(KHV) from Potential Vector Species to Common Carp

212, Bull. Eur. Ass. Fish Pathol., 32(6) 2012

Horizontal transmission of koi herpes virus (KHV) from potential vector species to common carp

J. Kempter1ǰȱǯȱ ÙÚ1, R. Panicz1*, J. Sadowski1, ǯȱ¢Ù 1 and S. M. Bergmann2

ŗȱȱȱǰȱ¢ȱȱȱȱȱǰȱȱȱ ¢ȱȱ¢ȱȱ££ǰȱ ££ȱ à £ȱŚǰȱŝŗȬśśŖȱ££ǲȱŘȱȬ ĝȬ ȱǻ Ǽǰȱȱȱ ȱȱȱ ǰȱ ȱȱ ¢ȱȱ ǰȱûŗŖǰȱŗŝŚşřȱ Ȭȱ ȱǰȱ ¢

Abstract ¡ȱęȱǰȱęȱȱȱȱȱȱȱȱǻ Ǽȱǰȱ¢Ǳȱ ȱǰȱȱǰȱǰȱȱěǰȱȱȱȱȱȱ ȱȱȱ ȱ¢ǯȱȱęȱȱȱȱȱȱȱȱęȱȱ¢ȱ ȱ ȱȱ been diagnosed and prior to the beginning of the research study the presence of the virus genome ȱęȱȱȱȱęȱȱȱǯȱęȱȱȱǻǼȱȱ utilized in the experiment originated from the University of Wageningen. During a four-week period the SPF carp were exposed to infection through cohabitation with vector species previously ęȱȱ ȱǯȱȱȱȱȱȱ¢ȱȱȱ£ȱ- mission of KHV between selected species, even in the case of species showing no clinical signs of KHV disease (KHVD), while an average water temperature in the tanks ranged from 12°C to 16°C.

Introduction Koi herpes virus (KHV) disease (KHVD) is a free) SPF common carp (Bergmann et al., 2010). serious viral disease causing mass mortality in The possibilities of the virus being transferred the species ¢ȱ. According to pre- ¢ȱęȱȱȱȱȱ ȱ¢ȱ vious research, clinical signs can be observed as part of an experimental study performed by not only in common carp (ǯȱ), but also Kempter et al. (2008). According to the results, in hybrids: ǯȱ x ȱ and ǯȱ during experimental infection by immersion, x ȱ. Immersion aquaria species such as tench (ȱ), vimba (ȱ challenge experiments, showed severe losses ), common bream (ȱ) and Ğȱȱ ȱ ȱȱȱ ȱ grass carp (¢ȱ) can transmit řśƖȱȱŗŖŖƖȱȱȱ¡ȱęȱȱȱ¡ȱȱ KHV to SPF carp when water temperatures ȱ¢ȱȱ ȱȱȱǻęȬȬ range between 18 and 27°C. The four potential

* Corresponding author’s email: [email protected] Bull. Eur. Ass. Fish Pathol., 32(6) 2012, 213

ȱȱ ȱęȱȱȱ¢- River in south-western Poland (N50°45’14.364”, tomatic carriers of KHV by PCR analysis of gill E18°36’30.1068”). Koi herpes virus (KHV) was swabs prior to the start of the aquaria cohabita- ¢ȱęȱȱȱȱȱ- ȱ¡ǯȱȱȱ ȱęȱ tured common carp in 2004 (Bergmann et al., in SPF carp in samples of gill or pooled visceral 2006) and its presence was subsequently con- material (Kempter et al., 2008). Samples were ęȱȱ ȱȱǰȱȱȱ analysed according to methods summarised spring and summer of 2006 and 2007, prior in Table 1. In 2010, carp production in Poland ȱȱȱȱęȱȱȱȱȱȱ amounted to 15,400 tonnes per annum, and experiment in 2008. The following potential the estimated number of carp farms reported ȱęȱȱ ȱȱȱȱ as 500 (Lirski, 2011). Therefore, it would seem in experimental trials: common roach (ȱ advisable to analyze the risk connected with the ), European perch (ȱĚ), tench, ȱȱ¢ȱęȱȱȱ ȱěȱǻ ¢ȱ), silver carp ponds, as they may constitute a reservoir carp ( ¢¢ȱ¡) and grass of KHV infection without displaying the clinical ǯȱȱȱęȱ ȱȱȱ signs. The intention of this research study was the Fisheries Research Station (RSD) in Nowe ȱȱ ȱȱęȱȱȱ Czarnowo (March, 2008) in sealed bags with from carp might act as a vector introducing an appropriate amount of oxygenated pond

ȱȱ¢ȱęȱǯ water. On arrival at RSD, they were placed in 1m3 ǰȱęȱ ȱȱ ȱȱŗŘȬŗŜ°C. Materials and methods During the four-week cohabitation period the Experimental infection tank water was neither replaced nor comple- Fish adjudged to have the potential to play a role ȱ ȱȱ ȱȱ ȱęȱ ȱȱȱȱȱĴȱ ȱȱ ȱ was not conducted. The potential vector species as being species that are important for angling intended for experimental infection were placed ȱęȱȱȱ ȱȱȱ ȱȱȱǻȱƽȱŘŖȱęȱȱǼȱȱ farms located in the catchment area of the Oder ȱ ȱęȬȬȱǻǼȱ

ȱŗǯȱȱ£ȱȱȱȱęȱȱȱȱȱ ȱȱȱȱ¢ȱǯ

Primer ȱǻśȂȬřȂǼ ȱ£ References KHV-F GACGACGCCGGAGACCTTGTG Gilad et al. 486 bp KHV-R CACAAGTTCAGTCTGTTCCTCAAC (2002) KHV-1Fn CTCGCCGAGCAGAGGAAGCGC Bergmann et al. 414 bp KHV-1Rn TCATGCTCTCCGAGGCCAGCGG (2006) KHV-TK-F GGGTTACCTGTACGAG Bercovier et al. 409 bp KHV-TK-R CACCCAGTAGATTATGC (2005) KHV-TK-Fn CGTCGTGAGGAATACGACG Unpublished Way 348 bp KHV-TK-Rn ACCGTACAGCTCGTACTGG (2007) 214, Bull. Eur. Ass. Fish Pathol., 32(6) 2012 common carp (n = 20 per tank) with a code second round of PCR was applied in case of line R8f10 xR3f10 obtained from the University of low copy numbers of virus genome. The PCR Wageningen (The Netherlands). The SPF carp products of KHV-F/KHV-R primers were used ȱ ȱȱęȱȱȱ¢ȱ as a template for a second nested PCR with ȱȱȱ ȱǯȱȱȱęȱ KHV-1Fn/KHV-1Rn primers (Gilad et al., 2002; species and SPF carp were of a comparable size, Bergmann et al., 2006). A second set of primers ¡¢ȱŗǯśǯȱȱȱȱęȱȱ comprised of KHV-TK-F/KHV-TK-R primers ȱ¡ȱǰȱŘŖȱęȱȱȱȱ ȱȱęȱȱȱ Ȭ ȬȦ Ȭ Ȭȱ were screened for KHV. DNA was extracted applied in the nested PCR (Bercovier et al., 2005; using DNAzol (Invitrogen) reagent from liver, Way, 2007 [unpublished]). The PCR assays were intestine and pancreas and a standard diag- performed according to previously published nostic polymerase chain reaction (PCR) assay methods and the primers and methods used in according to published primers was applied this study are detailed in Table 1. (Bercovier et al., 2005). As expected, the SPF carp screened KHV negative, however, the In order to verify the presence and the correct ȱȱ ȱȱ ȱęȱȱ size of the PCR products, electrophoresis on tissue samples collected from all potential vector a 1.5% argarose gel (Prona), utilizing Power- species. A negative control group (n = 150) of Pack™ Basic (BioRad) was performed. The am-

SPF common carp, code line R8f10 x R3f10, were plicons were visualized with the Gel Doc™XR maintained in spring water at 12-16 ºC. All tanks (BioRad) and sized according to a GeneRuler™ were physically separated from each other in 100 bp Plus DNA ladder (Fermentas). order to prevent cross contamination between experimental tanks. Results No mortality or clinical signs of KHV disease KHV detection ǻ Ǽȱ ȱȱȱ¢ȱȱȱęȱȱ Ğȱ¢ȱŝǰȱŗŚǰȱŘŗȱȱŘŞȱȱȱ¡ǰȱ constituting the reservoir of KHV nor SPF carp. 2 SPF carp were randomly selected from each The water temperatures recorded during the ex- tank and analysed by PCR in order to detect perimental trials ranged from 12-16°C, with an KHV DNA. Gill samples were aseptically col- average water temperature of 14°C during the 4 lected from each SPF carp (sample 1), as well as week cohabitation period. Detailed results are a fragment of the intestine, liver and pancreas summarised in Table 2. In the SPF carp used as a as an organ tissue pool (sample 2). negative control group, no KHVD clinical signs were observed and KHV DNA was not detected The collected tissues were homogenised with at any point during the experimental trial. KHV scissors and DNA was isolated according to DNA was detected from all carp sampled at 28 DNAzol (Invitrogen) reagent following manu- ¢ȱȱǻǼȱȱ ȱȱęȱ Ȃȱǯȱȱęȱȱȱ demonstrating any clinical signs consistent with presence or absence of the virus involved a ǯȱȱ¡ȱęȱȱ ȱ standard procedure of PCR and nested PCR ȱȱ£¢ȱĴȱ¢ȱȱ ȱȱȱȱ ȱęȱǯȱȱ ęȱȱęȱȱȱ ȱȱȱ¢ȱ Bull. Eur. Ass. Fish Pathol., 32(6) 2012, 215

ȱŘǯ KHV DNA detection using nested primers, Bergmann et al. (2006) and Unpublished Way (2007), Ğȱȱȱŝth, 14th , 21rst and 28th dp cohab.

Variants ¢ȱŝ ¢ȱŗŚ ¢ȱŘŗ ¢ȱŘŞ ȱ¢ȱȱȱ ȱ ȱ¢ȱ ȱ Gills Pool Gills Pool Gills Pool Gills Pool SPF carp + Cr 3/4 nr 4/4 nr 4/4 4/4 nr nr SPF carp + Ep 4/4 nr 4/4 nr 4/4 4/4 nr nr SPF carp + T 2/4 nr nr nr 3/4 nr 1/4 nr SPF carp + Er nr nr 4/4 nr 2/4 nr nr nr SPF carp + Sc 2/4 nr nr nr 4/4 4/4 1/4 nr SPF carp + Gc nr nr nr nr 4/4 4/4 nr 4/4 SPF carp (k-) nr nr nr nr nr nr nr nr ȱ¢ȱȱȱ Ȭ ȱ ȱ¢ȱ Ȭ ȱ Gills Pool Gills Pool Gills Pool Gills Pool SPF carp + Cr nr 1/4 nr 4/4 nr nr 4/4 4/4 SPF carp + Ep nr 4/4 nr 4/4 nr nr 4/4 4/4 SPF carp + T nr 1/4 nr nr nr nr 1/4 4/4 SPF carp + Er nr nr nr nr nr 2/4 1/4 4/4 SPF carp + Sc nr nr nr nr nr nr 1/4 4/4 SPF carp + Gc nr nr nr nr nr nr 1/4 4/4 SPF carp (k-) nr nr nr nr nr nr nr nr

ȱȬȱȱǰȱȱȬȱȱǰȱȱȮȱǰȱȱȬȱȱěǰȱȱȬȱȱǰȱ ȱȬȱ ȱǰȱ ǻȬǼȱȮȱȱǰȱęȱȱƸȦȱǰȱȱƽȱȱǯ

ȱǯȱȱȱęȱȱȱ ȱȱȱȱȱȱęȱȱ in the study were able to transmit KHV DNA to for relay or re-stocking in natural waters and for naïve carp, in our case Dutch SPF carp. ęȱȱ¢ȱȱȱȱǯȱ Research conducted in order to create an epidemiological map of the Oder catchment area In order to determine the epidemiological risk raises the question as to whether certain species connected with KHV, it is important to specify which are not considered to be typical KHV ¢ȱ ȱȱęȱȱ carriers, but whose carrier status have been ęȱȱȱǰȱ ȱȱȱ described, such as pike (¡ȱ), bullhead display KHVD clinical signs, may infect cypri- (Ĵȱ) or tench (ǯȱ), may take part ȱǯȱȱȱȱȱĞȱ in spreading the virus as a vector (Kempter et not representatives of the family Cyprinidae. al., 2008). The authors of this report previously 216, Bull. Eur. Ass. Fish Pathol., 32(6) 2012

ȱȱęȱȱȱȱȱ ȱȱȱ ȱȱę¢ȱǯȱȱ ȱǻȱřǼȱ ȱȱȱęȱȱ ȱȱȱȱȱęȱęȱȱȱ KHV carriers due to KHV DNA detection by carriers for all species sampled, the largest pro- ǯȱȱęȱȱȱȱ¢ȱ ȱȱ portion of carriers were Prussian carp (ȱ ȱęȱǰȱȱȱȱȱ ) (52.3%), common bream (40%), tench ȱȱȱǯȱȱȱęǰȱȱȱ (34%) and pike (20%). It was also important to of tissue homogenate (liver, spleen, skin, kidney recognize the species described in this study and gills) was used to extract DNA (DNAzol as non-carriers, i.e. common rudd (ȱ Reagent). Four PCR runs, according to refer- ¢), stone moroko (ȱ ences listed in Table 1, were applied to detect ), common carp x crucian carp hybrid (ǯȱ KHV DNA. It is important to mention that apart ȱ¡ȱǯȱ), common bleak (ȱ from carp, this list included tench, perch and ), silver bream (ȱ), grass ǰȱǯǯȱȱȱęȱȱȱ carp (ǯȱ), three-spined stickleblack ( Ȭ

ȱřǯȱȱȱęȱȱęȱȱȱȱ ȱȱǻ ȱȱǯǰȱŘŖŖŞǼǯ

Collected ęȱ Common name ęȱ individuals by PCR Common carp ¢ȱ 81 22 Prussian carp ȱ 21 11 Tench ȱ 23 8 European perch ȱĚ 70 6 Commonroach ȱ 93 5 Northern pike ¡ȱ 25 5 Common dace ȱ 20 4 Gudgeon ȱ 31 4 Common bream ȱ 10 4 Ide ȱ 10 2 Crucian carp ȱ 23 2 European chub ȱ 72 Common barbel ȱ 11 Vimba bream ȱ 11 European bullhead Ĵȱ 11 Koi carp ¢ȱȱ 41 Spined loach ȱ 51 Belica ȱ 31 Common nase ȱ 11 Bull. Eur. Ass. Fish Pathol., 32(6) 2012, 217

ȱ), crucian carp (ǯȱ) and The study of pathogen transfer within the zander (ȱ). What is especially ȱęȱȱȱȱȱęȱȱ ȱȱȱȱȱȱȱȱęȱ can provide interesting and useful informa- species which belong to the Cyprinidae, such as tion about the viral transmission mode. Other common rudd, common bleak and silver bream. species within the Cyprinidae family, such as In those cases, a lack of PCR assay sensitivity ęȱǻǯȱ), have been previously might also play an important role, knowing studied in experimental cohabitation trials (El that in the latent phase of the KHV infection Matbouli et al., 2007; Sadler et al., 2008). Ac- the viral load is incredibly low (1–5 copies ml-1) ȱȱȱǰȱęȱȱȱ (Bergmann and Kempter, 2011). To determine ȱȱȱ¢ȱȱȱęȱȱȱ whether such populations are KHV carriers, the periods following an outbreak and that they ęȱȱȱȱȱȱȱ ȱ¢ȱ may act as a carrier populationǯ Duration of before sample collection. ȱȱȱęȱȱ ȱȱ caution should be taken when newly bought Initially, in 2003, it was believed that the ęȱȱȱȱȱęȱȱ ȱȱȱ optimum temperature for KHV replication common carp. In the present study, the ex- and shedding ranged between 22-26°C (Perel- perimental cohabitation of SPF carp with 6 berg et al., 2003). However, KHV induced mass ęȱȱǻęȱȱ ȱȱȱ mortality in common carp can also take place to the experimental start up) representing two when the water temperature is as low as 8°C families, Cyprinidae and Percidae, showed that (Bergmann, pers. comm.). In the present experi- ęȱȱęȱ£ȱȱȱ ȱȱȱ ment, the water temperature was much lower occur between selected species and SPF carp. than in the experiments mentioned above, i.e. 14°C on average, and this resulted in a lack of Another problem is the possibility that wild mortality in SPF carp. However, the authors ęȱ¢ȱȱȱȱ ȱ ȱȱ ¢£ȱȱĞȱ¡¢ȱŜȱ¢ȱ ȱęǯȱ ȱȱȱȱȱęǰȱ of KHV presence in Poland, the virus has sys- ȱęȱȱȱȱęȱȱ tematically adapted itself to the Polish system simultaneously (polycultures). The possibility of carp breeding (i.e. 3-year cycle at lower water exists when KHV vector species, like tench or temperatures compared to warm water condi- pike, are sold to another farm or used in re- tions, e.g. in Israel or Asia). This situation may stocking programs the virus will be transferred ȱȱȱęȱȱȱȱȱ horizontally and spread beyond the farm either which have taken place in Polish or European ȱ ȱęȱȱȱǯȱȱȱ

ȱȱęȱȱ ȱǯȱ situation may take place when infected indi- Such a situation was described for betanodavi- viduals from the natural environment are in- ruses that pose a threat for a broad spectrum ȱȱęȱȱȱ ǯȱ ȱȱ ȱęȱȱǻ£ȱȱǯǰȱŘŖŗŘǼǰȱȱ be mentioned that no vertical transfer of KHV additional studies should be applied for KHV has been observed to date, however, the pres- to verify the adaptation hypothesis. ence of the virus particles in gonads has been ęȱǻ £ȱȱǯǰȱŘŖŗŗǼǯȱȱȱ 218, Bull. Eur. Ass. Fish Pathol., 32(6) 2012

ȱȱ¡ȱȱȱȱȱ¡ȱęȱ of pathogenic KHV, both when KHVD clini- hybrids to koi herpesvirus (KHV) and the cal signs are visible and during the period of development of KHV disease (KHVD). latency, constitutes a serious problem for species ȱȱȱ 33, 267-272. which are either the subject of aquaculture or El-Matbouli M, Saleh M, Soliman H. (2007). inhabit open waters. What is more, as shown Detection of cyprinid herpesvirus type 3 in by the results of experimental cohabitation, ęȱȱ ȱ¢ ȬřȬȱ koi carp (¢ȱ koi). ¢ȱ water temperature of ca. 14°C does not restrict 161, 792-3. the horizontal transmission of the virus. The Gilad O, Yun S, Andree KB, Adkison MA, dynamics of adaptive changes in the survival Zlotkin A, Bercovier H, Eldar A and strategy of KHV shows the necessity of con- Hedrick RP (2002). Initial characteristics ducting further studies on cohabitation. This of koi herpesvirus and development of a would specify not only the paths of pathogen polymerase chain reaction assay to detect the virus in koi, ¢ȱ koi. Diseases transmission but also changes in its genomic ȱȱ 48, 101–108. character and carrier status. ȱǰȱȱǰȱĴȬȱ ǰȱȱ CM, Bercovier H and Hedrick RP (2004). Concentrations of a koi herpesvirus (KHV) ȱȱȱȱęȱ ȱȱȱ in tissues of experimentally-infected SPO RYBY no. OR 16-61535-OR1600009/07). ¢ȱ koi as assessed by real-time TaqMan PCR. ȱȱȱ ŜŖǰȱ179–187. References Bercovier H, Fishman Y, Nahary R, Sinai Gomez DK, Joh SJ, Jang H.; Shin SP, Choresca S, Zlotkin A, Eyngor M, Gilad O, Eldar CH, Han JE, Kim JH, Jun JW and Park SC A and Hedrick R (2005). Cloning of the (2011). Detection of koi herpesvirus (KHV) koi herpesvirus (KHV) gene encoding from koi (¢ȱȱ) broodstock in thymidine kinase and its use for a highly South Korea. 311, 42-47. sensitive PCR based diagnosis. ȱ ȱ ǰȱ ÙÚȱǰȱ£ȱȱȱ ȱ ¢ 5, 13. J (2008). ȃȱȱȱȱ Bergmann SM and Kempter J (2011). Detection species and the infection susceptibility ȱȱȱǻ ǼȱĞȱȬȱ ȱ Ȭ Ȭȱȱȱ in persistently infected common carp ȱ¢ȱęȱȱȱȱ (¢ȱ L.) using non-lethal hybrids acquired from open waters and sampling methods. ȱȱȱȱ culture sites of the Odra River drainage”. ȱȱȱ 31, 92-100. Wydawnictwo naukowe Akademii Rolniczej w Szczecinie (Publishers of Bergmann SM, Kempter J, Sadowski J Scientific Agricultural University in and Fichtner D (2006). First detection, Szczecin), Szczecin. ISBN – 978-83-7317- confirmation and isolation of koi 053-7. herpesvirus (KHV) in cultured common carp (¢ȱ L.) in Poland. ȱ ȱȱǻŘŖŗŗǼǯȱ£Čȱȱ ȱ ȱȱȱȱȱȱ w 2010 roku. ¢ȱ¢ 3, 2-5. 26, 97-104. Panzarin V, Fusaro A, Monne I, Cappellozza ȱ ǰȱ ȱ ǰȱ ÙÚȱ ǰȱ E, Patarnello P, Bovo G, Capua I, Holmes Ù£¢ȱǰȱȱǰȱȱǰȱ EC and Cattoli G (2012). Molecular Lenk M and Kempter J (2010). Susceptibility epidemiology and evolutionary dynamics Bull. Eur. Ass. Fish Pathol., 32(6) 2012, 219

of betanodavirus in southern Europe. ǰȱȱȱ 12, 63-70. Perelberg A, Smirnov M, Hutoran M, Diamant A, Bejerano Y and Kotler M (2003). Epidemiological description of a new viral ȱěȱȱ¢ȱ in Israel. ȱ ȱȱ 55, 5-12. Sadler J, Marecaux E and Goodwin AE (2008). Detection of koi herpes virus (CyHV-3) in ęǰȱȱ (L.), exposed to infected koi. ȱȱęȱ 31, 71-2.