DOCSLIB.ORG

Preferential Import of Queuosine-Modified Trnas Into

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Preferential Import of Queuosine-Modified Trnas Into Published online 9 July 2021 Nucleic Acids Research, 2021, Vol. 49, No. 14 8247–8260 https://doi.org/10.1093/nar/gkab567 Preferential import of queuosine-modified tRNAs into Trypanosoma brucei mitochondrion is critical for organellar protein synthesis Sneha Kulkarni1,2, Mary Anne T. Rubio1,3,EvaHegedusov˝ a´ 1, Robert L. Ross4, Patrick A. Limbach 5, Juan D. Alfonzo3 and Zdenekˇ Paris 1,2,* 1Institute of Parasitology, Biology Centre, Czech Academy of Sciences, Ceskˇ eBud´ ejovice,ˇ Czech Republic, 2Faculty 3 of Science, University of South Bohemia, Ceskˇ eBud´ ejovice,ˇ Czech Republic, Department of Microbiology and The Downloaded from https://academic.oup.com/nar/article/49/14/8247/6318497 by guest on 01 October 2021 Center for RNA Biology, The Ohio State University, Columbus, OH, USA, 4Metabolomics Mass Spectrometry Core, Department of Cancer Biology, University of Cincinnati, Cincinnati, OH, USA and 5Rieveschl Laboratories for Mass Spectrometry, Department of Chemistry, University of Cincinnati, Cincinnati, OH, USA Received November 30, 2020; Revised May 28, 2021; Editorial Decision June 13, 2021; Accepted June 21, 2021 ABSTRACT sine (Q), a hypermodified 7-deaza-guanosine, is one of the most chemically intricate modifications described to date. Transfer RNAs (tRNAs) are key players in protein syn- Q is found at the wobble position 34 of tRNAs that contain thesis. To be fully active, tRNAs undergo extensive a5-GUN-3 anticodon sequence, where N represents any post-transcriptional modifications, including queuo- of the canonical nucleotides, which includes tRNAHisGUG, sine (Q), a hypermodified 7-deaza-guanosine present tRNAAspGUC, tRNAAsnGUU, tRNATyr GUA (3). Q is in the anticodon of several tRNAs in bacteria and eu- found in both bacteria and eukarya, and catalyzed by tRNA karya. Here, molecular and biochemical approaches guanine transglycosylase (TGT) (4). In bacteria, Q is syn- revealed that in the protozoan parasite Trypanosoma thesized de novo, wherein guanosine is modified by five se- brucei, Q-containing tRNAs have a preference for quential enzymatic reactions to form preQ1, which is then the U-ending codons for asparagine, aspartate, ty- incorporated into tRNAs by the bacterial TGT homodimer rosine and histidine, analogous to what has been (bTGT). PreQ1 is further modified to Q by two enzymatic steps on the tRNA itself (4). A related 7-deaza-guanosine described in other systems. However, since a lack of derivative called archaeosine (G+) is present at position 15 tRNA genes in T. brucei mitochondria makes it essen- on the D-loop of several tRNAs in archaea. Archaeal TGT tial to import a complete set from the cytoplasm, we is a homolog of bacterial TGT and catalyzes the exchange of surprisingly found that Q-modified tRNAs are pref- guanine with preQ0, a precursor common to the biosynthe- erentially imported over their unmodified counter- sis of both G+ and Q (5,6). Eukaryotes lack the enzymes re- parts. In turn, their absence from mitochondria has quired for de novo synthesis of queuosine and hence rely on a pronounced effect on organellar translation and af- nutrient sources and additionally, in the case of mammals, fects function. Although Q modification in T. brucei their gut microbiome. Queuine (q, free base of queuosine) is globally important for codon selection, it is more is recognized by eukaryotic TGT (eTGT), and exchanged so for mitochondrial protein synthesis. These results with guanine on the tRNA (7). In mice and humans, TGT provide a unique example of the combined regula- exists as a heterodimer of queuine tRNA ribosyltransferase 1 (QTRT1), and queuine tRNA ribosyltransferase domain tory effect of codon usage and wobble modifications containing 1 (QTRTD1) (8). on protein synthesis; all driven by tRNA intracellular Because of its position at the wobble base in the anti- transport dynamics. codon, Q may play a role in codon recognition. Morris and co-workers proposed a model where the Q modification INTRODUCTION may influence cellular growth and differentiation by codon- biased regulation of protein synthesis (9). They carried out Transfer RNAs (tRNAs) bear the most extensive diver- an in silico analysis which showed that the NAU/NAC ra- sity of post-transcriptional modifications among all nucleic tio of usage of cognate codons of Q-containing tRNAs, is acids in cells (1). Several complex modifications exist in the much higher in housekeeping genes (>0.81) than in onco- anticodon stem-loop region of tRNAs, which may act to developmental gene transcripts (<0.35) (9), which could ensure accuracy and fidelity during translation (2). Queuo- *To whom correspondence should be addressed. Tel: +420 38 777 5427; Email: [email protected] C The Author(s) 2021. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] 8248 Nucleic Acids Research, 2021, Vol. 49, No. 14 lead to differential protein synthesis in healthy v/s cancer their function, localization and physical interaction. Fur- cells. In Xenopus oocytes, Q-containing tRNAs eliminate ther, we aimed to study the mechanism by which this modifi- the proposed codon preference by efficiently recognizing ei- cation differentially influences translation. We analyzed the ther NAU or NAC codons, whereas the unmodified tRNAs combined effects of differential codon usage, and Q-tRNA preferably recognize NAC (10). In drosophilid lineage, Q levels, on cytosolic translation. Furthermore, as the mito- mediates a shift in codon preference within a genome, dur- chondrion is one of the organelles, which undergoes ma- ing various developmental stages (11,12). Recently, Tuorto jor transformation during the life cycle of Trypanosoma,we et al. showed that Q-containing tRNA levels control trans- studied the role of Q in mitochondrial translation. As ex- lational speed at their cognate and near-cognate codons in pected, queuosine functions in codon-biased translation in humans (13). They also reported that the loss of Q resulted the cytoplasm, but surprisingly Q-tRNAs are preferentially in the induction of the unfolded protein response, in hu- imported into the mitochondria to play a role in translation mans and mice (13). Thus, there is evidence supporting the of U-rich mitochondrial mRNAs. The combined effects of role of queuosine tRNA modification in regulating codon- its role in transport and organellar protein synthesis is crit- Downloaded from https://academic.oup.com/nar/article/49/14/8247/6318497 by guest on 01 October 2021 biased translation, although its impact appears to vary be- ical for mitochondrial function as shown here. tween organisms. The role of tRNA modifications is particularly relevant MATERIALS AND METHODS in medically and economically important trypanosomatid Cell culture, generation of cell lines and q depletion experi- parasites. Trypanosoma brucei is a unicellular dixenous par- ments asite, belonging to the order Kinetoplastida. Its nuclear genome is organized in a unique way, with several unre- Wild type (WT), procyclic T. brucei 29–13 cells (21) lated genes clustered together and transcribed as a poly- were grown in SDM-79 medium (22) supplemented with cistronic unit (14,15). As a result, these parasites lack most 10% fetal bovine serum. RNAi construct was gen- of the transcriptional control found in other organisms, erated by cloning region of the coding sequence of with the bulk of gene expression regulation occurring post- TbTGT1 into the plasmid vector p2T7-177 using following transcriptionally.Additionally, they undergo extensive mor- oligonucleotides: TbTGT1-F: CCCAAGCTTCTAAGA phological and metabolic remodeling, during their life cy- CCAGGGGAAGATATACTTAAT; TbTGT1-R: CGCG cle, which includes switching from glycolysis in the mam- GATCCCGATAGGAGTGTAGCCCCAA. Cloning sites malian host to oxidative phosphorylation inside the in- for HindIII and BamHI are underlined in the sequence. sect vector, continually changing their surface glycoprotein RNAi was induced by the addition of 1 ␮g/ml of tetracy- composition to evade the immune system, etc. (16). These cline to the media, generating dsRNA from head-to-head events demand rapid changes in translation of developmen- orientated T7 promoters (21). tally regulated proteins. In such situations, changes in post- For tagging of the endogenous TbTGT proteins: transcriptional modifications of tRNAs may be essential for TbTGT1 was tagged at the c-terminus, with myc tag the survival or virulence of the parasite, which in the case of using pMOTag 4M vector (with phleoR), as described Q implies two different environments to supply queuine: the (23). TbTGT2 was tagged at the c-terminus, with V5 gut of the insect and the bloodstream of mammals. tag, using a modified pPOTv4 vector (with puroR) (24). Complicating things further is the fact that the mitochon- Primers used for PCR were as following: TGT1myc-F: drial genome of T. brucei does not encode any tRNAs. Con- GAATACGTACAGAAGTTTTTTTTAGGATATTACC sequently, they must import the whole set of tRNAs from CGGCACGGGATTACCCAAAGTGGATTGTTGAT the cytoplasm to be utilized for organellar translation (17). GCACTTGCTTCTGTCAGTGTTGAGCTCCCCCG tRNA modifications present a possible way to regulate im- CCCGCTCGAGATGGAGCAGAAG,
Load more

Recommended publications
  • Discovery of Novel Bacterial Queuine Salvage Enzymes and Pathways in Human Pathogens
    Discovery of novel bacterial queuine salvage enzymes and pathways in human pathogens a,1 b,1 c,1 b d a Yifeng Yuan , Rémi Zallot , Tyler L. Grove , Daniel J. Payan , Isabelle Martin-Verstraete , Sara Sepic´ , Seetharamsingh Balamkundue, Ramesh Neelakandane, Vinod K. Gadie, Chuan-Fa Liue, Manal A. Swairjof,g, Peter C. Dedone,h,i, Steven C. Almoc, John A. Gerltb,j,k, and Valérie de Crécy-Lagarda,l,2 aDepartment of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611; bInstitute for Genomic Biology, University of Illinois at Urbana–Champaign, Urbana, IL 61801; cDepartment of Biochemistry, Albert Einstein College of Medicine, Bronx, NY 10461; dLaboratoire de Pathogénèse des Bactéries Anaérobies, Institut Pasteur et Université de Paris, F-75015 Paris, France; eSingapore-MIT Alliance for Research and Technology, Infectious Disease Interdisciplinary Research Group, 138602 Singapore, Singapore; fDepartment of Chemistry and Biochemistry, San Diego State University, San Diego, CA 92182; gThe Viral Information Institute, San Diego State University, San Diego, CA 92182; hDepartment of Biological Engineering and Chemistry, Massachusetts Institute of Technology, Cambridge, MA 02139; iCenter for Environmental Health Sciences, Massachusetts Institute of Technology, Cambridge, MA 02139; jDepartment of Biochemistry, University of Illinois at Urbana–Champaign, Urbana, IL 61801; kDepartment of Chemistry, University of Illinois at Urbana–Champaign, Urbana, IL 61801; and lUniversity of Florida Genetics Institute, Gainesville, FL 32610 Edited by Tina M. Henkin, The Ohio State University, Columbus, OH, and approved August 1, 2019 (received for review June 16, 2019) Queuosine (Q) is a complex tRNA modification widespread in 1A. The TGT enzyme, which is responsible for the base ex- eukaryotes and bacteria that contributes to the efficiency and accuracy change, is the signature enzyme in the Q biosynthesis pathway.
    [Show full text]
  • Queuine, a Bacterial Derived Hypermodified Nucleobase, Shows Protection in in Vitro Models of Neurodegeneration
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427538; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Queuine, a bacterial derived hypermodified nucleobase, shows protection in in vitro models of neurodegeneration Patricia Richard1*, Xavier Manière2*, Lucie Kozlowski2, Hélène Guillorit2,3, Patrice Garnier2, Antoine Danchin4, Nicole C. McKnight1** 1 Stellate Therapeutics Inc., 101 Avenue of the Americas, JLABS @ NYC, New York, NY 10013 2 Stellate Therapeutics SAS, 47 rue de Montmorency, 75003, Paris, France 3 Institut de Génomique Fonctionnelle, 141 rue de la Cardonille, 34094, Montpellier, France 4 Kodikos Labs, Institut Cochin, 24 rue du Faubourg Saint-Jacques, 75014, Paris, France ** corresponding author Email: [email protected] * These authors contributed equally to this work 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.20.427538; this version posted January 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Growing evidence suggests that human gut bacteria, comprising the microbiome that communicates with the brain through the so-called ‘gut-brain-axis’, are linked to neurodegener- ative disorders. Imbalances in the microbiome of Parkinson’s disease (PD) and Alzheimer’s dis- ease (AD) patients have been detected in several studies. Queuine is a hypermodified nucleobase enriched in the brain and exclusively produced by bacteria and salvaged by humans through their gut epithelium. Queuine replaces guanine at the wobble position of tRNAs with GUN anticodons and promotes efficient cytoplasmic and mitochondrial mRNA translation.
    [Show full text]
  • Synthetic Ligands for Preq1 Riboswitches Provide Structural and Mechanistic Insights Into Targeting RNA Tertiary Structure
    ARTICLE https://doi.org/10.1038/s41467-019-09493-3 OPEN Synthetic ligands for PreQ1 riboswitches provide structural and mechanistic insights into targeting RNA tertiary structure Colleen M. Connelly1, Tomoyuki Numata2,3, Robert E. Boer1, Michelle H. Moon1, Ranu S. Sinniah1, Joseph J. Barchi1, Adrian R. Ferré-D’Amaré 2 & John S. Schneekloth Jr. 1 1234567890():,; Riboswitches are naturally occurring RNA aptamers that regulate gene expression by binding to specific small molecules. Riboswitches control the expression of essential bacterial genes and are important models for RNA-small molecule recognition. Here, we report the discovery of a class of synthetic small molecules that bind to PreQ1 riboswitch aptamers. These molecules bind specifically and reversibly to the aptamers with high affinity and induce a conformational change. Furthermore, the ligands modulate riboswitch activity through tran- scriptional termination despite no obvious chemical similarity to the cognate ligand. X-ray crystallographic studies reveal that the ligands share a binding site with the cognate ligand but make different contacts. Finally, alteration of the chemical structure of the ligand causes changes in the mode of RNA binding and affects regulatory function. Thus, target- and structure-based approaches can be used to identify and understand the mechanism of synthetic ligands that bind to and regulate complex, folded RNAs. 1 Chemical Biology Laboratory, National Cancer Institute, Frederick, MD 21701, USA. 2 Biochemistry and Biophysics Center, National Heart, Lung and Blood Institute, Bethesda, MD 20892, USA. 3 Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8566, Japan. These authors contributed equally: Colleen M.
    [Show full text]
  • Protection of the Queuosine Biosynthesis Enzyme Quef from Irreversible Oxidation by a Conserved Intramolecular Disulfide
    biomolecules Article Protection of the Queuosine Biosynthesis Enzyme QueF from Irreversible Oxidation by a Conserved Intramolecular Disulfide Adeba Mohammad 1, Adriana Bon Ramos 2, Bobby W. K. Lee 2, Spencer W. Cohen 2, Maryam K. Kiani 1, Dirk Iwata-Reuyl 2, Boguslaw Stec 3 and Manal A. Swairjo 1,3,* 1 Graduate College of Biomedical Sciences, Western University of Health Sciences, 309 E. Second Street, Pomona, CA 91766, USA; [email protected] (A.M.); [email protected] (M.K.K.) 2 Department of Chemistry, Portland State University, P.O. Box 751, Portland, OR 97207, USA; [email protected] (A.B.R.); [email protected] (B.W.K.L.); [email protected] (S.W.C.); [email protected] (D.I.-R.) 3 Department of Chemistry and Biochemistry, San Diego State University 5500 Campanile Drive, San Diego, CA 92182, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-619-206-3864 Academic Editor: Jürg Bähler Received: 10 January 2017; Accepted: 10 March 2017; Published: 16 March 2017 Abstract: QueF enzymes catalyze the nicotinamide adenine dinucleotide phosphate (NADPH)-dependent reduction of the nitrile group of 7-cyano-7-deazaguanine (preQ0) to 7-aminomethyl-7-deazaguanine (preQ1) in the biosynthetic pathway to the tRNA modified nucleoside queuosine. The QueF-catalyzed reaction includes formation of a covalent thioimide intermediate with a conserved active site cysteine that is prone to oxidation in vivo. Here, we report the crystal structure of a mutant of Bacillus subtilis QueF, which reveals an unanticipated intramolecular disulfide formed between the catalytic Cys55 and a conserved Cys99 located near the active site.
    [Show full text]
  • MODOMICS: a Database of RNA Modification Pathways. 2017 Update
    Published online 2 November 2017 Nucleic Acids Research, 2018, Vol. 46, Database issue D303–D307 doi: 10.1093/nar/gkx1030 MODOMICS: a database of RNA modification pathways. 2017 update Pietro Boccaletto1,†, Magdalena A. Machnicka1,2,†, Elzbieta Purta1,Pawe-lPiatkowski˛ 1, B-lazej˙ Baginski´ 1, Tomasz K. Wirecki1,Valerie´ de Crecy-Lagard´ 3, Robert Ross4,Patrick A. Limbach4, Annika Kotter5, Mark Helm5 and Janusz M. Bujnicki1,6,* 1Laboratory of Bioinformatics and Protein Engineering, International Institute of Molecular and Cell Biology in Warsaw, ul. Ks. Trojdena 4, PL-02-109 Warsaw, Poland, 2Institute of Informatics, University of Warsaw, Banacha 2, PL-02-097 Warsaw, Poland, 3Microbiology and Cell Science Department, University of Florida, Gainesville, FL 32611, USA, 4Department of Chemistry, Rieveschl Laboratories for Mass Spectrometry, University of Cincinnati, Cincinnati, OH 45221, USA, 5Institut fur¨ Pharmazie und Biochemie, Johannes Gutenberg-Universitat,¨ Staudinger Weg 5, D-55128 Mainz, Germany and 6Faculty of Biology, Adam Mickiewicz University, ul. Umultowska 89, PL-61-614 Poznan, Poland Received September 15, 2017; Revised October 15, 2017; Editorial Decision October 16, 2017; Accepted October 18, 2017 ABSTRACT for basic biological processes [review: (1)]. Now we know that 163 post-transcriptional modifications of RNA intro- MODOMICS is a database of RNA modifications duce a functional diversity that allows the four basic ribonu- that provides comprehensive information concern- cleotide residues to gain diverse functions, akin to those of ing the chemical structures of modified ribonucleo- side chains of amino acid residues, which may be e.g., po- sides, their biosynthetic pathways, the location of lar, charged, aliphatic or aromatic. Modifications can di- modified residues in RNA sequences, and RNA- rectly influence RNA structure, by promoting or disrupt- modifying enzymes.
    [Show full text]
  • ST.25 Page: 3.25.1
    HANDBOOK ON INDUSTRIAL PROPERTY INFORMATION AND DOCUMENTATION Ref.: Standards – ST.25 page: 3.25.1 STANDARD ST.25 STANDARD FOR THE PRESENTATION OF NUCLEOTIDE AND AMINO ACID SEQUENCE LISTINGS IN PATENT APPLICATIONS Revision adopted by the SCIT Standards and Documentation Working Group at its eleventh session on October 30, 2009 It is recommended that Offices apply the provisions of the “Standard for the Presentation of Nucleotide and Amino Acid Sequence Listings in International Patent Applications Under the Patent Cooperation Treaty (PCT)” as set out in Annex C to the Administrative Instructions under the PCT, mutatis mutandis, to all patent applications other than the PCT international applications, noting that certain provisions specific to PCT procedures and requirements may not be applicable to patent applications other than PCT international applications(*). The text of that PCT Standard is reproduced on the following pages. (*) If, on July 1, 2009, the national law and practice applicable by an Office is not compatible with the provisions of paragraph 3(i) of the “Standard for the Presentation of Nucleotide and Amino Acid Sequence Listings in International Patent Applications Under the Patent Cooperation Treaty (PCT)” requiring that a sequence listing which is contained in the international application as filed “shall be presented as a separate part of the description, be placed at the end of the application, preferably be entitled ‘Sequence Listing’, begin on a new page and have independent page numbering”, that Office may choose not to follow those provisions for as long as that incompatibility continues. en / 03-25-01 Date: December 2009 HANDBOOK ON INDUSTRIAL PROPERTY INFORMATION AND DOCUMENTATION Ref.: Standards – ST.25 page: 3.25.2 ANNEX C STANDARD FOR THE PRESENTATION OF NUCLEOTIDE AND AMINO ACID SEQUENCE LISTINGS IN INTERNATIONAL PATENT APPLICATIONS UNDER THE PCT INTRODUCTION 1.
    [Show full text]
  • Queuosine Deficiency in Eukaryotes Compromises Tyrosine Production Through Increased Tetrahydrobiopterin Oxidation
    JBC Papers in Press. Published on April 12, 2011 as Manuscript M111.219576 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M111.219576 QUEUOSINE DEFICIENCY IN EUKARYOTES COMPROMISES TYROSINE PRODUCTION THROUGH INCREASED TETRAHYDROBIOPTERIN OXIDATION Tatsiana Rakovich‡, Coilin Boland‡, Ilana Bernstein§, Vimbai M. Chikwana¶, Dirk Iwata-Reuyl¶, and Vincent P. Kelly‡ From the ‡School of Biochemistry & Immunology, Trinity College Dublin, Dublin 2, Ireland, §School of Environmental & Life Sciences, University of Newcastle, Callaghan, NSW, 2308, Australia, and ¶Department of Chemistry, Portland State University, Portland, Oregon 97207 Running head: Queuosine deficiency leads to elevated dihydrobiopterin Address correspondence to: Vincent Kelly, Ph.D., School of Biochemistry and Immunology, Trinity College Dublin, Dublin 2, Ireland. Tel: +353-1-8963507; Fax: 81-298-53-7318; E-mail: [email protected] Queuosine is a modified pyrrolopyrimidine of complex carbohydrates to the provision of vital nucleoside found in the anticodon loop of micronutrients (1). Queuosine is an example of a transfer RNA acceptors for the amino acids micronutrient, synthesised exclusively by bacteria Downloaded from tyrosine, asparagine, aspartic acid, and but which, for poorly defined reasons, is utilised histidine. Since it is exclusively synthesised by by almost all eukaryotic species with the exception bacteria, higher eukaryotes must salvage of the baker’s yeast, S. cerevisiae (2). queuosine or its nucleobase queuine from food Bacterial queuosine biosynthesis occurs in two and the gut microflora. Previously, animals stages. Firstly, a series of five enzymatic steps www.jbc.org made deficient in queuine died within 18 days of convert guanosine triphosphate nucleoside (GTP) withdrawing tyrosine—a non-essential amino to the soluble 7-aminomethyl-7-deazaguanine acid—from the diet [Marks T, Farkas WR (preQ ) molecule.
    [Show full text]
  • Federal Register/Vol. 86, No. 100/Wednesday, May 26, 2021/Proposed Rules
    Federal Register / Vol. 86, No. 100 / Wednesday, May 26, 2021 / Proposed Rules 28301 DEPARTMENT OF COMMERCE comments. Attachments to electronic expected to have a minimal impact on comments will be accepted in ADOBE® applicants in general. Patent and Trademark Office portable document format or The USPTO encourages applicants to MICROSOFT WORD® format. Because file their patent applications via its 37 CFR Part 1 comments will be made available for USPTO patent electronic filing system and imposes a surcharge for non- [Docket No. PTO–P–2020–0032] public inspection, information that the submitter does not desire to make electronic filing of an original patent RIN 0651–AD48 public, such as an address or phone application (excluding reissue, design, number, should not be included in the plant, and provisional applications), as Electronic Submission of a Sequence comments. mandated by section 10(h) of Public Listing, a Large Table, or a Computer Visit the Federal eRulemaking Portal Law 112–29, September 16, 2011 Program Listing Appendix in Patent (Leahy-Smith America Invents Act). The Applications website (www.regulations.gov) for additional instructions on providing USPTO provides information (Legal AGENCY: United States Patent and comments via the portal. If electronic Framework for Patent Electronic Trademark Office, Department of submission of comments is not feasible System) concerning electronic filing via Commerce. due to lack of access to a computer and/ the USPTO patent electronic filing system on its website at www.uspto.gov/ ACTION: Notice of proposed rulemaking. or the internet, please contact the USPTO using the contact information patents-application-process/filing- SUMMARY: The United States Patent and below for special instructions.
    [Show full text]
  • A Truncated Aminoacyl–Trna Synthetase Modifies RNA
    A truncated aminoacyl–tRNA synthetase modifies RNA Juan C. Salazar*, Alexandre Ambrogelly*, Pamela F. Crain†, James A. McCloskey†‡, and Dieter So¨ ll*§¶ Departments of *Molecular Biophysics and Biochemistry, and §Chemistry, Yale University, New Haven, CT 06520-8114; and Departments of †Medicinal Chemistry and ‡Biochemistry, University of Utah, Salt Lake City, UT 84112-5820 Contributed by Dieter So¨ll, March 21, 2004 Aminoacyl–tRNA synthetases are modular enzymes composed of a tRNA in trans (11, 12), a mechanism that should increase the central active site domain to which additional functional domains fidelity of the translation process. were appended in the course of evolution. Analysis of bacterial Here we report the characterization of another widely distrib- genome sequences revealed the presence of many shorter amino- uted aaRS paralog, a glutamyl–tRNA synthetase (GluRS)- acyl–tRNA synthetase paralogs. Here we report the characteriza- related protein encoded by yadB in E. coli. tion of a well conserved glutamyl–tRNA synthetase (GluRS) paralog Materials and Methods (YadB in Escherichia coli) that is present in the genomes of >40 species of proteobacteria, cyanobacteria, and actinobacteria. The E. Oligonucleotides, DNA Sequencing, Radiochemicals, and Bacterial coli yadB gene encodes a truncated GluRS that lacks the C-terminal Strains. Oligonucleotides synthesis and DNAs sequencing was third of the protein and, consequently, the anticodon binding performed by the Keck Foundation Biotechnology Resource 14 domain. Generation of a yadB disruption showed the gene to be Laboratory at Yale University. Uniformly labeled [ C]Glu (254 ͞ ϭ 32 dispensable for E. coli growth in rich and minimal media. Unlike mCi mmol; 1 Ci 37 GBq), sodium [ P]pyrophosphate (1–60 ͞ ␥ 32 ͞ GluRS, the YadB protein was able to activate glutamate in presence Ci mmol), and [ - P]ATP (6,000 Ci mmol) were from Amer- 14 ͞ of ATP in a tRNA-independent fashion and to transfer glutamate sham Biosciences.
    [Show full text]
  • Detection and Quantification of Glycosylated Queuosine Modified
    Downloaded from rnajournal.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Detection and quantification of glycosylated queuosine modified tRNAs by acid denaturing and APB gels Wen Zhang1, Ruyi Xu2,3, Żaneta Matuszek4, Zhen Cai2,3, Tao Pan4,* 1. Department of Chemistry, University of Chicago, Chicago, IL 60637, USA 2. Bone Marrow Transplantation Center, The First Affiliated Hospital, School of Medicine, Zhejiang University,Hangzhou, China 3. Institute of Hematology, Zhejiang University, Zhejiang, China 4. Department of Biochemistry & Molecular Biology, University of Chicago, Chicago, IL 60637, USA *Corresponding author: [email protected] Keywords: Queuosine, Mannosyl-Queuosine, Galactosyl-Queuosine, Acid denaturing PAGE. 1 Downloaded from rnajournal.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract: Queuosine (Q) is a conserved tRNA modification in bacteria and eukaryotes. Eukaryotic Q-tRNA modification occurs through replacing the guanine base with the scavenged metabolite queuine at the wobble position of tRNAs with G34U35N36 anticodon (Tyr, His, Asn, Asp) by the QTRT1/QTRT2 heterodimeric enzyme encoded in the genome. In humans, Q-modification in tRNATyr and tRNAAsp are further glycosylated with galactose and mannose, respectively. Although galactosyl-Q (galQ) and mannosyl-Q (manQ) can be measured by LC/MS approaches, the difficulty of detecting and quantifying these modifications with low sample inputs has hindered their biological investigations. Here we describe a simple acid denaturing gel and non- radioactive Northern blot method to detect and quantify the fraction of galQ/manQ-modified tRNA using just microgram amounts of total RNA. Our method relies on the secondary amine group of galQ/manQ becoming positively charged to slow their migration in acid denaturing gels commonly used for tRNA charging studies.
    [Show full text]
  • (Oq) Reductase Reveals Parallels Between Halorespiration and Trna Modification
    Discovery of epoxyqueuosine (oQ) reductase reveals parallels between halorespiration and tRNA modification Zachary D. Miles, Reid M. McCarty, Gabriella Molnar, and Vahe Bandarian1 Department of Chemistry and Biochemistry, University of Arizona, 1041 East Lowell Street, Tucson, AZ 85721-0088 Edited by Christopher T. Walsh, Harvard Medical School, Boston, MA, and approved March 10, 2011 (received for review December 15, 2010) Transfer RNA is one of the most richly modified biological mole- This in vitro reconstitution of the 7-deazapurine core was aided cules. Biosynthetic pathways that introduce these modifications by the discovery of the toyocamycin biosynthetic gene cluster in are underexplored, largely because their absence does not lead Streptomyces rimosus, which contains three genes that had been to obvious phenotypes under normal growth conditions. Queuo- previously shown to be required for the biosynthesis of queuosine sine (Q) is a hypermodified base found in the wobble positions in Bacillus subtilis (10–13). The cluster also contained a GTP of tRNA Asp, Asn, His, and Tyr from bacteria to mankind. Using cyclohydrolase I (GCH I) homolog, which hinted at GTP as being liquid chromatography MS methods, we have screened 1,755 sin- the primary metabolic precursor. GCH I catalyzes the conversion gle gene knockouts of Escherichia coli and have identified the key of GTP to 7,8-dihydroneopterin triphosphate (H2NTP) in the final step in the biosynthesis of Q. The protein is homologous to first step in the biosynthesis of both folic acid and biopterin. B12-dependent iron-sulfur proteins involved in halorespiration. GCH I was subsequently shown to be required for the biosynth- The recombinant Bacillus subtilis epoxyqueuosine (oQ) reductase esis of Q in Escherichia coli (14).
    [Show full text]
  • The Queuosine Pathway Is Not Essential for Ensifer Medicae WSM419 Symbiosis and Certain Components of This Pathway Modulate Lipid Biosynthesis
    The Queuosine pathway is not essential for Ensifer medicae WSM419 symbiosis and certain components of this pathway modulate lipid biosynthesis By Jaco Daniel Zandberg Supervisors: Dr. Wayne Reeve Dr. Julie Ardley Dr. Ravi Tiwari i Declaration I hereby declare, that unless otherwise stated, the work presented in this thesis is my own Jaco Daniel Zandberg ii Acknowledgements I would like to begin with the formalities. A special thank you to Mr. Xin Du and Prof. Yonglin Ren at Murdoch University, Perth, Australia for allowing me access to your HS-GC system and analysis. Furthermore, thank you to Dr. Bill Dunstan for allowing me access to your microscope and imaging software. Now, with the formalities finished, I take the time here to use all the words I was barred from using by my supervisors whilst writing this thesis (because I’ll be damned if I don’t get to use these fantastic words) and what better place than here, thanking the very people that told me not to. So here I take the time to showcase my thanks to Dr. Julie “comma” Ardley for ensuring that I understand the plethora of information regarding everything ‘plant’ and for providing me with the necessary support when I needed it most. I thank Dr. Ravi “sticky fingers” Tiwari for “procuring” much needed reagents and for teaching me the most complicated genetic engineering technique, primer design. Lastly, I would like to thank Dr. Wayne “strikethrough” Reeve for providing me with a once in a lifetime opportunity, showcasing a phenomenal aptitude for the work done here and for excelling in his role as supervisor, one could not hope for a better supervisor.
    [Show full text]