18.00 19.00 20.00 21.00 22.00 23.00 24.00 25.00 T ime --> (c)

119

Chapter # 4 Results and Discussion

A b u n d a n c e

TIC: 2014-7-18_41.D\ data.ms

2 6 0 0 0 0 2 4 0 0 0 0 2 2 0 0 0 0 2 0 0 0 0 0 1 8 0 0 0 0 1 6 0 0 0 0 1 4 0 0 0 0 1 2 0 0 0 0

1 0 0 0 0 0 1 3 . 2 2 4 8 0 0 0 0

6 0 0 0 0 1 5 . 8 2 1 1 9 . 0 1 0 4 0 0 0 0 2 0 . 8 6 9 1 7 . 1 1 6 1 7 . 3 9 6 2 0 . 1 2 0 2 2 . 4 0 0 2 3 . 8 5 6 2 0 0 0 0 2 1 . 6 4 8

1 3 . 0 0 1 4 . 0 0 1 5 . 0 0 1 6 . 0 0 1 7 . 0 0 1 8 . 0 0 1 9 . 0 0 2 0 . 0 0 2 1 . 0 0 2 2 . 0 0 2 3 . 0 0 2 4 . 0 0 2 5 . 0 0 T im e --> (d) Fig 4.22. GC/MS chromatograms representing monosaccharide linkage composition of (a) L. edodes (b) P. ostreatus (c) H. erinaceus (d) V. volvacea T-GLC, RT: 13.2; 3-GLC RT: 15.8; T-GAL RT: 15.9; 6-MAN RT: 17.0; 4-GLC RT: 17.4; 3,4- GLC RT: 19.0; 2,4-MAN RT: 19.5; 3,6-GLC RT: 20.1; 4,6-GAL RT: 20.8; 2,6-GAL RT 21.6; 3,4,6-GLC RT: 22.4; 2,4,6-MAN RT: 22.9, 2,3,6-GLC RT: 23.9 This information can be used to group monosaccharide linkages into polysaccharide classes and enables common derivatives to be split between different classes. For example, 4-Glc is common to cellulose, xyloglucan, (galacto) glucomannan, (1,3;1,4)-β-glucan and starch. 4- Glc to starch can be eliminated if the sample contains no starch or has been depleted of starch. (1,3;1,4)-β-glucan is dependent on the presence of 3-Glc. In general, the presence of 4-Glc to glucomannan is dependent on the presence of 4-Man and 4,6-Man, unless the sample is known to contain (galacto) mannan alone. Xyloglucan can be determined from the presence of 4,6-Glc, t-Xyl and other xyloglucan-associated linkages such as 2-Xyl, 2-Gal and t-Fuc, although the presence of some of these side-chain linkages are species dependent (Pettolino et al., 2012). The monosaccharide linkage data is recalculated to reflect the best possible estimate of total cell wall polysaccharide composition. The major components identified and the estimated levels of each, although not identical, are generally consistent with those reported by extensive fractionation techniques including (1,3;1,4)-β-glucan as moajor components with xyloglucan, glucosamannan and cellulose as minor components.

120

Chapter # 4 Results and Discussion

Table 4.32. Monosaccharide linkage composition of selected wild and commercial mushrooms (%DW) Sugars L. edodes H. erinaceus P. ostreatus V. volvacea T-GLC 12.4 7 32.7 26.2 3-GLC 10.3 14.6 1.01 17.2 T-Gal - - 2.8 - 6-MAN 31.4 5.4 15.1 11.1 4-GLC 17.4 9.3 16.6 5.1 3,4-GLC 18.0 - 7.8 - 3-MAN - 3 - - 2,4-MAN 19.4 - 1.8 - 2,3-GLC - 6.6 - 9 3,6-GLC 5.6 4.3 3.8 4.3 4,6-GLC 2.1 3.6 - - 4,6-GAL 3.1 - 0.7 - 2,6-GAL 1.5 - 0.2 4.9 2,3,4-GLC - - - 10.2 3,4,6-GLC 16.3 - 7.6 5.2 2,3,6-GLC 4.7 1.9 2.3 4.6 2,4,6-MAN - - 4.6 -

Carbohydrate composition of the fractions obtained by GC/MS is summarized in (Table 4.33) Glucose is the main sugar in all cases, and is abundant in G. lucidum, as it contain 86% glucose and only 6.5% mannose, while small amounts of D -galactose and D -mannose were also present. Table 4.33. Calculation of polysaccharide composition based on linkage analysis Sugars L. edode P. ostreatus H. erinaceus V. volvacea Glucose % 49.4 66.2 45.5 76.7 Galactose % 4.5 3.7 3.6 4.9 Mannose % 34.2 29.2 8.3 16.3

121

Chapter # 4 Results and Discussion

The contents of D-glucose obtained by GC/MS well correlated with enzymatic determination of total glucans so these polysaccharides are the main source of D-glucose in the fractions. So the presence of 3-Glc in all the selected mushrooms showed the presence of (1,3;1,4)-β- glucan Methylation analysis revealed the presence of 2,3,6 glucose, 2,6 glucose, 2,3,4 and 2,4,6 glucose. These results confirm that highly branched 1-3,1-6-glucans of the selected mushrooms.

Our results are consistent with Synytsya et al. (2009). D -Glucose is the main sugar in all cases, while small amounts of D-galactose and D-mannose were also found, so galactomannans are present in some fractions as minor component. The contents of D- glucose obtained can be correlated to the determination of total glucans 4.19.1. Monosaccharide linkage composition of wild G. lucidum by PMAAs The linkage composition of monosaccharides of G. lucidum analyzed by GC/MS is shown in Fig 4.23.

A b u n d a n c e

TIC: 2014-7-18_33.D\ data.ms

5 0 0 0 0 0

4 5 0 0 0 0

4 0 0 0 0 0

3 5 0 0 0 0

3 0 0 0 0 0

2 5 0 0 0 0

2 0 0 0 0 0

1 5 0 0 0 0

1 0 0 0 0 0 1 5 . 8 0 6 2 0 . 8 4 1 1 9 . 1 5 1 5 0 0 0 0 1 7 . 4 0 9 2 0 . 12 30 .7 6 7 5 2 2 . 3 8 6 2 3 . 8 9 0 1 3 . 2 2 5 1 6 . 9 9 5 0 1 3 . 0 0 1 4 . 0 0 1 5 . 0 0 1 6 . 0 0 1 7 . 0 0 1 8 . 0 0 1 9 . 0 0 2 0 . 0 0 2 1 . 0 0 2 2 . 0 0 2 3 . 0 0 2 4 . 0 0 2 5 . 0 0 T im e --> Fig 4.23. GC/MS chromatogram representing monosaccharide linkage composition of G. lucidum T-GLC, RT: 13.2; 3-GLC RT: 15.8; T-GAL RT: 15.9; 6-MAN RT: 17.0; 4-GLC RT: 17.4; 3,4- GLC RT: 19.0; 2,4-MAN RT: 19.5; 3,6-GLC RT: 20.1; 4,6-GAL RT: 20.8; 2,6-GAL RT 21.6; 3,4,6-GLC RT: 22.4; 2,4,6-MAN RT: 22.9, 2,3,6-GLC RT: 23.9 T-Gal, 2,6-Gal, 4,6-Gal were not detected in wild G. lucidum while glucose is the main sugar present in high concentration 86.1 % and mannose is present in lower concentration 6.5%. Table 4.34. Monosaccharide linkage composition of selected wild G. lucidum (% DW)

T-GLC 3-GLC 6-MAN 4-GLC 2,3-Glc 3,6-Glc 4,6-Glc 2,3,4-GLC 3,4,6-GLC 2,3,6-GLC

5 21.3 1.8 7.5 13.2 8.8 6.1 6.1 4.7 4.7

122

Chapter # 4 Results and Discussion

The above analyses shoed that commercial local, exotic and wild mushrooms contain higher amount of glucose, mannose was also present in significant amount but galactose was observed in lower concentration in commercial mushrooms as it was not detected in G. lucidum. 4.20. Characterization of polysaccharides from selected mushrooms Nature constantly synthesizes huge amounts of polysaccharides which serve for the most part as structural scaffolds like chitin in animals and cellulose in plants or as storage carbohydrates like starch and glycogen in animals. Mushrooms polysaccharides have been extensively studied as immune modulators and adjuvant agents in the management of cancer treatment. These fungi have been increasingly consumed by the majority of cancer patients during their treatments as dietary supplements (Hardy, 2008). A special group of β-1,3 linked polyglucose is widely spread in various bacteria, fungi, mushrooms, algae and higher plants. Mushrooms polysaccharide has attracted attention because of bioactive and medicinal properties such as immune modulating, antimicrobial, anti-inflammatory, anti-infective, cholesterol lowering, antiviral, radioprotective, antitumoral and wound-healing potential (Kogan, 2000). 4.20.1. Extraction and purification of polysaccharide Crude polysaccharides were obtained from selected mushrooms by hot water extraction. The extracts were fractionated and purified by anion exchange chromatography. Crude polysaccarides 500 mg were dissolved in 10 mL water and loaded on DEAE cellulose column. The elutions of polysaccharides were monitored by phenol sulfuric acid assay and concentrations of polysaccharides in all mushrooms are shown in fig 4.22. The major fractions were further purified with gel filtration chromatography on sephadex G200 column. Purified polysaccharide fraction were obtained and lyophilized for SEM and FTIR spectroscopy.

123

Chapter # 4 Results and Discussion

3.5 3 4.5 4 2.5

3.5

2 3 2.5 1.5 2 1 1.5 1

Concentration 0.5 Concentration 0.5 0 0 0 20 40 0 20 40 Vial no. Vial no.

(a) (b)

1.2 1.4

1 1.2

0.8 1 0.6 0.8 0.4 0.6 0.4 0.2

Concentration 0.2 Concentration 0 0 1 6 11 16 21 26 1 6 11 16 21 26 31 36 Vial no. Vial no.

(c) (d)

3

2.5 2 1.5 1 0.5

Concentration 0 1 6 11 16 21 26 31 36 Vial no.

(e) Fig 4.24. Polysaccharide concentration after ion exchange chromatography in selected mushrooms (a) L. edodes (b) P. ostreatus (c) V. volvacea (d) H. erinaceus (e) G. lucidum 4.20.2. Scanning Electron Microscopy (SEM) To observe the surface morphology and in order to determine the morphological changes in the structure and to verify the arrangement of glucan (crude and purified), scanning electron microscopy was carried out (Fig 4.25). Scanning electron microscopy confirmed that there 124

Chapter # 4 Results and Discussion was a particular change in surface morphology of the glucan. There was a clear difference in between the crude and purified glucans, when water molecules were removed from them by the process of lyophilization a soft structure was formed fig 4.25. The surfaces of these samples were scanned by the use of magnification power at 10µm.

(a)

(b)

(c)

125

Chapter # 4 Results and Discussion

(d)

(e)

Fig 4.25. Scanning Electron Microscopy (SEM) of crude and purified polysaccharide from selected mushrooms (a) P. ostreatus (b) L. edodes (c) V. Volvacea (d) H. erinaceus (e)G. lucidum 4.20.3. Fourier transformation infrared spectroscopy (FTIR)

Infrared spectroscopy gives us information about the evidence of presence of different functional groups such as O-H, N-H and C=O and about the molecular structure. Many functional groups are present in the organic compounds. In polymer segments the vibrations of groups have effect on the intermolecular interactions and this information can be obtained by doing FT-IR analysis. FT-IR spectra of the polysaccharides were recorded and characteristics wave numbers were observed. In the spectrum of crude and purified polysaccharide from H. erinaceus mushroom (Fig 4.26a) the broad peak 3753.49 cm-1 and at 3660 cm-1 were observed and these were due to the stretching behavior of O-H bond and the other absorption peak at about 2357.76 cm-1, 2326.84 cm-1 were the result of stretching modes of C-H group. Two absorption bands at 126

Chapter # 4 Results and Discussion

957.61 cm-1 which were in the range of 1000-1200 cm-1 (mainly CC and CO stretching vibrations in pyranoid rings) showed that pyranose was the monosaccharide unit in the crude polysaccharides and it also showed that polysaccharides are the major components. A broad peak appeared at 1562.72 cm-1 and weak peak at 1500.0 cm-1 confirmed the presence of carboxyl group. However, a small absorption peak at 842.77 cm-1,732 cm-1 and 608.68 cm-1 could be linked with the β-glycoside linkage between the sugar monomers. In the spectrum of purified glucan (Fig 4.26a1) the stretching of O-H vibration was found at 3610.9 cm-1 as well as C-H stretching mode was at 2344.5 cm-1. A slight modification was observed between crude and pure polysaccharides. In the spectrum of crude and purified glucan from V. volvacea (Fig 4.26,b:b1), the broad peak 3391.3 cm-1 was observed and this was due to the stretching behaviour of O-H bond and the other absorption peak at about 2984.5 cm-1, 2348.9 cm-1 were the result of stretching modes of C-H group. The absorption peak at 798.0576 cm-1 indicated the presence of lipids. Small bands at 1655.48, 1615.72 cm-1 that could be due to protein degradation products bound to polysaccharide. The peaks at 882.8852 cm-1 and 1037.11 cm-1 were observed for β- glycosidic bonds. In the spectrum of crude and purified glucan from L. edodes (fig 4.26 c,c1), the broad peak 3863.9 cm-1 and at 3850.6 cm-1 were observed and these were due to the stretching behavior of O-H bond and the other absorption peak at about 2768.53 cm-1, 2357.76 cm-1 were the result of stretching modes of C-H group. The absorption peaks at 847. 1938 cm-1 and 829.5264 cm-1 in the crude and purified glucans were observed for β-glycosidic bonds.

(a)

127

Chapter # 4 Results and Discussion

(a1)

(b)

(b1)

128

Chapter # 4 Results and Discussion

(c)

(c1)

(d)

129

Chapter # 4 Results and Discussion

(d1)

(e)

(e1)

Fig 4.26. FT-IR Spectra of crude and purified polysaccharides from (a, a1) H. erinaceus, (b, b1) V. volvacea, (c, c1) L. edodes, (d, d1), P. ostreatus (e, e1) G. lucidum, (a) Crude polysaccharide, (a1) purified glucan. The spectra of corresponding fractions isolated from P. ostreatus and G.lucidum mushrooms are presented in figures (Fig 4.26, d, d1: e, e1). They showed several intense highly overlapped IR bands in the region of 950–1200 cm-1 (mainly CC and CO stretching

130

Chapter # 4 Results and Discussion vibrations in pyranoid rings) indicating the presence of polysaccharides as major components. Partially, the intense band at 1150–1160 cm-1 was assigned to COC stretching of glycosidic bonds. The weaker band near 894 cm-1 is specific for β-glycosidic bonds and therefore, indicates the presence of β-glucans. Other bands and shoulders assigned to β- glucans were found near 1376, 1317, 1162, 1100, 1080, 1040 and 990 cm. Bands at 1650 and 1540 cm-1 were assigned respectively to amide I and amide II vibrations of proteins. The amide I bands were overlapped by in-plane deformation of water near 1640 cm-1 and therefore, cannot be used itself for identification of amide bonds. Band at 1649 cm-1 (amide I) together with the band at 1562 cm-1 (amide II) indicate the presence of α-chitin. Sharp -1 bands at 2924 and 2856 cm were assigned to CH2 stretching vibrations of lipids. Small bands at 1600, 1580 (shoulder) and 812–692 cm-1 that could be owing to protein degradation products bound to polysaccharide and more intense CH2 stretching bands together with -1 -1 -1 smaller features at 1738 cm (C=O stretching), 1675 cm (CH2 bending) and 720 cm (CH2 rocking) indicate the presence of lipids. According to Zhang et al. (2012) in the infrared spectra of the purified glucan, a broadly stretched intense peak at 3400 cm-1 represents the characteristic of hydroxyl groups and a weak peak indicated C-H band at around 2920 cm-1. The relatively strong absorption peak at around1640 cm-1 indicated the characteristic of C=O. The absorbance of polysaccharides in the range 950–1200 cm-1 is due to the stretching vibration of C-O-C, C-O-H bonds. The bands in the range of 350–600 cm-1 are assigned to skeletal modes of pyranose rings. The bands towards 1720 and 1251 cm-1 of indicated the trace of uronic acids and ester sulfate inthe samples. Sarangi et al., (2011) reported FTIR of polysaccharides with broad peaks at 3217.2 cm-1 and Grosev et al. (2005) also reported broad peaks of glucan in a region of 3600- -1 -1 3200 cm while a smaller peak at 2916 cm is certified to C-H stretching vibrations of CH2 group same findings were reported by Qian et al. (2009). 4.20.4. UV-Vis spectroscopic analyses of polysaccharide based silver nano- particles Silver nanoparticles has gained boundless interests because of their unique properties such as chemical stability, good conductivity, antibacterial, anti-viral, antifungal and anti- inflammatory activities (Klaus-Joerger et al., 2001; Ahmad et al., 2003). Silver nitrate and purified polysaccharide were used for the preparation of silver nano-particles. This process

131

Chapter # 4 Results and Discussion involved the green synthesis of silver nanoparticles by the help of autoclaving. These polysaccharides act as stabilizing and reducing agent during silver nanoparticles synthesis. The silver nanoparticles becomes sterile and safe after autoclaving it. This method of production is according to the requirement of the green chemistry principles (Kora et al., 2010). These polysaccharides expand to become more available for silver ions to react with functional group. The hydroxyl groups oxidize to carbonyl groups caused by the presence of silver ions, and these silver ions get reduced to elemental silver. The prepared silver nanoparticles were characterized by spectral analysis in the region of UV/visible using spectrophotometer in the wave length ranged 190-500 nm. This is the most extensively used simple and sensitive technique for the confirmation of silver nanoparticles. Absorption spectra of polysaccharide base silver nanoparticles and polysaccharide extract was recorded to observe the production of Ag nanoparticles by UV-vis spectroscopy. The spectrums obtained from both are shown in Fig 4.27.

(a)

(a1)

132

Chapter # 4 Results and Discussion

(b)

(b1)

(c)

(c1)

133

Chapter # 4 Results and Discussion

(d)

(d1)

(e)

(e1)

Fig 4.27. UV-Vis spectra of polysaccharides and polysaccharides based silver nano- particles of mushrooms (a, a1) V. volvacea (b, b1) P. ostreatus (c, c1) L. edodes (d, d1) H. erinaceus (e, e1) G. lucidum Note: (a) polysaccharide (a1) polysaccharide based nano particles. In both graphs, the peaks present at high absorbance contain polysaccharide based silver nanoparticles and the lower peaks are the polysaccharide extracts. Silver nanoparticles

134

Chapter # 4 Results and Discussion formed from both polysaccharides exhibited strong peak around 190-250 nm. Peaks at this range are due to surface plasma resonance (SPR) and it is responsible for conducting electrons present at the surface of Ag nano-particles. The dark yellowish color of silver nanoparticles is due the surface plasma resonance transition (Bankura et al., 2012). There were no peaks in the region of 314-500 nm which is the confirmation of nanocluster formation or aggregation of nanoparticles (Kora et al., 2010). As the silver nanoparticles of natural extract is an emerging field and our results showed that silver particles were effectively bound with the polysaccharides identified from the mushrooms. These silver nanoparticles can be investigated further for the potential of antimicrobial activities.

135

SUMMARY

Mushrooms can be used in diet as nutraceutical or functional foods maintaining and promoting health longevity and health quality. Nutraceuticals are derived from various natural sources such as medicinal plants, marine organisms, fruits and vegetables. Mushrooms are comparable to medicinal plants and can be used in the form of extracts and powder for prevention, alleviation, healing of diseases and in providing a healthy balanced diet. In current study, wild Ganoderma lucidum was collected from Jinnah garden Faisalabad, while two commercial locally cultivated and available mushrooms Pleurotus ostreatus and Volvariela volvacea were collected from Horticulture Department, University of Agriculture Faisalabad, and two commercial locally available exotic mushrooms Lentinus edodes and Hericium erinaceus were purchased from local market. The selected mushrooms were evaluated for their nutritional value, as well as for their nutraceutical properties. Prior to extraction, all these selected mushrooms were subjected to proximate composition analysis. Protein, fat, ash and total carbohydrate contents ranged from 15.04-21.14%, 0.53-2.02%, 2.01-7.02%, 65.34-82.47%, respectively. G. lucidum had the highest contents of carbohydrate (82.47%) and fiber (54.12%) on dry weight basis. The total calorie values were found in the range of 363.4-395.8 kcal/100 g. Minerals analyzed by inductivity coupled plasma-optical emission spectrometry (ICP-OES), revealed that Ca, Mg, P, K, Fe and Na were present in considerable amounts, while contents of toxic heavy metal such as Pb, As and Cd were below detection limit. P. ostreatus stands out to be rich source of K (2395.04 mg/100g), P (833 mg/100g), Na (395.80 mg/100g), Mg (125.40 mg/100g) and Ca (61.33 mg/100g). V. volvacea proved to be relatively more affluent in concentration of K (3547 mg/100g), Mg (145.66 mg/100g), Na (42.10 mg/100g) and Fe (17.70 mg/100g). Qualitative macro and micro mineral profile by laser induced breakdown spectroscopy (LIBS) identified various elements such as iodine, manganese, barium, titanium, vanadium, nitrogen, carbon and hydrogen. The selected mushrooms were evaluated for their capacity to provide a dietary source of essential and non essential amino acids. According to the data all amino acids were present in significant amounts except tryptophan. The mushrooms were extracted with 80% ethanol and fractionated with non polar n- hexane followed by solvents of ascending polarity, dichloromethane, ethyl acetate and water for the assessment of antioxidant and antimicrobial potentials. A moderate antimicrobial potential was exhibited by all mushrooms against

136

Summary selected bacterial (E. coli, P. multocida, B. subtilis and S. aureus) and fungal species (A. niger, A. flavus, F. solani and H. maydis). Antioxidants were determined by measuring total phenolics and total flavonoid contents. Ethyl acetate and water fractions of H. erinaceus and V. volvacea contained phenolic contents in the range of 0.82-8.36 mg/g and 1.52-7.59 mg/g respectively. HPLC analysis showed that chlorogenic acid (11.4955±0.1 µg/g), ferulic acids (7.8450±0.7 µg/g) and p. cumaric acid (3.1891±0.2 µg/g) were chief phenolics in H. erinaceus, while maximum amount of caffeic acid was observed in P. ostreatus (6.5172±8.7 µg/g). Two methods were used for determining antioxidant activity, DPPH radical scavenging and reducing power capacity. The water fractions were found to be the most active in DPPH assay demonstrating 4.7-19.6 mg/g EC50 values, and similar trend was observed for reducing power assay. The selected mushrooms were also screened for their toxic potential. Toxicological screening of these mushrooms against brine shrimp nauplii showed that the commercial mushrooms are safe for use, whereas slight toxicity was observed in dichloromethane fractions of G. lucidum. Qualitative and quantitative analyses represent a diverse range of phytoconstituents present in mushrooms, like alkaloids, tannins, saponins and β-carotene which might be responsible for their therapeutic potential. Biological activities of the selected mushrooms were assessed by determining their potential as anti-cancerous and antithrombus. G. lucidum showed maximum cytotoxicity on H-29 colon carcinoma cell lines with 29% viability of cells followed by H. erinaceous 66%, L. edodes 68%, V.volvacea 83% and P. ostreatus 84%, whereas in case of H-1299 cell lines, 24% viability of cells was shown by G. lucidum followed by P. ostreatus 61% and H. erinaceus 72%. In contrast, the maximum percentage of clot lysis was shown by H. erinaceus followed by V. volvacea, L. edodes and p. ostreatus and low activity was observed in G. lucidum. G. lucidum was also found a potent inhibitor of tyrosinase and α-glucosidase enzymes. Quantification of fatty acids by GC/MS revealed that linolenic acid was present in highest concentration in V. volvacea 16.013 mg/g followed by P. ostreatus 10.25 mg/g. Unsaturated fatty acids (UFA) predominated over the saturated fatty acids in all the studied mushrooms except in G. lucidum. The order of γ-tocopherol concentration in selected mushrooms was elevated in V. volvacea followed by H. erinaceus, P. ostreatus, L. edodes and G. lucidum. The order of Lutein concentration was observed as H. erinaceus > V. volvacea > G. lucidum > P. ostratus > L. edodes. Special attention was

137

Summary paid to mushrooms monosaccharides, disaccharides and polysaccharides composition. Analysis showed that glucose, galactose and mannose were present in high amounts in the studied mushrooms. Glucose was observed in higher amount in G. lucidum (86.1±2.8%) followed by V. volvacea (76.7±8.4%), P. ostreatus (66.2±0.1%), L.edodes (49.4±1.0%) and H. erinaceus (45.5±7.7%). Rhamnose was not detected in all the studied species whereas fucose and arabinose were not observed in P. ostreatus. Linkage analysis showed that glucose is the main sugar, while small amounts of D-galactose and D -mannose were also present in the studied mushrooms. Methylation analysis indicated that (1-3;1-4)-β-glucan was major component and xyloglucan and glucosamannan as minor components. The polysaccharides from selected mushrooms were extracted, purified, and characterized by Scanning Electron Microscopy (SEM), Fourier Transformation Infrared spectroscopy (FTIR) and UV/visible spectroscopy. On the basis of current data, locally cultivated V. volvacea, P. ostreatus and locally grown wild G. lucidum were found nutritious and non-toxic as well as possess antimicrobial, antioxidant, antithrombolytic and anti-cancerous potential. Conclusion and Future prospects The results from our studies confirm similar reports by others as well as showed indicator compounds that could have been responsible for their activity against infectious diseases caused by microbes, acclaimed traditional system of medicine. Further studies to substantiate our findings and their development into healthy nutritious food are recommended.

138

LITERATURE CITED

Adejumo, T. O. and O. B. Awosanya. 2005. Proximate and mineral composition of four edible mushroom species from South Western Nigeria. African Journal of Biotechnology. 4 (10): 1084-1088. Ahmad A, P. Mukherjee, S. Senapati, D. Mandal, M. I. Khan, P. Kumar, M. Sastry. 2003. Extracellular biosynthesis of silver nanoparticles using the fungus Fusarium oxysporum. Colloids Surf B. Biointerfaces. 28: 313–8. Aida, F. M. N., A. M. Shuhaimi, M. Yazid and A. G. Maaruf. 2009. Mushroom as a potentialSource of Prebiotics.Trends in Food Science and Technology. (20): 567-575. Ainsworth, E. A. and K. M. Gillespie. 2007. Estimation of total phenolic content and other oxidation substrates in plant tissues using Folin-ciocalteu reagent. Nature protocols. 2(4): 875-877. Akinyele I. O. and O. S. Shokunbi. 2015. Concentrations of Mn, Fe, Cu, Zn, Cr, Cd, Pb, Ni in selected Nigerian tubers, legumes and cereals and estimates of the adult daily intakes. Food Chemistry. 173: 702–708. Altschul, S. F., W. Gish, W. Miller, E. W. Myers and D. J. Lipman. 1990. Basic local alignment search tool. Journal of Molecular Biology. 215: 403.

Alves, M. J., I.C.F.R. Ferreira, A. Martins and M. Pintado. 2012. Antimicrobial activity of wild mushroom extracts against clinical isolates resistant to different antibiotics. Journal of Applied Microbiology. 113: 466-475 Ansari V. A., H. H. Siddiqui and S. P. Singh. 2012. Antithrombotic and Thrombolytic activity of Terminalia belerica fruit extracts. Research Journal of Pharmaceutical, Biological and Chemical Sciences. 3(2): 471-478. Arbaayah, H. H. and Y. U. Kalsom. 2013. Antioxidant properties in the oyster mushrooms (Pleurotus spp.) and split gill mushroom (Schizophyllum commune) ethanolic extracts. Mycosphere. 4: 661-673. Assunção, L. S., J. M. R. da Luz, M. d. C. S. da Silva, P. A. F. Vieira, D. M. S. Bazzolli, M. C. D. Vanetti and M. C. M. Kasuya. 2012. Enrichment of mushrooms: An interesting strategy for the acquisition of lithium. Food Chemistry. 134: 1123-1127.

139

Literature Cited

Babu, P. D. and R. S. Subhasree. 2010. Valuing the Suitable Agro-Industrial Wastes for Cultivation of P. platypus and P. ostreatus.Advances in Biological Research. 4 (4): 207-2010. Badshah, H., F. Ullah, M. U. Khan, A. S. Mumtaz and R. N. Malik. 2015. Pharmacological activities of selected wild mushrooms in South Waziristan (FATA), Pakistan. South African Journal of Botany. 97: 107–110. Baek, H. S., H. S. Rho, J. W. Yoo, S. M. Ahn, J. Y. Lee, J. Lee, M. K. Kim and I. S. Chang. 2008. The inhibitory effect of new hydroxamic acid derivatives on melanogenesis. Bull Korean Chemical Sciences. 29: 43-46. Bankura, K. P., D. Maity, M. M. R. Mollick, D. Mondal, B. Bhowmick, M. K. Bain, A. Chakraborty, J. Sarkar, K. acharya and D. Chattopadhya. 2012. Synthesis, characterization and antimicrobial activity of dextran stabilized silver nanoparticles in aqueous medium. Carbohydrate polymer. 89: 1159-1165. Barros, L., D. M. Correia, I. C. F. R. Ferreira, P. Baptista and C. Santos-Buelga. 2008. Optimization of the determination of tocopherols in Agaricus sp. Edible mushrooms by a normal phase liquid chromatographic method. Food Chemistry. 110: 1046–1050. Barros, L., M. Duenas, I. Ferreira, P. Baptista and C. Santos-Buelga. 2009. Phenolic acids determination by HPLC-DAD-ESI/MS in sixteen different Portuguese wild mushrooms species. Food and Chemical Toxicology. 47: 1076–1079. Barros, L., P. Baptista, D. M. Correira, S. Casa, B. Oliveira and I. C. F. R. Ferreira. 2007. Fatty acid and sugar compositions and nutritional value of five wild edible mushrooms from Northeast Portugal. Food Chemistry. 105 (1): 140–145. Barros, L., S. A. Heleno, A. M. Carvalho and I. C. Ferreira. 2010. Lamiaceae often used in portuguese folk medicine as a source of powerful antioxidants: Vitamins and phenolics. LWT-Food Science and Technology. 43: 544-550. Barros, L., T. Cruz, P. Baptista, L. M. Estevinho and I. C. F. R. Ferreira. 2008. Wild and commercial mushrooms as source of nutrients and nutraceuticals. Food and Chemical Toxicology. 46: 2742–2747. Becker, E. M., L. R. Nissen and L. H. Skibsted. 2004. Antioxidant evaluation protocols: Food quality or health effects. European Food Research and Technology. 219: 561- 571.

140

Literature Cited

Beluhan, S. and A. Ranogajec. 2011. Chemical composition and non-volatile components of Croatian wild edible mushrooms. Food Chemistry. 124: 1076–1082. BeMiller, J. and J. Bohn. 1995. Β-d-glucans as biological response modifiers: A review of structure-functional activity. Carbohydr Polym. 28: 3-14. Bisen, P. S., R. K. Baghel, B. S. Sanodiya, G. S. Thakur and G. B. Prasad. 2010. Lentinusedodes: a macrofungus with pharmacological activities. Current Medicinal Chemistry. 17: 2419–30. Borchers, A. T., A. Krishnamurthy, C. L. Keen, F. J. Meyers and M. E. Gershwin. 2008. The immunobiology of mushrooms. Experimental Biology and Medicine. 233: 259–76. Bozin, B., N. Mimica-Dukic, N. Simin and G. Anackov. 2006. Characterization of volatile composition of essential oil of some lamiaceae species and the antioxidant and antimicrobial activities of the entire oils. Journal of Agriculture and Food Chemistry. 54: 1822-1828. Brahmi, F., E. Mechri, S. Dabbou, M. Dhibi and M. Hammami. 2012. The efficacy of phenolics compounds with different polarities as antioxidants from olive leaves depending on seasonal variations. Industrial Corps and Products. 38: 146-152. Burlingame, B., R. Charrondiere and B. Mouille. 2009. Food composition is fundamental to the cross-cutting initiative on biodiversity for food and nutrition. Journal of Food Composition and Analysis. 22: 361–365. Chang S. T. 2008. Overview of mushroom cultivation and utilization as functional foods. In: Cheung PCK, editor. Mushrooms as functional foods. New Jersey: John Wiley & Sons Inc. 1–33. Chatha, S., S. A., F. Anwar, M. Manzoor and J. R. Bajwa. 2006. Evaluation of the antioxidant activity of rice bran extracts using different antioxidant assays. Grasas y aceites. 57: 328-335. Chen, H., J. Ying, J. Li and M. Yua. 2012. Antioxidant activities of polysaccharides from Lentinus edodes and their significance for disease prevention, International Journal of Biological Macromolecules. 50: 214– 218. Chen, Y., W. Bicker, J. Wu, M. Y. Xie and W. Lindner. 2010. Ganoderma species discrimination by dual-mode chromatographic fingerprinting: A study on stationary phase effects in hydrophilic interaction chromatography and reduction of sample

141

Literature Cited

misclassification rate by additional use of reversed-phase chromatography. Journal of Chromatography. 1217: 1255–1265. Cheung, L. M., P. C. K. Cheung and V. E. C. Ooi. 2003. Antioxidant activity and total phenolics of edible mushroom extracts.Food Chemistry. 81: 249–255. Cheung, P. C. K. 2010. The nutritional and health benefits of mushrooms. Nutrition Bulletin. 35: 292–299. Chihara, G. 1992. Immunopharmacology of Lentinan, a polysaccharide isolated from Lentinus edodes: its applications as a host defence potentiator. International Journal of Oriental Medicine.17: 57-77. Choi, J. H., D. W. Kim, S. E. Park, B. S. Choi, K. Sapkota, S. Kim and S. J. Kim. 2014. Novel thrombolytic protease from edible and medicinal plant Aster yomena (Kitam.) Honda with anticoagulant activity: Purification and partial characterization.Journal of Bioscience and Bioengineering. 118 (4): 372-377. Clapham, M. W., J. G. Foster, J. P. S. Neel and J. M. Fedders. 2005. Fatty acid composition of traditional and novel forages.Journal of Agricultural Food chemistry. 53: 10068- 10073. Colak, A. F. and E. Sesli. 2009. Nutritional composition of some wild edible mushrooms. Turkish Journal of Biochemistry. 34(1): 25–31. Cremers, D. A. and L. J. Radziemski. 2006. Handbook of Laser-Induced Breakdown Spectroscopy. John Wiley and Sons, Ltd, England. Cukalovic, I. L., S. Despotovic, N. Lakic, M. Niksic, V. Nedovic and V. Tesevic. 2010. Ganoderma lucidum — Medical mushroom as a raw material for beer with enhanced functional properties. Food Research International. 43: 2262–2269. Cumagun, C. J. R., J. Hockenhull and M. Lubeck. 2000. Characterization of Trichoderma isolates from Philippine rice fields by UP-PCR and rDNA-ITS1 analysis: Identification of UP-PCR markers. Journal of Phytopathlogy. 48: 109-115. daSilva, M. C., J. Naozuka, P. V. Oliveira, M. C. Vanetti, D. M. Bazzolli, N. M. Costa and M. C. Kasuya. 2010. In vivo bioavailability of selenium in enriched pleurotus ostreatus mushrooms. Metallomics. 2: 162-166.

142

Literature Cited

Degenhardt, A., S. Habben and P. Winterhalter, 2002. Isolation of the lignan secoisolariciresinol diglucoside from flaxseed (Linum ustitatissimum L.) by high- speed counter-current chromatography. Journal of Chromatogr. 943: 299-302. Demirel, S., M. Tuzen, S. Saracoglu and M. Soylak. 2008. Evaluation of various digestion procedures for trace element contents of some food materials.Journal of hazardous materials. 152: 1020-1026. Diez, V. A. and A. Alvarez. 2001. Compositional and nutritional studies on two wild edible mushrooms from northwest Spain. Food Chemistry.75: 417–422. Dong, H., M. Li, F. Zhu, F. Liu, J. Huang. 2012. Inhibitory potential of trilobatin from Lithocarpus polystachyus Rehdgainst α-glucosidase and α-amylase linked to type 2 diabetes. Food Chemistry. 130: 261–266. Dubois, M., K. A. Gilles, J. K. Hamilton, P. A. Rebers and F. Smith. 1956. Colourimetricmethod for determination of sugars and related substances. Analytical Chemistry. 28: 350-356. Dulger, B., C. C. Ergul and F. Gucin. 2002. Antimicrobial activity of the macrofungus Lepista nuda. Fitoterapia. 73: 695-697. Egwim, E. C.R., C. Elem and R. U. Egwuche. 2011. Proximate composition, phytochemical screening and antioxidant activity of ten selected wild edible Nigerian mushrooms.American journal food and nutrition. 1(2): 89-94. Ehssan, H. O. and A. M. Saadabi. 2012. Screening of antimicrobial activity of wild mushrooms from Khartoum State of Sudan. Microbiology Journal. 2: 64-69. Elmastas, M., O. Isildaka, I. Turkekulb and N. Temur. 2007. Determination of antioxidant activity and antioxidant compounds in wild edible mushrooms. Journal of Food Composition and Analysis. 20: 337-345. Ergönül, P. G., I. Akata, F. Kalyoncu and B. Ergönül. 2013. Fatty Acid Compositions of Six Wild Edible Mushroom Species. Hindawi Publishing Corporation. The Scientific World Journal. Article ID 163964. http://dx.doi.org/10.1155/2013/163964. Falandysz, J. 2008. Selenium in edible mushrooms.Journal of Environmental Science and Health, Part C: Environmental Carcinogenesis and Ecotoxicology Reviews. 26: 256– 299.

143

Literature Cited

Falandysz, J., A. Mazur, A. K. Kojta, G. Jarzynska, M. Drewnowska and A. Dry_załowska. 2012. Mercury in fruiting bodies of dark honey fungus (Armillaria solidipes) and beneath substratum soils collected from spatially distant areas. Journal of the Science of Food and Agriculture. 93: 853–858. Falandysz, J., T. Kunito, K. R. Gucia, A. Mazur, J. Falandysz and S. Tanabe. 2008. Some mineral constituents of Parasol Mushroom Macrolepiota procera. Journal of Environ Science Health. 43:187–192. Faridur, R. M., K. M. Rezaul., I. M. Farhadul., H. M. Rowshanul and H. M. Tofazal. 2010. Phytochemical and cytotoxic investigation of Oyster mushrooms. International research Journal of Pharmacy. 1(1): 342-345. Ferlay, J., H. R. Shin, F. Bray, D. Forman, C. Mathers and D. M. Parkin. 2010. Estimates of worldwide burden of cancer in 2008: Globocan 2008. International journal of cancer. 127: 2893-2917. Ferlay, J., I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D. M. Parkin, D. Forman and F. Bray. 2015. Cancer incidence and mortality worldwide: Sources, methods and major patterns in globocan 2012. International journal of cancer. 136: E359-E386. Ferreira, I. C. F. R., L. Barros and R. M. V. Abreu. 2009. Antioxidants in wild mushrooms. Current Medicinal Chemistry. 16: 1543–1560. Finimundy, T. C., G. Gambato, R. Fontana, M. Camassola, M. Salvador, S. Moura, J. Hess, J. A. P. Henriques, A. J. P. Dillon and M. Roesch-Ely. 2013. Aqueous extracts of Lentinula edodes and Pleurotus sajor-caju exhibit high antioxidant capability and promising in vitro antitumor activity. Nutriton Research. 33: 76 – 84. Finney D. J. Probit analysis. 3rd ed. Cambridge: Cambridge University Press; 1971 Fujita, P., J. Keogh, M. Noakes, C. Margetts and P. Taylor. 2003. The role of edible mushrooms in health: Evaluation of the evidence. Journal of Fuctional Foods. 999: 675-680. Fukushima, N. S. and H. Tsuda. 1985. Carcinogenity and modification of the carcinogenic response by BHA, BHT and other antioxidants. Critical Reviews in Toxicology. 15: 109–150.

144

Literature Cited

Gangadevi, V., S. Yogeswari, S. Kamalraj, G. Rani and J. Muthumary. 2008. The antibacterial activity of Acalypha indica L. Indian Journal of Science and Technology. 1(6): 1-5. Gezer, K., M. Duru, I. Kivrak, A. Turkoglu, N. Mercan, H. Turkoglu and S. Gulcan. 2006. Free-radical scavenging capacity and antimicrobial activity of wild edible mushroom from Turkey. 5(20): 1924-1928. Graham, G. C., S. P. Mayer and R. J. Henry. 1994. A simplified method for the preparation of fungal genomic DNA for PCR and RAPD analysis. Biotechniques. 16(1): 48–50.

Grosev, M. V., R. Bozaic and J. Gerwin. 2005. Puppels Vibrational spectroscopic characterization of wild growing mushrooms and toadstools. Journal of Spectrochimica Acta. 57: 2815–2829. Guan, J., F. Yang and S. P. Li. 2010. Evaluation of Carbohydrates in Natural and Cultured Cordyceps by Pressurized Liquid Extraction and Gas Chromatography Coupled with Mass Spectrometry. 15: 4227-4241. Guillamón, E., A. García-Lafuente, M. Lozano, M. D‘Arrigo, M. A. Rostagno, A. Villares and J. A. Martínez. 2010. Edible mushroom: Their roles in the prevention of cardiovascular diseases. Fitoterapia. 81: 715–723. Gursoy, N., C. Sarikurkcu, M. Cengiz and M. H. Solak. 2009. Antioxidant activities, metal contents, total phenolics and flavonoids of seven Morchella species. Food and Chemical Toxicology. 47: 2381–2388. Haider, M. S., I. A. Khan, S. A. Naqvi, M. J. Jaskani, R. W. Khan, Nafees, Maryam and I. Pasha. 2013. Fruit developmental stages effects on biochemical attributes in date palm. Pakistan Journal of Agriculture Sciences. 50(4): 577-583. Hardy, M. L. 2008. Dietary supplement use in cancer care: Help or harm. Hematology/ Oncology Clinics of North America. 22: 581–617. Hatvani, N. 2001. Antibacterial effect of the culture fluid of Lentinus edodes mycelium grown in submerged liquid culture. Antimicrobial Agents. 17: 71-74. Hearst, R., D. Nelson, G. McCollum, B. C. Millar, Y. Maeda, C. E. Goldsmith, P. J. Rooney, A. Loughrey, J. R. Rao and J. E. Moore. 2009. An examination of antibacterial and antifungal properties of constituents of Shiitake (Lentinula edodes) and Oyster

145

Literature Cited

(Pleurotus ostreatus) mushrooms. Complementary Therapies in Clinical Practice. 15: 5–7. Heleno, A. S., L. Barros, A. Martins, M. J. R. P. Queiroz, C. Santos-Buelga and I. R. F. C. Ferreira. 2012. Phenolic, polysaccharidic, and lipidic fractions of mushrooms from northeastern Portugal: chemical compounds with antioxidant properties. Journal of Agricultural Food Chemistry. 60: 4634-4640. Heleno, S. A., L. Barros, M. J. Sousa, A. Martins and I. C. F. R. Ferreira. 2009. Study and characterization of selected nutrients in wild mushrooms from Portugal by gas chromatography and high performance liquid chromatography. Microchemical Journal. 93: 195-199. Heleno, S. A., L. Barros, M. J. Sousa, A. Martins and I. C. F. R. Ferreiraa. 2010. Tocopherols composition of Portuguese wild mushrooms with antioxidant capacity.Food Chemistry. 119: 1443–1450. Hua, K. F., H. Y. Hsu, L. K. Chao, S. T. Chen, W. B. Yang and J. Hsu. 2007. G. lucidum polysaccharides enhance CD14 endocytosis of LPS and promote TLR4 signaltransduction of cytokine expression. Journal of Cell Physiology. 212: 537–50. Hua, Y., T. Wang, X. Yang and Y. Zhao. 2014. Analysis of compositional monosaccharides in fungus polysaccharides by capillary zone electrophoresis. Carbohydrate Polymers. 102: 481–488. Hung, P. V. and N. N. Y. Nhi. 2012. Nutritional composition and antioxidant capacity of several edible mushrooms grown in the Southern Vietnam.International Food Research Journal. 19(2): 611-615. Igwe, C. U., O. A. Ojiako, K. C. Anugweje, L. A. Nwaogu and C. O. Ujowundu. 2012. Amino acid profile of raw and locally processed seeds of Prosopis africana and Ricinus communis: potential antidotes to protein malnutrition. Functional foods in health and disease. 2(4): 107-119. Intl, A. 1995. Official methods of analysis of aoac international. Arlington, Va.: AOAC Intl. pv (loose-leaf). Iteku, B. J., S. Li, X. Peng, R. M. R. Kassim, B. Liu and Y. Zhou. 2013. Purification, structural elucidation and antitumor activity of a novel mannogalactoglucan from the fruiting bodies of Lentinus edodes. Fitoterapia. 84: 338–346.

146

Literature Cited

Iwalokun, B. A., U. A. Usen, A. A. Otunba and D. K. Olukoya. 2007. Comparative phytochemical evaluation, antimicrobial and antioxidant properties of Pleurotus ostreatus. African Journal of Biotechnology. 6(15): 1732-1739. Jahan, N., R. Bajwa, T. Kausar, S. Baig, N. Habib and M. B. Bhatti. 2010. Productivity of Pleurotus ostreatus under solid state fermentation on lignocellulosic substrates. Mycopathology. 6(1-2): 51-56. Jayakumar, T., P. A. Thomas and P. Geraldine. 2007. Protective effect of an extract of the oyster mushroom (Pleurotus ostreatus) on antioxidants of major organs of aged rats.Experimental Gerontology. 42: 183–191. Jayakumar, T., P. A. Thomas and P. Geraldine. 2009. In-vitro antioxidant activities of an ethanolic extract of the oyster mushroom, Pleurotus ostreatus. Innovative Food Science and Emerging Technologies. 10: 228–234. Jayakumar, T., P. A. Thomas, J. R. Sheu and P. Geraldine. 2011. In-vitro and in-vivo antioxidant effects of the oyster mushroom Pleurotus ostreatus. Food Research International. 44: 851–861. Jeff, I. B., X. Yuana, L. Suna, R. M. R. Kassima, A. D. Fodaya and Y. Zhoua. 2013. Purification and in vitro anti-proliferative effect of novel neutral polysaccharides from Lentinus edodes. International Journal of Biological Macromolecules. 52: 99– 106. Jeong, S. C., Y. T. Jeong, B. K. Yang, R. Islam, S. R. Koyyalamudi, G. Pang, K. Y. Choa and C. H. Song. 2010. White button mushroom (Agaricus bisporus) lowers blood glucose and cholesterol levels in diabetic and hypercholesterolemic rats. Nutrition Research. 30: 49–56. Jian-Hua, X., M. Y. Shen, S. P. Nie, X. Liu, H. Zhang and M. Y. Xie. 2013. Analysis of monosaccharide composition of Cyclocarya paliurus polysaccharide with anion exchange chromatography. Carbohydrate Polymers. 98: 976–981. Jing, N., J. Shi, G. Li, Z. Sun and J. You. 2012. Determination of fatty acids from mushrooms using high performance liquid chromatography with fluorescence detection and online mass spectrometry. Food Research International. 48: 155–163. Kadiri, M. and I. C. Fasidi. 1990. Studies on enzyme activities of Plerotus tuber regium Hein at various fruitbody stages. Nahrung. 34(8): 695-999.

147

Literature Cited

Kalac, P. 2009. Chemical composition and nutritional value of European species of wild growing mushrooms: a review. Food Chemistry. 113: 9–16. Kalac, P. 2013. A review of chemical composition and nutritional value of wild growing and cultivated mushrooms. Journal of the Science of Food and Agriculture. 93: 209–218. Kamal-Eldin, A. and L. Appelqvist. 1996. The chemistry and antioxidant properties of tocopherols and tocotrienols. Lipids. 31: 671–701. Kang, D. G, C. K. Yun and H. S. Lee. 2003. Screening and comparison of antioxidant activity of solvent extracts of herbal medicines used in Korea. Journal of Ethmopharmacology. 87: 231–6. Kanu, P. J., K. Zhu, J. B. Kanu, H. Zhou, H. Qian and K. Zhu. 2007. Biologically active components and nutraceuticals in sesame and related products: a review and prospect. Trends Food Science Technology. 18- 599–608. Kaul, Vijay Kumar. 1985. The Compound Verb in Kashmiri. Unpublished Ph.D. dissertation. Kurukshetra University. Kavishree, S., J. Hemavathy, B. R. Lokesh, M. N. Shashirekha and S. Rajarathnam. 2008. Fat and fatty acids of Indian edible mushrooms. Food Chemistry. 106: 597–602. Kean, E. G., B. R. Hamaker and M. G. Ferruzi. 2008. Carotenoid Bioaccessibility from Whole Grain and Degermed Maize Meal Products. Journal of Agriculture Food Chemistry. 56: 9918–9926. Keen, C. L., J. Y. Uriu-Adams, J. L. Ensunsa and M. E. Gershwin. 2004. Trace elements/minerals and immunity. In: Handbook of nutrition and immunity. Springer: pp: 117-140. Keypour, S., H. Riahi, M. F. Moradali and H. Rafati. 2008. Investigation of the antibacterial activity of achloroform extract of Ling Zhi or Reishi Medicinal Mushroom, Ganoderma lucidum (W.Curt.: Fr) P. Karst. (Aphyllophoromycetideae) from Iran. International Journal of Medicinal Mushrooms. 10(4): 345-349.

Khan, A. M., R. A. Qureshi, F. Ullah, S. A. Gilani, A. Nosheen, S. Sahreen, M. K. Laghari, M. Y. Laghari, S. Rehman, I. Hussain and W. Murad. 2011. Phytochemical analysis of selected medicinal plants of Margalla Hills and surroundings. Journal of medicinal plants research. 5(25): 6017-6023.

148

Literature Cited

Kim, J., K. Sapkota, S. Park, B. Choi, S. Kim, N. T. Hiep, C. Kim, H. Choi, M. Kim and H. Chun. 2006. A fibrinolytic enzyme from the medicinal mushroom cordyceps militaris. Journal of Microbiology. 44: 622. Kitzberger, C. S. G., Artur Smaˆnia Jr., R. C. Pedrosa and S. R. S. Ferreira. 2007. Antioxidant and antimicrobial activities of shiitake (Lentinula edodes) extracts obtained by organic solvents and supercritical fluids. Journal of Food Engineering. 80: 631–638. Kıvrak, I., S. Kıvrak and M. Harmandar. 2014. Free amino acid profiling in the giant puffball mushroom (Calvatia gigantea) using UPLC–MS/MS. Food Chemistry. 158: 88–92. Klaus-Joerger, T., R. Joerger, E. Olsson and C. Granqvist. 2001. Bacteria as workers in the living factory: metal accumulating bacteria and their potential for materials science. Trends Biotechnol. 19:15–20. Klein, E., D. L. Smith and R. Laxminarayan. 2007. Hospitalizations and deaths caused by methicillin-resistant Staphylococcus aureus, United States, 1999–2005. Emerging Infectious Diseases. 13: 1840–1846. Kogan, G. 2000. 1-3,1-6-β-D-Glucans of yeasts and fungi and their biological activity. Studies in Natural Products Chemistry. 23: 107–152. Kolar, F. R., S. Vaishali, B. Kamble, D. Ghansham and B. Dixit. 2011. Phytochemical constituents and antioxidant potential of some underused fruits. African Journal of Pharmacy and Pharmacology. 5(18): 2067-2072. Kora, A. J., R. B. Sashidhar and A. arunachalam. 2010. Gum kondagogu (Cochlospermumgossipium): A template for the green synthesis and stabilization of silver nanoparticles with antibacterial application. Carbohydrate Polymers. 82: 670- 679. Koyyalamudi, S. R., S. C. Jeong, S. Manavalan, B. Vysetti and G. Pang. 2013. Micronutrient mineral content of the fruiting bodies of Australian cultivated Agaricus bisporus white button mushrooms. Journal of Food Composition and Analysis. 31: 109–114. Kozarski, M., A. Klaus, M. Niksic, M. M. Vrvic, N. Todorovic, D. Jakovljevic and L. J. L. D. Van Griensven. 2012. Antioxidative activities and chemical characterization of polysaccharide extracts from the widely used mushrooms Ganoderma applanatum,

149

Literature Cited

Ganoderma lucidum, Lentinus edodes and Trametes versicolo. Journal of Food Composition and Analysis. 26: 144–153. Kuldo, E., G. Z. Jarzynska, M. Gucia and J. Falandysz. 2014. Mineral constituents of edible parasol mushroom (Scop. ex Fr.) Sing and soils beneath its fruiting bodies collected from a rural forest area. Chemical Papers. 68(4): 484–492. Kumari, D., M. S. Reddy and R. C. Chandra. 2011. Antioxidant Activity of three Species of Wild Mushroom Genus Cantharellus Collected from North-Western Himalaya, India. International Journal of Agriculture and Biology.13: 415–418. Kwon, Y. I., E. Apostolidis and K. Shetty. 2008. In vitro studies of eggplant (Solanum melongena) phenolics as inhibitors of key enzymes relevant for type 2 diabetes and hypertension. Bioresource Technology. 99: 2981-2988. Lampi, A. M., L. Kataja, A. Kamal-Eldin and P. Vieno. 1999. Antioxidant activities of alpha- and gamma-tocopherols in the oxidation of rapeseed oil triacylglycerols.Journal of the American Oil Chemists‘ Society. 76: 749–755. Lawrence G. D. 2010. The Fats of Life: Essential Fatty Acids in Health and Disease, Rutgers University Press, Piscataway, NJ, 2010. Leal, A. R., L. Barros, J. C. M. Barreira, M. J. Sousa, A. Martins, C. Santos-Buelga and I. C. F. R. Ferreira. 2013. Portuguese wild mushrooms at the ―pharma–nutrition‖ interface: Nutritional characterization and antioxidant properties. Food Research International 50: 1–9. Lee, I. Y. 2002. Curdlan.In E. J. Vandamme, S. De Baets and A. Steinbuchel (Eds.), Biopolymers. Polysaccharides.Weinheim, Germany: Wiley-VCH Verlag. 5: 135-158. Lee, J. S., J. Y. Cho and E. K. Hong. 2009. Study on macrophage activation and structural characteristics of purified polysaccharides from the liquid culture broth of Hericium erinaceus. Carbohydrate Polymers. 78: 162–168. Lee, K. J., I. J. Yun, K. H. Kim, S. H. Lim, H. J. Ham, W. S. Eum and J. H. Joo. 2011. Amino acid and fatty acid compositions of Agrocybe chaxingu, an edible mushroom. Journal of Food Composition and Analysis. 24:175–178. Lei, J., Z. Jiang, B. Weng, X. Tang and D. Su. 2007. Effect of Chamaecrasta nictitans cultivation substrate C:N ratio on the fatty acid content of Coprinus comatus fruit bodies. Acta Edulis Fungi. 14: 70–72.

150

Literature Cited

Li, S. G., D. G. Wang, W. Tian, X. X. Wang, J. X. Zhao and Z. Liu. 2008. Characterization and anti-tumor activity of a polysaccharide from Hedysarum polybotrys Hand.-Mazz. Carbohydrate Polymers. 73: 344–350. Li, W., Z, Gu, Y. Yanga, S. Zhou, Y. Liu and J. Zhanga. 2014. Non-volatile taste components of several cultivated mushrooms. Food Chemistry. 143: 427–431. Liu, J., L. Jia, J. Kan and Chang-hai Jin. 2013. In vitro and in vivo antioxidant activity of ethanolic extract of white button mushroom (Agaricus bisporus).Food and Chemical Toxicology. 51: 310–316. Liu, K., J. Wang, L. Zhao and Q. Wang. 2013. Anticancer, antioxidant and antibiotic activities of mushroom Ramaria flava. Food and Chemical Toxicology. 58: 375–380. Liu, R. H. 2013. Dietary bioactive compounds and their health implications. Journal of food science. 78: A18-A25. Liu, Y. T., J. Sun, Z. Y. Luo, S. Q. Rao, Y. J. Su and R. Xu. 2012. Chemical composition of five wild edible mushrooms collected from southwest China and their antihyperglycemic and antioxidant activity. Food and Chemical Toxicology. 50: 1238–1244. Liu, Y., Y. Q. Du, J. H. Wang, X. Q. Zha, and J. B. Zhang. 2014. Structural analysis and antioxidant activities of polysaccharide isolated from Jinqian mushroom. International Journal of Biological Macromolecules. 64: 63–68. Ma, L., H. Chen, P. Dong and X. Lu. 2013. Anti-inflammatory and anticancer activities of extracts and compounds from the mushroom Inonotus obliquus. Food Chemistry. 139: 503–508. Maeda, Y. Y. and G. Chihara. 1999. Lentinan and other antitumoral polysaccharides.In H. Wagner (Ed.), Immunomodulatory agents from plants (pp. 203–221). Basel, Switzerland: Birkhauser Verlag. Mallikarjuna, S. E., A. Ranjini, D. J. Haware, M. R. Vijayalakshmi, M. N. Shashirekha, and S. Rajarathnam. 2013. Mineral Composition of Four Edible Mushrooms. Journal of Chemistry.http://dx.doi.org/10.1155/2013/805284. Manilal, A., S. Sujith, G. S. Kiran, J. Selvin and C. Shakir. 2009. Cytotoxic potentials of red alga, Laurenciabrandenii Collected from the Indian Coast.Global journal of pharmacology. 3(2): 90-94.

151

Literature Cited

Manjunathan, J., N. Subbulakshmi, R. Shanmugapriya and V. Kaviyarasan. 2011. Proximate and mineral composition of four edible mushroom species from South India. International Journal of Biodiversity and Conservation. 3(8): 386-388. Marekova, I., S. Momchilova, B. Grung and B. Nikolova-Damyanov. 2012. Fatty acid composition of wild mushroom species of order Agaricales—Examination by gas chromatography–mass spectrometry and chemometrics. Journal of Chromatography. 910: 54– 60. Mattila, P., P. Salo-Vaananen, K. Konko, H. Aro and T. Jalava. 2002. Basic composition and amino acid contents of mushrooms cultivated in Finland. Journal of Agricultural and Food Chemistry. 50: 6419 - 6422. Mau, J. L., H. C. Lin and C. C. Chen. 2001. Non-volatile components of several medicinal mushrooms. Food Research International. 34:521–526. McDowell, L. R. 2003. Minerals in animal and human nutrition. Elsevier Science BV. Mdachi, S. J. M., M. H. H. Nkunya., V. A. Nyigo and I. T. Urasa. 2004. Amino acid composition of some Tanzanian wild mushrooms.Food Chemistry. 86: 179–182. Menghani, E., K. Bhatnagar, P. Saraswat and M. Soni. 2011. Isolation and characterization of bioactives from arid zone plants.International journal of pharmaceutical research and development. 4(2): 113-118. Mishra, K. K., R. S. Pal, R. A. Kumar, C. Chandrashekara, S. K. Jain and J. C. Bhatt. 2013. Antioxidant properties of different edible mushroom species and increased bioconversion efficiency of Pleurotus eryngii using locally available casing materials. Food Chemistry. 138: 1557–1563. Mishra, S. and R. B. Singh. 2010. Effect of Mushroom on the Lipid Profile, Lipid Peroxidation and Liver.Functions of Aging Swiss Albino Rats. The Open Nutraceuticals Journal. 3: 248-253. Miziolek, A. W., V. Palleschi and I. Schechter. 2006. Laser-Induced Breakdown Spectroscopy (LIBS) Fundamentals and Applications. Cambridge University Press, New York. Mkrtchayan, J. A. 2014. Qualitative analysis of fatty acids composition in different collection of coprenoid mushrooms. Proceedings of the Yerevan state University. 1: 37–41.

152

Literature Cited

Modi, H. A., S. Parihar, E. A. Pithawala and N. K. Jain. 2014. Priliminary phytochemical screening and antibactrial activity of wild edible mushrooms collected from Mahal forest of Dang district, Gujrat, India, World journal of pharmacy and pharmaceutical. 3(8): 1164-1174. Mori, K., C. Kobayashi, T. Tomitac, S. Inatomi and M. Ikeda. 2008. Antiatherosclerotic effect of the edible mushrooms Pleurotus eryngii (Eringi), Grifola frondosa (Maitake), and Hypsizygus marmoreus (Bunashimeji) in apolipoprotein E–deficient mice.Nutrition Research. 28: 335–342. Mosisa, Z. H., A. Kebede and V. V. Preetha. 2015. Cultivation of selected Pleurotus species using sugarcane bagasse, waste paper and leaves of Prosopis juliflora (Sw.) DC. International Journal of Advanced Research. 3(2): 522-531. Mukhopadhyay, R. and A. K. Guha. 2015. A comprehensive analysis of the nutritional quality of edible mushroom Pleurotus sajor-caju grown in deproteinized whey medium. LWT-Food Science and Technology. 61(2): 339-345. Muleta, D., B. Gume and D. Abate. 2013. Evaluation of locally available substrates for cultivation of oyster mushroom (Pleurotus ostreatus). African journal of Microbiology Research. Jimma, Ethiopia. 5: 2228-2237. Murphy, M. M., L. M. Barraj, D. Herman, X. Bi, R. Cheatham and R. K. Randolph. 2012. Phytonutrient intake by adults in the united states in relation to fruit and vegetable consumption. Journal of the Academy of Nutrition and Dietetics. 112: 222-229. Nandi, A. K., S. Samanta, S. Maity, I. K. Sen, S. Khatua, K. Sanjana, P. Devi, K. Acharya, T. K. Maiti and S. S. Islam. 2014. Antioxidant and immunostimulant β-glucan from edible mushroom Russula albonigra (Krombh.) Fr. Carbohydrate Polymers. 99: 774– 782. Nasim, G., M. Ali and N. Mehmood. 2010. Molecular analysis of Ganoderma lucidum isolates from Lahore. Pakistan Journal of Botany. 42(5): 3307-3315. Nasreen, Z., R. Bajwa, T. Kausar, S. Baig, N. Habib and M. B. Bhatti. 2008. Productivity of Pleurotus ostreatus under solid state fermentation on lignocellulosic substrates. Mycopath. 6(1-2): 51-56. Nnorom, I. C., G. Jarzyńska, M. Drewnowska, A. Dryżałowska, A. Kojta, S. Pankavec and J. Falandysz. 2013. Major and trace elements in sclerotium of Pleurotus tuber-

153

Literature Cited

regium (Ósū) mushroom Dietary intake and risk in southeastern Nigeria. Journal of Food Composition and Analysis. 29(1): 73-81. Novaes, M. R. C. G., L. A. M. Lima and M. V. Souza. 2003. Effects of the supplement using arginine 6% into experimental tumor.Rev Metabolismo e Nutr. (Porto Alegre- Brasil). 7(2): 52-56. Novaes, M. R. C. G., L. C. G. Novaes and V. C. Taveira. 2007. Natural Products from Agaricales Medicinal Mushrooms: Biology, Nutritional Properties, and Pharmacological Effects on Cancer. Revista Brasileira de Cancerologia. 53(4): 411- 420. Novaes, M. R. G., R. Fortes, A. Melo and V. Recova. 2005. Alterations on the metabolism of lipids in post-surgery patients with colorectal cancer supplemented with fungus Agaricus sylvaticus. Clinical Nutrition. 24(4): 672. Novak, M. V., R. Bozaic and J. Gerwin. 2011. Puppels Vibrational spectroscopic characterization of wild growing mushrooms and toadstools. Journal of Spectrochimica Acta. 57: 2815–2829. Nowacka, N., R. Nowak, M. Drozd, M. Olech, R. Los and A. Malm. 2014. Analysis of phenolic constituents, antiradical and antimicrobial activity of edible mushrooms growing wild in Poland. LWT-Food Science and Technology. 59: 689-694. Obayed Ullah, M., M. Haque, K. Fatima Urmi, A. Hasanat, Md. Zulfiker, E. S. Anita, M. Begum and K. Hamid. 2013. Anti-bacterial activity and brine shrimp lethality bioassay of methanolic extracts of fourteen different edible vegetables from Bangladesh. Asian Pacific Journal Tropical Biomedicine. 3(1): 1-7. Okoro, I. O. and F. I. Achuba. 2012. Proximate and mineral analysis of some wild edible mushrooms . African Journal of Biotechnology. 11(30): 7720-7724. Ouzouni, P. K., D. Petridis, W. D. Koller and K. A. Riganakos. 2009. Nutritional value and metal content of wild edible mushrooms collected from West Macedonia and Epirus, Greece. Food Chemistry. 115: 1575–1580. Oztürk, M., M. E. Duru, S. Kivrak, N. Mercan-Do_gan, A. Türkoglu and M. A. Ozler. 2011. In vitro antioxidant, anticholinesterase and antimicrobial activity studies on three Agaricus species with fatty acid compositions and iron contents: a comparative study on the three most edible mushrooms. Food and Chemical Toxicology. 49: 1353-1360.

154

Literature Cited

Palacios, M. L., C. Moro, M. D‘Arrigo, M. A. Rostagno, J. A. Martínez, A. García-Lafuente, E. Guillamón and A. Villares. 2011. Antioxidant properties of phenolic compounds occurring in edible mushrooms.Food Chemistry. 128: 674–678. Palomo, I., E. Fuentes, T. padro and L. Badimon. 2012. Platelets and atherogenesis: Platelet anti-aggregation activity and endothelial protection from tomatoes (Solanum lycopersicum L.). Experimental and Therapeutic Medicine. 3: 577-584. Patel, S., and A. Goyal. 2012. Recent developments in mushrooms as anti-cancer therapeutics: a review. 3 Bitech. 2(1): 1-15. Pedneault, K., P. Angers, A. Gosselin and R. J. Tweddell. 2006. Fatty acid composition of lipids from mushrooms belonging to the family Boletaceae. Amycolog icalrese arch. 110: 1179–1183. Pereira, E., L. Barros A. Martins and I. C. F. R. Ferreira. 2012. Towards chemical and nutritional inventory of Portuguese wild ediblemushrooms in different habitats. Food Chemistry. 130: 394–403. Petkovšek, S. Al Sayegh and B. Pokorny. 2013. Lead and cadmium in mushrooms from the vicinity of two large emission sources in Slovenia. Science of the Total Environment. 443: 944–954. Pettolino, F. A., C. Walsh, G. B. Fincher and A. Bacic. 2012. Determining the polysaccharide composition of plant cell walls. Nature protocols. 7(9): 1590-1607. Philip, D. 2009. Biosynthesis of Au, Ag and Au–Ag nanoparticles using edible mushroom extract. Spectrochimica Acta Part A. 73: 374–381. Pierre, C., R. tremblay and J. Y. Dube. 1978. ρ-Nitrophenol-α-D-Glucopyranoside as substrate for measurement of maltase activity in Human Semen. Clinical Chemistry 24: 208-211. Porto, C., S. Calligaris, E. Celotti and M. C. Nicoli. 2000. Antiradical properties of commercial cognacs assessed by the dpph test. Journal of agricultural and food chemistry. 48: 4241-4245. Prabasari, I., F. Pettolino, M. L. Liao and A. Bacic. 2011. Pectic polysaccharides from mature orange (Citrus sinensis) fruit albedo cell walls: sequential extraction and chemical characterisation. Carbohydrate Polymer. 84: 484–494.

155

Literature Cited

Prasad, S., R. S. Kashyap, J. Y. Deopujari, H. J. Purohit, G. M. Taori and H. F. Daginawala. 2006. Development of an in vitro model to study clot lysis activity of thrombolytic drugs. BioMed Central.doi:10.1186/1477-9560-4-14. Pulido, R., L. Bravo and F. Saura-Calixto. 2000. Antioxidant of dietary polyphenols as determined by a modified Ferric Reducing Antioxidant Power assay. Journal of Agriculture Food Chemistry. 46: 3396-3402. Pushpa, H. and K. B. Purushothama. 2010. Nutritional Analysis of Wild and Cultivated Edible Mushrooms. World Journal of Dairy and Food Sciences. 5(2): 140-144. Puttaraju, N. G., S. U. Venkateshaiah, S. M. Dharmesh and R. Somasundaram. 2006. Antioxidant activity of indigenous edible mushrooms. Journal of Agricultural and Food Chemistry. 54: 9764-9772. Qian, J. Y., W. Chen, M. W. Zhang and H. Zhang. 2009. Adulteration identification of some fungal polysaccharides with SEM, XRD, IR and optical rotation: Journal of a Primary Approach Carbohydrate Polymers. 35: 227-230. Quereshi, S., A. K. Pandey and S. S. Sandhu. 2010. Evaluation of antibacterial activity of different Ganodermalucidum extracts. People s Journal of Scientific Research. 3(1): 9-13. Rabinovich, M., D. Figlas, S. Delmastro and N. Curvetto. 2007. Copper-and zinc-enriched mycelium of agaricus blazei murrill: Bioaccumulation and bioavailability. J Med Food. 10: 175-183. Ravikrishnan, V., P. Naik, S. Ganeshb and M. Rajashekhar. 2015. Amino acid, fatty Acid and mineral profile of mushroom Lentinus polychrous lev, from Western Ghats, Southern India. International journal of plant, Animal and Environmental Sciences. 5(1): 278-281. Reis, S. F., A. Martins, L. Barros and I. C. F. R. Ferreira. 2012. Antioxidant properties and phenolic profile of the most widely appreciated cultivated mushrooms: A comparative study between in vivoand in vitro samples. Food and Chemical Toxicology. 50:1201– 1207. Ren, L., Y. Hemar, C. O. Perera, G. Lewis, G. W. Krissansen and P. K. Buchanand. 2014. Antibacterial andantioxidant activities of aqueous extracts of eight edible mushrooms. Biactive Carbohydrates and Dietary Fiber. 3: 41–51.

156

Literature Cited

Ribeiro, B., P. G. de Pinho, P. B. Andrade, P. Baptista and P. Valentão. 2009. Fatty acid composition of wild edible mushrooms species: A comparative study. Microchemical Journal. 93: 29–35. Robaszkiewicz, A., G. Bartosz, M. Lawrynowicz, M. Soszyński. 2010. The Role of Polyphenols, β-Carotene and Lycopene in the Antioxidative Action of the Extracts of Dried, Edible Mushrooms. Journal of Nutrition and Metabolism. Article ID 173274. doi:10.1155/2010/173274. Roy, A. and S. Saraf. 2006. Limonoids: Overview of significant bioactive triterpenes distributed in plants kingdom. Biological and Pharmaceutical Bulletin. 29: 191-201. Sabir, S. M., I. Hayat, I. Hussain and S. R. A. Gardezi. 2003. Proximate analysis of mushrooms of Azad Kashmir. Pakistan Journal of Plant pathology. 2(2): 97-101. Saha, S., S. Walia, A. Kundu and N. Pathak. 2013. Effect of mobile phase on resolution of the isomers and homologues of tocopherols on a triacontyl stationary phase. Analytical and bioanalytical chemistry. 405: 9285-9295. Salman, M., M., Shahid, A. Jamil and S. Rehman. 2014. Effect of Lactobacillos acidophillis bacterium on Bacillus cereus biofilm. Journal of Pure Applied Microbiology. 8: 3721-3728. Sam, T. W., S. M. Collegate and R. T. Molyneux. 2010. Toxicity testing using the brine shrimp: In Bioactive Natural Products Detection. Isolation and structural determination; CRC press; Boca roten, FL. 442-456. Sanodiya, S. B., G. S. Thakura, R. K. Baghela, G. B. K. S. Prasadb and P. S. Bisen. 2009. Ganoderma lucidum: A Potent Pharmacological Macrofungus Current. Pharmaceutical Biotechnology. 10: 717-742. Santos-Neves, J. C., M. I. Pereira, E. R. Carbonero, A. H. P. Gracher, G. Alquini, P. A. J. Gorin. 2008. A novel branched Î ± Î2-glucan isolated from the basidiocarps of the edible mushroom Pleurotus florida. Carbohydrate Polymer. 73:309–14. Sarangi, I., D. Ghosh, S. K. Bhutia, S. K. Mallick and T. K. Maiti. 2006. Anti-tumor and immunomodulating effects of Pleurotus ostreatus mycelia-derived proteoglycans. International Immunopharmacology. 6: 1287–1297.

157

Literature Cited

Sarikurkcu, C., B. Tepe, M. S. Kocak and M. C. Uren. 2015. Metal concentration and antioxidant activity of edible mushrooms from Turkey. Food Chemistry. 175: 549– 555. Sarikurkcu, C., M. Copur, D. Yildiz and I. Akata. 2011. Metal concentration of wild edible mushrooms in Soguksu National Park in Turkey. Food Chemistry. 128: 731–734. Sarker S. D., L. Nahar and Y. Kumarasamy. 2007. Microtitre plate-based antibacterial assay incorporating resazurin as an indicator of cell growth, and its application in the in vitro antibacterial screening of phytochemicals. Methods. 42(4): 321-324. Schneider, G and J. Wolfling. 2004. Synthetic cardenolides and related compounds. Current Organic Compounds. 8:14-18. Schneider, I., G. Kressel, A. Meyer, U. Krings, R. G. Berger and A. Hahn. 2011. Lipid lowering effects of oyster mushroom (Pleurotus ostreatus) in humans. Journal of Functional foods. 3: 17 –24. Shao S., M. Hernandez, J. K. G. Kramer, D. L. Rinker and R. Tsao. 2010. Ergosterol Profiles, Fatty Acid Composition and Antioxidant Activities of Button Mushrooms as Affected by Tissue Part and Developmental Stage. Journal of Agriculture Food Chemisrty. 58 (22): 11616–11625. Sharif, S., M. Shahid, M. Abbas, M. Iqbal, M. Afzal and T. Pirzada. 2013. Antimicrobial activity of selected Pakistani medicinal plants used in folkloric medicine. African Journal of Microbiology Research. 7(21): 2530-2541. Sharma, P. K., S. K. Shahi, P. K. Shrma, M. K. R. Lavanya and M. Balhara. 2015. Antimicrobial potential of Ganoderma Spp. fruiting body and cultured myceilium. African Journal of Microbiology Research. 9(5): 265-274. Shi, L., A. Ren and D. Mu. 2010. Current progress in the study on biosynthesis and regulation of ganoderic acids. Applied Microbiology Biotechnology. 88:1243–1251. Sicilia, T., H. B. Niemeyer, D. M. Honig and M. Metzler. 2003. Identification and stereochemical characterization of lignans in flaxseed and pumpkin seeds. Journal of Agricurure Food Chemistry. 51: 1181-1188. Siegel, R., J. Ma, Z. Zou and A. Jemal. 2014. Cancer statistics, 2014. CA: a cancer journal for clinicians. 64: 9-29.

158

Literature Cited

Singh, M., B. Vijay, S. Kamal and G. Wakchaure. 2011. Mushrooms: Cultivation, marketing and consumption. Mushrooms: cultivation, marketing and consumption. Singleton, V. L., A. Joseph and J. R. J. A. Rossi. 1965. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. American Journal Enology and Viticulture. 16: 144-158. Smiderle, F. R., L. M. Olsen, A. C. Ruthes, P. A. Czelusniak, A. P. Santana-Filho, G. L. Sassaki, P. A. J. Gorin and M. Iacomini. 2012. Exopolysaccharides, proteins and lipids in Pleurotus pulmonarius submerged culture using different carbon sources. Carbohydrate Polymers. 87: 368– 376. Smolskaite, L., P. R. Venskutonis and T. Talo. 2015. Comprehensive evaluation of antioxidant and antimicrobial properties of different mushroom species. LWT - Food Science and Technology. 60(1): 462-471.. Sohaimy, S. 2012. Functional foods and nutraceuticals-modern approach to food science. World Applied Sciences Journal. 20: 691-708. Song, B. J., T. N. Sapper, C. E. Burtch, K. Brimmer, M. Goldschmidt, and M. G. Ferruzzi. 2013. Photo- and Thermodegradation of Anthocyanins from Grape and Purple Sweet Potato in Model Beverage Systems.Journal of Agriculture Food Chemistry. 61: 1364−1372. Stanley, G., K. Harvey, V. Slivova, J. Jiang and D. Sliva. 2005. G. lucidum suppresses angiogenesis through the inhibition of VEGF and TGF-beta 1 fromprostate cancer cells. Biochemical and Biophsical Research Communications. 330: 46–52. Steinkraus, G., R. White and L. Friedrich. 2007. Vancomycin MIC creep in non- vancomycin-intermediate Staphylococcus aureus (VISA), vancomycin-susceptible clinical methicillin-resistant S. aureus (MRSA) blood isolates from 2001–05. Journal Antimicrob Chemother. 60: 788–794.

Su, C. H., M. N. Lai and L. T. Ng. 2013. Inhibitory effects of medicinal mushrooms on α- amylase and α-glucosidase-enzymes related to hyperglycemia. Food Function. 4(4): 644-649. Sultana K., Z. K. Shinwari and F. Iftikhar. 2007. Diversity of Edible mushrooms in Pakistan. Jouranl of agriculture research. 20: 1-2.

159

Literature Cited

Sun, Y. X. 2011. Structure and biological activities of the polysaccharides from the Leaves, roots and fruits of Panax ginseng C. A. Meyer: An overview. Carbohydrate Polymers. 85: 490–499. Sutharsingh, R., S. Kavimani, B. Jayakar, M. Uvarani and A. Thangathirupathi. 2011. Quantitative phytochemical estimation and antioxidant studies on aerial parts of naraveliazeylanica dc. International Journal of pharmaceutical studies and research. 2(2): 52-56. Synytsya, A., K. Mickova, A. Synytsya, I. Jablonsky, J. Spevacek, E. Kovarikova and J. Copikova. 2009. Glucans from fruit bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity.Carbohydrate Polymers. 76: 548–556. Thetsrimuang, C., S. Khammuang, K. Chiablaem, C. Srisomsap and R. Sarnthima. 2011. Antioxidant properties and cytotoxicity of crude polysaccharides from Lentinus polychrous Lév. Food Chemistry. 128: 634–639. Tholl, D. 2006. Terpene synthases and the regulation, diversity and biological roles of terpene metabolism. Current Opinion in Plant Biology. 9: 297-304. Tomkins, A. 2002. 18 nutrition, infection and immunity: Public health implications. Nutrition and immune function. 375. Trease, G., E. W. Trease and E. Pharmacognosy, A physicians‘s guide to herbal medicine. 1989. Bailliere, Tindall. London. Trindade, S., A. Sousa, K. B. Xavier, F. Dionisio, M. Ferreira and I. Gordo. 2009. Positive epistasis drives the acquisition of multidrug resistance. PLoS Genetics. 5: 578. Tsai, S. Y., H. Shih-Jeng, L. Sheng-Hua, T. Wu, P. Lian and J. Mau. 2009. Flavour components and antioxidant properties of several cultivated mushrooms. Food Chemistry. 113: 578–584. Turkoglu, A., I. Kivrak, N. Mercan, M. E. Duru, K. Gezer and H. Turkoglu. 2006. Antioxidant and antimicrobial activities of Morchella conica Pers. African Journal Biotechnology. 5(11): 1146-1150. Udu-Ibiam, O. E., O. Ogbu, U. A. Ibiam, A. U. Nnachi, M. V. Agah, C. O. Ukaegbu, O. S. Chukwu, N. B. Agumah and K. I. Ogbu. 2014. Phytochemical and Antioxidant

160

Literature Cited

Analyses of Selected Edible Mushrooms, Ginger and Garlic from Ebonyi State, Nigeria. IOSR Journal of Pharmacy and Biological Sciences. 9 (3): 86-91. Unekwu, H. R., J. A. Audu, M. H. Makun and E. E. Chidi. 2014. Phytochemical screening and antioxidant activity of methanolic extract of selected wild edible Nigerian mushrooms. Asian Pacific Journal of Tropical Diseases. 4(1): 153-157. Vaghasiya, Y., R. Dave and S. Chanda. 2011. Phytochemical analysis of some medicinal plants from western region in India. Research journal of medicinal plant. 5(5): 567- 576. Valgas, C., S. M. de Souza, E. F. A. Smânia and A. J. Smânia. 2007. Screening methods to determine antibacterial activity of natural products. Brazilian Journal of Microbiology. 38: 369-380. Vamanu, E. 2012. In vitro antimicrobial and antioxidant activities of ethanolic extract of lyophilized mycelium of Pleurotus ostreatus PQMZ91109. Molecules. 17: 3653- 3671. Vaz, J. A., L. Barros, A. Martins, C. Santos-Buelga, M. H. Vasconcelos and I. C. F. R. Vasconcelos. 2011. Chemical composition of wild edible mushrooms and antioxidant properties of their water soluble polysaccharidic and ethanolic fractions. Food Chemistry. 126: 610–616. Vaz, J. A., L. Barros, A. Martins, J. Sá Morais, M. H. Vasconcelos and I. C. F. R. Ferreira. 2011. Phenolic profile of seventeen Portuguese wild mushrooms. LWT-Food Science and Technology. 44: 343-346. Vieira, P. A. F., D. C. Gontijo, B. C. Vieira, E. A. F. Fontes, L. S. de Assunção, J. P. V. Leite, M. G. de A. Oliveira and M. C. M. Kasuya. 2013. Antioxidant activities, total phenolics and metal contents in Pleurotus ostreatus mushrooms enriched with iron, zinc or lithium. LWT-Food Science and Technology. 54: 421- 425. Villares, A., L. Mateo-Vivaracho, A. García-Lafuente and E. Guillamón. 2014. Storage temperature and UV-irradiation influence on the ergosterol content in edible mushrooms. Food Chemistry. 147: 252–256. Volman, J. J., J. D. Ramakers and J. Plat. 2008. Dietary modulation of immune function by β-glucans. Physiology and Behavior. 94: 276–284.

161

Literature Cited

Wandati, T. W., G. M. Kenji and J. M. Onguso. 2013. Phytochemicals in edible wild mushrooms from selecte areas in Kenya. Journal of Food Research. doi: 10.5539/jfr.v2n3p137. Wang, J .L., K. Liu, W. Z. Gong, Q. Wang, D. T. Xu, M. F. Liu, K. L. Bi, Y.F. Song. 2012. Anticancer, antioxidant, and antimicrobial activities of anemone (Anemone cathayensis). Food Science and Biotechnology. 21: 551–557. Wang, J., W. Chen, H. Yang and G. Tian. 2010. Recent advances in the extraction and determination of the nutrients from Agrocybe aegerita. Modern Agricultural Sciences and Technology. 3: 20: 335. Wang, X. 2004. The analysis of the fatty acid compositions in the fruit body and the mixture barley and mycelium of Pleurotus eryngii. Journal of Huaiyin Teachers College (Natural Science Edition). 3: 61–63. Wang, X. M., J. Zhang, L. H. Wu, Y. Li. Zhao, T. Li, J. Q. Li, Y. Z. Wang and H. G. Liu. 2014. A mini review of chemical composition and nutritional value of edible wild- grown mushroom from China. Food Chemistry. 151: 279–285. Wasser, S. P. 2002. Medicinal mushrooms as a source of antitumor and immunomodulating polysaccharides. Applied Microbiology and Biotechnology. 60(3): 258–274. Westerndarp, H. 2006. Effect of tannins in animal nutrition, (DTW) Dtsch. Tierarztl. Wochenschn. 113(7): 264-268. White, T. J., T. Bruns, S. Lee and J. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. (Eds.), PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, USA, pp. 315–322.

Woldegiorgis, A. Z., D. Abate, D. G. Haki and G. R. Ziegler. 2014. Antioxidant property of edible mushrooms collected from Ethiopia. Food Chemistry. 157: 30–36 Wu, Y., X. Song, S. Tao, X. Wu, P. Xu, X. Liu, S. Guanand and D. Guo. 2010. Cytotoxic triterpenoids from G. lucidum. Phytochemistry. 71:1579–1585. Xing, Z. and X. Zhao. 2014. Mushroom production in China: the illegal use of fluorescent whitening agents (FWAs) and related outbreaks. Global Safety of Fresh Produce. 401- 408.

162

Literature Cited

Xu, D. X., J. Lin, Z. M. Duan, Y. P. Wan, B. Bai and C. Sun. 2012. Detection of chemical compositions of wild Lactarius volemus from Yunnan province. Edible Fungi. 4: 60– 61. Xu, X., P. Chen, L. Zhang and H. Ashida. 2012. Chain structures of glucans from lentinus edodes and their effects on no production from raw 264.7 macrophages. Carbohydrate Polymers. 87: 1855-1862. Yamac, M. and F. Bilgili. 2006. Antimicrobial activities of fruit bodies and/or mycelia cultures of some mushroom isolates. Pharmaceutical Biology. 44: 660–667. Yang, H. J., H. C. Lin and J. L. Mau. 2001. Non-volatile taste components of several commercial mushrooms. Food Chemistry. 72: 465-471. Yano, A., S. Kikuchi, Y. Yamashita, Y. Sakamoto, Y. Nakagawa, Y. Yoshida. 2010. The inhibitory effects of mushroom extracts on sucrose-dependent oral biofilm formation. Applied Microbiology and Biotechnology. 86: 615–623. Yasumoto, K., K. Iwami and H. Mitsuda. 1971. A new sulphur containing peptide from Lentinus edodes acting as precursor for lenthionine. Agricultural Biological Chemistry. 35: 2059-69. Yoon, K. N., N. Alam, J. S. Lee, K. R. Lee and T. S. Lee. 2011. Detection of phenolic compound concentration and evaluation of antioxidant and anti tyrosinase activity of various extracts fron the fruiting body of L. edodes. World Applied Sciences Journal. 129(10): 1851-1859. Yuen, J. W. M and M. D. I. Gohel. 2008. The dual roles of Ganoderma antioxidants on urothelial cell DNA under carcinogenic attack. Journa of Ethnopharmacology. 118: 324–330. Zahid, M. K., S. Barua and S. M. Huq. 2009. Proximate Composition and Mineral Content of Selected Edible Mushroom Varieties of Bangladesh. Bangladesh Journal of Nutrition. 22: 61-68. Zhang, A. Q., P. L. Sun, J. S. Zhang, C. H. Tang, J. M. Fan and X. M. Shi. 2007. Structural investigation of a novel fucoglucogalactan isolated from the fruiting bodies of the fungus Hericium erinaceus. Food Chemistry. 104: 451–456.

163

Literature Cited

Zhang, Y., L. Dai, X. Kong and L. Chen. 2012. Characterization and in vitro antioxidant activities of polysaccharides from Pleurotus ostreatus. International Journal of Biological Macromolecules. 51(3): 259-265. Zhang, Y., Y. R. Cao and H. Xu. 2012. Evaluation of heavy metal contents in some wild edible mushrooms from Panzhihua. Journal of Sichuan University. 49: 246–252. Zhang, Z., H. Song, Z. Peng, Q. Luo, J. Ming and G. Zhao. 2012. Characterization of stipe and cap powders of mushroom (Lentinus edodes) prepared by different grinding methods. Journal of Food Engineering. 109: 406–413. Zhu, X. L., A. F. Chen and Z. B. Lin. 2007. G. lucidum polysaccharides enhance the function of immunological effector cells in immunosuppressed mice. Journal of Ethnopharmacology. 111: 219–226.

164