The Queuosine Pathway Is Not Essential for Ensifer Medicae WSM419 Symbiosis and Certain Components of This Pathway Modulate Lipid Biosynthesis
The Queuosine pathway is not essential for Ensifer medicae WSM419 symbiosis and certain components of this pathway modulate lipid biosynthesis
By Jaco Daniel Zandberg
Supervisors: Dr. Wayne Reeve Dr. Julie Ardley Dr. Ravi Tiwari
i
Declaration
I hereby declare, that unless otherwise stated, the work presented in this thesis is my own
Jaco Daniel Zandberg
ii
Acknowledgements
I would like to begin with the formalities. A special thank you to Mr. Xin Du and Prof. Yonglin
Ren at Murdoch University, Perth, Australia for allowing me access to your HS-GC system and analysis. Furthermore, thank you to Dr. Bill Dunstan for allowing me access to your microscope and imaging software.
Now, with the formalities finished, I take the time here to use all the words I was barred from using by my supervisors whilst writing this thesis (because I’ll be damned if I don’t get to use these fantastic words) and what better place than here, thanking the very people that told me not to.
So here I take the time to showcase my thanks to Dr. Julie “comma” Ardley for ensuring that I understand the plethora of information regarding everything ‘plant’ and for providing me with the necessary support when I needed it most. I thank Dr. Ravi “sticky fingers” Tiwari for
“procuring” much needed reagents and for teaching me the most complicated genetic engineering technique, primer design. Lastly, I would like to thank Dr. Wayne “strikethrough”
Reeve for providing me with a once in a lifetime opportunity, showcasing a phenomenal aptitude for the work done here and for excelling in his role as supervisor, one could not hope for a better supervisor.
This one short year has been the most rewarded educational experience I have had in eighteen years of being educated, I sincerely thank again all those who were mentioned and all those who were not mentioned.
iii
Table of Contents DECLARATION ...... II ABBREVIATIONS ...... VII ABSTRACT ...... VIII INTRODUCTION ...... 1 1.1 LIFE ON EARTH IS BASED ON A HIGHLY SIMILAR GENETIC CODE ...... 2 1.2 THE FEATURES AND FUNCTIONALITIES OF THE GENOME...... 3 1.3 EXPRESSING THE GENETIC MESSAGE ...... 5
1.3.1 THE TRANSLATION MACHINERY AND THE UNIVERSAL GENETIC CODE ...... 5 1.3.2 DECODING THE GENETIC CODE ...... 7 1.3.3 THE SELECTION-MUTATION DRIFT THEORY...... 8 1.3.4 THE CODON-ANTICODON WOBBLE POSITION ...... 9 1.3.5 THE RIBOSOMAL GRIP AND ITS EFFECTS ON CODON-ANTICODON BINDING AFFINITY ...... 10 1.4 BROADENING THE WOBBLE-POSITION RULES ...... 11
1.4.1 THE DEVIATION IN THE GENETIC CODE ...... 12 1.5 THE GROSJEAN & WESTHOF MODEL FOR THE UNIVERSAL GENETIC CODE ...... 12 1.6 THE GLOBAL AND INDUCIBLE MODULATION OF THE TRANSLATION MACHINERY ...... 14 1.7 TRNA MODIFICATION ...... 15 1.8 THE QUEUOSINE TRNA MODIFICATION ...... 18 1.9 CONTROLLING THE QUEUOSINE PATHWAY ...... 23 1.10 THE IMPACT AND FUNCTION OF QUEUOSINE ...... 26 1.11 LEGUMES AND ROOT-NODULE BACTERIA ...... 29
1.11.1 ESTABLISHMENT OF AN AMICABLE SYMBIOTIC RELATIONSHIP ...... 29 1.11.1.1 The rhizosphere ...... 29 1.11.1.2 The infection process of RNB ...... 31 1.11.2 ESTABLISHMENT OF AN N2 FIXING SYMBIONT ...... 33 1.11.3 AN EXAMPLE OF TERMINALLY DIFFERENTIATED BACTEROIDS ...... 34 1.12 WHAT IS THE ROLE OF THE Q-PATHWAY IN RNB? ...... 35 1.14 AIMS ...... 36 MATERIALS AND METHODS ...... 37 2.1 BIOINFORMATICAL ANALYSIS AND PREDICTION ...... 38
2.1.1 ASSEMBLING GENETIC SEQUENCES OF CONSTRUCTS ...... 39 2.2 STRAINS, GROWTH CONDITIONS AND CRYOPRESERVATION ...... 40 2.3 PCR PRIMER DESIGN ...... 43 2.4 PCR AMPLIFICATION CONDITIONS ...... 44 2.5 PCR AMPLIFICATION ...... 45 2.6 PCR PRODUCT PURIFICATION ...... 46
iv
2.7 LIGATION REACTIONS ...... 46
2.7.1 QUADRUPLE FRAGMENT LIGATION CONSTRUCTS PQLΔSMED_3534, PQLΔSMED_4938 AND PQLΔSMED_4937 IN THE MOBILE SUICIDE VECTOR PJQ200SK...... 46 2.7.1 QUADRUPLE FRAGMENT LIGATION CONSTRUCTS PQLΔNGR_C36640 IN THE MOBILE SUICIDE VECTOR PJQ200SK...... 46 2.8 COMPETENT CELL PREPARATION ...... 47 2.9 EXTRACTION AND PURIFICATION OF PLASMID DNA ...... 48 2.10 TRANSFORMATION ...... 48 2.11 BIPARENTAL CONJUGATION METHODOLOGY WITH E. MEDICAE WSM419 ...... 49 2.12 TRIPARENTAL CONJUGATION METHODOLOGY WITH E. FREDII NGR234 ...... 50 2.13 PCR CONFIRMATION...... 51
2.13.1 PCR AMPLIFICATION CONFIRMATION OF THE UP AND DN REGIONS FOR INACTIVATION VECTORS ...... 51 2.13.2 PCR AMPLIFICATION CONFIRMATION OF THE UP AND DN REGIONS FOR MUTANT DERIVATIVES ...... 51 2.14 AGAROSE GEL ELECTROPHORESIS ...... 52 2.15 DNA SEQUENCING ...... 53 2.16 ANTIBIOTIC VIABILITY TESTING ...... 53 2.17 MEAN GENERATION TIME ASSAY ...... 53 2.18 PROLONGED STATIONARY PHASE ASSAY ...... 54 2.19 E. MEDICAE WSM419 AND MUTANT DERIVATIVE STRESS PHENOTYPING...... 55
2.19.1 MOTILITY PHENOTYPING ...... 55 2.20 HEADSPACE VOLATILE ORGANIC ASSAY BY GAS CHROMATOGRAPHY MASS SPECTROMETRY (HS-GC-MS) ...... 56 2.21 PLANT NODULATION AND NITROGEN FIXATION ...... 56 2.22 PCR CONFIRMATION OF NODULE OCCUPANTS ...... 58 RESULTS ...... 60 3.1 BIOINFORMATICAL ANALYSIS AND PREDICTION OF THE Q PATHWAY FOR ALL 139 GEBA-RNB ...... 61
3.1.1 Q-PATHWAY GENES ARE UBIQUITOUS IN THE GEBA-RNB ...... 61 3.1.2 CERTAIN QUE GENE NEIGHBOURHOODS ARE STRONGLY CONSERVED ACROSS RNB ...... 62 3.1.3 CERTAIN RNB CONTAIN AN ALTERNATE ORTHOLOG OF QUEE1 IN THE QUEED GENE NEIGHBOURHOOD ...... 64 3.2 DETAILED BIOINFORMATIC ANALYSES OF THE Q GENES IN THE NHR E. MEDICAE WSM419 AND THE BHR E. FREDII NGR234 ...... 66
3.2.1 PARTICULAR Q-PATHWAY GENES HAVE BEEN ANNOTATED AS EXOPOLYSACCHARIDE SYNTHESIS (EXS) GENES IN E. MEDICAE WSM419 AND E. FREDII NGR234 ...... 66 3.2.2 THE Q BIOSYNTHETIC ENZYMES OF E. MEDICAE WSM419 AND E. FREDII NGR234 ARE HIGHLY CONSERVED ...... 68 3.3 CONSTRUCTION AND CONFIRMATION OF THE E. MEDICAE WSM419 AND E. FREDII NGR234 MUTANT STRAINS ...... 69
3.3.1 AN OVERVIEW OF THE PROCESS USED IN ENSIFER MUTANT CONSTRUCTION ...... 69 3.3.2 IDENTIFYING ANTIBIOTIC RESISTANCE MARKERS TO SELECT FOR ENSIFER MUTANTS ...... 69 3.3.3. OVERVIEW OF THE CONSTRUCTION OF INACTIVATION VECTORS ...... 71 3.3.4. CONSTRUCTION AND CONFIRMATION OF THE E. MEDICAE WSM419 INACTIVATION VECTORS ...... 72 3.4.2 CONSTRUCTION AND CONFIRMATION OF E. MEDICAE WSM419 MUTANTS ...... 74
v
3.4.3 CONSTRUCTION AND CONFIRMATION OF E. FREDII NGR234 INACTIVATION VECTORS ...... 78 3.4.4 CONSTRUCTION AND CONFIRMATION OF E. FREDII NGR234 QUEG MUTANT ...... 80 3.5 FREE-LIVING PHENOTYPING...... 81
3.5.1 IS THERE AN EFFECT ON GROWTH FOR THE QUE MUTANT DERIVATIVES?...... 81 3.5.2 FREE-LIVING PHENOTYPES FOR E. MEDICAE WSM419 WILD-TYPE AND MUTANT DERIVATIVE STRAINS ...... 82 3.5.3 E. MEDICAE MORPHOLOGY AND MOTILITY ...... 84 3.5.3.1 Motility and morphology of E. medicae WSM419 and mutant derivatives ...... 84 3.5.3.2 Colony swarming of E. medicae WSM419 and que mutants on solid TYC media...... 84 3.6.3 THE UNIQUE DONUT MORPHOLOGY OF E. MEDICAE WSM419 ON SOLID YMA MEDIA ...... 85 3.6.3.1 Single colony morphology of E. medicae WSM419 wild-type ...... 85 3.6.3.2 Single colony morphology of E. medicae WSM419 mutant derivative strains ...... 86 3.6.4 DETECTION OF SUCCINOGLYCAN (EPSI) USING CALCOFLUOR (CF) ...... 88 3.6.5 PROLONGED STATIONARY PHASE (PSP) ASSAY ...... 89 3.6.6 VOLATILE ORGANIC ASSAY USING HEAD-SPACE GAS CHROMATOGRAPHY – MASS SPECTROMETRY (HS-GC-MS) ...... 90 3.7 SYMBIOTIC PHENOTYPING ...... 93
3.7.1 RECOVERY OF E. MEDICAE WSM419 WILD-TYPE AND MUTANT DERIVATIVE STRAINS FROM DEVELOPED MEDICAGO TRUNCATULA NODULES ...... 93 3.7.2 CONFIRMATION OF E. MEDICAE INOCULANTS IN RECOVERED NODULES ...... 93 DISCUSSION ...... 96 4.1 THE QUEUOSINE PATHWAY AND ITS ROLE IN THE TRANSLATIONAL MACHINERY ...... 97 4.2 THE INFLUENCE OF THE Q MODIFICATION ...... 98
4.2.1 THE GENOMIC ENCYCLOPAEDIA FOR BACTERIA AND ARCHAEA-ROOT NODULATING BACTERIA (GEBA-RNB) GENOME RESOURCE ...... 99 4.3 THE Q-PATHWAY IS UBIQUITOUS IN THE GEBA-RNB ...... 100
4.3.1 THE NHR E. MEDICAE WSM419 AND THE BHR E. FREDII NGR234 BOTH CONTAIN A COMPLETE Q-PATHWAY ...... 101 4.4 THE Q-PATHWAY IS REQUIRED FOR OPTIMAL GROWTH OF E. MEDICAE WSM419 ...... 102 4.5 AN INTACT QUEUOSINE PATHWAY IS NOT REQUIRED FOR E. MEDICAE WSM419 CELL VIABILITY EVEN AFTER PROLONGED STATIONARY PHASE (PSP)...... 103
4.5.1 THE ABSENCE OF QUEE CAUSES SLOWER GROWTH...... 103 4.5.2 THE ΔQUED AND ΔQUEE MUTATIONS IMPACT COPPER TOLERANCE ...... 104 4.6 THE DISRUPTION OF QUED AND QUEE, BUT NOT QUEG, DIMINISHES THE ABILITY FOR E. MEDICAE WSM419 TO PRODUCE SUCCINOGLYCAN (EPSI) ...... 105
4.6.1 OSMOTIC STRESS TOLERANCE ...... 106 4.7 AN INTACT QUEUOSINE PATHWAY IS NOT NECESSARY FOR THE SUCCESSFUL ESTABLISHMENT OF A M. TRUNCATULA SYMBIOTICALLY FIXING NODULE ...... 107 4.8 DISRUPTION OF QUEE IMPACTS LIPID BIOSYNTHESIS IN E. MEDICAE WSM419 ...... 109 4.9 THE MODEL OF Q-PATHWAY INTERACTIONS AND FUTURE DIRECTIONS ...... 112 APPENDIX A ...... 115 APPENDIX B...... 119 APPENDIX C ...... 123 REFERENCES ...... 126
vi
Abbreviations Base pair bp Deoxyribonucleic acid DNA Ribonucleic acid RNA Transfer RNA tRNA Messenger RNA mRNA Ribosomal RNA rRNA Aminoacyl tRNA synthetase aaRS Amino acid bound to tRNA aa-tRNA The wobble-position N34 Anticodon wobble base AWB Codon wobble base CWB Queuosine Q Queuosine pathway Q-pathway Queuine q 5’ upstream region 5’ UTR 5’ intragenic region UP 3’ downstream region 3’ DTR 3’ intragenic region DN Broad host range BHR Narrow host range NHR Root hair curling RHC Infection thread IT Symbiotic nitrogen fixation SNF Nodule-specific cysteine-rich (NCR) peptides NCR peptides Headspace Gas chromatography mass spectrometry HS-GC-MS
vii
Abstract
The Queuosine pathway (Q-pathway) is a complex biosynthetic pathway responsible for the production of Q-modified tRNA (Q-tRNA). Q-tRNA alters the codon–anticodon interactions for the Q-family of tRNA molecules which are charged with the amino acids asparagine, aspartate, histidine or tyrosine, improving the efficiency and stringency of translation. Q-tRNA has been shown to be essential for cell survival in certain stressful conditions, bacterial virulence, and recently for the establishment of an effective symbiotic relationship between the RNB Ensifer meliloti 1021 and its legume host Medicago truncatula.
This thesis has shown that the Q-pathway is ubiquitous in 139 root-nodule bacteria
(RNB) characterized in the Genomic Encyclopaedia-Root Nodule Bacteria (GEBA-RNB) project.
Access to the GEBA-RNB genomes provided an essential resource to identify, categorise and catalogue a total of 1,245 que genes in a comprehensive Q-pathway RNB database. The constructed database contains all Q-pathway genes for each strain, IMG unique accession numbers, protein domains and predicted protein functions. The database enabled specific genes to be targeted for inactivation in the narrow host range RNB E. medicae WSM419 and in the broad host range RNB E. fredii NGR234. Using this information, four inactivation vectors were successfully created and verified to inactivate queD, queE and queG in E. medicae
WSM419 and queG in E. fredii NGR234. The inactivation vectors were successfully used to create six double cross-over mutants of E. medicae WSM419 (two independent mutations in each of the targeted que genes) and two queG single cross-over mutants of E. fredii NGR234.
All of the mutations in E. medicae WSM419 were verified by PCR amplification. These mutants were then used to investigate the role of the Q-pathway in WSM419 by extensively phenotyping free-living and symbiotic forms. Inactivation of queD or queE was found to
viii decrease the growth rate of these mutants in free-living conditions. These mutations were shown to significantly reduce the final cell density (P-value = <0.05) of cultures exposed to
o ZnSO4, CuSO4, NaCl and at 20 C in comparison to the wild-type and queG mutant. However, no significant difference in the final cell density (P-value = >0.05) was observed for cultures
o exposed to pH 5.7, pH 7.0, EtOH, Sucrose, H2O2, and at 37 C. However, all mutant cultures treated with SDS showed a significant reduction in final cell density (P-value = <0.05) compared to the wild-type.
Furthermore, this study revealed that the queD and queE mutants, but not the queG mutant, were affected in their ability to produce succinoglycan. Succinoglycan is essential for the symbiotic proficiency of E. meliloti 1021 with Medicago spp. The symbiotic proficiency of the E. medicae WSM419 mutant derivatives were therefore investigated. This study revealed that the Q-pathway is not required for the establishment of a successful E. medicae-M. truncatula symbiosis. These results are contrary to the findings of the published study by
Marchetti et al. (2013) and calls into question the role of the Q-pathway in symbiotic function.
Finally, this study revealed that QueE modulates the production of long chain fatty acids, most likely through an affect via FadR or FabH. There was an increase in the long chain fatty acid content of the queE mutant compared to the wild-type as measured by a headspace gas-chromatography mass-spectrometry.
A model has now been constructed and presented in this thesis to explain the relationship between the findings of this study and the components of the Q-pathway. This model presents new avenues for future research into the role of que genes not only in the
NHR E. medicae WSM419 but also in the BHR microsymbiont E. fredii NGR234.
ix
Introduction
Chapter 1 Introduction 1
1.1 Life on earth is based on a highly similar genetic code
The genetic similarities of organisms indicate that there has been a divergent evolution from a common ancestor as early as 4.1 billion years ago, based on the remains of life in Western
Australian rock (Bell et al., 2015). The genetic code dictates the translation of the genetic information into protein, and this decoding process is highly conserved in all forms of life.
Pioneering work with Escherichia coli (E. coli) in the 1960’s enabled the genetic code to be cracked (Nirenberg et al., 1965). The bases of the genetic material consist of five nucleotide bases, split into two groups: 1) Purines - Adenine (A) and Guanine (G), 2)
Pyrimidines - Cytosine (C), Thymidine (T) in deoxyribonucleic acid (DNA), and lastly Uracil (U), which substitutes for T in ribonucleic acid (RNA). Typical base ‘pairing’ abides by Watson-Crick base pairing where a purine base binds to a corresponding pyrimidine base through hydrogen bonding, forming a ‘base pair’ (bp) (Fig 1.1). Depending on the sequence of the bases in DNA, corresponding RNA can be transcribed, these conserved sequences that encode RNA are known as genes. Regardless of cell type or domain of life, all organisms contain their genes that need to be decoded in a stable and efficient manner.
Figure 1.1. Watson-Crick base pairing for two base pairs. Canonical base pairing, which abide by Watson-Crick base pairing rules. The G-C base pair contains three H-bonds, whereas A-T and A-U contain two H-bonds. Figure was obtained from OpenStax College, Biology.
Chapter 1 Introduction 2
1.2 The features and functionalities of the genome
The entirety of genetic information contained in an organism is known as the ‘genome’, and the genome determines: 1) the number of proteins that can be expressed, 2) the rate at which the proteins are expressed, and 3) which specific proteins are expressed at a particular time or condition. As a result, the genomic content determines the extent of proteins that can be synthesised as well as the capability to produce response factors towards certain stressors.
Due to biotic and abiotic stresses faced by a bacterial organism, the genome is under constant selective and changing pressures. Eventually, the genome of the organism becomes minimalistic and streamlined within a niche environment. In the review conducted by
Giovannoni et al. (2014), streamlined genomes were typically categorised by: 1) small genomes with a highly conserved core and only a few pseudogenes, 2) low ratios of intergenic
DNA to coding DNA; 3) low numbers of paralogs. The essence of streamlining theory is that selection is most efficient in organisms that have large effective population sizes, and favours cell architecture that minimizes resources required for replication (Giovannoni et al., 2014,
Grzymski & Dussaq, 2012).
It is important to note that streamlining is a function of evolutionary adaptation and that evolutionary adaptation can provide the cause for an entire population to adapt to a new niche environment. However, there are some issues associated with evolutionary adaptation:
1) It is not immediate, 2) One member of the population must still survive, 3) A change in the genome is necessary either by mutation or gene acquisition. It has been established that the more environmental stresses an organism faces, the larger the genome, and the greater the fraction of its genome devoted to regulatory genes (Hodgeson & Thomas, 2002).
Chapter 1 Introduction 3
The increase in regulatory genes is essential for an effective and reactive adaptation to provide cells with the means to immediately react and adapt to environmental challenge through transcriptional or translational changes (Neidhardt, 2002). In the case of bacterial cells, this is usually accomplished through one of three response systems: 1) Starvation stress response, 2) Global stress response and 3) Emergency response. The basic response for these systems is shown in Fig 1.2.
Stress
Sensor
Signal
Regulator Feedback Effector operons loop
Responding proteins
Cell response
Figure 1.2. Basic response circuit for bacteria to stress. A stress is detected by a sensor, typically a membrane protein. From the membrane protein signal transduction occurs, causing expression of a regulator appropriate for the stressor. The regulator is able to affect a regulating operon known as a regulon, which in turn produces proteins necessary to overcome the specific stressor. Collectively this is known as the cell response, which can feed back into the signalling protein or regulator, where it may cause further expression or inhibition.
In short, the size of a bacterial genome and its expression is indicative of the capabilities to adapt to environmental challenge. Hence, a larger genome provides a greater variety of responses (Rocha, 2004). However, the size of the genome does not ultimately define the extent of adaptability or proficiency, as the efficiency of expressing can further provide optimization and increase the capacity to adapt.
Chapter 1 Introduction 4
1.3 Expressing the genetic message 1.3.1 The translation machinery and the Universal Genetic Code
Expression of the genetic message involves decoding the DNA or RNA nucleotides into the functional or structural proteins. In this process, the sequences of nucleotide triplets called codons, correspond to a specific amino acid or a start/stop signal. The genetic information is expressed through accurate reading of the codon by transfer RNA (tRNA) molecules, which carry specific amino acids (aa-tRNA). Specifically, reading occurs by codon-anticodon pairing
(Watson-Crick rules) between messenger RNA (mRNA) and tRNA on the ribosome (Fig
1.3)(Ling et al., 2015, Das & Lyngdoh, 2012).
tRNA Growing polypeptide
Amino acids Thr-tRNA
Polypeptide chain
Figure 1.3. The procedure and proteins associated with protein synthesis during translation. For each amino acid there is a corresponding tRNA, on which it is attached to by aminoacyl-tRNA synthase (aaRS). The resulting aminoacyl-tRNAs are then delivered to the ribosome by initiation or elongation factors to decode its corresponding codon. This figure uses Threonine (Thr) as an example amino acid (Ling et al., 2015).
The tRNA provides a precise translation of genetic information from DNA to amino acids in proteins. All canonical permutations of codon-anticodon binding are represented in the ‘Universal Genetic Code Chart’ (Fig 1.4), each permutation coding for a specific amino acid.
Chapter 1 Introduction 5
Figure 1.4. The universal genetic code. The universal genetic code consists of 61 of the 64 nucleotide triplets, known as sense codons, which translate a total of 20 amino acids, and the three remaining codons (UAA, UAG, UGA) being responsible for termination of protein synthesis, termed stop codons. The sense codons suffer from degeneracy which allows a single tRNA to translate more than one synonymous codon and most codons can be translated by more than one iso-acceptor tRNA (Ling et al., 2015).
Chapter 1 Introduction 6
1.3.2 Decoding the genetic code
During translation an aa-tRNA molecule enters the large subunit of the ribosome at
position A (Aminoacyl site), wherein the formation of cognate codon-anticodon duplexes
occurs by hydrogen bonding of bases in aa-tRNA and mRNA (Klepper et al., 2007, Urbonavicius
et al., 2001, Grosjean & Westhof, 2016). Following the binding of the cognate codon-
anticodon duplexes, the ribosome will traverse from 5’ to 3’, where the aa-tRNA enters
position P (Peptide site) of the ribosome and becomes peptidyl-tRNA as the amino acid
attached will either begin a polypeptide chain or add to it (Fig 1.5).
Polypeptide chain
Free tRNA aa-tRNA (Phe-tRNA)
Large ribosmal subunit
Small ribosomal Figure 1.5. The translational procedure involving cognate Phenylalanine-tRNA,subunit mRNA, and ribosome. aa- tRNA (in this example Phe-tRNA) enters the large subunit of the ribosome at position A, wherein the formation of cognate codon-anticodon duplexes occurs by hydrogen bonding. As the ribosome traverses from 5’ to 3’, the aa-tRNA enters position P becoming peptidyl-tRNA, the polypeptide chain being created will be added to the Phenylalanine (Phe). Once the Phe aa has disassociated, the tRNA enters position E where it is released as a free tRNA. Image modified from OpenStax College, Biology (CC BY 4.0).
Thereafter, the ribosome shifts 3 bp (a codon) and the tRNA is released as it enters
into the E site (Exit site). Eventually, the extended polypeptide chain is released and undergoes
folding to form a protein. Due to its extreme expenditure of energy and frequency of
Chapter 1 Introduction 7 occurrences, optimized translation is an important part of genome optimization. The optimization of translation is thought to occur due to the ‘Selection-Mutation drift theory’.
1.3.3 The Selection-Mutation drift theory
The rate of translation of synonymous codons is dependent on: 1) the concentration of tRNAs and 2) the rates of the pairing of each codon-anticodon combination (Ran & Higgs, 2010).
Furthermore, some codons are more abundant than others, this is a result of mutational biases and selective forces as per the selection-mutation drift theory (Andersson & Kurland,
1990, Sharp et al., 1993, Bulmer, 1991).
The translational machinery can be optimized by the selection-mutation drift theory
(Rocha, 2004, Bulmer, 1991, Ling et al., 2015) which leads to a streamlined genome. Typically a streamlined genome has an enhanced codon bias towards the genes that are regularly expressed (Giovannoni et al., 2014) and all non-expressed codons are culled as per the selection-mutation drift theory. Rocha et al. (2004). showed that as the mean generation time of growth gets shorter, genomes contain more regularly expressed tRNA genes, but fewer anticodon species. An analysis of a comprehensive tRNA gene deletion library of
Saccharomyces cerevisiae (S. cerevisiae) revealed that identical tRNA gene sequences at different genomic loci contribute differentially to fitness (Bloom-Ackermann et al., 2014). As such, despite a seeming overall reduction in variation, a small degree of innate variation is still present. Ultimately, a genome is optimized to a niche environment through streamlining and the ‘shedding’ of unwanted genetic information and despite a loss of tRNA species, innate variation is observed for tRNA genes expressed at different loci. This is not the only example of innate variation found in the genetics. The greatest influence on the translation machinery
Chapter 1 Introduction 8 by an innate mechanism is due to the wobble-position, which is the cause for the genetic information to be translated in a degenerate manner
1.3.4 The codon-anticodon wobble position
Previously it was explained that the codon-anticodon duplexes abide by strict Watson-Crick base pairing. However, this is only for N35 and N36 (Fig 1.6). At position 34 of the anticodon loop, non-Watson-Crick base pairing is observed with the third base of the codon. This position is called the ‘wobble position’ (Crick, 1966, Das & Lyngdoh, 2012, Ran & Higgs, 2010).
Anticodon loop 5’ 3’
34 36 35
mRNA 3’ 3 2 1 5’ Figure 1.6. The anticodon-codon binding schematic for tRNA and mRNA. The distribution of nucleotide residues of the anticodon loop for position 27 to 43 represented in a pie chart with the colour code shown top-right of the figure. The interaction between the codon-anticodon duplex is represented to have a weak bond at position 34 (N34) of the tRNA and position 3 of the mRNA. The other two members of the duplex have strong hydrogen bonding. Distribution of nucleotide residues were recovered from the online software tool ‘tRNAmodviz’, the bioinformatic information was agglomerated from 195 sequences; 2 kingdoms, 110 species, 4 organelles, and 23 amino acid triplets. Made by author.
Chapter 1 Introduction 9
The third base of the codon (the codon wobble base or CWB) may be – adenosine (A), cytosine (C), guanine (G), or uracil (U), whereas the anticodon wobble bases (AWB) exclude
‘A’ (Das & Lyngdoh, 2012). The near-total absence of ‘A’ (2.07%) at the wobble position is attributed to evolutionary exclusion; any ‘A’ residues at the AWB are converted into inosine by anticodon adenine deaminase (Balasubramanian et al., 1980), as such, any CWB with ‘U’ as a base will have an unfavoured binding. The wobble-position provides further and powerful innate variation in the decoding machinery. However, to maintain rational decoding of the genetic code, the ribosome must assist in stabilising the codon-anticodon duplex.
1.3.5 The ribosomal grip and its effects on codon-anticodon binding affinity
Recent studies (Machnicka et al., 2013, Cantara et al., 2011, Agris, 2008, Demeshkina et al.,
2012, Jenner et al., 2010, Ogle et al., 2001) on the function of modified nucleotides in tRNA have found that the ribosome is not a passive machine but an active component (structurally and kinetically) of the codon selection mechanism, improving stringency and stability.
Specifically in bacteria, the ribosome (70S) consists of a large subunit (50S) and a small subunit
(30S). A portion of the small subunit (16S) makes A-minor type interactions in the minor groove of the first two base pairs of the codon-anticodon helix, which is known as the ribosomal grip (Fig 1.7)(Grosjean & Westhof, 2016, Lim & Venclovas, 1992), stabilizing the effect caused by the wobble-position to an extent. Despite extensive research into this field, the wobble-position remains ill defined, with the original rules dated back to 1960. Recently however new ‘rules’ have been brought forward.
Chapter 1 Introduction 10
A
B
Figure 1.7. The effect of ribosomal grip in the codon-anticodon duplex at the A-site of the ribosome. A) The cognate tRNA binding to mRNA with the assistance of the ribosomal subunit 16S. B) The incorrect tRNA binding to mRNA with a partial binding of the ribosomal subunit 16S.
1.4 Broadening the wobble-position rules
Originally it was thought that all living organisms used the universal genetic code (Ling et al.,
2015). However, the assumed universal and immutable genetic code is now known to contain many variations. The postulated ‘Crick wobble rules’ defined, but did not explain, which base pairs are allowed/disallowed at the wobble position of the codon-anticodon duplex. As such, it has become necessary to broaden the definition of the wobble-position hypothesis and associated rules, primarily due to the increasing number of non-standard codon-anticodon interactions.
Chapter 1 Introduction 11
1.4.1 The deviation in the genetic code
Some years after Crick’s work, it was discovered that the mitochondrial genetic code of yeast deviated from the standard code, with CUN codons assigned to Threonine (Thr) instead of
Leucine (Leu), and UGA used to encode Tryptophan (Trp) (Li & Tzagoloff, 1979, Macino et al.,
1979) instead of being a translational stop codon. Furthermore, certain organisms (including
E. coli and humans) were found to contain an ‘expanded’ genetic code and to recode some
UGA stop codons to insert selenocysteine (Sec) into selenoproteins (Grosjean & Westhof,
2016). Mukai et al. (2016) found that tRNASec normally recognizes the UGA stop codon but can also recognize and bind to the other two stop codons; UAG and UAA. Furthermore, selenocysteine is formed directly on tRNA and is never a free metabolite (Krzycki, 2005). A second amino acid pyrrolysine (Pyl) has also been found to decode UGA. The major difference between the two additive amino acids is that selenocysteine is found in all domains of life
(Bock & Thanbichler, 2004), whereas pyrrolysine appears limited to Methanosarcinacea and the Gram-positive Desulfitobacterium hafniense (Krzycki, 2005). These deviations in the genetic code are examples of an innate variation found in the translation machinery and is not the only example of a change in expression of the genetic code innate to the machinery.
1.5 The Grosjean & Westhof model for the Universal Genetic Code
As discussed previously, the selective and mutational forces optimize the translational machinery by influencing the content of the machinery, primarily the tRNA species.
Furthermore, there is a certain degree of innate variation involved in the translational machinery caused by 1) The wobble-position, 2) The deviation in non-standard decoding, and
3) The flexibility exhibited by the code. In order to include the innate variation and deviation in the genetic code, Grosjean & Westhof. 2016. proposed an improved layout of the Universal
Chapter 1 Introduction 12
Genetic Code (Fig 1.8), wherein an unsymmetrical circularised format of all the interactions between mRNA, tRNA, and rRNA can be represented.
Figure 1.8. Circular representation of the genetic code emphasizing the inherent regularities of the decoding recognition process. The codons containing solely G = C pairs at the first two positions are at the top, those containing solely A–U pairs at the bottom, and those with mixed pairs of G=C and A–U either at the first or second pair of the codon/anticodon helix in the middle at the right and left. Thick red lines separate the three main regions. The red arrow indicates the direction of rotation for C1, G1, U1, A1 and the blue arrows the direction of rotation for C2, G2, U2, A2 on the right and left parts of the wheel. The amino acids coded by unsplit 4-codon boxes are indicated in red and those by split 2:2- and 3:1-codon boxes, together with the usual stop codons, are indicated in black. Throughout, the codon positions are numbered B1-B2-B3 and the anticodon nucleotides B34-B35-B36, both from 5’ to 3’(Grosjean & Westhof, 2016).
Chapter 1 Introduction 13
1.6 The global and inducible modulation of the translation machinery
Thus far we have discussed the ability for bacteria to actively respond to environmental stressors by using a range of stress response systems. These response systems are however limited by genomic content. Content of which is influenced by natural selection (particularly the tRNA species), causing streamlining and minimalism to be favoured when a niche environment is maintained for generations. An organism containing a minimalist genome is able to out compete other organisms with less optimized genomes. However, a minimalist genome is a ‘double-edged sword’ as its ability to respond to a variety of changes is diminished and readily out competed by an organism containing an extensive genome when exposed to a change in the environment.
Rarely is an organism in an optimal environment for long in nature, as such most organisms don’t attain a perfectly streamlined genome. Rather, organisms develop genomes that are predisposed to a particular environment and are able adapt to a certain extent to the niche environment. During times of great change and the phenotypic predisposition of the genomic content is insufficient to overcome the stress, the innate variation provided by the wobble-position, flexibility and deviation in the translation machinery may provide the necessary ability to overcome stress by altering translation globally in the genome. For example, in mycobacteria the substitution in codon usage of glutamate for glutamine and aspartate for asparagine confers remarkable phenotypic resistance to the antibiotic rifampicin
(Javid et al., 2014). However, this global response is limited and is innate.
Bacterial response systems are inducible, directly influencing genomic expression, however is limited to genomic content and as such influenced by natural selection. On the contrary, the genetic code contains innate variation that can influence the global expression
Chapter 1 Introduction 14 of the genome, however is limited in the extent of which expression is changed compared to the response systems and is not inducible. Recently, a diverse set of pathways have become apparent that are inducible and affect the global expression of a genome by modifying the translation machinery directly, specifically the tRNA molecules, these pathways are collectively known as tRNA modifications.
1.7 tRNA modification The most characteristic feature of tRNAs is the presence of hypermodified nucleosides in the anticodon loop and stem (positions 27–40) (Pathak & Vinayak, 2005). These modifications are varied and occur in tRNAs throughout all domains of life (Fig 1.9)(Machnicka et al., 2013,
Grosjean & Westhof, 2016, Jackman & Alfonzo, 2013). The modified tRNAs are vastly different from one another: 1) chemical structures, 2) presence in different tRNAs, 3) location of modification and 4) influence on different reactions in which the tRNA participates. These differences are accounted for by the complex chemical groups that are incorporated into tRNA
(Jackman & Alfonzo, 2013, Grosjean & Westhof, 2016).
Early in the study of tRNA modifications, the absence of highly conserved modifications showed a negligible phenotypic effect on different cell types. Furthermore, the deletion of a single gene required for the tRNA modification often caused little to no detectable growth defects (Jackman & Alfonzo, 2013). The observation of a synthetically lethal network of interactions between modification enzymes in yeast, where single deletions are viable, but deletion of combinations of tRNA modification genes are not, suggests some redundancy in the system whereby loss of single modifications can be compensated for by the presence of others (Alexandrov et al., 2006). Recent studies have shown that the lack of two or more
Chapter 1 Introduction 15
modification, which individually causes no effect on cell growth, usually leads to synthetic
lethality (Jackman & Alfonzo, 2013).
A
B
Figure 1.9. All known tRNA modifications that are found on N34, AWB. A) All associated tRNA modifications with the nucleotides found at position 34 of the tRNA molecule for three domains and the organelles, extracted from (Grosjean & Westhof, 2016). B) Modification profile of N34, using the online software ‘tRNAmodviz’ database for 602 sequences from: 4 kingdoms, 110 species, 4 organelles, 23 amino acid triplets.
Chapter 1 Introduction 16
Regardless of the differences, it has been established through a comparison of modified tRNA species from Archaea, Bacteria and Eukarya that a core set of 18 ‘universal’ modifications occur in tRNA in all three domains of life (Jackman & Alfonzo, 2013). Although there has been much conservation in the core modifications, some of these have ‘evolved’ by the acquisition of chemical groups that have been added onto the core in a sequential manner by other enzymes (Maraia & Arimbasseri, 2017). Despite the differences exhibited by each modification and the conservation of a core set of modifications, it has been established that they all contribute in some way to efficiency and accuracy of translation (Urbonavicius et al.,
2001, Vinayak & Pathak, 2009, Maraia & Arimbasseri, 2017). Furthermore, there is rarely only one modification per tRNA; in general, all modifications on one tRNA work in tandem to achieve the common goal of permitting tRNAs, by means of their sequence diversity to read a nearly universal genetic code (Jackman & Alfonzo, 2013).
Position N34 on tRNA anticodon is not only unique in nature regarding the wobble- position but is also associated with a shift in anticodon and codon use patterns on a broad evolutionary scale (Maraia & Arimbasseri, 2017, Grosjean et al., 2010, Marck & Grosjean,
2002). Post-transcriptional modifications of N34 can change the physiochemical behaviour of the base and/or the spatial preference of the nucleotide (Grosjean & Westhof, 2016). It can allow N34 to fit within a mini-helix structure together with the two other base-pairs of the anticodon, further assisting in stringency alongside the ribosomal grip (Rozov et al., 2015,
Demeshkina et al., 2012, Weixlbaumer et al., 2007, Murphy et al., 2004, Murphy &
Ramakrishnan, 2004). This results in a modulation of codon–anticodon interactions and helps to maintain the correct reading frame during translation (Noller & Baucom, 2002), and occasionally provides improved efficiency in binding energy (Vinayak & Pathak, 2009).
Chapter 1 Introduction 17
The nature of the modification and the combination of modifications on the tRNA can provide an active and global method for creating necessary variation in the genetic code to enable an organism to survive in a harsh environmental condition without the need for compromising an optimized and streamlined genome. The subtle, yet global effects of tRNA modification can be made clear from the effects of two of the most important hypermodified nucleosides known to occur in tRNA. These hyper-modifications in both instances arise from the modification of tRNA with queuosine or archaeosine, both of which contain a characteristic 7-deazaguanosine core signature (Vinayak & Pathak, 2009).
1.8 The Queuosine tRNA modification
Queuosine (Q) and its derivatives are prevalent in bacterial and eukaryotic tRNAs, with exceptions found mostly in yeast (Marchetti et al., 2013), while Archaea contain archaeosine
(Jackman & Alfonzo, 2013). The tRNA modification with Q results after a number of enzymatic steps in the complex Q-biosynthetic pathway. As a result, the hypermodified base queuine “q” is incorporated into the wobble position of the anticodon in tRNA. This modification only occurs in the Q-family of tRNAs (tRNAHis,Tyr,Asp,Asn) which all have in common the anticodon sequence 5’-GUN-3’ (Vinayak & Pathak, 2009, Biela et al., 2013, Manna & Harman, 2016,
Ehrenhofer-Murray, 2017). The corresponding Q nucleoside containing queuine is designated
‘Q’, which can only be synthesized de novo via a complex biosynthetic pathway in eubacteria
(Q-pathway, henceforth)(Fig 1.10)(Zallot et al., 2017a). In contrast, eukaryotes, or bacteria without the complete Q-pathway, utilise a salvage pathway to obtain q or PreQ0, respectively, from their surrounding environment (Zallot et al., 2017a, Zallot et al., 2017b, Ehrenhofer-
Murray, 2017). Table 1.1 and 1.2 shows detailed information on each enzyme and the substrates found in the Q-pathway.
Chapter 1 Introduction 18
The initial step of converting free guanine triphosphate (GTP) involves an essential FolE enzyme (GTP cyclohydrolase) which is not unique to the Q-pathway. This enzyme converts
GTP into 7,8-dihydroneopterin 3’-triphosphate (DHT). Following DHT production, a specialised set of reactions occurs from the enzyme activity of three key enzymes that catalyse in the following order; QueD – 6-carboxy-5,6,7,8-tetrahydropterin synthase, QueE – 7-carboxy-6- deazaguanine synthase, QueC – 7-cyano-7-deazaguanine synthase. The three genes that code for these enzymes are usually found in an operon, queCDE. The resulting product is ‘PreQo’, which is also the substrate that can be salvaged by bacteria that lack the prerequisite biosynthetic enzymes via the specialised transmembrane transporter ‘yhhQ’ (Zallot et al.,
2017b). There are also alternative purine transporters that enable PreQ0 uptake but at a much slower rate. Following PreQo salvage, or synthesis, the enzyme QueF (a 7-cyano-7- deazaguanine reductase) forms PreQ1, the only known example of enzymatic reduction of a nitrile bond (Kim et al., 2010).
The enzyme TGT (a tRNA guanine transglycosylase) inserts PreQ1 into tRNA at position
G34 by breaking the glycosidic bond between the base and the sugar located at N34 (Hutinet et al., 2016). As a result of its fundamental function, TGT is a conserved enzyme in all organisms with only a few exceptions (Manna & Harman, 2016, Biela et al., 2013).
Chapter 1 Introduction 19
Figure 1.10. The Queuosine biosynthetic pathway de novo in eubacteria, with further modifications of q-34-tRNA and eukaryotic Queuosine salvage pathway. (Hutinet et al., 2016, Thiaville et al., 2016, Nelp & Bandarian, 2015, Fergus et al., 2015, Ray et al., 2014).
Chapter 1 Introduction 20
Table 1.1. The gene symbol, molecular name, function and secondary function of all enzymes that are directly involved in the Queuosine biosynthesis pathway de novo in eubacteria. Enzyme Molecular name Function Secondary Reference function FolE GTP cyclohydrolase I Initial step for the Q- The same pfam as (Van Lanen & pathway, which cleaves QueF Iwata-Reuyl, the ribose sugar 2003) QueD 6-carboxy-5,6,7,8- Cleaves the Loss of QueD can (Cicmil & Shi, tetrahydropterin triphosphate off the cause a loss in 2008) synthase 7,8-dihydroneopterin- pathogenicity in 3’-triphosphate Shigella flexneri QueE 7-carboxy- Reverts the (McCarty et deazaguanine synthase hydropterin core back al., 2009, into a guanine-like core Bruender et al., 2017) QueC 7-cyano-deazaguanine Dual-enzymatic ATP dependant (Nelp & synthase activity, a two-step Bandarian, catalysis, which results 2015) in the formation of a nitrile bond QueF 7-cyano-deazaguanine The QueF family QueF is protected (Van Lanen et reductase represents a fifth class from irreversible al., 2005, of enzymes responsible oxidation due to a Mohammad for nitrile metabolism, conserved et al., 2017, the four-electron intramolecular Kim et al., reduction disulfide 2014) to form primary amines, via use of NADPH Bacterial Bacterial tRNA-guanine Replaces guanine with Four types of TGTs (Hurt et al., TGT transglyucosylase preQ1 on the tRNA found in 2007, Durand (bTGT) wobble position (34) respective et al., 2000, kingdoms: 1) Manna & Chlamydial Harman, TGTase, 2) 2016) Bacteria-like TGTase, 3) bTGT, 4) Eukaryotic TGTases QueA S- Utilises Adomet (Mathews et adenosylmethione:tRNA cofactor to produce al., 2005) ribosyltranserase- epoxyqueuine-34-tRNA isomerase QueG Epoxyqueine reductase Cobamalin (vitamin B12) QueH serves as an (Frey et al., dependent reaction alternative 1988, Zallot et al., 2017a)
Chapter 1 Introduction 21
Table 1.2. All intermediary substrates produced by the Queuosine biosynthetic pathway de novo in eubacteria. Substrate Molecular Name Primary function Alternative References (Abbreviated) function GTP GTP Free nucleobase H2NTP 7,8- Initial substrate of the Essential (Rakovich et al., dihydroneopterin- Q-pathway, with molecule for 2011) 3’-triphosphate guanine converted into tyrosine tetrahydroptering and production ribose sugar excised CTH 6-carboxy-5,6,7,8- Third substrate in the (Vinayak & tetrahydropterin Q-pathway with the Pathak, 2009) triphosphate group removed from the tetrahydropterin CDG 7-deaza-7- Fourth substrate in the (McCarty et al., carboxyguanine Q-pathway, with the 2009) guanine core re- established ADG 7-amido- Intermediatary (Vinayak & deazaguanine molecule for QueC Pathak, 2009) catalysis
PreQo preQo Sixth substrate in the Bacterial salvage (Zallot et al., Q-pathway pathway 2017b) molecule PreQ1 PreQ1 Seventh substrate in Responsible for (McCown et al., the Q-pathway three classes of 2014) riboswitches for all Q genes
PreQ1-tRNA preQ1-34-tRNA Eighth substrate in the GTP is release (Brooks et al., Q-pathway, alongside with the 2012) being the initial incorporation of molecule incorporated PreQ1 into tRNA Qo-tRNA Epoxyqueuine-34- Ninth substrate in the (Miles et al., tRNA Q-pathway 2015)
Q-tRNA Queuine-34-tRNA Final product of the Q- Can be further (Ray et al., pathway modified or 2014, Fergus et digested al., 2015, Morris et al., 1999)
Chapter 1 Introduction 22
1.9 Controlling the Queuosine pathway
The regulation of que gene expression is controlled by a stringent regulatory mechanism, known as a riboswitch. Riboswitches selectively recognize a cognate ligand (metabolite or ion) causing a conformational change to induce the formation of a transcriptional terminator. The cognate ligand in the Q-pathway is PreQ1. Furthermore, for mRNA, the conformational change causes the inhibition of translation. An initial study conducted by Roth et al. (2007) found that
PreQ1 is able to selectively bind to a phylogenetically conserved sequence (motif), usually located on the 5’ upstream region (UTR) of the QueCDE(F) operon. Despite the motifs being phylogenetically conserved, a total of 36 alternative motifs exists; 22 exhibited control at the translational level and the other 14 at the transcriptional level (Roth et al., 2007).
The region of the RNA that undergoes conformational changes due to the binding of
PreQ1 is known as the aptamer region. In the case of the PreQ1 riboswitch, the targeted aptamer region is unusually small, only 34 nucleotides (Roth et al., 2007, Klein et al., 2009).
Despite the small size of the ligand-binding domain of the queCDE riboswitch, the affinity for
PreQ1 is high with the dissociation constant for PreQ1 in the nanomolar range (Roth et al.,
2007). As seen in Figure 1.11, when PreQ1 binds to its respective binding pocket of the aptamer domain on the riboswitch, genetic control is exerted through a conformational change of the (m)RNA (McCown et al., 2014). This change occurs on the RNA which causes an anti-terminator to become a terminator, in turn halts transcription, preventing translation.
Chapter 1 Introduction 23
anti-terminator Aptamer domain terminator
PreQ1
5’- Start codon - 3’ - 3’ Transcription Transcription halted
Figure 1.11proceeds. Conforma tional change exhibited by the mRNA in the absence of PreQ1 and presence of
PreQ1.The aptamer domain of ‘queC 5’ UTR’ shown is a total of 34 nucleotides long. The ligand binding
th domain is located on the 18 (from the 5’end) nucleotide. In the absence of PreQ1 the RNA forms an anti-terminator structure with the second loop, this in turn prevents the complementary sequence for the terminator (shown in green) from binding and forming a terminator. In the presence of PreQ1 the A- rich sequence highlighted in yellow is bound to the secondary structure formed by the first loop; creating a pseudoknot. This in turn allows for the complementary sequences of the terminator to bind and form a terminator, which halts transcription. Modified from (Kang et al., 2009).
Three classes of PreQ1 riboswitches exist and include class I, II and III. Class I PreQ1 riboswitches are the most common and have been divided into three subclasses that contain different sized motifs. Class I PreQ1 riboswitches are typically responsible for the control of queCDE(F) gene expression (Roth et al., 2007). Class II PreQ1 riboswitches (PreQ1-II) have a narrow distribution, predominantly occurring in bacteria from the Streptococcacae family.
Class III preQ1 riboswitches (preQ1-III) have recently been identified through bioinformatic analyses of consensus sequences and the structural architecture of PreQ1 riboswitches. Class
III RNAs were found only in association with the known PreQ0 transporter YhhQ (Fig 1.12)
(McCown et al., 2014).
Chapter 1 Introduction 24
A B
C
D
Figure 1.12. The riboswitch classes that sense preQ1 and related molecules. A) Chemical structures of preQ1, preQ0, B) Consensus sequences and secondary structure models of the three types of preQ1-I riboswitches. Stem and loop substructures are labelled P and L, respectively, and pseudoknots (Pk) are identified by the curved line. The asterisks identify C nucleotides that form cis (preQ1-I) or trans (preQ1- II) Watson-Crick base pairs with the ligand. C) PreQ1-II riboswitch consensus model. D) PreQ1-III riboswitch consensus model. Modified from (McCown et al., 2014).
In short, the Q-biosynthetic pathway auto-regulates itself by the concentration of
PreQ1 produced. The presence of PreQ1 is limited by several factors: 1) PreQ1 itself, 2) free
GTP, 3) bTGT, and ultimately, 4) the frequency of available Q-family tRNAs in the cell. The number of tRNAs is typically the limiting reagent, except during times of stress. Hence, stress increases global gene expression (usually of regulatory genes), which in turn requires a greater number of tRNAs to maintain the rate of translation, the number of tRNA directly influences the rate of Q production, until another factor, such as free GTP, becomes the limiting reagent.
Chapter 1 Introduction 25
1.10 The impact and function of Queuosine
It has been noted that the rate of errors (both missense and frameshifting) is effectively reduced through Q-modification (Urbonavicius et al., 2001, Pathak et al., 2007, Vinayak &
Pathak, 2009, Hutinet et al., 2016).
The primary role of Q is displayed in the Q-family tRNAs where the modification enhances the anticodon-codon binding specificity and improves tRNA usage efficiency. For example, q-34-tRNAasp has been shown to stabilise the binding of the modified tRNA anticodon (3’-CUG-5’) with its corresponding codons (5’-GAC-3’ or 5’-GAU-3’) and demonstrates a lower binding energy (Morris et al., 1999, Muller et al., 2015). In contrast, the unmodified tRNA strongly preferred the 5’-GAC-3’ codon (Muller et al., 2015), and had an unstable association with the secondary codon 5’-GAU-3’ (Fig 1.13). The ability for Q-tRNA to encode both codons is particularly important since there is no tRNA that has the anticodon 3’-
CUA-5’ due to the evolutionary absence of adenosine at the wobble position making binding to the codon 5’-GAU-3’ innately unfavourable (Urbonavicius et al., 2001). Hence, the modification is essential for the recognition of this codon. By altering the binding specificity and binding energy of the anticodon to its corresponding codon, the rate and fidelity of protein synthesis can be directly influenced by Q-tRNA (Vinayak & Pathak, 2009).
Chapter 1 Introduction 26
3’ 3’ A tRNA: 5’ tRNA: 5’
GUC GUC Low binding mRNA: 3’- -5’ mRNA: 3’- -5’ - Low binding GUC GUC 16S rRNA 16S rRNA
3’ 3’ B tRNA: 5’ tRNA: 5’
QUC QUC
mRNA: 3’- -5’ mRNA: 3’- -5’ -
GUC GUC 16S rRNA 16S rRNA
Figure 1.13. The complete anticodon-codon-rRNA interaction for the unmodified and modified tRNA encoding for aspartate. A) The unmodified tRNA strongly prefers the 5’-GAC-3’ codon and 16S rRNA and has an unstable association with the secondary codon 5’-GAU-3’. B) The modified tRNA molecule ‘q-34-tRNA’ shows stabilised binding to either codons and 16S rRNA. Made by author.
Chapter 1 Introduction 27
The role of a particular modification pathway is difficult to reveal due to the subtle effects it can have on an organism, which may be why tRNA modification is an under developed field. However, it has been established that the Q-modification is essential in a number of processes including: cell survival in stressful conditions (Noguchi et al., 1982,
Vinayak & Pathak, 2009), bacterial virulence (Vinayak & Pathak, 2009, Kim et al., 2010), cellular proliferation and metabolism, cancer, and tyrosine biosynthesis in eukaryotes (Fergus et al.,
2015). Furthermore, Marchetti et al. 2013. found a role for the Q-biosynthetic pathway in the symbioses between the root nodule bacterium Ensifer meliloti 1021 and the legume Medicago truncatula. To date, this is the only study that has investigated the role of the Q modification in Root Nodule Bacteria (RNB).
There is a substantial change in the lifestyle of RNB when converting from the free- living form into a microsymbiont. A study of the role of the Q biosynthetic pathway in RNB provides an excellent model system to reveal if the modification pathway is important for free- living survival, for the different host infection types or for the establishment of an effective nitrogen-fixing symbiosis with particular hosts.
Chapter 1 Introduction 28
1.11 Legumes and root-nodule bacteria
RNB, commonly known as rhizobia, are free-living bacteria that have the capacity to convert to a symbiotic form, designated the ‘bacteroid’, within a plant nodule, enabling atmospheric
N2 to be converted, or “fixed” into ammonia that is assimilated by the plant host. In turn, the plant supplies carbon to the bacteroids to drive the energetically costly process of nitrogen fixation (Gage, 2004). There are currently 16 bacterial genera known to be able to form nitrogen-fixing symbioses with legumes, including: Azorhizobium, Bradyrhizobium,
Burkholderia, Cupriavidus, Ensifer (formerly Sinorhizobium), Mesorhizobium,
Methylobacterium, Microvirga and Rhizobium (Sy et al., 2001, Moulin et al., 2001) (Reeve et al., 2015). Successful establishment of symbioses between microsymbiont (rhizobia) and legume hosts is determined by a number of factors and is initiated by a molecular dialogue that occurs in the rhizosphere.
1.11.1 Establishment of an amicable symbiotic relationship 1.11.1.1 The rhizosphere
The rhizosphere is the area surrounding the growing root system of a legume. This environment is constantly in a state of flux due to a number of aspects such as: nutrient acquisition by the legume, metal detoxification, alleviation of anaerobic stress in roots, mineral weathering, the presence of organic acids such as malate, citrate, oxalate, root exudates (e.g. organic acids and sugars) and lastly pathogen attraction (Jones, 1998). The flux exhibited in the rhizosphere is largely determined by the legume, and as a result, a certain degree of selection for ‘compatible’ rhizobia is created. Further specificity in legume-rhizobia associations is mediated by chemical cross-talk between the symbionts (Palacios & Newton,
2005). The initial release of flavonoids by the legume roots interact with rhizobial
Chapter 1 Introduction 29 transcriptional regulators of the LysR family (LTTR), primarily NodD (Lee et al., 2014). NodD induces the nodulation genes ‘nod, noe and nol’, that encode the biosynthesis and transport of the lipo-chito-oligosaccharides, or Nod-factors, which induce nodule formation in the legume host (Fig 1.14)(Relic et al., 1993, van Brussel et al., 1992, Lerouge et al., 1990). RNB clades have significant differences in the number and type of nod genes and the Nod-factors they can produce (Downie, 1994). There are five distinguishable categories of nod genes based on their functions which include the regulatory genes, biosynthetic genes, Nod-factor modification genes, Nod-factor secretion genes and those genes with unknown functions
(Downie, 1998).
Figure 1.14. The establishment of an amicable symbiotic relationship between microsymbiont and legume host. The initial release of flavonoids by the root system of legume host causes the rhizobia located in the rhizosphere to induce a signal cascade to produce Nod-factors and several other signalling molecules. The signalling molecules released by the rhizobia allow for the rhizobia to infect and nodulate the cortical cells in the legume primordium made by author and Dr. J Ardley.
Chapter 1 Introduction 30
1.11.1.2 The infection process of RNB
The specific genetic determinants of the microsymbiont determines the host range, which can be either diverse (broad host range, or “BHR”), or restricted (narrow host range, or “NHR”)
(Pueppke & Broughton, 1999). For example, certain BHR rhizobia, such as Ensifer fredii
NGR234, can form a symbiotic relationship with over 100 different legume genera (Schmeisser et al., 2009). In contrast, NHR rhizobia, such as Ensifer medicae WSM419, are far more restricted in their ability to form a successful symbiosis with more than one legume genus,
(Reeve et al., 2010).
Full compatibility of RNB with a legume host is determined by the appropriate release of multiple mediators from both partners and include flavonoids. These mediators include
Nod factors, surface polysaccharides, exopolysaccharides and extracellular proteins. Each component performs a unique role in the communication process between the RNB and legume host (Perret et al., 2000, Salazar et al., 2010).
Once an appropriate exchange of mediators has occurred, rhizobial infection can commence. Infection can occur via ‘non-infection thread forming’ or ‘infection thread forming’ invasions (Figure 1.15). RHC is a common method of rhizobial infection and involves the production of infection threads (ITs)(Sprent, 2007). The IT is a tubular structure first initiated in the root hair as an invagination of the root hair cell wall by the infecting rhizobia, which then elongates by cell wall deposition and ramifies throughout root cortex towards the nodule primordium that develops in the root cortical cells (Gage & Margolin, 2000). The
Initiation of ITs require several sequential steps; attachment of bacteria on the root hairs, root hair curling and bacterial colonization at the tip of distorted (curled) root hairs (Kouchi et al.,
2010).
Chapter 1 Introduction 31
A B C
Epidermal Crack Root hair curl
Figure 1.15. The three methods of legume host infection by rhizobia. A) In ‘Epidermal’ and B) ‘crack entry’ infection methods, the invading rhizobia migrate towards meristematic cells via epidermal breaching or entering at the site of an emerging lateral root; C) In ‘Root-hair curling‘ (RHC), rhizobia cause root hair tip growth distortion, causing the root hair to entrap the rhizobia. Within the RHC, rhizobia are enclosed within a host-produced infection thread and proliferate. Thereafter, the infection thread extends towards the developing nodule primordium.
Once curled, the enclosed rhizobia proliferate, colonize and express cell wall degrading enzymes to penetrate to the root hair plasma membrane. The root hair deposits new cell wall material at the site of degradation, eventually forming an IT that grows down through the root hair. As the IT forms in the root hair, differentiated cells in the root cortex start to divide to form the nodule meristem (Kouchi et al., 2010). The root nodule cells can develop into elongated “indeterminate” (plant meristematic cells maintain activity) or spherical
“determinate” (plant meristematic cells lose activity) nodule types, with the type of nodule strongly correlated to the phylogeny of the specific legume (Sprent et al., 2013, Doyle, 2011).
For example, in the legume hosts Lotus japonicus and Glycine max (soybean), the activity of the nodule meristem is restricted at the early stages of nodule development and the developed nodule is determinate and spherical in shape. In contrast, the legume hosts
Chapter 1 Introduction 32
Medicago spp (medic), Pisum spp (pea) and Trifolium spp (clover) have a persistent meristem at the tip of the nodule, resulting in an elongated indeterminate nodule (Sprent et al., 2013).
ITs remain in the nodule and continuously release bacteria for endosymbiosis (Sprent et al.,
2013, Doyle, 2011).
1.11.2 Establishment of an N2 fixing symbiont
After successful infection of root cortex cells within either determinate or indeterminate nodule primordia, the invading rhizobia are released from the infection thread into the nodule cells cytoplasm, where they are enclosed by the peribacteriod membrane, which is derived from the host plasma membrane (Kouchi et al., 2010). Encapsulated within the peribacteriod membrane, the rhizobia differentiate into a symbiosis-specific form, termed the ‘bacteroid’
(Figure 1.16). These bacteroids eventually reach full maturation, in which they cease cell division and become a nitrogen-fixing intracellular organelle, termed a ‘symbiosome’ (Kouchi et al., 2010, Gage, 2004). Productive symbiotic nitrogen fixation (SNF) enables the microsymbiont to receive carbohydrates and a favorable environment from the host plant in exchange for bacterial fixed N (Dixon & Kahn, 2004). Bacteroid differentiation and nitrogen fixation is under strict control with complex interactions between the nodule cell and the intracellular bacteria.
In some indeterminate nodules (those belonging to legumes within the inverted repeat lacking clade or “IRLC”) the bacteroids undergo a drastic change in morphology, such as cell elongation and/or Y-shaped transformation, whereas bacteroids in determine nodules are only slightly larger than free-living rhizobia (Kouchi et al., 2010, Mergaert et al., 2006).
Furthermore, terminally differentiated bacteroids in indeterminate nodules are functional but not capable of free-living growth once differentiated. Vegetative cells can be recovered from
Chapter 1 Introduction 33 crushed nodules, since non-differentiated cells are released from infection threads. Since bacteroids in determinate nodules are not terminally differentiated, these cells can resume free-living growth after nodule crushing or senescence (Kouchi et al., 2010).
1.11.3 An example of terminally differentiated bacteroids
Symbiosome development and terminal differentiation of bacteroids in indeterminate nodules involves a nodule specific secretory pathway of nodule-specific cysteine-rich (NCR) peptides (Kouchi et al., 2010, Mergaert et al., 2003). In Medicago truncatula, NCR peptides were shown to be the host plant factors which direct symbiotic rhizobia into terminal bacteroid differentiation (Figure 1.15)(Van de Velde et al., 2010).
Figure 1.16. A model for a nodule-specific secretory pathway of NCR peptides to direct symbiosome development and terminal differentiation of bacteroids in indeterminate nodules. A signal peptidase complex (SPC), a component of which has been identified as DNF1, is required for targeting the nodule-specific cysteine-rich (NCR) peptides to the symbiosome. NCR peptides are thought to be incorporated into bacteroids, leading to terminal differentiation of bacteroids. CW – Cell wall, PM – plasma membrane, PBM – Peribacteroid membrane, ER – endoplasmic reticulum, IT – Infection thread. Figure reproduced from (Kouchi et al., 2004)
Chapter 1 Introduction 34
1.12 What is the role of the Q-pathway in RNB?
The lifestyle change from free-living rhizobia to bacteroids is associated with global shifts in gene and protein expression that are regulated through pathways that have not yet been completely elucidated. According to the study by Marchetti et al. (2013), the rhizobial Q- pathway is necessary for an effective establishment of symbiosis between Ensifer
(Sinorhizobium) meliloti strain 1021 and the legume host Medicago truncatula. However,
Marchetti and colleagues did not examine the free-living phenotypes of their bacterial Q- pathway mutants, nor did they examine the effects of mutations in the rhizobial Q-pathway in different rhizobial species, or across a range of hosts.
Until now, the lack of RNB genome sequences has prevented comparisons being drawn with other RNB symbionts. New genome information is now accessible through the Genomic
Encyclopedia of Bacteria and Archaea–Root Nodule Bacteria (GEBA-RNB) sequencing project, which includes both broad and narrow host range RNB (Reeve et al., 2015). These genome sequences will provide an essential resource to reveal if the Q-pathway is ubiquitous in all sequenced rhizobia, to establish if the Q-pathway is essential for diverse RNB-legume symbioses, and to examine phenotypic effects caused by the absence of the Q-pathway.
Chapter 1 Introduction 35
1.14 Aims
It is the intention of this thesis to:
1) Determine if the Q-pathway is ubiquitous in RNB by performing bioinformatics comparisons and analyses using the genome data available for 139 sequenced RNB strains.
2) Construct suicidal gene inactivation vectors to target key biosynthetic genes required for the Q-biosynthetic pathway in both E. medicae WSM419 and E. fredii NGR234.
3) Use suicidal gene inactivation vectors to construct double crossover knockout mutations in the queD, queE and queG genes of the Q-pathway in E. medicae WSM419 and E. fredii
NGR234.
4) Investigate the effect of Q-pathway mutations on the free-living and symbiotic lifestyles for the NHR E. medicae WSM419.
Chapter 1 Introduction 36
Materials and Methods
Chapter 2 Materials and Methods 37
2.1 Bioinformatical analysis and prediction
Bioinformatic analyses were performed using the US Joint Genome Institute (JGI) Integrated
Microbial Genomes (IMG) online database (https://img.jgi.doe.gov) and the National Center for Biotechnology Information (NCBI) online database (https://www.ncbi.nlm.nih.gov/). The dataset used to interrogate the databases included 139 Genomic Encyclopaedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) genomes (Reeve et al., 2015). Initial genome screening for Q biosynthesis pathway genes (FolE, QueD, QueE, QueC, QueF, bTGT, QueA,
QueG) was conducted using the IMG BLASTp (E-value = 1e-5) algorithm (https://img
.jgi.doe.gov/cgi-bin/mer/main.cgi?section=FindGeneBlast&page=geneSearchBlast) against the genomes of E. medicae WSM419 (IMG ID 640753051), Escherichia coli K-12 (IMG ID
646311926) and Sinorhizobium meliloti 1021 (IMG ID 637000269). These strains provided a full reference set of que genes. All subsequent bioinformatic screening was conducted using
E. medicae WSM419 as the reference genome for the que genes. Initial mass bioinformatic screening of all 139 RNB genomes involved using the routine IMG BLASTp (E-value = 1e-5) search function. All match hits (>30% identity and >75% query coverage) were recorded and functional verification of the proteins encoded was determined by comparing COG, pfam, and
TIGR protein domains to reference proteins. Protein domains were obtained from IMG or the
NCBI Conserved Domain Database (CDD) (https://www.ncbi.nlm.nih. gov/cdd). If genes could not be identified through initial screening conditions, then the BLASTp stringency was reduced
(E-value = 1e-2). Genes identified with reduced stringency were identified as correct if the encoded proteins contained the expected protein domains. If a gene was not identified using the criteria above, the nucleotide sequence of each que gene derived from a reference genome was used in a NCBI tBLASTx search (https://blast.ncbi.nlm.nih.gov/Blast.cgi
Chapter 2 Materials and Methods 38
?PROGRAM=blastx&PAGETYPE=BlastSearch&LINK_LOC=blasthome). Genes identified with tBLASTx were accepted if the encoded proteins contained the expected protein domains. A final round of manual screening was performed using the gene neighbourhoods and common loci to locate missing genes. All gene neighbourhoods were analysed using the JGI-IMG ‘Show gene-neighbourhood’ feature (https://img.jgi.doe.gov/cgi-bin/mer/main.cgi). NCBI BLASTn and tBLASTn algorithms were utilised in conjunction with the bioinformatics Geneious® v8.1.9 and MEGA7® software packages to interrogate incorrectly annotated or unannotated sequences of certain RNB genomes. All identified genes were catalogued for each genome with additional information captured including IMG unique accession number and protein domains.
2.1.1 Assembling genetic sequences of constructs
Gene neighbourhood sequences from the genome of E. medicae WSM419 and E. fredii
NGR234 were imported into the bioinformatic software Geneious® v8.1.9. To construct the inactivation vectors, the sequences of pJQ200SK and pRTGNm2 were used (Table 2.3). Primer binding sites, restriction sites, ligation junction sites, and regions of interest were annotated and formatted. The assembled models provided the theoretical sizes of PCR fragments that would be obtained for a successfully constructed recombinant plasmid in E. coli or from a successfully constructed double cross-over (DXO) rhizobial mutant.
Chapter 2 Materials and Methods 39
2.2 Strains, growth conditions and cryopreservation The bacterial strains and plasmids used in this study are listed in Table 2.1, 2.2, 2.3. E. coli strains were grown at 37oC overnight using LB broth (1% w/v tryptone (BD BBL, Australia},
0.5% w/v yeast extract (BD BBL, Australia) and 0.5% w/v NaCl) (Sambrook, 2001) or Antibiotic
Medium No. 3 (BD BBL, Australia) if gentamycin was used. SOC media (2% w/v tryptone, 0.5% w/v yeast extract, 0.5% w/v NaCl, 25 mM KCl, 2 mM MgCl2.6H2O, and 2mM glucose was added immediately to transformation mixtures after heat shock to promote survival of transformed cells (Sambrook, 2001). All Ensifer strains were cultured at 28oC in TYC media (0.5% w/v tryptone, 0.3% w/v yeast extract, 6 mM CaCl2.2H2O (Beringer, 1974) or 3.024 YMA media
(0.3% w/v D-glucose, 0.2% w/v mannitol, 0.1% w/v yeast extract, 2.8 mM K2HPO4, 1.7 mM
MgSO4, 1.7 mM NaCl, 0.4 mM CaSO4 and 1.9 mM NH4Cl). All cell resuspensions were performed in normal saline (0.89% w/v NaCl). For exopolysaccharide production assays, 3.024
YMA solid media contained 0.025% [w/v] Calcofluor (CF, Fluorescence Brightener 28, Sigma-
Almich®). All E. coli and Ensifer broth cultures were grown on a gyratory shaker (orbit 25 mm) set to 250 rpm unless otherwise specified. All RNB plate cultures were incubated at 28oC for
2-4 d. Sucrose and antibiotic solutions were filter-sterilised using a 0.22 µm syringe filter prior to incorporation into media. Antibiotics (Sigma-Aldrich®) were used at the following concentrations (µg ml-1): chloramphenicol (20), gentamycin (60; 10 for E. coli), kanamycin
(100), nalidixic acid (75), neomycin (100), rifampicin (60), spectinomycin (100) and streptomycin (100). For long term storage, 3 ml of well grown bacterial cultures were mixed with 600 µl of sterile 80 % glycerol and then stored at -80oC with a unique MUE (E. coli)/MUR
(rhizobia) accession number.
Chapter 2 Materials and Methods 40
Table 2.1. Escherichia coli strains used in this study.
† Strain Relevant Characteristics Source/Reference E. coli BW20767 RP4-2-tet::Mu-1kan::Tn7 integrant leu-63::IS10 recA1 creC510 (Metcalf et al., hsdR17 endA1 zbf-5 uidA (∆MluI):pir+ thi. 1996) DH10β F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 recA1 Invitrogen, endA1 araD139 ∆ (ara, leu)7697 galU galK λ-rpsL nupG; SmR. Australia DH5α SupE44 ∆lacU169 (Φ 80 lacZ∆M15) hsdR17 recA1 endA1 gyrA96 Invitrogen, thi-1 relA1. Australia JM83 F- ara Δ(lac-proAB) rpsL (StrR)[ⱷ80 dlacΔ(lacZ)M15] thi; SmR. (Yanisch-Perron et al., 1985) MT616 pro-82 thi-1 hsdR17 supE44 endA1 recA56 (=MT609 (pRK600)); (Finan et al., 1986) CmR. MUE1470 BW20767 transformant with mobilizable inactivation vector This study pQLΔSmed_3534:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1471 BW20767 transformant with mobilizable inactivation vector This study pQLΔSmed_4938:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1472 BW20767 transformant with mobilizable inactivation vector This study pQLΔSmed_4938:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1473 BW20767 transformant with mobilizable inactivation vector This study pQLΔSmed_4937:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1474 BW20767 transformant with mobilizable inactivation vector This study pQLΔSmed_4937:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1492 JM83 transformant with mobilizable inactivation vector This study pQLΔNGR_c36640:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. MUE1493 JM83 transformant with mobilizable inactivation vector This study pQLΔNGR_c36640:CAS-GNm with a pQJ200SK backbone conferring GmR, KmR, SucS. R21 E. coli control strain with a pJQ200SK derivative containing CAS- Ravi Tiwari GNm; Gm R, Km R, Suc S * Resistance to gentamycin (GmR), kanamycin (KmR) and streptomycin (SmR), sensitive to sucrose (SucS).
Chapter 2 Materials and Methods 41
Table 2.2. Ensifer strains used in this study.
Strain Relevant Characteristics† Source/Reference E. medicae WSM419 Wild-type acid-tolerant isolate from Sardinia; CmR, NxR. (Howieson & Ewing, 1986) MUR2511 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queG (Smed_3534); CmR, KmR, NxR. MUR2513 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queD (Smed_4938); CmR, KmR, NxR. MUR2517 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queG (Smed_3534); CmR, KmR, NxR. MUR2518 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queD (Smed_4938); CmR, KmR, NxR. MUR2523 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queE (Smed_4937); CmR, KmR, NxR. MUR2549 WSM419 derivative containing a double crossover insertion of This study ΩCAS-GNm in queE (Smed_4937); CmR, KmR, NxR. E. fredii R R NGR234 Wild-type broad host range microsymbiont; Rf 60 Sm 100 (Perret et al., 1991) MUR2572 NGR234 derivative containing a double crossover insertion of This study ΩCAS-GNm in queG (NGR_c36640); RfR, KmR, SmR. MUR2573 NGR234 derivative containing a double crossover insertion of This study ΩCAS-GNm in queG (NGR_c36640); RfR, KmR, SmR. * Resistance to chloramphenicol (CmR), kanamycin (KmR), nalidixic acid (NxR), rifampicin (RfR) and streptomycin (SmR).
Table 2.3. Plasmids used in this study
† Strain Relevant Characteristics Source/Reference Plasmids pJQ200SK Gene replacement vector; GmR, SucS. (Quandt & Hynes, 1993) pRTGNm2 pUC18 containing the CAS-GNm cassette; ApR,KmR Ravi Tiwari pQLΔSmed_3534 Quadruple ligation (QL) vector containing a pJQ200SK backbone This study with Smed_3534:CAS-GNm; KmR pQLΔSmed_4938 Quadruple ligation (QL) vector containing a pJQ200SK backbone This study with Smed_4938:CAS-GNm; KmR pQLΔSmed_4937 Quadruple ligation (QL) vector containing a pJQ200SK backbone This study with Smed_4937:CAS-GNm; KmR pQLΔNGR_c36640 Quadruple ligation (QL) vector containing a pJQ200SK backbone This study with NGR_c36640:CAS-GNm; KmR * Resistance to ampicillin (ApR), gentamycin (GmR), kanamycin (KmR), sensitive to sucrose
(SucS).
Chapter 2 Materials and Methods 42
2.3 PCR primer design
Primers were designed using Geneious v8.1.9® (Biomatters Ltd.) and purchased from
Integrated DNA Technology (IDT). The annealing temperatures (Tm) of each primer was set between 70–72oC (New England Biolab® Tm calculator (https://tmcalculator.neb.co m/#!/main) and the primer sequences were checked to ensure only one binding site occurred in the genome. All primers used in this study are shown in Table 2.4.
Table 2.4. Primers used in this study. Primer name Sequence (5’-3’) Source/reference pJQ200SK ‘’ Gus157 CGCGATCCAGACTGAATGCC Tiwari et al. (1999) Nm CCTGCATCTAGCCCGCCTAATG Tiwari et al. (1999) M13 Forward CCCAGTCACGACGTTGTAAAACG Tiwari et al. (1999) M13 Reverse AGCGGATAACAATTTCACACAGG Tiwari et al. (1999) E.medicae WSM419 Smed_4938 Up-F GGATCTCGAGTCCACTTTGACCTAAAAG This study Smed_4938 Up-R GGGCGAATTCAGGTTCTTCAACTGATG This study Smed_4938 Dn-F GAATAAGCTTGCATTTCTACGAATGGTG This study Smed_4938 Dn-R GGGATCTAGAACCACGAACTTCAACAC This study Smed_4937 Up-F ATATCTCGAGCACAACTACATCGTCGAG This study Smed_4937 Up-R TCAGGAATTCCTGTATAGCCGGATTTCC This study Smed_4937 Dn-F GAGTAAGCTTCAGTTGCATGTCCTCATT This study Smed_4937 Dn-R GCGCTCTAGACAGAGGGTTAACATCATC This study Smed_3534 Up-F AAAACTCGAGTGTCTATGTCGACGACAG This study Smed_3534 Up-R AAATGAATTCATGCGACAGATGTCAAAC This study Smed_3534 Dn-F AACGAAGCTTGAAGCTGAAAATGATGAC This study Smed_3534 Dn-R GCCATCTAGACTTGTTCTCACCATAGAATG This study Smed_3534 EG Up-F ATGGCTATCAGACGGAGCTGAGC This study Smed_3534 EG Dn-R CACAATTGTGCAAGCGACACG This study Smed_4938 EG Up-F GGCCGTGAGACAAACTTCGTG This study Smed_4938 EG Dn-R CTGCAGATAGACGGGCAGATGC This study Smed_4937 EG Up-F CGTAGCGGAGGAGGTGGAATAATG This study Smed_4937 EG Dn-R CCGGCCAGAGGGTTAACATCATC This study E. fredii NGR234 NGR_c36640 Up-F TGTGCTCGAGTCTCTCAGAATATGGCTATC This study NGR_c36640 Up-R TGTAGAGCTCTCCGCCTTTATAGCGTG This study NGR_c36640 Dn-F TATAAAGCTTGAATGGGAAATGGCAGGAGT This study NGR_c36640 Dn-R ATAATCTAGACATAGAAGGATCGCGCCATC This study NGR_c36640 EG Up-F TCGCGGTTCGTACGCCTTAT This study NGR_c36640 EG Dn-R AAATCTATTCGCCGCGCCAG This study Red nucleotides = 4 bp overhang, blue nucleotides = Restrictions sites: XhoI – CTCGAG, EcoRI – GAATTC, SacI – GAGCTC, HindIII – AAGCTT, XbaI – TCTAGA.
Chapter 2 Materials and Methods 43
2.4 PCR amplification conditions
All PCR amplifications used Phusion® High-Fidelity PCR master mix with HF buffer (New
England BioLabs®) according to the vendor protocol to amplify specified fragments. PCR reaction conditions used to produce the UP and DN fragments for construction of inactivation vectors or for confirmation are listed in Table 2.5 and 2.6.
Table 2.5. PCR reaction 1 used to produce UP and DN fragments for the construction of all inactivation vectors, for the confirmation of inactivation vector pQLΔNGR_c36640 and for the confirmation of all Ensifer mutant derivatives. All reactions use concentrated cell resuspensions as template standardised to an OD600nm =10 Reagent Concentration Primer forward 0.5 µM Primer reverse 0.5 µM DMSO 3% Phusion HF® master mix 0.5 U/25 µl Template cells 1 µL PCR H2O Up to 25 µl
Table 2.6. PCR reaction 2 used to produce UP & DN fragments for the confirmation of inactivation vectors pQLΔSmed_3534, pQLΔSmed_4938 and pQLΔSmed_4937. Reagent Concentration Primer forward 0.5 µM Primer reverse 0.5 µM DMSO 3% Phusion HF® master mix 0.5 U/25 µl Template DNA 1 – 100 ng PCR H2O Up to 25 µl
All amplification cycling conditions are listed in Table 2.7, 2.8, and 2.9.
Table 2.7. PCR cycling condition 1 used with template cells at an OD600nm= 10 Cycles Step Temperature (oC) Time 1x Initial denaturation 98oC 4 min Denaturation 98oC 10 s 35x Annealing/extension 70oC 60 s 1x Final extension 70oC 5 min Final Final hold 14oC Indefinite
Chapter 2 Materials and Methods 44
Table 2.8. PCR cycling condition 2 for use with template cells (at an OD600nm= 10) recovered from wild-type inoculated nodules
Cycles Step Temperature Time 1x Initial denaturation 98oC 4 min Denaturation 98oC 10 s 35x Annealing/extension 72oC 90 s 1x Final extension 72oC 5 min Final Final hold 14oC Indefinite
Table 2.9. PCR cycling condition 3 for use with purified plasmid DNA. Cycles Step Temperature Time 1x Initial denaturation 98oC 40 s Denaturation 98oC 10 s 35x Annealing/extension 72oC 60 s 1x Final extension 72oC 5 min Final Final hold 14oC Indefinite
2.5 PCR amplification
The UP and DN intragenic fragments for the queG (Smed_3534), queD (Smed_4938), and queE
(Smed_4938) genes from E. medicae WSM419 were amplified using primers listed in Table
2.4. Specifically, the primer pairs Smed_3534 UP-F/Smed_3534 UP-R and Smed_3534 DN-
F/Smed_3534 DN-R were used to amplify the UP and DN fragments, respectively, for queG.
The primer pairs Smed_4938 UP-F/Smed_4938 UP-R and Smed_4938 DN-F/Smed_4938 DN-
R, were used to amplify the UP and DN fragments, respectively, for queD. The primer pairs
Smed_4937 UP-F/Smed_4937 UP-R and Smed_4937 DN-F/Smed_4937 DN-R, were used to amplify the UP and DN fragments, respectively, for queE. All E. medicae WSM419 UP-F primers listed here contain the restriction site XhoI, UP-R primers contain the restriction site EcoRI,
DN-F primers contain the restriction site HindIII, DN-R primers contain the restriction site XbaI.
The UP and DN intergenic fragments for queG (NGR_c36640) genes from E. fredii NGR234 were amplified using primers listed in Table 2.4. Specifically, the primer pairs NGR_c36640
Chapter 2 Materials and Methods 45
UP-F/NGR_c36640 UP-R and NGR_c36640 DN-F/NGR_c36640 DN-R, were used to amplify the
UP and DN fragments, respectively, for queG. All E. fredii NGR234 UP-F primers listed here contain the restriction site XhoI, UP-R primers contain the restriction site SacI, DN-F primers contain the restriction site HindIII, DN-R primers contain the restriction site XbaI.
2.6 PCR product purification
The PCR products, typically UP and DN fragments, were purified using a Wizard® Plus SV
Minipreps DNA Purification System, according to the vendors protocol. All centrifugation steps
o were performed at 20, 800 g. DNA was eluted into 20 µl of PCR grade H2O and stored at -20 C.
2.7 Ligation reactions 2.7.1 Quadruple fragment ligation constructs pQLΔSmed_3534, pQLΔSmed_4938 and pQLΔSmed_4937 in the mobile suicide vector pJQ200SK.
Quadruple fragment ligation mixtures were prepared to contain: XhoI/EcoRI restricted PCR amplified UP fragment (Smed_3534, Smed_4938 or Smed_4937), HindIII/XbaI restricted PCR amplified DN fragment (Smed_3534, Smed_4938 or Smed_4937), EcoRI/HindIII restricted pRTGNm2 and XhoI/XbaI restricted pJQ200SK at varied UP:DN:Insert:Vector ratios (1:1:1:2,
2:2:1:4 and 4:1:2:2) for each construct to improve the probability of obtaining the desired recombinant. The ligation reaction mixtures were incubated at 25oC for 2 h.
2.7.1 Quadruple fragment ligation constructs pQLΔNGR_c36640 in the mobile suicide vector pJQ200SK.
Quadruple fragment ligation mixtures were prepared to contain: XhoI/SacI restricted PCR amplified UP fragment (NGR_c36640), HindIII/XbaI restricted PCR amplified DN fragment
(NGR_c36650), SacI/HindIII restricted pRTGNm2 and XhoI/XbaI restricted pJQ200SK at varied
UP:DN:Insert:Vector ratios (1:1:1:2, 2:2:1:4 and 4:1:2:2) to improve the probability of
Chapter 2 Materials and Methods 46 obtaining the desired recombinant. The ligation reaction mixtures were incubated at 25oC for
2 h.
2.8 Competent cell preparation
Method 1: Competent cells of E. coli DH5α and JM83 were prepared using the following method. Cells were grown overnight in 50 mL LB broth. The 50 ml culture was centrifuged at
2,500 g for 8 min, the cell pellet resuspended in 8 ml of sterile ice-cold TFB (100 mM KCl, 45 mM MnCl2, 10 mM CaCl2, 3 mM Hexamine CoCl3, pH adjusted to 6.7 with 1M MES) and left on ice for 15 min. Cells were recentrifuged at same speed for 8 min and the cell pellet resuspended in 2 mL ice cold TFB. An aliquot of 140 µl of dimethylformamide was added to the cell suspension and incubated on ice for 5 min. Following this, 140 µl of 0.7 M β- mercaptoethanol was added and the cell mixture incubated on ice for 10 min. After this, 140
µl of dimethylformamide was added and the cell mixture further incubated on ice for another
5 min. The cells were then used immediately for transformation.
Method 2: Competent cells of E. coli BW20767 were prepared using a quick method as follows. Cells were grown overnight in 5 ml LB broth, sub-cultured into 2x 5 mL LB broths and incubated until the OD600nm reached 0.5. All of the 10 mL broth culture was centrifuged at 2,500 g for 8 min. E. coli BW20767 competent cells were prepared by resuspending the cell pellet into ice cold 5 mL TB buffer (10 mM Pipes, 55mM MnCl2, 15 mM CaCl2, 250 mM KCl.
The cells were left in an ice bath for 25 min, recentrifuged at 4,000 rpm for 8 min and resuspended in 1 ml ice cold TB prior to transformation.
Chapter 2 Materials and Methods 47
2.9 Extraction and purification of plasmid DNA
Wizard® Plus SV Minipreps DNA Purification System was used to isolate plasmid DNA from E. coli. Transformant cells were grown in 10 ml LB broth containing the antibiotics kanamycin and gentamycin. Cultures were dispensed into 10 ml centrifuge tubes and spun at 2,500 g for
8 min and then the plasmid was isolated by following vendor instructions. Isolated plasmid
DNA was suspended in 100 µl Nuclease-Free water (Promega®) and stored at -20oC until used.
An aliquot of 10 µl of isolated DNA was used to determine concentration (µg/µl) and purity using spectrophotometer analysis at OD260 and OD260nm/OD280nm, respectively. DNA was considered pure when OD260nm/OD280nm = 1.7 – 2.0.
2.10 Transformation
To improve the rate of transformation, quadruple ligation mixtures containing varied
UP:DN:CAS-GNm:pJQ200Sk ratios, 5 µl at 1:1:1:2, 5 µl at 2:2:1:4 and 5 µl at 4:1:2:2 were combined with 200 µl of competent cells. E. coli DH5α was used for recombinant plasmids intended for E. medicae WSM419 gene knockouts and E. coli JM83 was used for recombinant plasmids intended for E. fredii NGR234 gene knockouts. Transformation mixtures were incubated on ice for 30 min, heat shocked in a 42oC water bath for 90s and then an aliquot of
800 µL of SOC recovery media was added to the cells. The cells were incubated at 37oC for 1 h and then the transformation mixture was spread onto selective plates of AM3 containing kanamycin and gentamycin. The plates were then incubated at 37oC overnight.
The purified plasmids were transformed into E. coli BW20767 competent cells prepared by method 2. 1 µl of purified plasmid was added to 100 µl of E. coli BW20767 competent cells, with an additional 1 µL of DMSO. The mixture was then incubated on ice for
Chapter 2 Materials and Methods 48
30 min, heat shocked at 42oC for 90 s to take up inactivation vectors, and incubated on ice for
2 min. An aliquot of 500 µl of LB broth was added and the mixture was incubated at 37oC for
60 min. After incubation, the cell mixture was spread onto AM3 plates containing kanamycin and gentamycin to select for successful transformant cells.
2.11 Biparental conjugation methodology with E. medicae WSM419
Transformant E. coli BW20767 strains containing the inactivation vectors pQLΔSmed_3534, pQLΔSmed_4938 and pQLΔSmed_4937 were grown overnight in 5 ml LB broth at 37oC. Each
o culture was sub-cultured in 12 ml LB broth at 37 C until OD600nm = 0.5, at which point cultures were centrifuged at 2,500 g for 8 min and resuspended into 300 µL saline. E. medicae WSM419 cells were cultured into 50 ml TYC broth and incubated on a gyratory shaker at 200 rpm for three days, centrifuged at 2,500 g for 8 min and resuspended in 2.5 ml saline. For controls, an aliquot of 50 µl of each parent was spotted onto the surface of separate TYC plates. Aliquots of 50 µl of E. medicae WSM419 suspension were combined with 50 µl of each E. coli separately, mixed and the whole 100 µl mixture spotted individually onto the surface of separate TYC plates. This was performed in duplicate. All plates were incubated overnight at
28oC. The cells from each spot were resuspended in 1 mL of saline and aliquots of 5, 50 and
500 µl were spread onto the surface of selective TYC plates containing chloramphenicol, nalidixic acid and kanamycin with sucrose (to force for double crossovers) and without sucrose
(to select for single crossovers). The selection plates were then incubated for 3-4 d at 28oC to generate transconjugants. All transconjugants were replica patched onto TYC solid media containing chloramphenicol, nalidixic acid and kanamycin (to serve as a master plate), TYC containing chloramphenicol, nalidixic acid, kanamycin and sucrose (10% w/v) (to reveal double crossover mutants from single crossover), onto TYC containing chloramphenicol,
Chapter 2 Materials and Methods 49 nalidixic acid, and gentamycin (to further reveal double crossover mutants from single crossover) and finally onto TYC containing chloramphenicol, nalidixic acid and kanamycin (to serve as a control plate to show transfer of cells had occurred for all prior patch plates).
Successful DXO mutants that were chloramphenicol, nalidixic acid and kanamycin and sucrose resistant but which were gentamycin sensitive were cultured in 5 ml TYC broth for three days at 28oC maintaining antibiotic pressure with the antibiotics nalidixic acid, kanamycin and chloramphenicol.
2.12 Triparental conjugation methodology with E. fredii NGR234
E. fredii NGR234 was cultured in 5 ml TYC for three days at 28oC. An E. coli JM83 transformant containing the pQLΔNGR_c36640 plasmid to be mobilized was grown overnight in 5 ml LB broth containing kanamycin and the E. coli helper strain MT616 was grown overnight in 5 ml
LB broth containing chloramphenicol. Both E. coli cells were sub-cultured and incubated at
o 37 C until OD600nm = 0.5. All 5 ml cultures were centrifuged at 2,500 g for 8 min and the cell pellets resuspended in 150 µl saline. An aliquot of 30 µl of E. coli JM83 (pQLΔNGR_c36640), E. coli helper strain MT616, and recipient strain E. fredii NGR234 were each spotted onto separate TYC control plates. Aliquots of 30 µl of each strain were mixed and all of the suspension was spotted onto TYC plates. The plates were then incubated overnight. The cells from each spot were resuspended in 1 mL of saline and aliquots of 5, 50 and 500 µl were spread onto the surface of selective TYC plates containing streptomycin, kanamycin, and rifampicin with (to select for double crossovers) and without (to select for single crossovers) sucrose (10% w/v). All plates were incubated at 28oC for three days.
Chapter 2 Materials and Methods 50
2.13 PCR confirmation 2.13.1 PCR amplification confirmation of the UP and DN regions for inactivation vectors
Purified plasmid DNA of the inactivation vectors pQLΔSmed_3534, pQLΔSmed_4938 and pQLΔSmed_4937 were confirmed by using PCR reaction condition 2 (Table 2.6), PCR cycling condition 3 (Table 2.9) using primer pair M13-F/GUS157 to amplify the fragment containing the UP fragment, and primer pair M13-R/Nm, to amplify the fragment containing the DN fragment. Control reactions containing no plasmid DNA template were performed for all reactions. All PCR reaction products were visualised by agarose gel electrophoresis.
Confirmation of QL plasmids in transformants MUE1492 and MUE1493 was performed using cells as template. Cells were cultured in 5 ml LB broth maintaining selective pressure using the antibiotics kanamycin and gentamycin. Cultures were centrifuged at 4,000 g for 8 min, resuspended in saline to an optical density standardised to an OD600nm = 10. The fragment containing the UP region was amplified using the primer pair M13-F/GUS157 and the fragment containing the DN fragment was amplified using the primer pair M13-R/Nm (Table 2.4). PCR reaction 1 (Table 2.5) and PCR cycling condition 1 (Table 2.7) were used to PCR amplify the fragments. Control reactions containing no cell template was performed for all reactions. All
PCR generated products were visualised by agarose gel electrophoresis.
2.13.2 PCR amplification confirmation of the UP and DN regions for mutant derivatives
All E. medicae WSM419 mutant derivatives in this study were verified using PCR. All E. medicae mutant strains were cultured in 5 ml TYC maintaining selective pressure using the antibiotics nalidixic acid, kanamycin and chloramphenicol. The cultures were centrifuged at 4,000 g for 8 min and resuspended in saline, to provide an optical density OD600nm standardised to 10. PCR reaction 1 (Table 2.5) and PCR cycling condition 1 (Table 2.7) were used to amplify fragments
Chapter 2 Materials and Methods 51 containing UP and DN regions from prepared cells. Primer pairs used for producing the UP and
DN fragments for each mutant derivative are as follows: Smed_3534 EG Up-F/GUS157 to amplify the UP fragment and Smed_3534 EG DN-R/Nm were used to amplify the DN fragment from Smed_3534 (queG) mutants. Smed_4938 EG Up-F/GUS157 were used to produce the UP fragment from while Smed_4938 EG DN-R/Nm were used to produce the DN fragment from
Smed_4938 (queD) mutants. Smed_4937 EG Up-F/GUS157 were used to amplify the UP fragment while Smed_4937 EG DN-R/Nm were used to produce the DN fragment from
Smed_4937 (queE) mutants. Control reactions containing no cell template was performed for all reactions. All PCR reaction products were visualised by agarose gel electrophoresis.
2.14 Agarose gel electrophoresis
An agarose gel (1% [w/v] agarose (Fisher Biotec®) was prepared in TBE buffer (89 mM Ultra- pure Tris, 89 mM H3BO3, 0.5M EDTA buffered to pH 8.0) and cast to a depth of 15 mm. The gels were placed into gel tanks and immersed in 1xTBE buffer. An aliquot of 6x Gel Loading
Dye, Purple (New England BioLabs®) was added to make up a 1/5th volume to all samples prior agarose gel electrophoresis. Each sample was the loaded into the well of a submerged gel. A ladder marker was constructed by digesting Lambda DNA by HindIII, and EcoRI & HindIII and then mixing the reactions to construct a ‘HEH’ ladder. Digestion was performed using New
England BioLabs® restriction enzymes (HindIII-HF and EcoRI-HF) as per vendors instructions.
The gels were electrophoresed at 120 V for a period of 60 – 90 min. Once the run was complete, the gel was soaked in ethidium bromide (1% w/v) for 20 min prior to imaging using
Gel Doc™ XR+: BioRad and typically an exposure time of 0.5-1.5 s. The ethidium bromide software protocol was used to capture images (no filter was used).
Chapter 2 Materials and Methods 52
2.15 DNA sequencing
Plasmid DNA were prepared as per the Australian Genome Research Facility (AGRF) purified plasmid DNA sequencing protocol. Sequencing reactions contained 50-125 ng of plasmid DNA in a total reaction volume of 12 µl. Primers used for sequencing the UP fragments were M13-
F or GUS157 and primers used for the DN fragments were M13-R or Nm
2.16 Antibiotic viability testing
The antibiotic resistance profiles of E. coli DH5α, E. medicae WSM419 and E. fredii strains
HH103, NGR234 and USDA257 were determined using a spread plate assay with cells growing in log phase. E. coli DH5α was cultured in 5 ml LB broth at 37oC overnight. All Ensifer strains were cultured in 5 ml TYC for three days at 28oC. All strains were sub-cultured into sterile fresh media and incubated until the cells reached an optical density of OD600nm = ~0.3. All cultures
8 4 were standardised to an OD600nm = ~0.15 and then serially diluted to produce 10 , 10 and
1.5x103 cells/ml. An aliquot of 100 µl of each dilution was spread onto TYC plates containing a particular antibiotic. All plates containing Ensifer strains were incubated at 28oC for three days and plates containing E. coli strain were incubated at 37oC. The number of single colonies developed for each strain was counted once the incubation period was finished.
2.17 Mean generation time assay
Duplicate cultures of E. medicae WSM419 were incubated in 5 ml TYC containing nalidixic acid and chloramphenicol and duplicate cultures of mutant derivatives MUR2511, MUR2513,
MUR2517, MUR2518, MUR2523, and MUR2549 were incubated in 5 ml TYC containing the antibiotics nalidixic acid, chloramphenicol and kanamycin. All cultures were incubated for three days. The optical density for all cultures was measured and standardized to the lowest
Chapter 2 Materials and Methods 53
OD600nm value. Cultures were then sub-cultured into 25 ml TYC to an OD600nm value of 0.6 after one day of incubation at 28oC on a gyratory shaker (orbit = 35 mm) set to 200 rpm. Overnight sub-cultures were standardized to an OD600nm of 0.5, and then sub-cultured in duplicate into
o 25 ml TYC broth to a starting OD600nm of 0.05. All cultures were incubated at 28 C on a gyratory shaker (orbit = 35mm) set to 200 rpm. After one full generation of growth (~4 h) and at every
1.5 h intervals thereafter, duplicate samples for each culture (in duplicate) were removed and the OD600nm measured on the spectrophotometer (Hitachi® UD-1900). Measurements were recorded for six sampling times over a total of 11 h. At each sampling point for each culture, an aliquot was removed and serially diluted for viability counts. Cultures were diluted to cell concentrations of 2x104, 2x103, 2x102 cells/ml. An aliquot of 20 µl was spread onto TYC selection plates. The wild-type was spread onto plates containing nalidixic acid and chloramphenicol while the mutants were spread onto TYC containing nalidixic acid, kanamycin and chloramphenicol. All plates were incubated at 28oC for three days. After incubation, all visible single colonies counts were recorded.
2.18 Prolonged stationary phase assay
E. medicae WSM419 and the que mutant derivatives MUR2511, MUR2513, MUR2517,
MUR2518, MUR2523, and MUR2549 were cultured in 5 ml TYC with the appropriate antibiotic selection pressure for each culture. All cultures were incubated at 28oC for three days on a gyratory shaker. After incubation, all cultures were standardized and sub-cultured to a starting
OD600nm value of 0.025 and incubated until the OD600nm = ~1.0 (~21 h). After incubation, 500 µl of each culture was serially diluted to 2x104, 2x103, 2x102 cells/ml. An aliquot of 20 µl of each culture was spread onto TYC selective plates. Serial dilutions of a wild-type culture were spread plated onto media containing nalidixic acid and chloramphenicol while mutant
Chapter 2 Materials and Methods 54 dilutions were spread plated onto TYC containing nalidixic acid, kanamycin and chloramphenicol. All plates were incubated at 28oC for three days. After incubation, the counts of all visible single colonies were recorded. This process was repeated at day three, five and ten to determine the percentage survival of wild-type and mutant derivatives during a prolonged stationary phase.
2.19 E. medicae WSM419 and mutant derivative stress phenotyping
E. medicae WSM419 and mutant derivatives MUR2511, MUR2513, MUR2517, MUR2518,
MUR2523, and MUR2549 were cultured in 5 ml TYC with the appropriate antibiotic selection pressure for each culture. All cultures were incubated at 28oC for three days on a gyratory shaker. Wild-type and mutant cultures were exposed to the following treatments: 28oC, 20oC,
o 37 C, pH 5.7 (buffered by MES), pH 7.0 (buffered by HEPES), EtOH (0.3% [v/v]), H2O2 (100 µM), sucrose (15% [w/v]), sodium dodecyl sulfate (SDS, 0.5% [w/v]), NaCl (250 mM), ZnSO4 (250
µM), or CuSO4 (700 µM). All three-day old cultures were standardized to the same OD600nm value and then sub-cultured into each treatment to provide a starting OD600nm value of 0.025.
All cultures were incubated at 28oC unless otherwise stated. All cultures were incubated for two days, except cultures grown at pH 5.7 which were incubated for an additional two days.
Following incubation, the optical density values at OD600nm were recorded for all cultures.
2.19.1 Motility phenotyping
The motility was examined for all cultures that had been stress phenotyped. After incubation, an aliquot of 10 µl of each cell culture was spotted onto glass slides, a cover slip was attached, and the cell culture motility and shape were observed using an Olympus® BU-2 microscope.
Chapter 2 Materials and Methods 55
2.20 Headspace volatile organic assay by gas chromatography mass spectrometry (HS-GC-MS)
TYC (20 ml) cultures containing E. medicae WSM419 or mutant derivatives MUR2511,
MUR2513 and MUR254 were incubated at 28oC on a gyratory shaker (orbit = 35 mm) set to
200 rpm for three days. After incubation, all cultures were aseptically opened at room temperature (24oC) and saturating fibres were applied to the headspace of each culture for four hours. The fibre used was a 50/30 µm DVB/CAR/PDMS, Stableflex (Supelco®). The fibres were collected and analysed by Agilent Technologies® 7890B GC-system and Agilent
Technologies® 5877B MS device using a headspace-solid phase micro extraction-GC-MS (HS-
SPME-GC-MS) protocol. GC column used was a HP-5MS; length 30 m, diameter 0.250 mm, film
0.50 µM (Agilent Technologies ®). Flow rate was set to 1.1 mL/min, with a ramping temperature range starting at 40oC and increasing at 5oC/min until first ramp maximum limit of 220oC. Followed by ‘cleansing’ ramp stage, with an increasing rate of 50oC/min until 320oC is reached. The NIST-MS v14® software was used to interrogate a master database (GMP-
802201702), analyse and compare mass spectrometry profiles. The analysis was performed by Mr. Xin Du under the direction of Prof. Yonglin Ren at the Post harvest biosecurity and food laboratory, VLS, Murdoch University, Perth, Western Australia.
2.21 Plant nodulation and nitrogen fixation
Seeds of Medicago truncatula cultivar Jemalong were scarified using low grade sand paper and surface sterilised by immersion in 70% (v/v) ethanol for 1 min, followed by 3 min in 4%
(v/v) sodium hypochlorite and then rinsed six times with sterile distilled water. Seeds were germinated on sterile 1.5% (w/v) water-agar plates and aseptically transplanted into 27 sterilized, catchment draining plastic pots containing approximately 3.5 L of sterilized washed
Chapter 2 Materials and Methods 56 vermiculite. The vermiculite was sterilized using three consecutive rounds of autoclaving at
121oC for 30 min. After incubating on water agar plates at 24oC for one day, the germinated seedlings with similar radical lengths were selected (~1-2 cm long) and five seedlings were transplanted into each pot. Pot seedlings were inoculated with cultures of E. medicae
WSM419 or the mutant derivatives MUR2511, MUR2513, MUR2517, MUR2518, MUR2523 or
MUR2549 that were resuspended from TYC plates containing appropriate selection pressure.
All plates were incubated for three days and contained a lawn of confluent growth. Cells of each strain were resuspended into 50 ml saline containing ~109 cells/ml, cell suspensions were diluted to provide 106 cells/ml to reduce the risk of any spontaneous mutants. An aliquot of 1 ml diluted cell suspension was used to inoculate each germinated plant seedlings in a respective pot. Each strain was inoculated into 3 pots with each pot containing 5 seedlings. An additional three pots containing a total of 15 seedlings were used as a N- control while another three pots containing a total of 15 seedlings were used as a N+ control.
Inoculated pots were covered with glad wrap for three days to minimize evaporation and to avoid contamination. All plants were grown in a naturally lit, UV shielded, temperature controlled (max temp. 22°C) glasshouse. Each pot was watered every two days (90 ml) through an autoclave sterilized capped tube as previously described (Howieson & Dilworth, 2016).
After ten days of growth, two plants from each pot were culled ensuring the remaining plants were of similar size. An aliquot of 40 ml modified nutrient solution was added once every seven days, containing 7.25 mM Fe-EDTA, 2.5 mM K2SO4, 1.25 mM KH2PO4, 1 mM CaSO4, 0.5 mM MgSO4.2H2O, 7.5 µM H3BO3, 6.2 µM MnSO4.H2O, 2.37 µM ZnSO4.7H2O, 0.5 µM
CuSO4.5H2O and 0.5 µM Na2MoO4.2H2O. N+ control pots were provided with 5 ml 49.45 mM of KNO3, in addition to nutrient solution. N- control pots were provided no external nitrogen.
Chapter 2 Materials and Methods 57
After 55 days of growth, all plants were carefully harvested and washed free of vermiculite and an image was captured for each plant. All established nodules were documented (pot number, plant number, nodule position and nodule colour), recovered on an excised root section and stored at -4oC until used.
Nodules were surface sterilized by immersing nodules in 70% (v/v) ethanol for 1 min,
4% (v/v) sodium hypochlorite for 3 min and were then washed using six changes of sterile water. After the last rinse, each nodule was aseptically crushed, and the contents streaked onto TYC (selecting for any RNB), TYC with the antibiotics nalidixic acid and chloramphenicol
(selecting only for WSM419) and TYC containing the antibiotics nalidixic acid, kanamycin and chloramphenicol (selecting only for WSM419 mutant derivatives). After three days of incubation, single colonies were recovered and cultured in TYC broth maintaining selective pressure as per the plate recovered. After cells reached saturation, each culture was cryopreserved as previously described.
2.22 PCR confirmation of nodule occupants
PCR confirmation of each strain recovered from a nodule was performed from cells grown in
TYC broth containing the appropriate antibiotics. Broth cultures were incubated for three days at 28oC. After incubation 5 ml of each strain was centrifuged at 4,000 g for 8 min and the cell pellet resuspended in 100 µl of saline. An aliquot of 10 µl was used to determine the optical cell density and then all cultures were standardized to an OD600nm of 10. The wild-type cells were used as template in PCR reaction 1 (Table 2.5) and the amplification was performed using PCR cycling condition 2 (Table 2.8). The primer pairs Smed_3534 EG UP-F/Smed_3534
DN-R were used to produce a fragment spanning queG. In addition, a second primer pair for
Chapter 2 Materials and Methods 58 each wild-type strain was used in a separate reaction using the primer pair Smed_4938 EG UP-
F/Smed_4937 DN-R to produce a fragment spanning the queDE genes. Each mutant derivative strain was confirmed using the respective primer pair that confirmed the DXO mutation originally. Briefly, for ΔqueG: the UP fragment amplification was achieved using the
Smed_3534 EG UP-F/GUS157 primer pair and DN fragment amplification was achieved using the Smed_3534 EG DN-R/Nm primer pair. For ΔqueD: the UP fragment amplification was achieved using the Smed_4938 EG UP-F/GUS157 primer pair and the DN fragment amplification was achieved using the Smed_4938 EG DN-R/Nm primer pair. For ΔqueE the UP fragment amplification was achieved using the Smed_4937 EG UP-F/ GUS157 primer pair and
DN fragment amplification was achieved using the Smed_4937 EG DN-R/Nm primer pair. All amplified fragments were visualized after agarose gel electrophoresis as described previously.
Chapter 2 Materials and Methods 59
Results
Chapter 3 Results 60
3.1 Bioinformatical analysis and prediction of the Q pathway for all 139 GEBA-RNB 3.1.1 The Q-pathway genes are ubiquitous in the GEBA-RNB
The 139 GEBA-RNB genomes that have been sequenced and deposited into the Integrated
Microbial Genome (IMG) database (Reeve, 2015) were bioinformatically analysed to identify if a functional queuosine (Q)-pathway was ubiquitous in these microsymbionts or present only in selected backgrounds. Analyses were performed using the bioinformatic tools available through Integrated microbial genomes (IMG) at the Joint Genome Institute (JGI) and online resources available at National Center for Biotechnology Information (NCBI). The flowchart for the screening procedure is presented in Fig 3.1.
Figure 3.1. Flowchart schematic of the screening procedure utilised for all que genes in 139 GEBA-RNB. Each step of screening is divided into levels of increased intensity. A total of 1,245 genes were obtained using this screening method which included paralogs and orthologs.
Chapter 3 Results 61
Using this process, a total of 1,245 genes were identified in the GEBA-RNB that encoded proteins involved in the Q-pathway. The analyses revealed that every GEBA-RNB genome contained the full suite of genes necessary for a complete and functional Q-pathway.
In some genetic backgrounds, paralogs of genes were identified e.g. the Mesorhizobium loti
USDA 3471 genome was found to contain four annotated queD genes. Certain genes identified through the screening process were unannotated in particular genomes e.g. the queD gene was found to be unannotated in Mesorhizobium sp. WSM3224 and Ensifer (previously designated Sinorhizobium) fredii HH103, while the queF gene was unannotated in E. meliloti
MVII-I, GR4 and BL225C. All of the Q-pathway genes have been catalogued in a Queuosine
GEBA-RNB database (Appendix A, Table 1) in preparation for submission to the JGI-IMG Expert
Review (ER) database to improve the annotation of these genomes.
3.1.2 Certain que gene neighbourhoods are strongly conserved across RNB
The bioinformatic screening revealed particular genes to be strongly conserved in specific gene neighbourhoods and operon configurations. For example, the PreQ1 biosynthetic genes queC, queD, and queE were found to usually appear in a queCDE1, queE1DC or queE1D operon configuration (Fig 3.2). The queA and btgt genes were usually found to be co-located with the non-Q genes coaD, ppiA and ppiB in the queA-btgt (a) and queA-btgt (b) operon configurations
(Fig 3.3). The folE and queF genes were usually not co-located with other Q-genes. However, exceptions were found in: (1) B. sp. WSM2254, WSM3983, and Methylobacterium nodulans
ORS 2060 which contain paralog folE genes which form an operon with queC or queE1, and (2)
Mesorhizobium loti R88b, R7A, NZP2037 which contain paralog queF genes in an operon with queCDE1. The queG gene was not found adjacent to any other Q-biosynthetic genes.
Chapter 3 Results 62
Figure 3.2. The operon configurations and gene neighbourhoods most strongly conserved for queC, queD and queE1. Phylogenetically, the queCDE1 and the alternative queE1DC configuration are most common in the genera Paraburkholderia, Ensifer, Mesorhizobium and Rhizobium. The operon configuration queE1D is most commonly found in the genera Bradyrhizobium, Curpriavidus and Microvirga.
Figure 3.3. The operon configurations and gene neighbourhoods most strongly conserved for queA and tgt. The coaD, ppiA, ppiB, queA, btgt operon configuration queA-btgt (a) is most commonly found in Ensifer, Mesorhizobium, Microvirga and Rhizobium. The only other genus that shares a similar configuration of queA-btgt (b) is Bradyrhizobium, however, the btgt gene is no longer part of the operon but is still located nearby. The genera Burkholderia, Curpriavidus and Methylobacterium have the alternate queA-btgt (c) operon with the distinct absence of coaD, ppiA and ppiB in this neighbourhood. Certain strains of RNB (e.g. Mesorhizobium WSM2561) contain queA paralogs that are not located in close proximity to other Q genes.
Chapter 3 Results 63
3.1.3 Certain RNB contain an alternate ortholog of queE1 in the queED gene neighbourhood
The initial bioinformatic screening at level 1 (Fig 3.1) revealed that queE genes for a select few
RNB (Appendix A, Table 2), usually from the Bradyrhizobium genus, were completely absent.
However, using level 2 screening, an orthologous ‘queE2’ gene was found in the completely finished genome of B. sp. BTAi-1. Two-sequence alignment of Bradyrhizobium sp. BTAi-1 queE2 to E. medicae WSM419 queE1 sequence produced an alignment containing only 27% identity over 43% of the WSM419 query sequence. Despite this low nucleotide percentage identity, a Level 4 screening (Fig 3.1) revealed that the queE1 and queE2 gene neighbourhoods were highly conserved (Fig 3.4).
Figure 3.4. The comparison of the queE1D operon with the queE2D operon that is common in the genus Bradyrhizobium.
Level 5 screening (as in Fig 3.1) revealed that both QueE1 and QueE2 contained similar protein domains and therefore a conserved enzyme function (Table 3.1).
Chapter 3 Results 64
Table 3.1. The conserved protein domains of the queE1 and queE2 orthologs. Differences are bolded and underlined . Hit specifications queE1 of E. medicae WSM419 queE2 of B. sp. BTAi-1 Radical_SAM superfamily Radical_SAM superfamily Fer4_12 superfamily Fer4_12 superfamily Radical_SAM superfamily Superfamily Radical_SAM superfamily rSAM_QueE_Clost_superfamily
AiCRAFT_IMPCHas superfamily
NrdG NrdG Specific hits Radical_SAM Radical_SAM Bsubt_queE Radical_SAM
queE_cx14CxxC queE_cx14CxxC rSAM_QueE_Clost rSAM_QueE_Clost
rSAM_QueE_gams rSAM_QueE_gams
rSAM_QueE_Ecoli rSAM_QueE_Ecoli
Pf1A Pf1A
Non-specific hits NrdG2 NrdG2
Radical_SAM Bsubt_queE
PRK07106 rSAM_NirJ
MoaA
SCM_rSAM_ScmF
moaA
Chapter 3 Results 65
3.2 Detailed bioinformatic analyses of the Q genes in the NHR E. medicae WSM419 and the BHR E. fredii NGR234 3.2.1 Particular Q-pathway genes have been annotated as exopolysaccharide synthesis (exs) genes in E. medicae WSM419 and E. fredii NGR234
A comparison of all Q-pathway genes for E. medicae WSM419 and E. fredii NGR234 revealed that the genomic locations, gene neighbourhoods and protein functions were conserved, despite the differences in host range of these strains (Table 3.2). Many of the Q-pathway genes have been identified with the gene symbol que, however, three genes (queCDE1) were annotated with the gene symbol exs (exopolysaccharide synthesis genes exsBCE) in E. fredii
NGR234 in the IMG online database.
The QueCDE (ExsBCE) proteins of E. fredii NGR234 have been annotated as the following: a succinoglycan biosynthesis regulator, preQ(0) biosynthesis protein QueD, and
PreQ(0) biosynthesis protein QueE. In E. medicae WSM419, the QueCDE proteins have been annotated as: ExsB protein, preQ(0) biosynthesis protein QueD, and preQ(0) biosynthesis protein QueE. All of the genes involved with the E. medicae WSM419 and E. fredii NGR234 Q- pathway have been re-annotated in this study using the gene symbol in column one of Table
3.2.
Chapter 3 Results 66
Table 3.2. Comparison of the protein domains, gene location, and gene symbols for all Q-pathway genes in E. fredii NGR234 and E. medicae WSM419. Q IMG Locus tag Q- Conserved protein domains Gene Gene (Location) biosynthetic Symbol* Symbol enzyme NGR_c12570 folE (Chromosoma pfam01227 – GTP_cyclohydrol GTP cyclohydrolase folE l) COG0302 – GTP cyclohydrolase I Smed_1049 I folE TIGR00063 – GTP cyclohydrolase I Chromosomal NGR_b18170 exsC (pNGR234b) 6-pyruvoyl- pfam01242 – PTPS queD tetrahydropterin COG0720 – 6-pyruvoyl-tetrahydropterin synthase Smed_4938 synthase exsC TIGR03367 – queuosine biosynthesis protein pSmed01
NGR_b18160 pfam04055 – Radical_SAM exsE pfam13394 – 4Fe_4S single cluster domain (pNGR234b) PreQ(0) biosynthesis COG0602 – Organic radical activating enzyme queE1 protein QueE No Smed_4937 TIGR03365 – 7-cyano-7-deazaguanosine (preQ0) symbol (pSmed01) biosynthesis protein NGR_b18180 exsB (pNGR234b) 7-cyano-7- pfam06508 – QueC queC deazaguanine COG0603 – 7-cyano-7-deazaguanine synthase Smed_4939 synthase queC TIGR00364 – Queuosine biosynthesis protein (pSmed01) NGR_c23490 queF (Chromosoma NADPH-dependent pfam14489 – QueF COG0780 – NADPH-dependent 7-cyano-7- queF l) 7-cyano-7- Smed_2293 deazaguanine deazaguanine reductase QueF queF (Chromosoma reductase TIGR03139 – 7-cyano-7-deazaguanine reductase l) NGR_c15850 pfam01702 – TGT tgt (Chromosoma COG0343 – Queuine/archaeosine tRNA- tRNA-guanine- btgt l) ribosyltransferase Smed_1268 transglycosylase TIGR03139 – tRNA-guanine family tgt (Chromosoma transglycosylase l) NGR_c15840 S- pfam02547 – Queuosine_synth queA (Chromosoma adenosylmethioniine COG0809 – S-adenosylmethionine:tRNA queA l) :tRNA ribosyltransferase-isomerase Smed_1267 ribosyltransferase- TIGR00113 – S-adenosylmethionine:tRNA queA (Chromosoma isomerase ribosyltransferase-isomerase l) NGR_c36640 queG (Chromosoma pfam08331 – DUF1730 pfam13484 – Fer4_16 queG l) Epoxyqueuosine Smed_3534 reductase COG1600 – epoxyqueuosine reductase QueG queG (Chromosoma TIGR00276 – epoxyqueuosine reductase l) * Q gene symbol adopted in this study
Chapter 3 Results 67
3.2.2 The Q biosynthetic enzymes of E. medicae WSM419 and E. fredii NGR234 are highly conserved
A search for E. medicae WSM419 and E. fredii NGR234 conserved protein domains using the
NCBI CDD algorithm established that orthologous Q-biosynthetic enzymes contained conserved specific superfamily signature domains and specific CDD domain hits, implying functionally similar Q-pathways (Table 3.3 and Appendix B).
Table 3.3. CDD results for specific and non-specific hits for each of the Q-proteins in E. medicae WSM419 and E. fredii NGR234. Differences are underlined and in bold. E. medicae WSM419 E. fredii NGR234 Protein Specific CDD Non-specific CDD domain Specific CDD domain Non-specific CDD domain domain hits hits hits hits
PRK12606, folE, PRK12606, folE, FolE GTP_cyclohydrol, FolE GTP_cyclohydrol, PLN03044, FolE GTP_cyclohydrol PLN03044, PTZ00484, GTP_cyclohydrol PTZ00484, PLN02531, T- PLN02531, T-Fold Fold
QueD, PTPS, QueD, PTPS, QueD 6PTHBS, PTPS 6PTHBS, PTPS Queuosine_QueD Queuosine_QueD
rSAM_QueE_gams, rSAM_QueE_gams, Bsubt_queE, rSAM_QueE_Clost, rSAM_QueE_Clost, Bsubt_queE, NrdG, QueE NrdG, rSAM_QueE_Ecoli, pf1A, rSAM_QueE_Ecoli, pf1A, Radical_SAM Radical_SAM pFLA, Radical_Sam, pFLA, Radical_Sam, PRK07106 PFLE_PFLC
QueC, TIGR00364, PRK11106, MnmA, QueC, TIGR00364, Asn_synthase, PRK11106, MnmA, Asn_synthase_B_C, TilS, Asn_synthase, AsnB, PP-ATPase, Asn_synthase_B_C, TilS, QueC QueC, ExsB QueC, ExsB lysidine_TilS_N, AsnB, PP-ATPase, ATP_bind_3, trmU, lysidine_TilS_N, NAD_synthase ATP_bind_3, trmU, Alpha_ANH_like_II, NAD_synthase, COG1606 tRNA_Me_trans,
PRK13258, PRK13258, QueFC, QueF-II, QueF, queF, QueF QueF-II, QueF, queF QueFC, QueF QueF QueF_N
Q_tRNA_tgt, tgt_general, Q_tRNA_tgt, tgt_general, bTGT Tgt, Tgt, TGT PRK01008, PRK13533, Tgt, Tgt, TGT PRK01008, PRK13533, PRK13534, arcsn_tRNA_tgt PRK13534, arcsn_tRNA_tgt
queA, QueA, queA, QueA, QueA Queuosine_synth, PRK01424, 4hydrxCoA_B Queuosine_synth, PRK01424, 4hydrxCoA_B queA queA
Fer4_16, DUF1730-RDH- Fer4_16, DUF1730-RDH- TIGR00276, QueG HEAT_2, MtMuhB_like, TIGR00276, QueG HEAT_2, MtMuhB_like, QueG Fer4_7 Fer4_7, PRK14028
Chapter 3 Results 68
3.3 Construction and confirmation of the E. medicae WSM419 and E. fredii NGR234 mutant strains 3.3.1 An overview of the process used in Ensifer mutant construction
To establish the role of particular Q-pathway genes identified in E. medicae WSM419 and E. fredii NGR234, an appropriate mutation strategy needed to be developed. An overview of the mutation process used in this study is presented in Fig 3.4.
Figure 3.4. An overview of the process used to construct Ensifer mutants. Restriction enzymes RE1, 2, 3 and 4 were XhoI, EcoRI, HindIII, XbaI, respectively, for E. medicae WSM419 cloning strategy. Restriction enzymes RE1, 2, 3 and 4 were XhoI, SacI, HindIII, XbaI, respectively, for E. fredii NGR234 cloning strategy.
3.3.2 Identifying antibiotic resistance markers to select for Ensifer mutants
The selection for Ensifer recipients using antibiotic resistance marker will be essential for the selection of mutations in specific Q-pathway genes. For this strategy to work, the
Ensifer parents will need to be neomycin/kanamycin-sensitive (the CAS-GNm cassette used to disrupt the genes will provide kanamycin/neomycin resistance) and resistant to at least two
Chapter 3 Results 69 antibiotics to successfully select for Ensifer recipients. Hence, the antibiotic resistance profiles
(Table 3.4) were investigated for E. medicae WSM419 and the three E. fredii strains USDA257,
NGR234 and HH103. E. coli DH5α was included in these tests since it is sensitive to all of the antibiotics tested. Different cell densities were spread plated onto TYC to ascertain the effect of cell density on the resistance profiles.
Table 3.4. Intrinsic antibiotic resistances of E. medicae WSM419, E. coli DH5α, E. fredii USDA257, NGR234, and HH103 at different cell densities on TYC plates.
Cell Count Antibiotics* Organism (cells/mL) Rf Sm Sp Km Nm Gm Cm Nx E. medicae WSM419 107 103 150 E. coli DH5α 107 103 150 E. fredii USDA257 107 103 150 E. fredii NGR234 107 103 150 E. fredii HH103 107 103 150 Green = growth, Red = no growth *Rf – Rifampicin (60 µg/mL), Sm – Streptomycin (100 µg/mL), Sm – Spectinomycin (100 µg/mL), Km – Kanamycin (100 µg/mL), Nm – Neomycin (100 µg/mL), Gm – Gentamycin (60 µg/mL), Cm – Chloramphenicol (20 µg/mL), Nx – Nalidixic acid (75 µg/mL).
As expected, E. coli DH5α was not resistant to any of the antibiotics. At low cell densities the E. medicae WSM419 cells were resistant to chloramphenicol and nalidixic acid.
Furthermore, cells were found to be resistant to streptomycin and to spectinomycin only at highest cell density plated. Hence, the antibiotics chloramphenicol and nalidixic acid can be used to select for E. medicae WSM419 mutants.
Chapter 3 Results 70
Examination of the antibiotic resistance profiles for the E. fredii strains revealed the following: (1) USDA257 cells were resistant to kanamycin/neomycin and hence CAS-GNm could not be used in this genetic background, (2) NGR234 was resistant to both rifampicin and streptomycin but sensitive to kanamycin/neomycin, and (3) HH103 was not resistant to any of the antibiotics tested except to nalidixic acid only at high cell concentrations. Hence, E. fredii NGR234 was chosen as the genetic background for further mutation work.
3.3.3. Overview of the construction of inactivation vectors
An overview of the cloning process used to construct inactivation vectors is presented in Fig
3.5.
Figure 3.5. The overall quadruple parental ligation reaction for constructing the Q-pathway inactivation vectors. Restriction enzymes RE1, 2, 3 and 4 were XhoI, EcoRI, HindIII, XbaI, respectively, for E. medicae WSM419. Restriction enzymes RE1, 2, 3 and 4 were XhoI, SacI, HindIII, XbaI, respectively, for E. fredii NGR234.
Chapter 3 Results 71
3.3.4. Construction and confirmation of the E. medicae WSM419 inactivation vectors
Inactivation vectors constructed by quadruple fragment ligation reactions were transformed into E. coli BW20767 competent cells. Five gentamycin and kanamycin resistant transformants were selected: two containing the queD inactivation vector pQLΔSmed_4938, two containing the queE inactivation vector pQLΔSmed_4937 and one containing the queG inactivation vector pQLΔSmed_3534 (Table 3.5 and Fig 3.6).
Table 3.5 Expected PCR amplification product sizes derived from inactivation vectors, pQLΔSmed_4938, pQLΔSmed_4937 and pQLΔSmed_3534.
MUE Size of E. medicae WSM419 Expected Plasmids accession*of Region region cloned (bp) into PCR
E. coli inactivation plasmid amplification pQLΔSmed_3534 UP 658 926product size MUE1470 ΔqueG DN 824 1,049(bp) for pQLΔSmed_4938 UP 814 1,069verification MUE1471 ΔqueD DN 601 806 pQLΔSmed_4938 UP 814 1,069 MUE1472 ΔqueD DN 601 806 pQLΔSmed_4937 UP 539 806 MUE1473 ΔqueE DN 642 867 pQLΔSmed_4937 UP 539 806 MUE1474 ΔqueE DN 642 867 *MUE, Murdoch University E. coli collection. Each inactivation vector was confirmed by PCR amplification of the UP and DN fragments using the appropriate primer pairs. The sizes of the amplified fragments were consistent with the expected in silico product size (Table 3.5 and Fig 3.7). Each inactivation vector was sequenced by the Australian Genome Research Facility (AGRF) using the appropriate primer pairs. The sequence obtained was used to perform a BLASTn search using the JGI-IMG online database. All five inactivation plasmids contained UP and DN regions that were 100 % identical over the entire length to the respective regions in the E. medicae
WSM419 genome.
Chapter 3 Results 72
A
B
C
Figure 3.6. In silico schematic diagrams of constructed inactivation vectors transformed into E. coli BW20767, A) pQLΔSmed_4938, B) pQLΔSmed_4937, C) pQLΔSmed_3534.
Chapter 3 Results 73
A 1 2 3 B 1 2 3 C 1 2
Figure 3.7. Gel electrophoresis products produced from PCR amplification of regions spanning the UP and DN fragments for each inactivation vector. A) pQLΔSmed_4938 (ΔqueD): L1 – 1 kbp ladder, L2 – Repl icate 1, L3 – Replicate 2. B) pQLΔSmed_4937 (ΔqueE): L1 – Replicate 1, L2 – Replicate 2, L3 – 1kbp ladder. C) pQLΔSmed_3534 (ΔqueG): L1 – Replicate 1, L2 – 1kbp ladder.
3.4.2 Construction and confirmation of E. medicae WSM419 mutants
A conjugation of E. coli BW20767 transformants and E. medicae WSM419 cells produced mutant derivative strains that were kanamycin/neomycin, chloramphenicol and nalidixic acid resistant and sucrose resistant. Confirmation of successful DXO transconjugants was performed by PCR amplification of the UP and DN fragment of each mutant strain using primers that are beyond each original amplified region (Table 3.6).
Table 3.6. Expected fragment sizes for PCR amplification confirmation of successful gene knockouts in E. medicae WSM419 mutant derivatives. Size of E. medicae Expected PCR Transformant Strains MUR Region WSM419 region amplification derivative cloned (bp) into product size (bp) inactivation for verification ΔqueD MUE1471 MUR2549 UP 814 plasmid 1,029 (Smed_4938) MUR2523 DN 601 764 ΔqueD MUR2511 UP 814 1,029 MUE1471 (Smed_4938) MUR2517 DN 601 764 ΔqueE MUR2513 UP 539 806 MUE1473 (Smed_4937) MUR2518 DN 642 867 ΔqueE MUR2549 UP 539 828 MUE1473 (Smed_4937) MUR2523 DN 642 757 ΔqueG MUR2511 UP 658 922 MUE1470 (Smed_3534) MUR2517 DN 824 1,014 ΔqueG MUR2513 UP 658 922 MUE1470 (Smed_3534) MUR2518 DN 824 1,014
This result revealed that putative double crossover mutants had been successfully created for the Q-pathway genes queD, queE, and queG (Fig 3.8, 3.9 and 3.10).
Chapter 3 Results 74
Figure 3.8. The complete construction of the E. medicae WSM419 ΔqueD strain, including the location of all primers and junctions. A) The queD gene neighbourhood, of which the UP and DN fragments were amplified by PCR using the specified primer pairs. B) The theoretical insert consisting of the UP, DN fragments, and the cassette CAS-GNm. C) Linearized inactivation vector pQLΔSmed_4938, conferring KmR, GmR, SucroseS. D) Schematic of the E. medicae WSM419 ΔqueD strain containing the genotype: queC++, ∆queD and queE++. E) PCR amplified UP and DN fragments of DXO mutant derivatives MUR2513 and MUR2518, ‘control’ represent PCR reactions with no template, used for each primer pair: L1 – HEH ladder, L2 – MUR2518 DN control, L3 – MUR2518 DN, L4 – MUR2518 UP control, L5 – MUR2518 UP, L6 – MUR2513 DN control, L7 – MUR2513 DN, L8 – MUR2513 UP control, L9 – MUR2513 UP, L10 – HEH ladder.
Chapter 3 Results 75
Figure 3.9. The complete construction of the E. medicae WSM419 ΔqueE strain, including the location of all primers and junctions. A) The queE gene neighbourhood, of which the UP and DN fragments were amplified by PCR using the respective primer pairs. B) The theoretical insert construct consisting of the UP, DN fragments, and the cassette CAS-GNm. C) Linearized inactivation vector pQLΔSmed_4937, conferring: KmR, GmR, SucroseS. D) Schematic of the E. medicae WSM419 ΔqueE strain containing the genotype: queD++, ∆queE, ABC transporter++. E) PCR amplified UP and DN fragments of DXO mutant derivatives MUR2549 and MUR2523, ‘control’ represent PCR reactions with no template, used for each primer pair: L1 – HEH ladder, L2 – MUR2523 DN control, L3 – MUR2523 DN, L4 – MUR2523 UP control, L5 – MUR2523 UP, L6 – MUR2549 DN control, L7 – MUR2549 DN, L8 – MUR2549 UP control, L9 – MUR2549 UP, L10 – HEH ladder.
Chapter 3 Results 76
Figure 3.10. The complete construction of the ΔqueG E. medicae WSM419 strain, including the location of all primers and junctions. A) The queG gene neighbourhood, of which the UP and DN fragments were amplified by PCR using the respective primer pairs. B) The theoretical insert construct consisting of the UP, DN fragments, and the cassette CAS-GNm. C) Linearized inactivation vector pQLΔSmed_3534, conferring: KmR, GmR, SucroseS. D) Schematic of the E. medicae WSM419 ΔqueG strain containing the genotype: glutathione S-transferase++, ∆queG, NAD-dependend epimerase++. E) PCR amplified UP and DN fragments of DXO mutant derivatives MUR2511 and MUR2517, ‘control’ represent PCR reactions with no template, used for each primer pair: L1 – HEH ladder, L2 – MUR2511 UP, L3 – MUR2511 UP control, L4 – MUR2511 DN, L5 – MUR2511 DN control, L6 – HEH ladder, L7 – MUR2517 DN control, L8 – MUR2517 DN, L9 – MUR2517 UP control, L10 – MUR2517 UP.
Chapter 3 Results 77
3.4.3 Construction and confirmation of E. fredii NGR234 inactivation vectors
Due to time constraints, only one inactivation vector could be constructed for use in E. fredii
NGR234. The queG gene was selected since it produced the enzyme product required for the last step of the Q-pathway. The inactivation vector (Fig 3.11) was produced using the quadruple fragment ligation method (Fig 3.5).
Figure 3.11. Schematic diagram of the inactivation vectors pQLΔNGR234_c36640.
The resulting ligation mixture was transformed into E. coli JM83 competent cells and then spread onto selective media containing gentamycin and kanamycin/neomycin. Two transformants (MUE1471 and MUE1472) were selected and the inactivation vector for both transformants were confirmed by PCR amplification and subsequent gel electrophoresis of the UP and DN fragments produced (Fig 3.12). The sizes of the fragments amplified were compared to the expected in silico product size (Table 3.7).
Chapter 3 Results 78
Table 3.7 . Expected fragment sizes for PCR amplification to confirm both inactivation vectors intended for E. fredii NGR234 ΔqueG mutant construction. Size of E. fredii NGR234 Expected PCR Strains MUE Region region cloned (bp) into amplification product inactivation plasmid size (bp) for pQLΔNGR_c36640 verification MUE1471 UP 667 834 ΔqueG DN 856 960 pQLΔNGR_c36640 UP 667 834 MUE1472 ΔqueG DN 856 960
1 2 3
Figure 3.12. Gel image of amplified PCR products for UP and DN regions from the inactivation vector pQLΔNGR_c36640 in transformants MUE1471 and MUE1472: L1 – MUE1471 UP and DN, L2 – MUE1472 UP and DN, L3 – 1 kbp ladder. The inactivation vectors were confirmed by Sanger sequencing of the UP and DN regions in each vector. Generated DNA sequences confirmed 100% identity match to respective E. fredii NGR234 regions by BLASTn result. Both inactivation vectors were sequenced by AGRF using the primers M13-F, M13-R, GUS157 and Nm in separate sequencing reactions. The sequences obtained were used to perform a BLASTn search using the JGI-IMG online database. Both inactivation plasmids contained UP and DN regions that were 100 % identical over the entire length to the respective regions present in the E. fredii NGR234 genome.
Chapter 3 Results 79
3.4.4 Construction and confirmation of E. fredii NGR234 queG mutant
A triparental conjugation of a E. coli JM83 transformant, the E. coli MT616 helper strain and
E. fredii NGR234 cells produced mutant derivative strains that were resistant to
kanamycin/neomycin, rifampicin, streptomycin and sucrose (Fig 3.13). Due to time
restrictions, the mutation could not be confirmed by PCR analysis.
Figure 3.13. The complete construction of the ΔqueG S. fredii NGR234 strain, including the location of all primers and junctions. A) The queG gene neighbourhood, of which the UP and DN fragments were amplified by PCR using the respective primer pairs. B) The theoretical insert construct consisting of the UP, DN fragments, and the cassette CAS-GNm. C) Linearized inactivation vector pQLΔNGR234_c36640, conferring: KmR, GmR, SucroseS. D) Schematic of the S. fredii NGR234 ΔqueG strain containing the genotype: glutathione S-transferase++, ∆queG, nad-dependend epimerase++.
Chapter 3 Results 80
3.5 Free-living phenotyping 3.5.1 Is there an effect on growth for the que mutant derivatives?
To determine if an impaired Q-pathway influences the growth of E. medicae WSM419 or mutant derivative strains optical density (OD) and cell viability measurements were recorded over time (Fig 3.14).
A B
C D
Figure 3.14. Optical density reading & standardised cell counts (CFU/mLx10-6) vs time (h) for each strain of E. medicae WSM419 A) E. medicae WSM419, B) ΔqueG, C) ΔqueD, D) ΔqueE. All standard errors were <7% of the data values shown.
The mean generation times (MGTs) were calculated from the optical density (600nm) measurements for log-phase cultures over a period of 4.5 h. MGTs obtained for the wild-type,
ΔqueD, ΔqueE and ΔqueG mutants were established to be 2.8, 2.75, 3.25, and 3.25 h, respectively. The queD and queE mutant MGTs were found to be significantly different to that of the wild-type (P-value = <0.05), whereas the queG mutant MGT was not significantly different to that of the wild-type (P-value = >0.1).
Chapter 3 Results 81
Also, for each OD sample recorded, the respective viable cell count/ml was determined from the number of colony forming units (CFUs) grown on TYC spread plates, providing necessary insight into the viability of the cells recorded by the optical density. The R2 values between the optical density and cell counts were found to be 0.98, 0.99, 0.96 and 0.97 for the wild-type, ΔqueD, ΔqueE and ΔqueG mutants, respectively. Indicating that the optical density accurately reflects the CFUs in each sample, ensuring the integrity of the calculated MGT. The decreased MGTs of the ΔqueD and ΔqueE mutant derivative were therefore not caused by altered cell viability, instead is most likely caused by reduced cell growth compared to the wild-type
3.5.2 Free-living phenotypes for E. medicae WSM419 wild-type and mutant derivative strains
Phenotypic assays were conducted using free-living E. medicae WSM419 wild-type and mutant derivative strains using independent replicates for each strain. The optical density was recorded after two days of incubation for each culture and the data obtained are shown in Fig
3.15.
Figure 3.15. The recorded optical density for E. medicae WSM419 wild-type and mutant derivative strains after two days growth exposed to stressors.
Chapter 3 Results 82
o All cultures grown at 28 C (control condition) reached saturation (OD600nm = ~1.50). E. medicae WSM419 and mutant derivative strain cultures grown in the presence of H2O2, EtOH, sucrose, grown at high temperature (37oC), or when the media was buffered to pH 7.0, revealed that there was no significant difference of the final cell density of each mutant compared to the wild-type (P-value = >0.05). In contrast, at low temperature (20oC) the final cell density for the ΔqueD (OD600nm = 0.88) and ΔqueE (OD600nm = 0.88) mutant strains were found to be significantly less (P-value = <0.05) than the wild-type (OD600nm = 1.23) and the
ΔqueG mutant (OD600nm = 1.31). The growth of all cultures decreased significantly at pH 5.7 compared to pH 7.0 (P-value = >0.5), and a four-day incubation period was necessary for the pH 5.7 cultures to reach a readable optical density. There was no significant difference in the final cell density for all cultures that were buffered to pH 5.7 (P-value = >0.05).
The presence of ZnSO4 in broth cultures did not significantly affect the final cell density of the ΔqueG mutant compared to the wild-type (OD600nm = 1.50) (P-value = >0.05). However, the ΔqueD (OD600nm = 1.21) and ΔqueE (OD600nm = 1.23) reached a significantly lower final cell density than the wild-type and ΔqueG (P-value = >0.05).
The addition of CuSO4 did not significantly affect the final cell density of the ΔqueG
(OD600nm = 2.22) mutant to that of the wild-type (OD600nm = 2.21) (P-value = >0.05). In contrast, the ΔqueD (OD600nm = 1.68) and ΔqueE (OD600nm = 1.63) cultures grew to final cell densities which were significantly different to that of the ΔqueG mutant and wild-type (P-value = <0.05).
The addition of CuSO4 has been shown to increase melanin content in rhizobia and can be released from cells treated with the lysis agent sodium dodecyl sulphate (SDS). When these cultures were exposed to 0.5% SDS, a dark brown-black pigment was released (Appendix C,
Image 1 & 2), indicative of the presence of melanin. The intensity of the colour was not
Chapter 3 Results 83 distinguishable between the cultures implying that melanin production in the different backgrounds was not interfering with the optical density measurements.
The exposure of cultures to NaCl affected the growth of the cells in a similar way to that observed with CuSO4 treatment. The OD600nm readings for the wild-type (OD600nm = 2.07) and ΔqueG (OD600nm = 2.10) cultures grown in 250 mM NaCl were not significantly different
(P-value = >0.05). However, the final cell density of the wild-type and ΔqueG mutant cultures was significantly higher than the final cell densities reached for the ΔqueD (OD600nm = 1.75) and ΔqueE (OD600nm = 1.77) cultures (P-value = <0.05). The most significant difference in the final cell density was observed for the ΔqueG (OD600nm = 0.63), ΔqueD (OD600nm = 0.21) and
ΔqueE (OD600nm = 0.19) mutants compared to the wild-type (OD600nm = 1.52) (P-value = <0.05) treated with SDS.
3.5.3 E. medicae morphology and motility 3.5.3.1 Motility and morphology of E. medicae WSM419 and mutant derivatives
The shape of the cells and motility behaviour was examined for all treatments except for 37oC.
E. medicae WSM419 and que mutant derivatives were found to be Gram-negative motile rods with no distinguishable differences between them.
3.5.3.2 Colony swarming of E. medicae WSM419 and que mutants on solid TYC media
The colony growth pattern on simple TYC solid media was captured for the wild-type and que mutant derivative strains. All mutant derivatives showed a distinct pattern of cellular dispersion on this solid media that contrasted significantly with the pattern observed for the wild-type, for example, one of the mutant derivatives and wildtype are shown in Fig 3.16.
Chapter 3 Results 84
A B
Figure 3.16. Captured images of the cellular dispersion phenotype of single colonies of A) E. medicae WSM419 queD mutant strain MUR2518 and B) E. medicae WSM419
3.6.3 The unique donut morphology of E. medicae WSM419 on solid YMA media
E. medicae strain WSM419 forms mucoid colonies that appear as donut shapes on solid YMA media. The colony morphology of E. medicae WSM419 wild-type and mutant derivatives was explored comparing the shape, size and cellular dispersion on YMA recipes 3.024, Vincent, and a number of permutations between these two recipes (Appendix C, Table 1). Microscope images of each strain were captured after three days of growth.
3.6.3.1 Single colony morphology of E. medicae WSM419 wild-type
The colony morphology for the wild-type was found to change according to the YMA composition (Appendix C, Fig 1). 1) Single colonies on 3.024 YMA are up to three times bigger than that of Vincent YMA colonies, 2) the characteristic donut morphology is lost on Vincent
YMA, 3) single colonies on Vincent YMA have lost their clear mucoid front. This indicated that the unique donut morphology is established by the presence of 1) D-glucose, 2) NH4Cl or 3) both D-glucose and NH4Cl.
It was found that the donut morphology was restored to colonies grown on Vincent
YMA media with either the addition of NH4Cl or D-glucose. In both recipes, cellular dispersion
Chapter 3 Results 85 was increased and as a result colony sizes are comparable to that of 3.024 YMA. The ‘floral’ pattern of colony morphology is characteristic of cellular dispersion from the epicentre, which in turn is indicative of a need for nutrients. Colonies grown on Vincent YMA containing 10 g glucose and no mannitol, were found to have very little cellular dispersion with extensive mucoid fronts.
Comparing Vincent YMA and Vincent YMA (substituting glucose for mannitol), the size of the colony centres and cellular dispersion is comparable. However, the amount of EPS produced, and the clarity of the mucoid front, was vastly different, revealing that the presence of glucose stimulates clear EPS production.
3.6.3.2 Single colony morphology of E. medicae WSM419 mutant derivative strains
The morphology of the E. medicae WSM419 mutant derivative strains was explored on
3.024 YMA. The results revealed that the ΔqueG strain morphology is similar to that of the E. medicae WSM419 wild-type. In contrast, ΔqueD and ΔqueE single colonies had completely lost the typical donut centre, along with the loss of a clear mucoid front (Fig 3.17). The mucoid front displays opaqueness observed for E. medicae WSM419 wild-type strain colonies grown on Vincent YMA, however, unlike the wild-type strain grown on Vincent YMA, no loss in colony size or cellular dispersion is apparent for the ΔqueD and ΔqueE mutant derivatives.
Chapter 3 Results 86
A
B C
1mm
D E
F G
Figure 3.17. Single colony morphology for E. medicae WSM419 and mutant derivative after three days growth on the 3.024 YMA recipe. A) MUR2506 (wild-type) colony, B) MUR2511 (ΔqueG) colony, C) MUR2517 (ΔqueG) colony, D) MUR2513 (ΔqueD) colony, E) MUR2518 (ΔqueD) colony, F) MUR2549 (ΔqueE) colony, G) MUR2523 (ΔqueE) colony.
Chapter 3 Results 87
3.6.4 Detection of succinoglycan (EPSI) using calcofluor (CF)
To examine succinoglycan production on solid media, 0.02% calcofluor white M2R (CF,
Fluorescent Brightener 28, Sigma) was added to 3.024 YMA. Early log phase cells, standardised to OD600nm = 0.191, were spotted onto the YMA+CF plates. After three days growth, the fluorescence was imaged using a UV light source and SYBR green filter (Fig 3.18). The captured image revealed a noticeable decrease in fluorescence for the E. medicae WSM419 ΔqueD and
ΔqueE mutant derivatives. A reduction in fluorescence is indicative of a reduction in EPSI binding to CF, and as such the results demonstrate that EPSI biosynthesis has been reduced in these genetic backgrounds.
Wild-type
MUR2511 MUR2513 MUR2549 ΔqueG ΔqueD ΔqueE
MUR2518 MUR2523 ΔqueD MUR2517 ΔqueE ΔqueG
Wild-type Figure 3.18. Fluorescence phenotype of E. medicae WSM419 and mutant derivative strains colonies cultured on 3.024 YMA containing calcofluor plate after UV light exposure (t=1.5 s).
Chapter 3 Results 88
3.6.5 Prolonged stationary phase (PSP) assay
To ascertain the effects of prolonged incubation after culture saturation, E. medicae WSM419 wild-type and que mutant derivatives were cultured in TYC at 28 oC for 10 days after initially standardising each culture OD600nm to 0.5. The Gram stain of each culture revealed no significant effect on cellular morphology for any of the strains (Fig 3.19).
Wild-type ΔqueG ΔqueD ΔqueE
Figure 3.19. Gram staining results for E. medicae WSM419 and mutant derivatives.
After ten days incubation in stationary phase, the percentage survival for E. medicae
WSM419 wild-type and ΔqueG, ΔqueD and ΔqueE mutant strains decreased to 30%, 39%, 14%, and 5%, respectively, of the initial viable cell count. Hence, the ΔqueD and ΔqueE mutant strains showed a marked decrease in long-term viability in broth cultures. The pH of each broth culture after 10 days of incubation was measured to fall within a pH range of 7.0 – 8.0 revealing that the reduction in survival for ΔqueD and ΔqueE mutant strains was not due to a change in pH.
Chapter 3 Results 89
3.6.6 Volatile organic assay using Head-Space Gas Chromatography – Mass Spectrometry (HS-GC-MS)
During culturing, the observation was made that the E. medicae WSM419 ΔqueD and ΔqueE mutant strains could be distinguished from the E. medicae WSM419 wild-type and ΔqueG cultures by the aroma produced. To identify any difference in the volatile organic compound profiles, the headspace of each broth culture was analysed via HS-GC-MS and the profile generated for each sample was recorded and analysed (Fig 3.20). Multiple peaks were conserved throughout all samples, providing some integrity to the un-optimised HS-GC-MS analysis result. The resulting MS profile for the ΔqueE culture unexpectedly revealed a striking difference in the amount and type of volatile organics produced, compared to the wild-type.
Chapter 3 Results 90
Wild-type
ΔqueG
ΔqueD
ΔqueE
Figure 3.20. Annotated MS profiles for E. medicae WSM419 wild-type and ΔqueG, ΔqueD and ΔqueE cultures, derived from headspace gas chromatography.
Chapter 3 Results 91
The ΔqueE MS profiles revealed long chain fatty acids were produced in the headspace
(t >20 min). The greatest change in peak amplitude was observed for hexadecanoic acid
(C16H32O2). A simple peak area analysis comparison for hexadecanoic acid showed in comparison to the wild-type, a 2.1-fold increase in ΔqueG, 5-fold increase in ΔqueD, and a
20.1-fold increase in ΔqueE. Alongside the drastic increase in Hexadecanoic acid production, the ΔqueE culture showed an increase in several other long chain fatty acids (Fig 3.21).
Figure 3.21. Annotated MS profiles for E. medicae WSM419 ΔqueE culture derived from headspace gas chromatography at retention time >20 min.
Chapter 3 Results 92
3.7 Symbiotic phenotyping 3.7.1 Recovery of E. medicae WSM419 wild-type and mutant derivative strains from developed Medicago truncatula nodules
E. medicae WSM419 wild-type and mutant derivatives were inoculated onto germinated seedlings of the M. truncatula cultivar Jemalong. After 55 days of growth, the plants were harvested. It was noted that the plants performed poorly in the vermiculite system and may require an initial exogenous nitrogen pulse to better establish the seedlings. After harvest, large nodules were observed on plants inoculated with E. medicae WSM419 and on plants inoculated with ΔqueG, ΔqueD or ΔqueE. Notably, the majority of nodules were found near the crown of the root system. All recovered nodules were found to be pink in colour, indicating that effective symbiotic nitrogen fixation was occurring. A total of fifteen nodules were recovered from green plants that had been inoculated. All negative control (N-) treatments that had not been inoculated contained stunted plants with no visible nodules. All plants in positive control (N+) treatments, provided with exogenous nitrogen, displayed excellent growth and no visible nodules.
3.7.2 Confirmation of E. medicae inoculants in recovered nodules
All nodules were harvested, surface sterilized, washed and crushed. The nodule contents were streaked onto TYC, TYC containing chloramphenicol and TYC containing chloramphenicol and kanamycin/neomycin. As expected, E. medicae WSM419 grew on plates containing chloramphenicol, but not on plates containing chloramphenicol and kanamycin/neomycin. In contrast, E. medicae WSM419 mutant derivative strains grew on all of these plates. These results identified that each of the nodule occupants had the same antibiotic resistance profile
Chapter 3 Results 93 as the inoculant used. All of the recovered RNB were given a unique accession number and stored at -80 oC (Table 3.8).
Table 3.8. List of strains recovered from Medicago truncatula Jemalong nodules and associated attributes.
Nodule Inoculant MUR Inoculated Replicate Plant Colour Recovered RNB accession Strain MUR accession 1 2506 Wild-type 1 1 Pink 2553 2 2506 Wild-type 2 1 Pink 2554 3 2506 Wild-type 2 2 Pink 2555 4 2511 ΔqueG 1 1 Pink 2556 5 2511 ΔqueG 2 1 Pink 2557 6 2513 ΔqueD 1 1 Pink 2558 7 2513 ΔqueD 1 3 Pink 2559 8 2513 ΔqueD 2 1 Pink 2560 9 2513 ΔqueD 3 2 Pink 2561 10 2518 ΔqueD 1 1 Pink 2564 11 2518 ΔqueD 3 1 Pink 2565 12 2549 ΔqueE 1 1 Pink 2562 13 2549 ΔqueE 1 2 Pink 2563 14 2523 ΔqueE 3 1 Pink 2566 15 2523 ΔqueE 3 2 Pink 2567
The E. medicae WSM419 wild-type strain, MUR2555, was confirmed using the extragenic primers pairs Smed_3534 EG Up-F/Smed_3534 Dn-R and Smed_4938 Up-
F/Smed_4937 Dn-R to produce fragments spanning the entire queG (2,644 bp) and queDE
(2,528 bp) genes (Fig 3.22A).
Confirmation of the recovered E. medicae WSM419 mutant derivatives (MUR2556,
MUR2557, MUR2558, MUR2559, and MUR2567) was accomplished by PCR amplification and subsequent gel electrophoresis of the que UP and DN regions for each mutant. The correct
UP and DN regions were produced for each recovered mutant using the respective primer pairs used for mutant verification (Fig 3.22B and 22C).
Chapter 3 Results 94
A B 5 4 3 2 1 5 4 3 2 1
C 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1
Figure 3.22. Gel image of resulting PCR products for the E. medicae WSM419 wild-type and mutant derivative strains recovered from nodules harvested from M. truncatula, ‘control’ represent PCR reactions with no template, used for respective primer pairs: A) MUR2555; L1 – HEH marker, L2 – queG, L3 – queG control, L4 – queDE, L5 – queDE control. B) MUR2567; L1 – HEH marker, L2 – ΔqueE UP, L3 – ΔqueE UP control, L4 – ΔqueE DN, L5 – ΔqueE DN control. C) MUR2556: L1 – HEH marker, L2 – ΔqueG UP, L3 – ΔqueG UP control, L4 – ΔqueG DN, L5 – ΔqueG DN control; MUR2557: L6 – ΔqueG UP, L7 – ΔqueG UP control, L8 – ΔqueG DN, L9 – ΔqueG DN control, L10 – HEH marker; MUR2558: L11 – ΔqueD UP, L12 – ΔqueD UP control, L13 – ΔqueD DN, L14 – ΔqueD DN control; MUR2559: L15 – ΔqueD UP, L16 – ΔqueD UP control, L17 – ΔqueD DN, L18 – ΔqueD DN control, L19 – HEH marker.
Chapter 3 Results 95
Discussion
Chapter 4 Discussion 96
4.1 The Queuosine pathway and its role in the translational machinery
The specific pairing between mRNA codons to specific aminoacyl-tRNA anticodons enables accurate translation to occur as the ribosome progresses down a transcript. The codon- anticodon specificity and ribosomal grip provides the necessary precision for non-erroneous translation (Ling et al., 2015, Das & Lyngdoh, 2012). However, redundancy in the genetic code exists which is caused by the ‘wobble-position’ influence at the codon-anticodon wobble position (N34)(Grosjean & Westhof, 2016, Rozov et al., 2015).
One inducible change to the translational machinery that is incredibly diverse due to the number of different systems is provided by the tRNA modifications (Jackman & Alfonzo,
2013). It has been established through a comparison of modified tRNA species from archaea, bacteria, and eukarya that a core set of 18 ‘universal’ tRNA modifications are conserved across the three domains of life (Jackman & Alfonzo, 2013, Machnicka et al., 2013, Grosjean &
Westhof, 2016). A single tRNA modification may be deleted and still enable cell viability, but deletion of combinations of tRNA modification genes is lethal to cells. This suggests a redundancy in the system whereby loss of single modifications can be compensated for by the presence of others (Alexandrov et al., 2006, Jackman & Alfonzo, 2013). The effect of tRNA modification enables the correct reading frame to be maintained during translation and occasionally provides improved energy efficiency for binding (Noller & Baucom, 2002, Vinayak
& Pathak, 2009) and all contribute in some way to the efficiency and accuracy of translation
(Urbonavicius et al., 2001, Vinayak & Pathak, 2009, Maraia & Arimbasseri, 2017). The inducibility of tRNA modification systems provides a global effect on protein expression, unlike the typical stress response systems of bacteria, which induce specific groups of regulatory
Chapter 4 Discussion 97 proteins. One of the most important tRNA modifications known to occur in tRNA is the modification of queuosine (Q) into tRNA (Vinayak & Pathak, 2009).
4.2 The influence of the Q modification
The Q modified tRNA has been found to be present in all domains of life (Machnicka et al., 2013, Grosjean & Westhof, 2016, Jackman & Alfonzo, 2013). Although Q-tRNA has been found in all domains of life, only eubacteria are able to produce Q-tRNA de novo (Zallot et al.,
2017a). Other organisms that do not have a complete Q biosynthetic pathway depend on a salvage pathway to meet their requirements for Q-tRNA. This pathway requires the transport of queuine (q) into eukaryotic mitochondria by transporters of the DUF2419 protein family or transport of PreQ0 into bacterial cells by the transporter ‘YhhQ’ (Zallot et al., 2017b) to produce Q-tRNA (Fergus et al., 2015, Zallot et al., 2014). Synthesis of Q is initiated from the conversion of the of the nucleotide GTP into the precursor preQ1 which is then incorporated into the tRNA wobble position (G34) by either bacterial tRNA guanine transglycosylase (bTGT).
The preQ1 moiety is then further modified to produce Q-tRNA. This modification pathway is only required for the production of the Q-family of modified tRNAs (tRNAHis,Tyr,Asp,Asn) (Vinayak
& Pathak, 2009, Biela et al., 2013, Manna & Harman, 2016, Ehrenhofer-Murray, 2017).
It is important to consider the two sections of the Q-pathway (Thiaville et al., 2016,
Vinayak & Pathak, 2009). The first stage is the PreQ1 biosynthesis pathway which requires the folE, queCDE, and queF genes to produce the enzymes to synthesise PreQ1. The second stage is the Q-34-tRNA modification pathway which requires the tgt, queA, and queG genes to produce the enzymes required to make the final product Q-tRNA. It is important to differentiate the two components of the Q-pathway since: 1) the PreQ1 biosynthesis pathway
Chapter 4 Discussion 98 does not involve the tRNA molecule, 2) the expression of the queCDE genes is under stringent regulation by a PreQ1 riboswitch mechanism (McCown et al., 2014, Roth et al., 2007), 3) only eubacteria contain the complete PreQ1 biosynthesis pathway, and 4) The bacterial transporter, YhhQ, is known to directly influence the production of PreQ1 (Zallot et al., 2017b).
All organisms known to produce Q-tRNA show an improved binding efficiency for the codon-anticodon interaction, e.g. the modified Q-tRNAasp shows a stable and non-biased binding towards both corresponding codons (5’-GAC-3’ or 5’-GAU-3’) (Morris et al., 1999,
Muller et al., 2015). In contrast, the unmodified tRNA strongly preferred the GAC codon
(Muller et al., 2015) and had an unstable association with its alternative codon GAU. The Q- modification provides a reduction in binding specificity and improved binding efficiency without causing an increase in error rate (Vinayak & Pathak, 2009). For example, Q-tRNAs have been shown to suppress stop codons, e.g. the unmodified tRNATyr(G34) allows for stop codon readthrough, whereas Q-34-tRNATyr prevents it (Vinayak & Pathak, 2009). Furthermore, Q- tRNA has been shown to be essential for cell survival in stressful conditions (Noguchi et al.,
1982), bacterial virulence (Vinayak & Pathak, 2009), and recently for the establishment of an effective symbiotic relationship between the root nodule bacterium (RNB) Ensifer meliloti
1021 and the legume Medicago truncatula (Marchetti et al., 2013).
4.2.1 The Genomic Encyclopaedia for Bacteria and Archaea-Root nodulating Bacteria (GEBA-RNB) genome resource
The lack of available RNB genomes previously limited studies to “model” microsymbionts. The
GEBA-RNB sequencing project initiative broadened the number of genomes available to the
RNB community significantly (Reeve et al., 2015). This initiative, along with others, sequenced a total of 139 RNB genomes encompassing nine of the 16 currently validly described RNB
Chapter 4 Discussion 99 genera (Reeve et al., 2015). The strains sequenced included 13 type strains, elite inoculant strains of high commercial importance and strains with either a broad host range (BHR) and narrow host range (NHR) The strains were isolated from 69 different legume species, representing 39 taxonomically diverse genera, that were found growing in diverse biomes
(Reeve et al., 2015). These genomes can be used to investigate whether specific traits are localised with RNB specific groups or whether they are ubiquitous.
4.3 The Q-pathway is ubiquitous in the GEBA-RNB
The large scale bioinformatic analysis conducted in this study revealed that a complete Q- pathway was ubiquitous in the 139 GEBA-RNB genomes investigated. A comprehensive Q- pathway RNB database has been constructed, encompassing all the information to update the annotations of the GEBA-RNB genomes. The information contained within the database includes all of the genes within each strain, IMG unique accession numbers, the complete suite of proteins, identified protein domains and predicted protein functions.
During bioinformatic screening, it was evident that the queD and queF genes were poorly categorised, particularly in the M. sp. WSM3224, E. fredii HH103, E. meliloti MVII-I, GR4, and BL225C genomes. To date, the majority of genome-scale functional annotation pipelines have been developed in isolation from small-scale annotation efforts or experimental validation (Zallot et al., 2016). Specifically, orthology assignments are usually derived directly from sequence similarities from large datasets, because more exact approaches exhibit too high computational costs (Lechner et al., 2014). Q-pathway proteins such as QueD and QueF are routinely overlooked and occasionally mis-annotated as the protein paralogs PTTPS-II/III and FolE, respectively (Zallot et al., 2016).
Chapter 4 Discussion 100
Notably this study identified a queE ortholog designated queE2. This ortholog was discovered mostly in the Bradyrhizobium genus and encoded the QueE2 protein that appeared to be functionally indistinguishable from the ortholog QueE1 based on the protein domain similarity. Further analysis of the gene neighbourhoods revealed that the queE2D operon configuration was conserved with the typical queE1D operon configuration. To date the function of this orthologous protein has not been described in the literature. To elucidate the exact functional role of the potential ortholog, the identification of protein features such as post-translational modifications, subcellular localization, physical/chemical properties and enzyme assays could be used to help decipher protein function (Jensen et al., 2003). It would be useful to place the QueE1 and QueE2 proteins into phylogenetic context, as it will provide insight into the characteristic features of the resident organism, this may provide insight into the role of either protein (Kristensen et al., 2011). Functional role of the QueE orthologs could also be investigated using functional knockouts using the strategy outlined in this thesis. A suitable host for this purpose would be the BHR strains E. fredii USDA257 which contains both queE1 and queE2. A set of homologous recombination mutations targeting queE1, queE2, and both queE1 and E2, would help in this regard.
4.3.1 The NHR E. medicae WSM419 and the BHR E. fredii NGR234 both contain a complete Q- pathway
Both E. medicae WSM419 and E. fredii NGR234 were selected for further work in this study since they both contain the complete Q-pathway, they differ in their host range and each contain intrinsic antibiotic resistance profiles that make them suitable to genetic modification.
Chapter 4 Discussion 101
4.4 The Q-pathway is required for optimal growth of E. medicae WSM419
The established phenotypic effects of the E. medicae WSM419 ΔqueD and ΔqueE mutant derivatives reveal that QueD and QueE positively influence growth of E. medicae
WSM419 in both normal and stressful conditions (Fig 4.1). Notably, in all phenotypic assays for both queD and queE mutant derivatives, the difference in growth was conserved between them compared to the wild-type, with the only exception of MS profiles during volatile organic compound (VOC) assays, which is discussed later. To delineate the conserved phenotypic effects shown by queD and queE, it is important to consider the effects of the riboswitch (Kang et al., 2009). The highly sensitive (<10 nM) PreQ1 riboswitch negatively regulates the expression of the queCDE operon (McCown et al., 2014) and this may well occur in E. medicae
WSM419 as a conserved regulatory region typical of the PreQ1 riboswitch aptamer domain has been found. Excess PreQ1 binds to the small aptamer domain on the 5’UTR of the queC gene, causing transcription to halt, effectively inhibiting the expression of queCDE (Meyer et al., 2008, Klein et al., 2009, Roth et al., 2007, Van Vlack et al., 2017). Thus, queCDE will not be expressed until a sufficient amount of PreQo is salvaged via the YhhQ transporter, restoring
PreQ1 production (Zallot et al., 2017b). It is most likely that the conserved phenotypic effects established for the ΔqueD mutant derivative is due to a polar effect, causing the subsequent knockout of the queE gene
Chapter 4 Discussion 102
4.5 An intact Queuosine pathway is not required for E. medicae WSM419 cell viability even after prolonged stationary phase (PSP). 4.5.1 The absence of QueE causes slower growth.
The loss of the final step in the Q-pathway in synthesising Q-tRNA (ΔqueG), was found to not influence growth rate in broth cultures at optimal conditions. Surprisingly, a mutation in queE was found to affect the growth of E. medicae WSM419 cells. The functional role of QueE is not limited to the Q-pathway and has been found to modulate cell division of E. coli in response to cationic antimicrobial peptides. This response specifically requires the up-regulation of queE by the PhoQ/PhoP two-component system (Yadavalli et al., 2016) which recognises cationic antimicrobial peptides, low Mg2+, or Ca2+. The excess QueE can bind to the divisome and inhibit cell division and consequently increase filamentation (Yadavalli et al., 2016).
The TYC growth medium used in this study to culture Ensifer strains contains a low
Mg2+ and high Ca2+ concentration. Due to the high concentration of positively charged compounds and the inaccessibility of antimicrobial peptides, the effects of an anionic compound were tested. The anionic detergent SDS disrupts nearly all non-covalent interactions in native proteins and disrupts protein-protein and protein-lipid interactions
(Castro-Sowinski et al., 2002). Notably, the treatment of broth cultures with SDS reduced the growth of the queD and queE mutants by a factor of 8-fold compared to the wild-type. The growth of the queG mutant was reduced 2.5-fold compared to the wild-type, indicating that the Q-pathway is required for the typical growth of E. medicae WSM419 in the presence of an anionic detergent.
Chapter 4 Discussion 103
4.5.2 The ΔqueD and ΔqueE mutations impact copper tolerance
The Q-pathway has been associated with the ability to provide copper tolerance, in the
Gram-negative bacterium Pseudomonas. Particularly, the CinQ (queF) gene has been found to be induced during copper stress along with the yhhQ gene encoding the transporter, and disruption of CinQ has led to a slight decrease in copper tolerance (Quaranta et al., 2007,
Aguila-Clares et al., 2016). It is suspected that QueF might be necessary for fine-tuning the activation of the Cu2+ homeostatic machinery. The ΔqueD and ΔqueE mutants prevent the production of PreQ0, as such, the activity of QueF is strongly reduced, with the only source of
PreQ0 being obtained via YhhQ transporter.
PreQ0 plays an important role in stabilizing and tying together the functional multimeric enzyme structure, bridging the two halves of the active site for QueF activity
2+ (Swairjo et al., 2005). As such, the lack of PreQ0 may alter the ability for QueF to fine-tune Cu homeostasis.
Alternatively, diminished production of EPSI seen in ΔqueD and ΔqueE mutants causes an increased susceptibility to copper stress as EPS is known to contribute to metal resistance by a mechanism involving chelation (Mittelman & Geesey, 1985).
Chapter 4 Discussion 104
4.6 The disruption of queD and queE, but not queG, diminishes the ability for E. medicae WSM419 to produce succinoglycan (EPSI)
In many bacterial species, surface molecules such as EPS, are critical for the formation of a biofilm – a community of bacterial cells, adherent to a surface and to each other, and enclosed in a self-producing polymeric matrix (Fujishige et al., 2006). Once attached to a surface, bacterial microcolonies are established, and later, three-dimensional microbial communities of variable depth and architecture, which are frequently permeated by channels through which nutrients and water flow, are created (Stanley & Lazazzera, 2004). Biofilms are an essential life strategy for bacteria in natural environments, including the rhizosphere
(Fujishige et al., 2006).
Initial testing conducted in this study revealed an altered single colony morphology for the ΔqueD and ΔqueE mutant derivatives, specifically loss in the unique donut morphology typical of E. medicae WSM419. No loss in cellular dispersion or colony size was apparent, however the mucoid front exhibited an opaque mucoid front, indicative of a change in EPS production. Further testing was conducted on YMA containing calcofluor, which revealed a reduced amount fluorescence for the ΔqueDE mutant derivatives, indicating that the change in EPS production is specifically a diminished amount of EPSI that is produced compared to the wild-type (Lu & Cheng, 2010).
The 27 kb exo-exs gene cluster that contains 19 exo and 2 exs genes directs the biosynthesis of succinoglycan (EPSI)(Becker et al., 2002, Muller et al., 1993). Although the queCDE operon is not included in the EPSI operon, it is relatively nearby (~2 kbp).
Chapter 4 Discussion 105
It is speculated that the QueD and QueE genes positive regulate the production of EPSI.
Particularly, QueE regulation of EPSI can influence a number of phenotypic effects as EPS including biofilms formation, adhesion, bacterial cell aggregation, water retention, biofilm cohesion, nutrient acquisition, protective barrier formation, sorption of organic compounds and inorganic ions, export of cell components (Nwodo et al., 2012). The role of QueD and
QueE on EPSI biosynthesis in E. medicae WSM419 has been revealed through the treatment of bacterial cultures with a number of agents.
4.6.1 Osmotic stress tolerance
The production of EPSI is influenced by the osmolarity of the growth medium or the environment. It has been found that by increasing osmotic pressure via the addition of NaCl, a drastic increase in EPSI production is seen in E. meliloti SU-47 (Breedveld et al., 1990,
Niemeyer & Becker, 2001). The increased production of EPS1 allows the cell to produce a EPS matrix, keeping cells in the biofilm together (Flemming et al., 2007). In the case of soil growing rhizobia, the EPS matrix may slow the rate at which a bacterial colony equilibrates with the surrounding soil. In particular, the EPS matrix improves water retention and the EPS is found to retain several times its weight in water at low water potential (Roberson & Firestone, 1992).
Slowing the rate of drying within the colony microenvironment could increase bacterial survival by increasing the time available for metabolic adjustment (Roberson & Firestone,
1992).
As such, the production of EPSI is directly related to the ability for RNB to resist osmotic pressure. For the E. medicae WSM419 mutant derivative ΔqueE, the production of EPSI is impaired, and as a result, may cause a reduction in growth rate in high salt conditions.
Chapter 4 Discussion 106
4.7 An intact Queuosine pathway is not necessary for the successful establishment of a M. truncatula symbiotically fixing nodule
The establishment of an effective nitrogen fixing symbiosis between E.meliloti/medicae and
Medicago requires the presence of either LMW EPSI or LMW EPSII or both (Becker et al., 2002,
Wang et al., 1999). The results of this study reinforce this finding since E. medicae WSM419
ΔqueD and ΔqueE mutant derivatives which produced predominantly EPSII were fully capable of nodulating M. truncatula and fixing nitrogen. Of importance was the finding that the disruption of the Q-pathway (through ΔqueG, D and E mutations) of E. medicae WSM419 did not disrupt symbiotic proficiency with this host. This directly contradicts the finding by
Marchetti et al. 2013. that an intact Q-pathway is required for an effective symbiosis of an
Ensifer microsymbiont with M. truncatula.
The study conducted by Marchetti et al. 2013. identified profound symbiotic phenotypic defects for ΔqueF, ΔqueC and Δtgt E. meliloti 1021 mutants (the greatest effect was seen in the queF mutant) while no symbiotic effect was seen for a ΔqueA mutant. A number of items were not addressed by this study including:
1) E. meliloti 1021 is only able to synthesise EPSI. EPSII production is prevented in this strain since a native insertion element has disrupted the expR gene which is a positive regulator of EPSII biosynthesis (Janczarek, 2015). As such, only EPSI in a HMW and LMW form can be produced by E. meliloti 1021 and this is sufficient to enable infection of M. truncatula and the release of the invading cells from infection threads (Cheng & Walker, 1998, Leigh &
Lee, 1988, Zevenhuizen & van Neerven, 1983). The LMW fraction of EPSI (succinoglycan) is of particular interest because past studies have reported that the LMW form, rather than the
Chapter 4 Discussion 107
HMW form, is able to restore the ability of invasion-deficient E. meliloti mutants to invade nodules (Wang et al., 1999, Battisti et al., 1992).
2) E. meliloti 1021 microsymbiont used by Marchetti et al. 2013. is not optimised symbiotically for M. truncatula and displays a poor fixation rate compared to a microsymbiont such as E. medicae WSM419 (Terpolilli et al., 2012). The study by Marchetti et al. 2013. further identified that the Q-pathway mutations (except for a queA mutation) did not prevent the mutants from producing nodules but did compromise the ability of these mutants to fix nitrogen.
3) The ability to impact the expression of queCDE via riboswitching by altering the production of PreQ1 (McCown et al., 2014).
From this study, it can be concluded that queCDE (exsBCE) is intrinsically linked to the
EPSI biosynthesis pathway. As such, the phenotypic defects of queC mutant observed by
Marchetti et al. (2013) is most likely due to an impaired EPSI biosynthesis pathway and not the result of a loss of an intact Q-pathway as concluded in the paper. The Δbtgt mutant derivative would cause an increase in PreQ1 levels as the result of an interrupted Q- pathway
(Manna & Harman, 2016). The abundance of PreQ1 would repress the expression of queCDE through riboswitching. As a consequence, the amount of EPSI produced would be decreased but not abolished, reducing the rate of normal host invasion by E. meliloti 1021 mutants
(McCown et al., 2014, Cheng & Walker, 1998).
The queF gene is the only known biological example of a nitrile reductase which is able to convert PreQ0 into PreQ1 (Mohammad et al., 2017, Kim et al., 2010). A complete loss of
PreQ1 would occur in a ΔqueF mutant. As a result, there would be no repression by the PreQ1 riboswitch and the queCDE genes would be expressed enabling EPSI production to be
Chapter 4 Discussion 108 synthesised. The E. meliloti queF mutant was capable of nodulation but it was severely affected in the late stage of the symbioses with a defect in nodule symbiosome organization
(Marchetti et al., 2013). Analysis of the ΔqueF nodules found a sharp decrease in number of successfully infected cells, particularly in the central zone of the nodule, which is the zone associated with SNF (Vasse et al., 1990). The accumulation of aborted infections threads is indicative of impaired EPSI biosynthesis (Mendis et al., 2016). Unfortunately, the Marchetti et al. (2013) study did not provide the quantity of nodules and the colour of the observed nodules were not stated. This information would have provided further insight into how the nodule morphology was affected. It has been postulated that the production of higher than normal amounts of EPSI is detrimental in the invasion process (Wells et al., 2007) and this may be occurring in the queF mutant through a lack of riboswitch repression. However, another study demonstrates that over-production of EPSI in itself is not detrimental to the symbiosis with M. alfalfa (Jones, 2012) and, therefore, is unlikely to be a factor that contribute to symbiotic failure of the E. meliloti mutants. As such, without the information on nodule morphology in the paper of Marchetti et al. (2013), an explanation for the ΔqueF mutant derivative phenotype cannot be established.
Lastly, the ΔqueA mutant showed no phenotypic defect in symbioses, this indicates that the defects seen for all of these mutants is the result of altered EPSI biosynthesis and not due to a dysfunctional Q-pathway per se.
4.8 Disruption of queE impacts lipid biosynthesis in E. medicae WSM419
The E. medicae WSM419 ΔqueD and ΔqueE mutants grown in TYC could be distinguished from the wild-type by smell. The headspace of cultures of the mutant strains and the wild-type was
Chapter 4 Discussion 109 analysed using HS-GC-MS. The resulting MS profiles produced an entirely novel finding that the que mutants (particularly queE) produced an altered lipid profile. The ΔqueE mutation was particularly interesting in this regard since there was an overall increase in the production of long-chain fatty acids such as C14, C15, C16, C17, and C18 compared to the wild-type. Notably, there was a 20-fold increase in the saturated fatty acid hexadecanoic acid compared to the wild-type. Notably, the production of C18:1 was significantly less than that of C16:1 fatty acids, and C14:1 was moderately less than C16:1. The overexpression of the fabH gene in E. coli that encodes 3-oxoacyl-[acyl-carrier-protein] synthase 3 has been found to exhibit a similar fatty acid profile as seen in this study (Janßen & Steinbüchel, 2014, Cao et al., 2010). In the ΔfabH mutant there was an increase in C18 fatty acid, at the expense of C16 compared to the wild- type (Janßen & Steinbüchel, 2014, Cao et al., 2010). As such, the Q-pathway may be involved in lipid biosynthesis, specifically QueE acting to negatively regulate FabH production or its regulator FadR. Furthermore, the fadR gene (Janßen & Steinbüchel, 2014) encodes a regulatory protein which positively activates the transcription of fabA, fabB, and the operon fabHDG (My et al., 2013, Campbell & Cronan Jr, 2001, Tsay et al., 1992, Henry & Cronan Jr,
1991). The over-expression of fadR in a fatty acid-producing strain of E. coli increased the yield of saturated and unsaturated fatty acids significantly (Zhang et al., 2012).
The ΔqueE mutant long-chain fatty acid profile is similar to the profile obtained when the fadR gene was overexpressed, as such, QueE could be responsible for negatively regulating
FadR gene, alternatively QueE could be directly regulating FabH production.
Notably, the ΔqueD mutant derivative revealed an alternate fatty acid profile to that of ΔqueE. It was discussed earlier that the insertion mutation within queD gene could cause a polar effect on queE expression.
Chapter 4 Discussion 110
It has been shown through bioinformatic analyses that there is a conserved putative regulatory region (5’– GAAACAACGGCCGTTCGCGTCAGCGAGACGGCAAAGACCTGGGCGG–3’) located within E. medicae WSM419 queD and in close proximity to the start codon of queE.
This regulatory region (5’–CCGCCCTGTCCCTTGTCCCGTCTCGCGCCGCCAGTCAGCCGTTGTTTC–
3’) was also found upstream of pcsA (Smed_1420) which encodes a phosphotidylcholine synthase. Hence, queE expression could be controlled by an alternate regulatory system that would also regulate lipid membrane biosynthesis. It is proposed that during times of global stress, e.g. in stationary phase, it is possible that QueE expression could be up-regulated through this regulatory element thereby causing decreased expression of either FadR (a positive regulator of FabH) or FabH.
The effective regulation of fabH would cause an overall decrease in unsaturated fatty acid content in the cell (Janßen & Steinbüchel, 2014) causing a decrease in the unsaturated fatty acid content within the cell membrane in stationary phase cells. The ability for bacterial cells to grow in low temperatures has been established to be directly linked with the proportion of mono-unsaturated fatty acids found in the lipid membrane (Allen et al., 1999).
Particularly, R. leguminosarum bv. viciae has been shown to increase unsaturated fatty acid content significantly when the culture temperature was decreased (Théberge et al., 1996) and this was found to improve growth at low temperature.
Chapter 4 Discussion 111
4.9 The model of Q-pathway interactions and future directions
A model has now been constructed and presented to explain the relationship between the findings of this study and the components of the Q-pathway (Fig 4.1). One key finding of this study is that the Q-pathway is not necessary for a successful symbiosis between E. medicae
WSM419 and M. truncatula, which challenges the findings of Marchetti et al. (2013). The work conducted in this study provides an essential foundation to inactivate key que genes in the microsymbiont E. fredii NGR234 to establish if the Q-pathway is required for a successful symbiosis with a broader host range. The findings in this thesis also presents a new avenue for research into the role of que genes in lipid biosynthesis.
Chapter 4 Discussion 112
Figure 4.1. Model schematic of the functional role of the QueE protein in E. medicae WSM419. 1(Kingston et al., 2011), 2(Janßen & Steinbüchel, 2014), 3(My et al., 2013, Campbell & Cronan Jr, 2001, Tsay et al., 1992, Henry & Cronan Jr, 1991), 4(Yadavalli et al., 2016), 5(Janczarek, 2015)
Chapter 4 Discussion 113
Appendix
Appendix A 114
Appendix A
Table 1. All 139 GEBA-RNB organisms that have been screened using the JGI-IMG online database, with the fully catalogued genome E.coli K-12, E. meliloti 1021 and E. medicae WSM419 acting as reference for the sequencing of the Q-pathway constituents. All members of the GEBA-RNB have been found to contain the complete Q-pathway, with some members containing unannotated genes (shown in yellow), and most members containing either ‘QueE1’ or ‘QueE2’ except for USDA257 which contain both. Rhizobium Strain folE queD queE1 queE2 queC queF btgt queA queG Azorhizobium caulinodans ORS 571 1 1 0 1 1 1 1 1 2 Azorhizobium doebereinerae UFLA1-100 1 1 1 0 1 1 1 1 1 Bradyrhizobium elkanii USDA 3254 2 1 1 0 1 1 1 1 2 Bradyrhizobium elkanii USDA 3259 2 2 1 0 1 1 1 1 2 Bradyrhizobium elkanii USDA 76 2 2 1 0 1 1 1 1 2 Bradyrhizobium elkanii USDA 94 2 2 1 0 1 1 1 1 2 Bradyrhizobium elkanii WSM1741 2 2 0 1 1 1 1 1 1 Bradyrhizobium elkanii WSM2783 1 1 0 1 1 1 1 1 1 Bradyrhizobium genosp. SA-4 CB756 2 1 1 0 1 1 1 1 1 Bradyrhizobium japonicum USDA 110 1 1 1 0 1 1 1 1 1 Bradyrhizobium japonicum USDA 122 1 1 1 0 1 1 1 1 1 Bradyrhizobium japonicum USDA 124 1 1 0 1 1 1 1 1 1 Bradyrhizobium japonicum USDA 38 2 1 1 0 1 1 1 1 1 Bradyrhizobium japonicum USDA 4 2 1 1 0 1 1 1 1 1 Bradyrhizobium japonicum USDA 6 1 1 1 0 1 1 1 1 1 Bradyrhizobium sp. ARR65 1 1 0 1 1 1 1 1 1 Bradyrhizobium sp. Ai1a-2 1 3 1 0 1 1 1 1 1 Bradyrhizobium sp. BTAi1 2 1 0 1 1 1 1 1 1 Bradyrhizobium sp. Cp5.3 2 2 1 0 1 1 1 1 1 Bradyrhizobium sp. EC3.3 2 2 1 0 1 1 1 1 1 Bradyrhizobium sp. ORS 375 2 1 0 1 1 1 1 1 1 Bradyrhizobium sp. ORS278 2 1 0 1 1 1 1 1 1 Bradyrhizobium sp. ORS285 2 1 0 1 1 1 1 1 1 Bradyrhizobium sp. TV2a.2 1 1 1 0 1 1 1 1 2 Bradyrhizobium sp. Th.b2 1 2 1 0 1 1 1 1 1 Bradyrhizobium sp. USDA 3384 2 1 1 0 1 1 1 1 1 Bradyrhizobium sp. WSM1253 2 2 0 2 1 1 1 1 1 Bradyrhizobium sp. WSM1417 2 2 0 2 1 1 1 1 1 Bradyrhizobium sp. WSM1743 3 1 1 0 1 1 1 1 1 Bradyrhizobium sp. WSM2254 2 1 2 0 1 1 1 1 1 Bradyrhizobium sp. WSM2793 2 1 1 0 1 1 1 1 1 Bradyrhizobium sp. WSM3983 3 1 1 0 1 1 1 1 1 Bradyrhizobium sp. WSM4349 2 2 0 1 1 3 1 1 1 Bradyrhizobium sp. WSM471 2 2 0 2 1 1 1 1 1 Burkholderia sp. CCGE1002 1 1 1 0 1 1 1 1 1
Burkholderia sp. JPY251 2 1 2 0 1 1 1 1 1
Appendix A 115
Burkholderia sp. UYPR1.413 2 1 1 0 1 1 1 1 1 Burkholderia sp. WSM4176 2 1 1 0 1 1 1 1 1 Cupriavidus sp. AMP6 1 1 1 0 1 1 1 1 1 Cupriavidus sp. UYPR2.512 1 1 1 0 1 1 1 1 1 Cupriavidus taiwanensis LMG 19424 1 1 1 0 1 1 1 1 1 Cupriavidus taiwanensis STM6018 1 1 1 0 1 1 1 1 1 Cupriavidus taiwanensis STM6070 1 1 1 0 1 1 1 1 1 Ensifer sp. WSM1721 1 1 1 0 2 1 1 1 1 Ensifer sp. BR816 2 1 1 0 2 1 1 1 1 Ensifer sp. TW10 1 2 2 0 1 1 1 1 1 Ensifer sp. USDA 6670 2 1 1 0 1 1 1 1 1 Mesorhizobium amorphae CCNWGS0123 1 1 1 0 1 1 1 1 1 Mesorhizobium australicum WSM2073 1 1 1 0 2 1 1 1 1 Mesorhizobium ciceri CMG6 1 1 1 0 1 1 1 1 1 Mesorhizobium ciceri WSM4083 1 1 2 0 1 1 1 1 1 Mesorhizobium ciceri bv. biserrulae WSM1271 1 2 1 0 1 1 1 1 1 Mesorhizobium loti CJ3sym 1 2 2 0 2 1 1 1 1 Mesorhizobium loti MAFF303099 1 2 1 0 2 1 1 1 1 Mesorhizobium loti NZP2037 1 2 1 0 2 2 1 1 1 Mesorhizobium loti R7A 1 3 2 0 2 2 1 1 1 Mesorhizobium loti R88b 1 3 2 0 2 2 1 1 1 Mesorhizobium loti USDA 3471 1 4 3 0 3 1 1 1 1 Mesorhizobium opportunistum WSM2075 1 1 1 0 2 1 1 1 1 Mesorhizobium sp. WSM1293 1 1 1 0 1 1 1 1 1 Mesorhizobium sp. WSM2561 1 1 1 0 2 1 1 2 1 Mesorhizobium sp. WSM3224 1 1 0 1 1 1 1 1 1 Mesorhizobium sp. WSM3626 1 1 1 0 1 1 1 1 1 Methylobacterium nodulans ORS 2060 3 2 1 0 2 1 1 1 1 Methylobacterium sp. 4-46 1 1 0 1 1 1 1 1 2 Methylobacterium sp. WSM2598 1 1 0 1 1 1 1 1 2 Microvirga lotononidis WSM3557 1 2 2 0 4 1 1 1 1 Microvirga lupini Lut6 3 1 0 1 3 1 1 1 1 Paraburkholderia dilworthii WSM3556 1 1 1 0 1 1 1 1 1 Paraburkholderia mimosarum LMG 23256 2 1 0 1 1 1 1 1 1 Paraburkholderia mimosarum STM3621 1 1 0 1 1 1 1 1 1 Paraburkholderia nodosa DSM 21604 1 1 0 1 1 1 1 1 1 Paraburkholderia phenoliruptrix BR3459 1 1 2 0 1 1 1 1 1 Paraburkholderia phymatum STM815 1 1 2 0 1 1 1 1 1 Paraburkholderia sprentiae WSM5005 1 1 1 0 1 1 1 1 1 Paraburkholderia tuberum STM678 2 1 2 0 1 1 1 1 1 Rhizobium etli CFN 42, DSM 11541 1 1 1 0 1 1 1 2 1 Rhizobium etli CIAT 652 1 1 1 0 2 1 1 1 1 Rhizobium grahamii CCGE 502 1 1 1 0 1 1 1 1 1
Appendix A 116
Rhizobium leguminosarum bv. phaseoli 4292 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. phaseoli FA23 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii CB782 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii CC278f 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii CC283b 2 1 2 0 2 1 1 1 1 Rhizobium leguminosarum bv. trifolii SRDI565 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii SRDI943 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii TA1 1 1 1 0 1 1 2 2 1 Rhizobium leguminosarum bv. trifolii WSM1325 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii WSM1689 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii WSM2012 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii WSM2297 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii WSM2304 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. trifolii WSM597 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae 128C53 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae 248 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae 3841 2 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae GB30 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae Ps8 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae TOM 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae UPM1131 1 1 1 0 2 1 1 1 1 Rhizobium leguminosarum bv. viciae UPM1137 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae VF39 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae Vc2 2 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae Vh3 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae WSM1455 1 1 1 0 1 1 1 1 1 Rhizobium leguminosarum bv. viciae WSM1481 1 1 1 0 1 1 1 1 1 Rhizobium leucaenae USDA 9039 1 1 1 0 1 1 1 2 1 Rhizobium mesoamericanum STM3625 1 1 1 0 1 1 1 2 1 Rhizobium mesoamericanum STM6155 1 1 1 0 1 1 1 2 1 Rhizobium mongolense USDA 1844 1 1 1 0 1 1 1 1 1 Rhizobium sp. OR 191 1 1 1 0 1 1 1 2 1 Rhizobium sullae WSM1592 2 1 1 0 1 1 1 2 1 Rhizobium tropici CIAT899 2 1 1 0 1 1 1 1 1 Sinorhizobium arboris LMG 14919 1 1 1 0 2 1 1 1 1 Sinorhizobium fredii GR64 1 1 1 0 1 1 1 1 1 Sinorhizobium fredii HH103 1 1 1 0 1 1 1 1 1 Sinorhizobium fredii NGR234 1 1 1 0 1 1 1 1 1 Sinorhizobium fredii USDA 257 1 2 1 1 2 1 1 1 1 Sinorhizobium medicae DI28 1 1 1 0 1 1 1 1 1 Sinorhizobium medicae WSM1115 1 1 1 0 1 1 1 1 1 Sinorhizobium medicae WSM1369 1 1 1 0 1 1 1 1 1 Sinorhizobium medicae WSM244 1 1 1 0 1 1 1 1 1
Appendix A 117
Sinorhizobium medicae WSM419 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti 1021 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti 4H41 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti AK58 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti AK83 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti BL225C 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti BO21CC 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti CCNWSX0020 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti CIAM1775 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti GR4 1 1 1 0 1 1 1 2 1 Sinorhizobium meliloti GVPV12 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti MVII-I 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti Mlalz-1 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti RRI128 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti SM11 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti WSM1022 1 1 1 0 1 1 1 1 1 Sinorhizobium meliloti WSM4191 1 1 1 0 1 1 1 1 1
Table 2. All RNB which did not contain the queE1 gene. Bolded is the Bradyrhizobium sp. BTAi1, which was
used as the reference genome in order to find all other strains contained within the tables queE2. Strain Azorhizobium caulinodans ORS 571
Bradyrhizobium elkanii WSM1741
Bradyrhizobium elkanii WSM2783
Bradyrhizobium japonicum USDA 124
Bradyrhizobium sp. ARR65
Bradyrhizobium sp. BTAi1
Bradyrhizobium sp. ORS 375
Bradyrhizobium sp. ORS278
Bradyrhizobium sp. ORS285
Bradyrhizobium sp. WSM1253
Bradyrhizobium sp. WSM1417
Bradyrhizobium sp. WSM4349
Bradyrhizobium sp. WSM471
Paraburkholderia mimosarum LMG 23256
Paraburkholderia mimosarum STM3621
Paraburkholderia nodosa DSM 21604
Mesorhizobium sp. WSM3224
Methylobacterium sp. 4-46
Methylobacterium sp. WSM2598
Microvirga lupini Lut6
Appendix A 118
Appendix B Ensifer medicae WSM419 CDD result for all Q-genes
FolE full CDD result
QueD full CDD result
QueE1 full CDD result
Appendix B 119
QueC full CDD result
QueF full CDD result
bTGT full CDD result
QueA full CDD result
QueG full CDD result
Appendix B 120
Ensifer fredii NGR234 CDD result for all Q-genes FolE full CDD result
QueD full CDD result
QueE1 full CDD result
QueC full CDD result
Appendix B 121
QueF full CDD result
bTGT full CDD result
QueA full CDD result
QueG full CDD result
Appendix B 122
Appendix C
Image 1. Addition of 0.5% SDS to replicate 1 for each 5mL TY(C) broth cultures + 700 µM CuSO4 of E. medicae WSM419 strains at stationary phase after 15min wait: Wild-type – tube 6, ΔQueG rep 1 – tube 11, ΔQueG rep 2 – tube 17, ΔQueD rep 1 – tube 13, ΔQueD rep 2 – tube 18, ΔQueE rep 1 – tube 49, ΔQueE rep 2 – tube 49.
Image 2. 24 hrs of incubation and shaking at 28 oC after adding 0.5% SDS to all 5mL TY(C) broth cultures
+ 700 µM CuSO4 E. medicae WSM419 strains. Wild-type – tube 6, ΔQueG rep 1 – tube 11, ΔQueG rep 2 – tube 17, ΔQueD rep 1 – tube 13, ΔQueD rep 2 – tube 18, ΔQueE rep 1 – tube 49, ΔQueE rep 2 – tube 49.
Appendix C 123
Table 1. YMA recipe list for 3.024 YMA, Vincent YMA, and a range of permutations to cover the range of reagents used between the two YMA media.
Reagent 3.024 1 2 3 4 Vincent D-glucose 3g/L 3g/L 6g/L 10g/L - - Mannitol 2g/L 2g/L 4g/L - 10g/L 10g/L Yeast extract 1g/L 1g/L 1g/L 1g/L 1g/L 1g/L
K2HPO4 0.5g/L 0.5g/L 0.5g/L 0.5g/L 0.5g/L 0.5g/L
MgSO4.7H20 0.2g/L 0.2g/L 0.2g/L 0.2g/L 0.2g/L 0.2g/L NaCl 0.1g/L 0.1g/L 0.1g/L 0.1g/L 0.1g/L 0.1g/L
CaSO4.2H20 0.05g/L 0.05g/L 0.05g/L 0.05g/L 0.05g/L 0.05g/L
NH4Cl 0.1g/L 0g/L - - 0.1g/L - Agar 15g/L 15g/L 15g/L 15g/L 15g/L 15g/L
Appendix C 124
A B
1mm
1mm D C
1m
1mm
E F
1mm
1mm
Figure 1. Single colony morphology for wild-type E. medicae WSM419 on several YMA recipes. A)
3.024 YMA. B) Vincent, C) 3.024 YMA -NH4Cl, D) Vincent YMA -NH4Cl, E) Vincent YMA (6g Glucose, 4g Mannitol), F) Vincent YMA (10g Glucose, -Mannitol).
Appendix C 125
References
Agris, P.F. (2008) Bringing order to translation: the contributions of transfer RNA anticodon-domain modifications. EMBO Rep 9: 629-635. Aguila-Clares, B., Castiblanco, L.F., Quesada, J.M., Penyalver, R., Carbonell, J., Lopez, M.M., Marco- Noales, E., and Sundin, G.W. (2016) Transcriptional response of Erwinia amylovora to copper shock: in vivo role of the copA gene. Mol Plant Pathol. Alexandrov, A., Chernyakov, I., Gu, W., Hiley, S.L., Hughes, T.R., Grayhack, E.J., and Phizicky, E.M. (2006) Rapid tRNA Decay Can Result from Lack of Nonessential Modifications. Molecular Cell 21: 87- 96. Allen, E.E., Facciotti, D., and Bartlett, D.H. (1999) Monounsaturated but not polyunsaturated fatty acids are required for growth of the deep-sea bacterium Photobacterium profundum SS9 at high pressure and low temperature. Applied and Environmental Microbiology 65: 1710-1720. Andersson, S.G., and Kurland, C.G. (1990) Codon preferences in free-living microorganisms. Microbiol Rev 54: 198-210. Balasubramanian, R., Seetharamulu, P., and Raghunathan, G. (1980) A Conformational Rationale for the Absence of Adenine in the Wobble Position in Anticodons. J Mol Evol 17: 27-30. Battisti, L., Lara, J.C., and Leigh, J.A. (1992) Specific oligosaccharide form of the Rhizobium meliloti exopolysaccharide promotes nodule invasion in alfalfa. Proc Natl Acad Sci U S A 89: 5625-5629. Becker, A., Ruberg, S., Baumgarth, B., Bertram-Drogatz, P.A., Quester, I., and Puhler, A. (2002) Regulation of succinoglycan and galactoglucan biosynthesis in Sinorhizobium meliloti. J Mol Microbiol Biotechnol 4: 187-190. Bell, E.A., Boehnke, P., Harrison, T.M., and Mao, W.L. (2015) Potentially biogenic carbon preserved in a 4.1 billion-year-old zircon. Proceedings of the National Academy of Sciences 112: 14518- 14521. Biela, I., Tidten-Luksch, N., Immekus, F., Glinca, S., Nguyen, T.X., Gerber, H.D., Heine, A., Klebe, G., and Reuter, K. (2013) Investigation of specificity determinants in bacterial tRNA-guanine transglycosylase reveals queuine, the substrate of its eucaryotic counterpart, as inhibitor. PLoS One 8: e64240. Bloom-Ackermann, Z., Navon, S., Gingold, H., Towers, R., Pilpel, Y., and Dahan, O. (2014) A comprehensive tRNA deletion library unravels the genetic architecture of the tRNA pool. PLoS Genet 10: e1004084. Bock, A., and Thanbichler, M. (2004) Selenocysteine. EcoSal Plus 1. Breedveld, M., Zevenhuizen, L., and Zehnder, A. (1990) Osmotically induced oligo-and polysaccharide synthesis by Rhizobium meliloti SU-47. Microbiology 136: 2511-2519. Brooks, A.F., Velez-Martinez, C.S., Showalter, H.D., and Garcia, G.A. (2012) Investigating the prevalence of queuine in Escherichia coli RNA via incorporation of the tritium-labeled precursor, preQ(1). Biochem Biophys Res Commun 425: 83-88. Bruender, N.A., Grell, T.A., Dowling, D.P., McCarty, R.M., Drennan, C.L., and Bandarian, V. (2017) 7- Carboxy-7-deazaguanine Synthase: A Radical S-Adenosyl-l-methionine Enzyme with Polar Tendencies. J Am Chem Soc 139: 1912-1920. Bulmer, M. (1991) The selection-mutation-drift theory of synonymous codon usage. Genetics 129: 897- 907. Campbell, J.W., and Cronan Jr, J.E. (2001) Bacterial fatty acid biosynthesis: targets for antibacterial drug discovery. Annual Reviews in Microbiology 55: 305-332. Cantara, W.A., Crain, P.F., Rozenski, J., McCloskey, J.A., Harris, K.A., Zhang, X., Vendeix, F.A., Fabris, D., and Agris, P.F. (2011) The RNA Modification Database, RNAMDB: 2011 update. Nucleic Acids Res 39: D195-201.
References 126
Cao, Y., Yang, J., Xian, M., Xu, X., and Liu, W. (2010) Increasing unsaturated fatty acid contents in Escherichia coli by coexpression of three different genes. Applied microbiology and biotechnology 87: 271-280. Castro-Sowinski, S., Martinez-Drets, G., and Okon, Y. (2002) Laccase activity in melanin-producing strains of Sinorhizobium meliloti. FEMS Microbiol Lett 209: 119-125. Cheng, H.P., and Walker, G.C. (1998) Succinoglycan is required for initiation and elongation of infection threads during nodulation of alfalfa by Rhizobium meliloti. J Bacteriol 180: 5183-5191. Cicmil, N., and Shi, L. (2008) Crystallization and preliminary X-ray characterization of queD from Bacillus subtilis, an enzyme involved in queuosine biosynthesis. Acta Crystallogr Sect F Struct Biol Cryst Commun 64: 119-122. Crick, F.H. (1966) Codon--anticodon pairing: the wobble hypothesis. J Mol Biol 19: 548-555. Das, G., and Lyngdoh, R.H. (2012) Role of wobble base pair geometry for codon degeneracy: purine- type bases at the anticodon wobble position. J Mol Model 18: 3805-3820. Demeshkina, N., Jenner, L., Westhof, E., Yusupov, M., and Yusupova, G. (2012) A new understanding of the decoding principle on the ribosome. Nature 484: 256-259. Dineshukumar, T., Thanedar, S. An unexpected absence of queuosine modification in the tRNAs of an Escherichia coli B strain.pdf>. Dixon, R., and Kahn, D. (2004) Genetic regulation of biological nitrogen fixation. Nat Rev Microbiol 2: 621-631. Downie, J.A. (1994) Signalling strategies for nodulation of legumes by rhizobia. Trends in Microbiology 2: 318-324. Downie, J.A., (1998) Functions of rhizobial nodulation genes, p. 387-402. Doyle, J.J. (2011) Phylogenetic perspectives on the origins of nodulation. Mol Plant Microbe Interact 24: 1289-1295. Durand, J.M., Dagberg, B., Uhlin, B.E., and Bjork, G.R. (2000) Transfer RNA modification, temperature and DNA superhelicity have a common target in the regulatory network of the virulence of Shigella flexneri: the expression of the virF gene. Mol Microbiol 35: 924-935. Ehrenhofer-Murray, A.E. (2017) Cross-Talk between Dnmt2-Dependent tRNA Methylation and Queuosine Modification. Biomolecules 7. Fergus, C., Barnes, D., Alqasem, M.A., and Kelly, V.P. (2015) The queuine micronutrient: charting a course from microbe to man. Nutrients 7: 2897-2929. Finan, T.M., Kunkel, B., De Vos, G.F., and Signer, E.R. (1986) Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes. Journal of bacteriology 167: 66-72. Flemming, H.C., Neu, T.R., and Wozniak, D.J. (2007) The EPS matrix: the "house of biofilm cells". J Bacteriol 189: 7945-7947. Frey, B., McCloskey, J., Kersten, W., and Kersten, H. (1988) New function of vitamin B12: cobamide- dependent reduction of epoxyqueuosine to queuosine in tRNAs of Escherichia coli and Salmonella typhimurium. J Bacteriol 170: 2078-2082. Fujishige, N.A., Kapadia, N.N., De Hoff, P.L., and Hirsch, A.M. (2006) Investigations of Rhizobium biofilm formation. FEMS Microbiol Ecol 56: 195-206. Gage, D.J. (2004) Infection and invasion of roots by symbiotic, nitrogen-fixing rhizobia during nodulation of temperate legumes. Microbiol Mol Biol Rev 68: 280-300. Gage, D.J., and Margolin, W. (2000) Hanging by a thread: invasion of legume plants by rhizobia. Curr Opin Microbiol 3: 613-617. Giovannoni, S.J., Cameron Thrash, J., and Temperton, B. (2014) Implications of streamlining theory for microbial ecology. ISME J 8: 1553-1565. Grosjean, H., de Crecy-Lagard, V., and Marck, C. (2010) Deciphering synonymous codons in the three domains of life: co-evolution with specific tRNA modification enzymes. FEBS Lett 584: 252-264.
References 127
Grosjean, H., and Westhof, E. (2016) An integrated, structure- and energy-based view of the genetic code. Nucleic Acids Res 44: 8020-8040. Grzymski, J.J., and Dussaq, A.M. (2012) The significance of nitrogen cost minimization in proteomes of marine microorganisms. ISME J 6: 71-80. Henry, M.F., and Cronan Jr, J.E. (1991) Escherichia coli transcription factor that both activates fatty acid synthesis and represses fatty acid degradation. Journal of molecular biology 222: 843-849. Hodgeson, D.A., and Thomas, C.M., (2002) Signals, switches, regulons and cascades: control of bacterial gene expression. University Press, Cambridge, United Kingdom. Howieson, J., and Ewing, M. (1986) Acid tolerance in the Rhizobium meliloti–Medicago symbiosis. Australian Journal of Agricultural Research 37: 55-64. Howieson, J.G., and Dilworth, M.J., (2016) Working with rhizobia. Australian Centre for International Agricultural Research (ACIAR), Australia. Hurt, J.K., Olgen, S., and Garcia, G.A. (2007) Site-specific modification of Shigella flexneri virF mRNA by tRNA-guanine transglycosylase in vitro. Nucleic Acids Res 35: 4905-4913. Hutinet, G., Swarjo, M.A., and de Crecy-Lagard, V. (2016) Deazaguanine derivatives, examples of crosstalk between RNA and DNA modification pathways. RNA Biol: 1-10. Jackman, J.E., and Alfonzo, J.D. (2013) Transfer RNA modifications: nature's combinatorial chemistry playground. Wiley Interdiscip Rev RNA 4: 35-48. Janczarek, M. (2015) Exopolysaccharide Production in Rhizobia Is Regulated by Environmental Factors. Biological nitrogen fixation: 365-380. Janßen, H.J., and Steinbüchel, A. (2014) Fatty acid synthesis in Escherichia coli and its applications towards the production of fatty acid based biofuels. Biotechnology for biofuels 7: 7. Javid, B., Sorrentino, F., Toosky, M., Zheng, W., Pinkham, J.T., Jain, N., Pan, M., Deighan, P., and Rubin, E.J. (2014) Mycobacterial mistranslation is necessary and sufficient for rifampicin phenotypic resistance. Proc Natl Acad Sci U S A 111: 1132-1137. Jenner, L., Demeshkina, N., Yusupova, G., and Yusupov, M. (2010) Structural rearrangements of the ribosome at the tRNA proofreading step. Nat Struct Mol Biol 17: 1072-1078. Jensen, L.J., Ussery, D.W., and Brunak, S. (2003) Functionality of system components: conservation of protein function in protein feature space. Genome Res 13: 2444-2449. Jones, D.L. (1998) Organic acids in the rhizosphere – a critical review. Plant and Soil 205: 25-44. Jones, K.M. (2012) Increased production of the exopolysaccharide succinoglycan enhances Sinorhizobium meliloti 1021 symbiosis with the host plant Medicago truncatula. J Bacteriol 194: 4322-4331. Kang, M., Peterson, R., and Feigon, J. (2009) Structural Insights into riboswitch control of the biosynthesis of queuosine, a modified nucleotide found in the anticodon of tRNA. Mol Cell 33: 784-790. Kim, Y., Zhou, M., Moy, S., Morales, J., Cunningham, M.A., and Joachimiak, A. (2010) High-resolution structure of the nitrile reductase QueF combined with molecular simulations provide insight into enzyme mechanism. J Mol Biol 404: 127-137. Kim, Y.H., Hwang, J.H., Kim, K.S., Noh, J.R., Gang, G.T., Oh, W.K., Jeong, K.H., Kwak, T.H., Choi, H.S., Lee, I.K., and Lee, C.H. (2014) Enhanced activation of NAD(P)H: quinone oxidoreductase 1 attenuates spontaneous hypertension by improvement of endothelial nitric oxide synthase coupling via tumor suppressor kinase liver kinase B1/adenosine 5'-monophosphate-activated protein kinase-mediated guanosine 5'-triphosphate cyclohydrolase 1 preservation. J Hypertens 32: 306-317. Klein, D.J., Edwards, T.E., and Ferre-D'Amare, A.R. (2009) Cocrystal structure of a class I preQ1 riboswitch reveals a pseudoknot recognizing an essential hypermodified nucleobase. Nat Struct Mol Biol 16: 343-344. Klepper, F., Jahn, E.M., Hickmann, V., and Carell, T. (2007) Synthesis of the transfer-RNA nucleoside queuosine by using a chiral allyl azide intermediate. Angew Chem Int Ed Engl 46: 2325-2327.
References 128
Kouchi, H., Imaizumi-Anraku, H., Hayashi, M., Hakoyama, T., Nakagawa, T., Umehara, Y., Suganuma, N., and Kawaguchi, M. (2010) How many peas in a pod? Legume genes responsible for mutualistic symbioses underground. Plant Cell Physiol 51: 1381-1397. Kouchi, H., Shimomura, K., Hata, S., Hirota, A., Wu, G.J., Kumagai, H., Tajima, S., Suganuma, N., Suzuki, A., Aoki, T., Hayashi, M., Yokoyama, T., Ohyama, T., Asamizu, E., Kuwata, C., Shibata, D., and Tabata, S. (2004) Large-scale analysis of gene expression profiles during early stages of root nodule formation in a model legume, Lotus japonicus. DNA Res 11: 263-274. Kristensen, D.M., Wolf, Y.I., Mushegian, A.R., and Koonin, E.V. (2011) Computational methods for Gene Orthology inference. Brief Bioinform 12: 379-391. Krzycki, J.A. (2005) The direct genetic encoding of pyrrolysine. Curr Opin Microbiol 8: 706-712. Lechner, M., Hernandez-Rosales, M., Doerr, D., Wieseke, N., Thevenin, A., Stoye, J., Hartmann, R.K., Prohaska, S.J., and Stadler, P.F. (2014) Orthology detection combining clustering and synteny for very large datasets. PLoS One 9: e105015. Lee, S.G., Krishnan, H.B., and Jez, J.M. (2014) Structural basis for regulation of rhizobial nodulation and symbiosis gene expression by the regulatory protein NolR. Proc Natl Acad Sci U S A 111: 6509- 6514. Leigh, J.A., and Lee, C.C. (1988) Characterization of polysaccharides of Rhizobium meliloti exo mutants that form ineffective nodules. Journal of bacteriology 170: 3327-3332. Lerouge, P., Roche, P., Faucher, C., Maillet, F., Truchet, G., Prome, J.C., and Denarie, J. (1990) Symbiotic host-specificity of Rhizobium meliloti is determined by a sulphated and acylated glucosamine oligosaccharide signal. Nature 344: 781-784. Li, M., and Tzagoloff, A. (1979) Assembly of the mitochondrial membrane system: sequences of yeast mitochondrial valine and an unusual threonine tRNA gene. Cell 18: 47-53. Lim, V.I., and Venclovas, C. (1992) Codon-anticodon pairing. A model for interacting codon-anticodon duplexes located at the ribosomal A- and P-sites. FEBS Lett 313: 133-137. Ling, J., O'Donoghue, P., and Soll, D. (2015) Genetic code flexibility in microorganisms: novel mechanisms and impact on physiology. Nat Rev Microbiol 13: 707-721. Lu, H.Y., and Cheng, H.P. (2010) Autoregulation of Sinorhizobium meliloti exoR gene expression. Microbiology 156: 2092-2101. Machnicka, M.A., Milanowska, K., Osman Oglou, O., Purta, E., Kurkowska, M., Olchowik, A., Januszewski, W., Kalinowski, S., Dunin-Horkawicz, S., Rother, K.M., Helm, M., Bujnicki, J.M., and Grosjean, H. (2013) MODOMICS: a database of RNA modification pathways--2013 update. Nucleic Acids Res 41: D262-267. Macino, G., Coruzzi, G., Nobrega, F.G., Li, M., and Tzagoloff, A. (1979) Use of the UGA terminator as a tryptophan codon in yeast mitochondria. Proc Natl Acad Sci U S A 76: 3784-3785. Manna, S., and Harman, A. (2016) Horizontal gene transfer of a Chlamydial tRNA-guanine transglycosylase gene to eukaryotic microbes. Mol Phylogenet Evol 94: 392-396. Maraia, R.J., and Arimbasseri, A.G. (2017) Factors That Shape Eukaryotic tRNAomes: Processing, Modification and Anticodon-Codon Use. Biomolecules 7. Marchetti, M., Capela, D., Poincloux, R., Benmeradi, N., Auriac, M.C., Le Ru, A., Maridonneau-Parini, I., Batut, J., and Masson-Boivin, C. (2013) Queuosine biosynthesis is required for Sinorhizobium meliloti-induced cytoskeletal modifications on HeLa Cells and symbiosis with Medicago truncatula. PLoS One 8: e56043. Marck, C., and Grosjean, H. (2002) tRNomics: analysis of tRNA genes from 50 genomes of Eukarya, Archaea, and Bacteria reveals anticodon-sparing strategies and domain-specific features. RNA 8: 1189-1232. Mathews, I., Schwarzenbacher, R., McMullan, D., Abdubek, P., Ambing, E., Axelrod, H., Biorac, T., Canaves, J.M., Chiu, H.J., Deacon, A.M., DiDonato, M., Elsliger, M.A., Godzik, A., Grittini, C., Grzechnik, S.K., Hale, J., Hampton, E., Han, G.W., Haugen, J., Hornsby, M., Jaroszewski, L., Klock, H.E., Koesema, E., Kreusch, A., Kuhn, P., Lesley, S.A., Levin, I., Miller, M.D., Moy, K.,
References 129
Nigoghossian, E., Ouyang, J., Paulsen, J., Quijano, K., Reyes, R., Spraggon, G., Stevens, R.C., van den Bedem, H., Velasquez, J., Vincent, J., White, A., Wolf, G., Xu, Q., Hodgson, K.O., Wooley, J., and Wilson, I.A. (2005) Crystal structure of S-adenosylmethionine:tRNA ribosyltransferase- isomerase (QueA) from Thermotoga maritima at 2.0 A resolution reveals a new fold. Proteins 59: 869-874. McCarty, R.M., Somogyi, A., Lin, G., Jacobsen, N.E., and Bandarian, V. (2009) The deazapurine biosynthetic pathway revealed: in vitro enzymatic synthesis of PreQ(0) from guanosine 5'- triphosphate in four steps. Biochemistry 48: 3847-3852. McCown, P.J., Liang, J.J., Weinberg, Z., and Breaker, R.R. (2014) Structural, functional, and taxonomic diversity of three preQ1 riboswitch classes. Chem Biol 21: 880-889. Mendis, H.C., Madzima, T.F., Queiroux, C., and Jones, K.M. (2016) Function of Succinoglycan Polysaccharide in Sinorhizobium meliloti Host Plant Invasion Depends on Succinylation, Not Molecular Weight. MBio 7. Mergaert, P., Nikovics, K., Kelemen, Z., Maunoury, N., Vaubert, D., Kondorosi, A., and Kondorosi, E. (2003) A novel family in Medicago truncatula consisting of more than 300 nodule-specific genes coding for small, secreted polypeptides with conserved cysteine motifs. Plant Physiology 132: 161-173. Mergaert, P., Uchiumi, T., Alunni, B., Evanno, G., Cheron, A., Catrice, O., Mausset, A.E., Barloy-Hubler, F., Galibert, F., Kondorosi, A., and Kondorosi, E. (2006) Eukaryotic control on bacterial cell cycle and differentiation in the Rhizobium-legume symbiosis. Proc Natl Acad Sci U S A 103: 5230- 5235. Metcalf, W.W., Jiang, W., Daniels, L.L., Kim, S.K., Haldimann, A., and Wanner, B.L. (1996) Conditionally replicative and conjugative plasmids carrying lacZ alpha for cloning, mutagenesis, and allele replacement in bacteria. Plasmid 35: 1-13. Meyer, M.M., Roth, A., Chervin, S.M., Garcia, G.A., and Breaker, R.R. (2008) Confirmation of a second natural preQ1 aptamer class in Streptococcaceae bacteria. RNA 14: 685-695. Miles, Z.D., Myers, W.K., Kincannon, W.M., Britt, R.D., and Bandarian, V. (2015) Biochemical and Spectroscopic Studies of Epoxyqueuosine Reductase: A Novel Iron-Sulfur Cluster- and Cobalamin-Containing Protein Involved in the Biosynthesis of Queuosine. Biochemistry 54: 4927-4935. Mittelman, M.W., and Geesey, G.G. (1985) Copper-binding characteristics of exopolymers from a freshwater-sediment bacterium. Appl Environ Microbiol 49: 846-851. Mohammad, A., Bon Ramos, A., Lee, B.W., Cohen, S.W., Kiani, M.K., Iwata-Reuyl, D., Stec, B., and Swairjo, M.A. (2017) Protection of the Queuosine Biosynthesis Enzyme QueF from Irreversible Oxidation by a Conserved Intramolecular Disulfide. Biomolecules 7. Morris, R.C., Brown, K.G., and Elliott, M.S. (1999) The effect of queuosine on tRNA structure and function. J Biomol Struct Dyn 16: 757-774. Moulin, L., Munive, A., Dreyfus, B., and Boivin-Masson, C. (2001) Nodulation of legumes by members of the beta-subclass of Proteobacteria. Nature 411: 948-950. Muller, M., Hartmann, M., Schuster, I., Bender, S., Thuring, K.L., Helm, M., Katze, J.R., Nellen, W., Lyko, F., and Ehrenhofer-Murray, A.E. (2015) Dynamic modulation of Dnmt2-dependent tRNA methylation by the micronutrient queuine. Nucleic Acids Res 43: 10952-10962. Muller, P., Keller, M., Weng, W.M., Quandt, J., Arnold, W., and Puhler, A. (1993) Genetic analysis of the Rhizobium meliloti exoYFQ operon: ExoY is homologous to sugar transferases and ExoQ represents a transmembrane protein. Mol Plant Microbe Interact 6: 55-65. Murphy, F.V.t., and Ramakrishnan, V. (2004) Structure of a purine-purine wobble base pair in the decoding center of the ribosome. Nat Struct Mol Biol 11: 1251-1252. Murphy, F.V.t., Ramakrishnan, V., Malkiewicz, A., and Agris, P.F. (2004) The role of modifications in codon discrimination by tRNA(Lys)UUU. Nat Struct Mol Biol 11: 1186-1191.
References 130
My, L., Rekoske, B., Lemke, J.J., Viala, J.P., Gourse, R.L., and Bouveret, E. (2013) Transcription of the Escherichia coli fatty acid synthesis operon fabHDG is directly activated by FadR and inhibited by ppGpp. Journal of bacteriology 195: 3784-3795. Neidhardt, F.C., (2002) Microbial reaction to environment: bacterial stress responses revisited in the genomic-proteomic era. In: SYMPOSIA-SOCIETY FOR GENERAL MICROBIOLOGY. Cambridge; Cambridge University Press; 1999, pp. 1-18. Nelp, M.T., and Bandarian, V. (2015) A Single Enzyme Transforms a Carboxylic Acid into a Nitrile through an Amide Intermediate. Angew Chem Int Ed Engl 54: 10627-10629. Niemeyer, D., and Becker, A. (2001) The molecular weight distribution of succinoglycan produced by Sinorhizobium meliloti is influenced by specific tyrosine phosphorylation and ATPase activity of the cytoplasmic domain of the ExoP protein. J Bacteriol 183: 5163-5170. Nirenberg, M., Leder, P., Bernfield, M., Brimacombe, R., Trupin, J., Rottman, F., and O'Neal, C. (1965) RNA codewords and protein synthesis, VII. On the general nature of the RNA code. Proc Natl Acad Sci U S A 53: 1161-1168. Noguchi, S., Nishimura, Y., Hirota, Y., and Nishimura, S. (1982) Isolation and characterization of an Escherichia coli mutant lacking tRNA-guanine transglycosylase. Function and biosynthesis of queuosine in tRNA. J Biol Chem 257: 6544-6550. Noller, H.F., and Baucom, A. (2002) Structure of the 70 S ribosome: implications for movement. Biochem Soc Trans 30: 1159-1161. Nwodo, U.U., Green, E., and Okoh, A.I. (2012) Bacterial exopolysaccharides: functionality and prospects. Int J Mol Sci 13: 14002-14015. Ogle, J.M., Brodersen, D.E., Clemons, W.M., Jr., Tarry, M.J., Carter, A.P., and Ramakrishnan, V. (2001) Recognition of cognate transfer RNA by the 30S ribosomal subunit. Science 292: 897-902. Palacios, R., and Newton, W., (2005) Genomes and Genomics of Nitrogen-fixing Organisms. Springer, U.S.A. Pathak, C., Jaiswal, Y.K., and Vinayak, M. (2007) Possible involvement of queuine in regulation of cell proliferation. Biofactors 29: 159-173. Pathak, C., and Vinayak, M. (2005) Modulation of lactate dehydrogenase isozymes by modified base queuine. Mol Biol Rep 32: 191-196. Perret, X., Broughton, W.J., and Brenner, S. (1991) Canonical ordered cosmid library of the symbiotic plasmid of Rhizobium sp. NGR234. Proceedings of the National Academy of Sciences 88: 1923- 1927. Perret, X., Staehelin, C., and Broughton, W.J. (2000) Molecular basis of symbiotic promiscuity. Microbiol Mol Biol R 64: 180-+. Pueppke, S.G., and Broughton, W.J. (1999) Rhizobium sp. strain NGR234 and R. fredii USDA257 share exceptionally broad, nested host ranges. Mol Plant Microbe Interact 12: 293-318. Quandt, J., and Hynes, M.F. (1993) Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria. Gene 127: 15-21. Quaranta, D., McCarty, R., Bandarian, V., and Rensing, C. (2007) The copper-inducible cin operon encodes an unusual methionine-rich azurin-like protein and a pre-Q0 reductase in Pseudomonas putida KT2440. J Bacteriol 189: 5361-5371. Rakovich, T., Boland, C., Bernstein, I., Chikwana, V.M., Iwata-Reuyl, D., and Kelly, V.P. (2011) Queuosine deficiency in eukaryotes compromises tyrosine production through increased tetrahydrobiopterin oxidation. J Biol Chem 286: 19354-19363. Ran, W., and Higgs, P.G. (2010) The influence of anticodon-codon interactions and modified bases on codon usage bias in bacteria. Mol Biol Evol 27: 2129-2140. Ray, S., Banerjee, V., Blaise, M., Banerjee, B., Das, K.P., Kern, D., and Banerjee, R. (2014) Critical role of zinc ion on E. coli glutamyl-queuosine-tRNA(Asp) synthetase (Glu-Q-RS) structure and function. Protein J 33: 143-149.
References 131
Reeve, W., Ardley, J., Tian, R., Eshragi, L., Yoon, J.W., Ngamwisetkun, P., Seshadri, R., Ivanova, N.N., and Kyrpides, N.C. (2015) A Genomic Encyclopedia of the Root Nodule Bacteria: assessing genetic diversity through a systematic biogeographic survey. Stand Genomic Sci 10: 14. Reeve, W., Chain, P., O'Hara, G., Ardley, J., Nandesena, K., Brau, L., Tiwari, R., Malfatti, S., Kiss, H., Lapidus, A., Copeland, A., Nolan, M., Land, M., Hauser, L., Chang, Y.J., Ivanova, N., Mavromatis, K., Markowitz, V., Kyrpides, N., Gollagher, M., Yates, R., Dilworth, M., and Howieson, J. (2010) Complete genome sequence of the Medicago microsymbiont Ensifer (Sinorhizobium) medicae strain WSM419. Stand Genomic Sci 2: 77-86. Reeve, W.A., J.; Tian, R.; Eshragi, L.; Yoon, J. W.; Ngamwisetkun, P.; ... & Kyrpides, N. C. (2015) A genomic encyclopedia of the root nodule bacteria: Assessing genetic diversity through a systematic biogeographic survey. Standards in genomic sciences 10: 14. Relic, B., Talmont, F., Kopcinska, J., Golinowski, W., Prome, J.C., and Broughton, W.J. (1993) Biological activity of Rhizobium sp. NGR234 Nod-factors on Macroptilium atropurpureum. Mol Plant Microbe Interact 6: 764-774. Roberson, E.B., and Firestone, M.K. (1992) Relationship between desiccation and exopolysaccharide production in a soil Pseudomonas sp. Applied and Environmental Microbiology 58: 1284-1291. Rocha, E.P. (2004) Codon usage bias from tRNA's point of view: redundancy, specialization, and efficient decoding for translation optimization. Genome Res 14: 2279-2286. Roth, A., Winkler, W.C., Regulski, E.E., Lee, B.W., Lim, J., Jona, I., Barrick, J.E., Ritwik, A., Kim, J.N., Welz, R., Iwata-Reuyl, D., and Breaker, R.R. (2007) A riboswitch selective for the queuosine precursor preQ1 contains an unusually small aptamer domain. Nat Struct Mol Biol 14: 308-317. Rozov, A., Demeshkina, N., Westhof, E., Yusupov, M., and Yusupova, G. (2015) Structural insights into the translational infidelity mechanism. Nat Commun 6: 7251. Salazar, E., Díaz-Mejía, J.J., Moreno-Hagelsieb, G., Martínez-Batallar, G., Mora, Y., Mora, J., and Encarnación, S. (2010) Characterization of the NifA-RpoN Regulon in Rhizobium etli in Free Life and in Symbiosis with Phaseolus vulgaris. Appl Environ Microb 76: 4510-4520. Sambrook, J., (2001) Molecular cloning: a laboratory manual/Joseph Sambrook, David W. Russell. In.: Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, pp. Schmeisser, C., Liesegang, H., Krysciak, D., Bakkou, N., Le Quere, A., Wollherr, A., Heinemeyer, I., Morgenstern, B., Pommerening-Roser, A., Flores, M., Palacios, R., Brenner, S., Gottschalk, G., Schmitz, R.A., Broughton, W.J., Perret, X., Strittmatter, A.W., and Streit, W.R. (2009) Rhizobium sp. strain NGR234 possesses a remarkable number of secretion systems. Appl Environ Microbiol 75: 4035-4045. Sharp, P.M., Stenico, M., Peden, J.F., and Lloyd, A.T. (1993) Codon usage: mutational bias, translational selection, or both? Biochem Soc Trans 21: 835-841. Sprent, J.I. (2007) Evolving ideas of legume evolution and diversity: a taxonomic perspective on the occurrence of nodulation. New Phytol 174: 11-25. Sprent, J.I., Ardley, J.K., and James, E.K. (2013) From North to South: A latitudinal look at legume nodulation processes. South African Journal of Botany 89: 31-41. Stanley, N.R., and Lazazzera, B.A. (2004) Environmental signals and regulatory pathways that influence biofilm formation. Molecular microbiology 52: 917-924. Swairjo, M.A., Reddy, R.R., Lee, B., Van Lanen, S.G., Brown, S., de Crecy-Lagard, V., Iwata-Reuyl, D., and Schimmel, P. (2005) Crystallization and preliminary X-ray characterization of the nitrile reductase QueF: a queuosine-biosynthesis enzyme. Acta Crystallogr Sect F Struct Biol Cryst Commun 61: 945-948. Sy, A., Giraud, E., Jourand, P., Garcia, N., Willems, A., de Lajudie, P., Prin, Y., Neyra, M., Gillis, M., Boivin- Masson, C., and Dreyfus, B. (2001) Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes. J Bacteriol 183: 214-220. Terpolilli, J.J., Hood, G.A., and Poole, P.S., (2012) What determines the efficiency of N2-fixing Rhizobium-legume symbioses? In: Advances in microbial physiology. Elsevier, pp. 325-389.
References 132
Théberge, M.-c., Prevost, D., and CHALIFOUR, F.P. (1996) The effect of different temperatures on the fatty acid composition of Rhizobium leguminosarum bv. viciae in the faba bean symbiosis. New phytologist 134: 657-664. Thiaville, J.J., Kellner, S.M., Yuan, Y., Hutinet, G., Thiaville, P.C., Jumpathong, W., Mohapatra, S., Brochier-Armanet, C., Letarov, A.V., Hillebrand, R., Malik, C.K., Rizzo, C.J., Dedon, P.C., and de Crecy-Lagard, V. (2016) Novel genomic island modifies DNA with 7-deazaguanine derivatives. Proc Natl Acad Sci U S A 113: E1452-1459. Tsay, J.-T., Oh, W., Larson, T., Jackowski, S., and Rock, C. (1992) Isolation and characterization of the beta-ketoacyl-acyl carrier protein synthase III gene (fabH) from Escherichia coli K-12. Journal of Biological Chemistry 267: 6807-6814. Urbonavicius, J., Qian, Q., Durand, J.M., Hagervall, T.G., and Bjork, G.R. (2001) Improvement of reading frame maintenance is a common function for several tRNA modifications. EMBO J 20: 4863- 4873. van Brussel, A.A., Bakhuizen, R., van Spronsen, P.C., Spaink, H.P., Tak, T., Lugtenberg, B.J., and Kijne, J.W. (1992) Induction of pre-infection thread structures in the leguminous host plant by mitogenic lipo-oligosaccharides of Rhizobium. Science 257: 70-72. Van de Velde, W., Zehirov, G., Szatmari, A., Debreczeny, M., Ishihara, H., Kevei, Z., Farkas, A., Mikulass, K., Nagy, A., Tiricz, H., Satiat-Jeunemaitre, B., Alunni, B., Bourge, M., Kucho, K., Abe, M., Kereszt, A., Maroti, G., Uchiumi, T., Kondorosi, E., and Mergaert, P. (2010) Plant peptides govern terminal differentiation of bacteria in symbiosis. Science 327: 1122-1126. Van Lanen, S.G., and Iwata-Reuyl, D. (2003) Kinetic mechanism of the tRNA-modifying enzyme S- adenosylmethionine:tRNA ribosyltransferase-isomerase (QueA). Biochemistry 42: 5312-5320. Van Lanen, S.G., Reader, J.S., Swairjo, M.A., de Crecy-Lagard, V., Lee, B., and Iwata-Reuyl, D. (2005) From cyclohydrolase to oxidoreductase: discovery of nitrile reductase activity in a common fold. Proc Natl Acad Sci U S A 102: 4264-4269. Van Vlack, E.R., Topp, S., and Seeliger, J.C. (2017) Characterization of Engineered PreQ1 Riboswitches for Inducible Gene Regulation in Mycobacteria. J Bacteriol 199. Vasse, J., De Billy, F., Camut, S., and Truchet, G. (1990) Correlation between ultrastructural differentiation of bacteroids and nitrogen fixation in alfalfa nodules. Journal of bacteriology 172: 4295-4306. Vinayak, M., and Pathak, C. (2009) Queuosine modification of tRNA: its divergent role in cellular machinery. Biosci Rep 30: 135-148. Wang, L.X., Wang, Y., Pellock, B., and Walker, G.C. (1999) Structural characterization of the symbiotically important low-molecular-weight succinoglycan of Sinorhizobium meliloti. J Bacteriol 181: 6788-6796. Weixlbaumer, A., Murphy, F.V.t., Dziergowska, A., Malkiewicz, A., Vendeix, F.A., Agris, P.F., and Ramakrishnan, V. (2007) Mechanism for expanding the decoding capacity of transfer RNAs by modification of uridines. Nat Struct Mol Biol 14: 498-502. Wells, D.H., Chen, E.J., Fisher, R.F., and Long, S.R. (2007) ExoR is genetically coupled to the ExoS–ChvI two-component system and located in the periplasm of Sinorhizobium meliloti. Molecular microbiology 64: 647-664. Yadavalli, S.S., Carey, J.N., Leibman, R.S., Chen, A.I., Stern, A.M., Roggiani, M., Lippa, A.M., and Goulian, M. (2016) Antimicrobial peptides trigger a division block in Escherichia coli through stimulation of a signalling system. Nat Commun 7: 12340. Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33: 103-119. Zallot, R., Brochier-Armanet, C., Gaston, K.W., Forouhar, F., Limbach, P.A., Hunt, J.F., and de Crecy- Lagard, V. (2014) Plant, animal, and fungal micronutrient queuosine is salvaged by members of the DUF2419 protein family. ACS Chem Biol 9: 1812-1825.
References 133
Zallot, R., Harrison, K.J., Kolaczkowski, B., and de Crecy-Lagard, V. (2016) Functional Annotations of Paralogs: A Blessing and a Curse. Life (Basel) 6. Zallot, R., Ross, R., Chen, W.H., Bruner, S.D., Limbach, P.A., and de Crecy-Lagard, V. (2017a) Identification of a Novel Epoxyqueuosine Reductase Family by Comparative Genomics. ACS Chem Biol 12: 844-851. Zallot, R., Yuan, Y., and de Crecy-Lagard, V. (2017b) The Escherichia coli COG1738 Member YhhQ Is Involved in 7-Cyanodeazaguanine (preQ(0)) Transport. Biomolecules 7. Zevenhuizen, L.P., and van Neerven, A.R. (1983) (1→ 2)-β-d-glucan and acidic oligosaccharides produced by Rhizobium meliloti. Carbohydrate research 118: 127-134. Zhang, F., Ouellet, M., Batth, T.S., Adams, P.D., Petzold, C.J., Mukhopadhyay, A., and Keasling, J.D. (2012) Enhancing fatty acid production by the expression of the regulatory transcription factor FadR. Metabolic engineering 14: 653-660. Figure 1.1 https://courses.lumenlearning.com/boundless-biology/chapter/nucleic-acids/ Figure 1.5 https://www.khanacademy.org/science/biology/gene-expression-central- dogma/translation-polypeptides/a/trna-and-ribosomes Figure 1.6 program http://genesilico.pl/trnamodviz Figure 1.7 http://slideplayer.com/slide/5693997/18/images/44/Proofreading+in+Translation.jpg Figure 1.9 program http://genesilico.pl/trnamodviz
References 134