BASIC RESEARCH www.jasn.org

IL-34–Dependent Intrarenal and Systemic Mechanisms Promote Lupus Nephritis in MRL-Faslpr Mice

Yukihiro Wada,1 Hilda M. Gonzalez-Sanchez,1 Julia Weinmann-Menke,2 Yasunori Iwata,1 Amrendra K. Ajay,1 Myriam Meineck,2 and Vicki R. Kelley1

1Renal Division, Department of Medicine, Brigham and Women’s Hospital, Boston, Massachusetts; and 2Department of Nephrology and Rheumatology, University Medical Center of the Johannes Gutenberg University Mainz, Mainz, Germany

ABSTRACT lpr Background In people with SLE and in the MRL-Fas lupus mouse model, macrophages and autoanti- bodies are central to lupus nephritis. IL-34 mediates macrophage survival and proliferation, is expressed by tubular epithelial cells (TECs), and binds to the cFMS receptor on macrophages and to a newly identified second receptor, PTPRZ. Methods To investigate whether IL-34–dependent intrarenal and systemic mechanisms promote lupus lpr nephritis, we compared lupus nephritis and systemic illness in MRL-Fas mice expressing IL-34 and IL-34 lpr knockout (KO) MRL-Fas mice. We also assessed expression of IL-34 and the cFMS and PTPRZ receptors in patients with lupus nephritis. lpr Results Intrarenal IL-34 and its two receptors increase during lupus nephritis in MRL-Fas mice. In knock- out mice lacking IL-34, nephritis and systemic illness are suppressed. IL-34 fosters intrarenal macrophage accumulation via monocyte proliferation in bone marrow (which increases circulating monocytes that are recruited by chemokines into the kidney) and via intrarenal macrophage proliferation. This accumulation leads to macrophage-mediated TEC apoptosis. We also found suppression of circulating autoantibodies and glomerular antibody deposits in the knockout mice. This is consistent with fewer activated and pro- liferating intrarenal and splenic B cells in mice lacking IL-34, and with our novel discovery that PTPRZ is expressed by macrophages, B and T cells. These findings appear translatable to human patients with lupus lpr nephritis, whose expression of IL-34, cFMS, and PTPRZ is similar to that seen in the MRL-Fas lupus mouse model. Moreover, expression of IL-34 in TECs correlates with disease activity. Conclusions IL-34 is a promising novel therapeutic target for patients with lupus nephritis.

J Am Soc Nephrol 30: 244–259, 2019. doi: https://doi.org/10.1681/ASN.2018090901

Nephritisiscommoninpatientswithlupus.1,2 Even mice, Mø in lupus-prone MRL-Faslpr mice are defec- with optimal therapy, up to 25% of these patients tive in shifting from M1 to M2 and hyperproliferate progress to ESRD.2–4 Moreover, a new therapeutic to Mø growth factors,8 thereby promoting an for lupus nephritis has not been approved in over five decades. Therefore, the need for a novel thera- Received September 6, 2018. Accepted November 16, 2018. peutic target for lupus nephritis is pressing and timely. Myeloid cells, most notably Mø, regulate the in- Y.W.,H.M.G.-S.,andJ.W.-M.contributed equally to this work. flammatory response to kidney injury and repair. Published online ahead of print. Publication date available at Activated Mø are broadly conceptually divided into www.jasn.org. “ ” “ ” M1 destroyers and M2 healers. Mø are integral Correspondence: Dr. Vicki R. Kelley, Harvard Institutes of Med- in AKI that resolves in normal mice,5–7 but trigger icine, 4 Blackfan Circle, Boston, MA 02115. Email: vkelley@rics. CKD in lupus-prone mice.7 For example, after a bwh.harvard.edu transient kidney insult (ischemia), unlike normal Copyright © 2019 by the American Society of Nephrology

244 ISSN : 1046-6673/3002-244 J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH accumulation of Mø that escalate inflammation in the renal Significance Statement tubular-interstitium. Moreover, MRL-Faslpr Mø are defective in removing apoptotic cells, leading to the induction of Macrophages and autoantibodies play a central role in the pathol- lpr autoantibodies that circulate, lodge in glomeruli, and thereby ogy of lupus nephritis in patients with lupus and in the MRL-Fas compromise glomerular filtration.7 Thus, the accumulation of mouse model. The authors demonstrate that IL-34 and its two re- ceptors, cFMS and PTPRZ, are upregulated in the kidney with ad- lpr Mø in lupus-prone mice is central to initiating and driving vancing nephritis in MRL-Fas mice. Genetically deleting IL-34 in lupus nephritis. these mice suppresses nephritis and the systemic illness via mac- IL-34 and colony stimulating factor 1 (CSF-1) are the prin- rophage- and autoantibody-mediated mechanisms within and ciple Mø growth factors that regulate the accumulation of outside of the kidney. The authors also found that patients with Mø in inflamed tissues. CSF-1 functions by engaging a high- lupus nephritis have elevated IL-34 in serum and urine; intrarenal and systemic expression of IL-34, cFMS, and PTPRZ similar to that fi lpr af nity receptor tyrosine kinase encoded by the cFMS proto- displayed in MRL-Fas mice; and IL-34 expression that correlates oncogene, CSF-1R (cFMS, CD115).9,10 cFMS is principally with histopathologic index of disease activity. These findings sug- expressed on mononuclear phagocytes, including progenitor gest that IL-34 is a promising novel therapeutic target for patients cells,11 monoblasts, promonocytes, monocytes,12 Mø,den- with lupus nephritis. dritic cells,13 and some epithelial cells.14,15 The discovery – fi that cFMS null mice were not viable, and that CSF-1 de cient (Fms-eGFP) mice expressing eGFP under the control of Fms fi mice survived, led to the identi cation of a second cFMS promoter and first intron, referred to as MacGreen, provided 16 ligand, known as IL-34. by David Hume (Roslin Institute, University of Edinburgh, IL-34 and CSF-1 have shared and differing properties. Both Edinburgh, Scotland)20;(2) (TgN[Csf1-Z]Ers7/+) mice ex- cytokines promote the growth and survival of monocytes and pressing lacZ under the control of Csf1 promoter and the first 17 formation of Mø colonies from BM, but differ in spatiotem- intron,21 referred to as TgZ mice, provided by Richard Stanley 17 poral expression in some adult and developing tissues, as (Albert Einstein College of Medicine, New York, NY); and (3) well as during disease. Although IL-34 and CSF-1 both signal tm1Mom fi B6.129S7-Rag1 /J (JAX). IL-34 KO mice deleted of Il34 through cFMS, a second IL-34 receptor, PTPRZ, was identi ed exons 3–5 and intercrossed with Il34 LacZ/+ offspring,22 pro- in brain.18 We elucidated a role for IL-34 using ischemia/ vided by Marco Colonna (Washington University, St. Louis, reperfusion renal injury (I/R),19 an acute model of tubular MO), were backcrossed onto the MRL-Faslpr background injury. However, unlike I/R, lupus nephritis is a systemic illness (backcrossed eight generations, then using “speed congenics” involving cell- and antibody-mediated mechanisms driving [JAX] at generations 4 and 6 we selected breeders with max- chronic tubulointerstitial and glomerular disease. Given the imal MRL-Faslpr genes). We bred and housed mice in the an- dissimilarities between IL-34 and CSF-1, and I/R and lupus imal facility at Harvard Medical School, Boston, MA. Use of nephritis, it is unclear whether IL-34–mediated mechanisms mice in this study was reviewed and approved by the Standing lead to lupus nephritis. Committee on Animals in the Harvard Medical School (Pro- To test the hypothesis that IL-34 is a potential therapeutic tocol #2016N000161), in adherence to standards set in the target for lupus nephritis, we compared IL-34 KO, wild-type lpr Guide for the Care and Use of Laboratory Animals (eighth (WT), and heterozygous (+/-) mice on the MRL-Fas back- ground during age-related advancing lupus nephritis. The edition, The National Academies Press, revised 2011). central questions are: (1) Do IL-34 and IL-34 receptors in- crease with progressive lupus nephritis in MRL-Faslpr mice? Serum and Renal Biopsy Specimens (2) Does deleting IL-34 suppress renal disease along with the Human renal biopsy specimens with the diagnosis of lupus fi fi systemic illness in MRL-Faslpr mice? (3) Is the accumulation of nephritis (as de ned by the ISN/RPS 2004 classi cation and Mø in lupus nephritis a result of IL-34–mediated mechanisms histopathology activity and chronicity indices) and of healthy within or outside of the kidney? (4) Are the IL-34 receptors, controls (patients with normal serum creatinine, no protein- cFMS and PTPRZ, expressed by different cells within and out- uria but dysmorphic erythrocytes in the urine, and no evidence side of the kidney? And (5) are the IL-34–dependent findings of kidneydisease in the kidney biopsy specimen) were provided in lupus-prone mice translatable to patients with lupus by the Department of Pathology, Friedrich-Alexander Univer- nephritis? sity Erlangen-Nuermberg, Germany.23 Renal pathologists, without access to the patient’s clinical data, evaluated these biopsy specimens. After informed consent, serum specimens METHODS were taken from patients who fulfilled the classification of SLE and diagnosis of lupus nephritis.24 Volunteers (age range, Mice 18–70 years) were screened for health by exclusion of any prior MRL-Faslpr, C57BL/6J, and B6.129S7-Rag1tm1Mom/J mice were kidney diseases, diabetes, hypertension, and autoimmune dis- purchased from The Jackson Laboratory (JAX), Bar Harbor, eases. Healthy controls had normal serum creatinine levels and ME. The following mutant mice were backcrossed onto the no proteinuria in spot urine (assessed by proteinuria and MRL-Faslpr background for more than ten generations: (1) albuminuria strip). Freshly voided urine and drawn blood

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 245 BASIC RESEARCH www.jasn.org samples were collected, centrifuged, aliquoted, and stored the numbers of: glomerular IgG and C3 deposits,7,32 intrarenal at 280°C before analysis as previously described.23 proliferating Mø and B cells,19 Mø, CD4 T cells, B220 unique double-negative T cells,29 apoptotic tubular epithelial cells Survival (TECs),7 and cells expressing PTPRZ.19 We assessed survival in IL-34 KO and WT MRL-Faslpr mice dying with renal disease (proteinuria). Human Kidney formalin-fixed tissue sections were stained for the pres- Gross Pathology ence of IL-34, cFMS, PTPRZ, Mø (CD68), B cells (CD19), and Lymphadenopathy (cervical, brachial, and inguinal) was T cells (CD3) in 20 randomly selected HPFs as previously de- graded as 0–4 (0=none; 1=small, one site; 2=moderate, two tailed.23 Antibodies used for immunostaining are listed in sites; 3=large, three sites; and 4=very large, four sites or more) Supplemental Table 2. and splenomegaly was analyzed by spleen weight upon eutha- Immunofluorescence and immunoperoxidase methods are nasia. Skin lesions were scored every 2 weeks from 1.5 months detailed in the Supplemental Material. of age as detailed in the Supplemental Material. Generating BMMø b-Galactosidase Mø were generated from mouse BM as previously detailed.7 b-Galactosidase staining was performed, as previously de- Briefly BM cells were isolated by flushing the mouse bone with scribed25 and detailed in the Supplemental Material. cold PBS, followed by culturing the BM cells in the presence of CSF-1 (10 ng/ml) in macrophage medium to separate adher- Immunoblotting ent differentiated cells. Wehomogenized mouse kidney tissues and performed western blotting for PTPRZ, a-Tubulin, ERK2, and GAPDH as Cocultures: Hypoxic or TNF-a–Stimulated TECs previously described.26 We performed SDS–PAGE (10% with BMMø acryl-amide) and western blotting of freshly isolated (bead We isolated and expanded TECs from IL-34 KO and WT MRL- isolation) human cell populations, granulocytes (CD66b+; Faslpr mouse kidneys, as previously reported.27 To isolate catalog no. 130–104–913), B cells (CD19+; catalog no. TECs, the renal cortex was diced into small pieces (,1 mm) 130–050–301), T cells (CD3+; catalog no. 130–050–101), and incubated in HBSS containing 0.2% collagenase II for and monocytes (CD14+; catalog no. 130–050–201) from 1 hour at 37°C in an oxygen-saturated atmosphere. The sam- Miltenyi Biotech, as previously described.27 After isolation, ple was then mashed through sieves of descending pore size PBL’s were stimulated for 4 hours with Poly I:C (catalog no. (smallest,40 mm). The filtrated cells were resuspended and Tlrl-pic, 10 mg/ml; Invitrogen) and LPS (catalog no. L2143; cultured in modified K1 medium containing 5% FBS (catalog Sigma-Aldrich) and CD14+ monocytes with CSF-1 (catalog no. 26–140–079; Gibco), 10 mg/ml EGF, 10 mM HEPES, m no. 300–25, 10 ng/ml; Prepro Tec). 0.5 mg/ml PGE2, 180 g/ml hydrocortisone, 100 U/ml penicillin, We stimulated monocytes to Mø for 7 days with CSF-1 and 100 mg/ml streptomycin. (catalog no. 300–25, 10 ng/ml) and GM-CSF-1 (catalog no. We cocultured TECs with BMMø for 48 hours under hyp- 315–03, 10 ng/ml; Prepro Tec) in a humified chamber at 37°C. oxic conditions (1% O2)with5%CO2-balanced nitrogen at 37°C in a hypoxic chamber. The number of apoptotic TECs 2 + Histopathology was analyzed by FACS gating on CD45 annexin-V cells. Cell We scored kidney pathology in periodic acid–Schiff–stained supernatants from hypoxic or TNF-a–stimulated TECs were paraffin sections, as previously detailed.28 Paraffin sections of collected and analyzed for IL-34 and CSF-1 expression by the submandibular salivary gland stained with H&E were eval- ELISA. To neutralize IL-34 and CSF-1 activity in the superna- uated as previously described29 and detailed in the Supple- tants of TNF-a–stimulated TECs (WT), we added anti–IL-34 mental Material. antibody (10 mg/ml, catalog no. AF5195; R&D Systems) and anti–CSF-1 antibody (2 mg/ml, 552513; BD Biosciences). We Renal Function incubated TECs with TNF-a (25 ng/ml for 18 hours) before We analyzed albuminuria levels30 from urine collected over 8 analyzing TEC apoptosis using the Toxilight assay. hours by SDS–PAGE and BUN and serum creatinine levels as previously described28,31 and detailed in the Supplemental ELISA Material. Proteinuria was screened using Albustix. To quantify intrarenal IL-34 and CSF-1 levels in mice we used mouse IL-34 ELISA kit (R&D Systems), another IL-34 ELISA Immunostaining (detailed in the Supplemental Material), and CSF-1 ELISA, as Mouse previously detailed,33 and the human IL-34 and CSF-1 DuoSet To identify intrarenal cFMS-bearing cells, we analyzed eGFP+ ELISA kits (R&D Systems). We measured serum total IgG and cells per high-power field (HPF) using MacGreen MRL-Faslpr ds-DNA antibody levels by ELISA as detailed in the Supple- as previously described.20 As previously detailed, we analyzed mental Material.

246 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH

Monocytes, T, and B Cell Purification (Mouse) To determine whether IL-34 and CSF-1, which share the cFMS Monocytes (catalog no. 130–100–629; Miltenyi) were isolated from receptor, are similarly expressed, we compared the locale and 2 BM. CD3+ T cells (catalog no. 8802–6840–74; MagniSort), CD4+ magnitude of these ligands in the kidney using IL-34lacZ+/ T cells (catalog no. 130–104–454; Miltenyi), and B cells (catalog no. MRL-Faslpr and TgZ MRL-Faslpr (CSF-1) reporter mice during 130–090–862; Miltenyi) were isolated from 3-month MRL-Faslpr the age-related progression of renal pathology: at 1.5 (before), spleen suspensions according to manufacturer instructions. 3.0 (mild), and 5.0 (severe) months of age. IL-34, similar to CSF-1, is robustly expressed in TECs in MRL-Faslpr mice with qPCR severe lupus nephritis (protein Figure 1A). Expression of both qPCR was performed as previously described.29 We detected intrarenal IL-34 and CSF-1 rises (transcripts Supplemental CSF-1, IL-34, cFMS, PTPRZ, and GAPDH using QuantiTect Figure 1A, protein Figure 1B) and is higher in the medulla Primer Assays (QIAGEN) or using primers purchased from than the cortex (Supplemental Figure 1B) during the age- Invitrogen and Integrated DNATechnologies. The data were an- related progression of lupus nephritis. Moreover, IL-34 is elevated alyzed by the DD-CTmethod. Primers are listed in Supplemental in the serum of MRL-Faslpr mice compared with non–lupus- Table 3. Further details are given in the Supplemental Material. prone C57BL/6 (B6) mice (Supplemental Figure 1C). Thus, the expression of IL-34 and CSF-1 similarly increases in TECs with BrdU Incorporation advancing lupus nephritis in MRL-Faslpr mice. Weinjected mice (ip) with BrdU (2 mg/mouse; EMD Millipore) 3 hours before euthanasia. BrdU+ cells were analyzed with an IL-34 Receptors Both Rise in the Kidney with anti-BrdU antibody by flow cytometry. Advancing Lupus Nephritis in MRL-Faslpr Mice Because IL-34 engages with two cognate receptors, cFMS and FACS PTPRZ,18,35 we determined whether both receptors increase We prepared and stained single-cell suspensions from kidneys, during the progression of lupus nephritis in MRL-Faslpr mice. RBC-lysed BM, and blood cells for intracellular and extracellular cFMS and PTPRZ transcripts rise with advancing lupus nephritis antigens as previously described.30 Briefly, after removing the (Figure 1C). By tracking a cFMS reporter gene (eGFP [enhanced capsule, kidneys were digested in collagenase IV for 1 hour at green fluorescent protein] identifies cFMS in MacGreen MRL- 37°C, mashed through a 40-mm sieve, and washed with PBS. Faslpr mice), we found that intrarenal cFMS expression increases Cells were collected by centrifugation. RBCs were lysed using during lupus nephritis (Figure 1D). Similarly, intrarenal PTPRZ ACK lysing buffer (BioSource International, Camarillo, CA) and protein increases during lupus nephritis (western blot, Figure the remaining cells were washed in PBS. FACS buffer (PBS, 1E). Collectively, along with IL-34, intrarenal cFMS and PTPRZ 5% BSA) was used to wash the cells and dilute antibodies. An- expression rises with advancing lupus nephritis. tibodies used for FACS are listed in Supplemental Table 4. IL-34 Promotes Pathology and Loss of Renal Function Statistical Analyses in MRL-Faslpr Mice with Lupus Nephritis Data represent the mean6SEM prepared using Graph-Pad TodeterminewhetherIL-34driveslupusnephritis,weprobedfor Prism software, version 5.0, or Excel. We used the Mann– the age-related loss of renal function and magnitude of re- Whitney U test to evaluate P values, the Cox proportional nal pathology in IL-34 KO MRL-Faslpr mice compared with hazards model with a single variable run for the IL-34 group WT and +/- mice (Figure 2A). Albuminuria, serum creatinine, using PROC PHREG of SAS for survival, and Spearman and BUN levels are suppressed in IL-34 MRL-Faslpr KO com- correlation coefficient for correlation. pared with WT and +/- mice (Figure 2B). Consistent with improved renal function, glomerular, tubular-interstitial, and Human Study Approval peri-vascular pathology (Figure 2C) and IgG and C3 within glo- Specimens for human study were taken after informed consent and merular peripheral loops (Figure 2D) decrease in the absence of their use was approved by the Standing Committee for Clinical IL-34. Of note, IL-34 levels in the serum (Supplemental Figure Studies of the Johannes-Gutenberg University, Mainz, Germany, 1D) and kidney (data not shown) were similar in IL-34 WTand in adherence to the Declaration of Helsinki; specimens were ana- +/- MRL-Faslpr mice. Thus, IL-34 promotes renal pathology and lyzed retrospectively. The protocol number is 837.467.13 (9152-F). the loss of renal function in MRL-Faslpr mice.

IL-34 Shortens Survival and Promotes Systemic Illness RESULTS in MRL-Faslpr Mice Because IL-34 promotes lupus nephritis, we determined IL-34 and CSF-1 Are Expressed by TECs and Increase whether IL-34 contributed to mortality in MRL-Faslpr WT in the Kidney with Advancing Lupus Nephritis in mice. IL-34 KO MRL-Faslpr mice survive longer than WT MRL-Faslpr Mice mice (P,0.02, Figure 3A). These mice died with renal disease Previously, we established that CSF-1 is expressed by TECs and because proteinuria was substantially elevated before death that this expression rises with advancing lupus nephritis.14,34 (not shown). Thus, IL-34 shortens survival in MRL-Faslpr mice.

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 247 BASIC RESEARCH www.jasn.org

A B IL-34 IL-34 n=5/group **p<0.01 n=3/group ** * *p<0.05 12 4 ** IL-34

0 0 30 m 300 m 300 m

CSF-1 CSF-1 n=4-6/group +p<0.06 n=2-4/group * *p<0.05 10 4 + * Postive tubules/HPF CSF-1 Protein (ng/ml)-Homogenates

30 m 300 m 300 m 0 0 Age (mo) 1.5 5.0 1.5 5.03.0 5.0 mo 1.5 mo

C D E cFMS PTPRZ cFMS PTPRZ * n=4/group n=3/group 5 * 10 *p<0.05 * **p<0.01 * Age (mo) 1.5 5.0 n=4-5/group 40 * 5 ** n=4-5/group *p<0.05 *p<0.05 250 Kda PTPRZ HPF expression -Tubulin

Relative mRNA 50 Kda Fold PTPRZ 0 0 eGFP+cells/ 0 0 Age (mo) 1.5 3.0 5.0 1.5 3.0 5.0 Age (mo) 1.5 5.0 Age (mo) 1.5 5.0

Figure 1. IL-34 ligand and receptors rise during advancing lupus nephritis in MRL-Faslpr mice. (A) IL-34 and CSF-1 expression in kidney of MRL-Faslpr mice identified using IL-34LacZ/+ MRL-Faslpr mice and TgZ MRL-Faslpr mice stained for b-galactosidase activity (X-gal) (original maginification, 34; inset, 340). (B) Intrarenal IL-34 and CSF-1 in kidney homogenates analyzed by ELISA. (C) cFMS and PTPRZ transcripts in kidney analyzed by qPCR. Values are normalized to GAPDH transcript and expressed as relative ratio. (D) Intrarenal cFMS expression identified using MacGreen MRL-Faslpr mice (eGFP under control of the cFMS). (E) Intrarenal PTPRZ protein levels analyzed by western blotting. Graph of PTPRZ relative to a-Tubulin. Data are mean6SEM. Mann–Whitney U test was used for statistical analysis.

Multiorgan systemic disease is characteristic of lupus in in the absence of IL-34 (Supplemental Figure 3). Note, there patients and MRL-Faslpr mice.36–38 We detected suppression are few neutrophils among the intrarenal neutrophils of the hallmarks of systemic illness in IL-34 KO MRL-Faslpr (CD45+CD11b+Ly6G+F4/802)inMRL-Faslpr mice with mice, including: circulating IgG and double-stranded DNA lupus nephritis and we did not detect a difference in these (dsDNA) (Figure 3B), sialadenitis (Figure 3C and Supplemen- neutrophils with and without IL-34 (data not shown). Thus, tal Figure 2), skin lesions (Figure 3D), lymphadenopathy, and deleting IL-34 suppresses intrarenal Mø, T, and B cells in lupus splenomegaly (Figure 3E). Collectively, deleting IL-34 suppresses nephritis. renal disease and systemic illness in MRL-Faslpr mice. Does IL-34 induce intrarenal chemokines that attract Mø, T, and B cells into the kidney and thereby promote lupus IL-34 Fosters Intrarenal Mø, T, and B Cells in MRL-Faslpr nephritis? Intrarenal chemokines, known to recruit Mø,T, Mice by Inducing Chemokines in Lupus Nephritis and B cells, are suppressed in IL-34 KO compared with WT Because IL-34 promotes Mø proliferation, we probed for the ac- and +/- MRL-Faslpr mice (Figure 4B). On the basis of our prior cumulation of intrarenal Mø in IL-34 KO and WT MRL-Faslpr studies in I/R, IL-34 does not directly recruit BM-derived cells mice. We detected a suppression in Mø, T, and B cells in IL-34 into the inflamed kidney.19 Moreover, multiple intrarenal cy- KO compared with WT and +/- MRL-Faslpr kidneys during tokines that lead to chemokine induction are amplified in WT advancing lupus nephritis (FACS Figure 4A, immunostaining compared with IL-34 KO MRL-Faslpr mice (Figure 4C). Col- Supplemental Figure 3). Moreover, intrarenal B220+ cells lectively, IL-34 induces intrarenal cytokines known to increase 2 2 which include B cells and the unique CD4 CD8 T cells that chemokines that recruit Mø, T, and B cells into the kidney, increase in inflamed tissues in MRL-Faslpr mice are decreased and, thereby, drive inflammation in MRL-Faslpr mice.

248 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH

A B Scheme Albuminuria Serum creatinine BUN * ** * lpr 120 ** 0.8 MRL- Fas IL-34: KO ** 40 ** +/– KO WT +/– * WT **

 g/8h *p<0.05 mg/dL mg/dL **p<0.01 Age (mo) 1.5 3.0 5.0

0 0 0 Age (mo) 1.5 3.0 5.0 1.5 3.0 5.0 1.5 3.0 5.0 n= 3-4 7-10 15-25 n= 5-6 7-8 15-26 n= 5-6 7-8 15-26

C D n=16-26/group IgG C3 *p<0.05 WT (1.5 mo) KO (5 mo) WT (5 mo) **p<0.01 Glomerular 3 * ** WT (1.5 mo) Glomerular 0 Tubulo-interstitial 3 **

** KO (5 mo) Tubulo/ interstitial 0

Perivascular WT (5 mo) Pathology score/HPF (5 mo) 3 ** ** IgG C3 n=6-14/group 3 3 * *p<0.05 (Cells) * * Perivascular 0 IL-34:KO +/– WT

Intensity (5 mo) 0 0 KO WT+/– KO +/– WT

Figure 2. Lupus nephritis is suppressed in IL-34 KO MRL-Faslpr mice. The following were compared: IL-34 KO, WT, and +/- MRL-Faslpr mice. (A) Schematic of experimental protocol. (B) Renal function including albuminuria, serum creatinine, and BUN levels. Dotted line in serum creatinine indicates the mean for B6 mice. (C) Representative photos of kidney stained with periodic acid–Schiff (original magnification, tubulo-interstitial and perivascular, 320; glomeruli 340). Quantification of glomerular, tubulo-interstitial, and peri- vascular pathology (5 months of age). Dotted lines in (C and D) indicate mean at 1.5 months of age (n=3). (D) Photos and graph of IgG and C3 deposition in MRL-Faslpr glomeruli at 5 months of age (original magnification, 340). Data are mean6SEM. Mann–Whitney U test was used for statistical analysis.

PTPRZ Is Expressed by TECs, T and B cells, and left graph). By comparison, because RAG KO MRL-Faslpr mice Monocytes/Mø during Lupus Nephritis (3 months) do not express PTPRZ, this suggests that PTPRZ is To probe for the function of IL-34 in lupus nephritis, it is im- expressed by Tand/or B cells (Figure 5C, right graph). Probing perative to identify the cell types expressing IL-34 receptors. It is further, we show for the first time that PTPRZ is expressed by well established that cFMS is expressed predominantly splenic Tand B cells and BM monocytes/Mø in mice with lupus by monocytes/Mø (Figure 5A). We now report that PTPRZ is (Figure 5C, upper panel). Moreover, using sequential expressed by renal intrinsic and infiltrating cells. Similar to our immunostained sections, we identified PTPRZ-expressing data in I/R in nonautoimmune mice,19 PTPRZ protein is expressed Tand B cells and Mø in the renal interstitium (Figure 5C, lower by TECs in mice with lupus nephritis (Figure 5B). However, we panel). Collectively, PTPRZ is robustly expressed in renal in- discovered the novel finding that renal infiltrating leukocytes trinsic TECs, T and B cells, and monocytes/Mø both systemi- express PTPRZ (Figure 5C). To identify the leukocytes that cally and in the kidney in MRL-Faslpr mice with lupus nephritis. express PTPRZ we first probed for expression in spleens from B6 and MRL-Faslpr WT and RAG KO (lack mature IL-34 Drives an Expansion of Mø within the Kidney and T and B cells) mice using western blotting (Figure 5C). En- BM during Lupus Nephritis larged spleens from MRL-Faslpr mice with lupus (3.0 months Because IL-34 promotes Mø proliferation, we tested the hy- of age) expressed more PTPRZ compared with age-matched B6 pothesis that IL-34–dependent Mø proliferation outside of and MRL-Faslpr mice before disease (1.5 months) (Figure 5C, and within the kidney leads to lupus nephritis. BM is a rich

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 249 BASIC RESEARCH www.jasn.org

A B Survival Serum IgG dsDNA Abs 100 IL-34: *p<0.05 *p<0.05 n=10/group n=10-11/group KO * * 2.5 1.2 WT

* % Survival mg/mL *p=0.02 OD (450 nm) n=14-19/group 0 0 0 02468101214 IL-34: KO WT+/– KO WT+/– Time (Months)

C E Sialadenitis Lymphadenopathy Splenomegaly * **p<0.01 IL-34: n=8-14/group * * ** 4 KO 1000 3 * ** +/– WT *p<0.05 *p<0.05 Score Spleen weight (mg)

Pathological score/HPF 0 0 0 KO WT+/– Age (mo) 1.5 3.0 5.0 1.5 3.0 5.0 n= 5-6 7-8 15-27 n= 5-6 7-8 15-27

D IL-34: IL-34: Skin Lesions 4 100 KO KO +/– +/– WT WT + WT * *p<0.05 * *p<0.05 * +p<0.06 *

1 cm Score

Incidence (%) * 0 0 KO Age (mo) 0 1.5 23456 1.5 3.0 5.0 1 cm n= 7-85-6 10-147-8 15-27 2-4 n= 3-4 7-8 15-27

Figure 3. Systemic illness is suppressed in IL-34 KO MRL-Faslpr mice. The following were compared: IL-34 KO, WT, and +/- MRL-Faslpr mice. (A) Survival. (B) Serum IgG and dsDNA antibody levels evaluated by ELISA. (C) Submandibular pathology (5 months of age). (D) Representative photos, incidence (left panel) and magnitude (right panel), of skin lesions. (E) Lymphadenopathy and splenomegaly. Dotted lines in (B and C) represent MRL-Faslpr mice at 1.5 months of age (n=3). Data are mean6SEM. Mann–Whitney U test was used for statistical analysis. source of Mø that traffictothekidneyduringinflammation. We fewer intrarenal proliferating Mø in the IL-34 KO compared find that the number of monocytes proliferating in the IL-34 KO with WT and +/- MRL-Faslpr mice with lupus nephritis (5 MRL-Faslpr BM is suppressed compared with WT (Figure 6A). months of age) (Figure 6B). Because IL-34 and CSF-1 both pro- Moreover, there are fewer circulating myeloid cells in IL-34 KO mote Mø proliferation, we determined whether CSF-1 compen- MRL-Faslpr mice. Thus, IL-34 increases BM monocytes and elevates sated for the absence of IL-34 by probing for expression of CSF-1 circulating monocytes that are available for chemokine recruitment in IL-34 KO, WT, and +/- MRL-Faslpr kidneys (5 months of age) into the kidney. To test the hypothesis that IL-34 promotes intra- and primary cultured TECs (Supplemental Figure 4). We renal Mø proliferation, we analyzed the number of intrarenal pro- detected similar expression of CSF-1 transcripts and se- liferating (Ki67+)Mø (F4/80) by immunostaining. We detected creted protein in the kidney (Supplemental Figure 4A) and

250 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH

A Mø T cell B cell ) ) ) 4 10 70 4 4 IL-34: 4 KO

+/– * *

WT ** ** * *p<0.05 * *

**p<0.01 * #CD45+Ly6G- ** * #CD45+CD11b- #CD45+CD11b- CD3e+CD19-(X10 CD3e-CD19+(X10 CD11b+F4/80+(X10 0 0 0 Age (mo) 0 1.5 3.0 5.0 0 1.5 3.0 5.0 0 1.5 3.0 5.0 n= 5-7 7-8 9-18 n= 5-6 7-8 7-10 n= 5-6 6-8 8-11

B Intra-renal chemokines (5 mo) MCP-1/CCL2 MIP-1/CCL3 RANTES/CCL5 * 8 * 80 ** 40 + *

n=9-15/group +p<0.07

expression *p<0.05 Relative mRNA 0 0 0 **p<0.01 IL-34: KO+/– WT KO WT+/– KO WT+/–

Mø

IP-10/CXCL10 MIG/CXCL9 I-TAC/CXCL11 BCA-1/CXCL13 40 * ** * * 80 60 40 ** + ** ** expression Relative mRNA 0 0 0 0 IL-34:KO +/– WT KO WT+/– KO+/– WT KO WT+/–

T cell B cell

n=10-14/group C Intra-renal cytokines (5 mo) *p<0.05 TNF- IL-1 **p<0.01 IFN- IL-10 * * 50 ** 30 50 60 ANRmevi * * * nois s e r t p al x e e R 0 0 0 0 IL-34:KO +/– WT KO+/– WT KO WT+/– KO WT+/–

Figure 4. Mø, T, and B cell accumulation and their respective chemokines and cytokines are suppressed in MRL-Faslpr mice. The following were compared: IL-34 KO, WT, and +/- MRL-Faslpr mice. (A) Age-related numbers of Mø, T, and B cells analyzed by FACS. (B) Intrarenal chemokine transcripts known to recruit Mø, T, and B cells. (C) Intrarenal cytokines transcripts. Mice in (B and C) are 5 months of age and dotted lines indicate mean levels at 1.5 months of age (n=4). Values are normalized to GAPDH or b-actin (for BCA- 1/CXCL13) transcripts and expressed as relative ratio. Data are mean6SEM. Mann–Whitney U test was used for statistical analysis. stimulated TECs (Supplemental Figure 4B) in IL-34 KO, WT, IL-34 Promotes Mø-Mediated TEC Apoptosis in and +/- MRL-Faslpr mice. Thus, CSF-1 does not compensate for MRL-Faslpr Mice the absence of IL-34, a finding consistent with the deletion of IL- To test the hypothesis that IL-34 promotes TEC apoptosis 34 suppressing lupus nephritis in MRL-Faslpr mice. Collectively, during lupus nephritis, we did in situ and in vitro experiments. nonredundant IL-34–dependent mechanisms within and out- We detected fewer apoptotic cells (caspase-3+) in the IL-34 KO side of the kidney contribute to lupus nephritis. compared with WTand 6 MRL-Faslpr mice (5 months of age)

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 251 BASIC RESEARCH www.jasn.org

A B cFMS PTPRZ-TEC + PTPRZ cFMS-eGFP 80µm 1.5 mo 80µm 5.0 mo

20µm 20µm 20µm

Control (B6 - 5.0 mo) 1.5 mo 5.0 mo

C PTPRZ -Leukocytes 2. Spleen 1. Kidney PTPRZ PTPRZ

ERK2 GAPDH lpr lpr

Age (mo) B6 B6 1.5 3.0 1.5 3.0 B6 MRL-Faslpr

3. Subpopulations MRL- Fas MRL- Fas 20µm Rag KO

Systemic: T cells (CD4) T cells (CD3) B cells Monocytes

PTPRZ

Actin Kidney: CD20 PTPRZ

20µm 20µm

CD3 PTPRZ

20µm 20µm

F4/80 PTPRZ

20µm 20µm

Figure 5. PTPRZ is expressed by TECs and hematopoietic kidney infiltrates. (A) Intrarenal cFMS expression identified using MacGreen MRL-Faslpr mice (eGFP under control of the cFMS). Representative photos of cFMS+ cells (original magnification, 340). (B) Intrarenal PTPRZ protein in MRL-Faslpr mice at 1.5 and 5.0 months of age compared with control (B6 mice, 5 months of age) using

252 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH by immunostaining (Figure 6C). These apoptotic cells were Because plasma cells develop in secondary lymphoid organs, TECs along with cells in the interstitium (Figure 6C) and we probed for the effect of IL-34 on splenic B cells. Similar to glomeruli. This was confirmed by enumerating intrarenal the kidney, we detected fewer proliferating B cells in the spleens caspase-3+E-cadherin+ cells by FACS analysis (Figure 6C). of MRL-Faslpr IL-34 KO mice compared with WT (Figure 7C). Note, these studies are limited, because we did not analyze Note, this change began before overt pathology, a finding con- nonapoptotic, caspase-independent forms of cell death. To sistent with prior reports.39 Collectively, these findings sug- determine whether IL-34 promotes Mø-mediated TEC apo- gest that PTPRZ may have a yet-to-be-appreciated effect on B ptosis in MRL-Faslpr kidneys, we exposed BMMø cocultured cell biology. with either IL-34 KO or WT TECs to hypoxia (see Figure 6D for scheme). There are fewer hypoxia-induced apoptotic Elevated Serum and Urine IL-34 in Patients with Lupus TECs in IL-34 KO MRL-Faslpr compared with WT TECs Nephritis and Similar Cell Types in Mice and Humans (Figure 6D). This was verified by substituting TNF-a with Lupus Nephritis Express IL-34 in place of hypoxia and neutralizing IL-34 with anti–IL-34 To determine whether our findings in mice are translational to antibody instead of using IL-34 KO mice (Figure 6D). human lupus, we tested the hypothesis that IL-34 is upregulated Note, there are fewer Mø when cocultured with IL-34 KO in patients with lupus nephritis. We detected elevated IL-34 MRL-Faslpr compared with WT TECs under hypoxic condi- levels in the serum and urine of patients with lupus nephritis tions (Figure 6D). Moreover, as in MRL-Faslpr kidneys with compared with healthy volunteers (Figure 8A, and demograph- lupus nephritis (Supplemental Figure 5A), BMMø skew ics, Supplemental Table 1). Using immunostaining in kidney toward a cyto-destructive M1 phenotype when cocultured sequential sections from patients with lupus nephritis versus with hypoxic TECs (Supplemental Figure 5B). However, healthy controls, we detected both IL-34 and CSF-1 in TECs, IL-34 does not skew the Mø phenotype. The numbers of but not necessarily in the same TECs (Figure 8B, and demo- M1 and M2 Mø in the presence or absence of IL-34 broadly graphics, Supplemental Table 1). IL-34 expression correlates donotdifferinMRL-Faslpr kidney (Supplemental Figure with the number of intrarenal Mø and T cells in patients with 5C). Collectively, these results suggest that IL-34 does not type II–IV lupus nephritis (Supplemental Figure 7A) and his- polarize, but, rather, increases the number of activated topathology disease activity (Supplemental Figure 7B). How- Mø in the inflamed kidney that, in turn, mediate TEC ever, IL-34 does not correlate with chronicity (Supplemental apoptosis. Figure 7B), a finding consistent with the progressive loss of TECs, the main source of IL-34. Thus, IL-34 is a potential IL-34 Promotes Intrarenal B Cell Activation and therapeutic target for lupus nephritis during escalating renal Proliferation during Lupus Nephritis inflammation, but not end-stage disease. Naïve B cells encountering antigen in the presence of CD4+ T To determine the level of expression and locale of IL-34 re- cells become activated, proliferate, and differentiate into ceptors in patients with lupus nephritis, we stained sequential effector B cells that produce antibody. Because fewer anti- sections for cFMS and PTPRZ. Although cFMS and PTPRZ bodies are in the circulation and lodge in glomeruli of IL-34 are both detected in TECs, cFMS is more robustly expressed KO MRL-Faslpr mice, we tested the hypothesis that IL-34 in- (Figure 8C). Note, these receptors are often, but not always, creases intrarenal B cell activation and proliferation during expressed by the same TECs (Figure 8C). Are IL-34 receptors lupus nephritis. Using B cell activation markers and gating expressed by renal infiltrating cells? Although it is well estab- on CD45+ and CD19+ cells, we detected suppression of intra- lished that cFMS is expressed by Mø, we now report the novel renal activated B cell number and frequency in IL-34 KO com- finding that PTPRZ is expressed by leukocytes. We detect pared with +/- MRL-Faslpr mice with lupus nephritis (Figure PTPRZ protein in renal infiltrates (immunostaining, Figure 7A). This could be the result of the increased infiltration or 8C, left) and T and B cells and monocytes/Mø (cultured and enhanced B cell activation within the 6 MRL-Faslpr kidney. stimulated) isolated from the buffy coat of patients with lupus Moreover, intrarenal B cell proliferation is suppressed in IL-34 nephritis and healthy controls (western blotting, Figure 8C, KO compared with 6 or WT MRL-Faslpr mice (immunostain- right, and demographics, Supplemental Table 1). Thus, ing, Figure 7B and Supplemental Figure 6, and FACS, Figure 7B). IL-34, cFMS, and PTPRZ are similarly expressed in mice and

immunostaining; representative photos (original magnification, 340). (C) 1. Intrarenal PTPRZ expression in infiltrates of MRL-Faslpr mice (5 months of age) using immunostaining (original magnification, 340; insert, 360). 2. Western blots of PTPRZ expression in spleens from: Left panel: B6 and MRL-Faslpr WT mice 1.5 and 3.0 months of age. Right panel: RAG KO and WT B6 and MRL-Faslpr mice 3.0 months of age. Both ERK2 and GAPDH were used to ensure equal protein loading, but only one displayed. 3. Upper panel: Western blot of T and B cells isolated from spleens and BM monocytes from MRL-Faslpr mice at 4 months of age (n=3 pooled samples). Representative of five experiments. Lower panel: Kidney sections (MRL-Faslpr, 3 months of age) sequentially stained for the presence of B (CD20) and T (CD3) cells, Mø (F4/80), and PTPRZ. Representative photos (original magnification, 340; boxed enlargement, 360). Circles encompass the same area stained for the presence of PTPRZ and leukocytic markers.

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 253 BASIC RESEARCH www.jasn.org

A B Bone marrow Blood Intra-renal ** * 20 ** 45 12 n=5-8/group n=5-8/group * +

- **p<0.01 *p=0.05 +

+ n=5-6/group *p<0.05 Ly6G Ki-67 CD11b + **p<0.01 F4/80 + +

+ cells/HPF Ki-67 CD11b %CD45 %CD45

0 0 0 IL-34: KO WT KO WT KO +/– WT

C Caspase-3 1. WT (1.5 mo) KO (5 mo) +/– (5 mo) 2. 5 8 ** + ) 4

* + n=5/group /HPF + (x10

+ + p=0.08 n=5-6/grp *p<0.05 **p<0.01 # caspase-3 # caspase-3 E-cadherin 40m 40m 40m 20m 0 0 – IL-34: KO+/– WT KO +/–

D 1. Apoptotic TEC (Hypoxia)

Scheme: IL-34 TEC: 10000 * M TNF- or Hypoxia 5000 0 18-48 h 2000 n=3/group Co-culture *p<0.05 CD45- cells Serum-free # Annexin-V+

0 TEC TEC apoptosis Hypoxia ––––++++ Mø – –++––++

KO WT

2. Apoptotic TEC (TNF-) 3. # Mø (Hypoxia) n=6/group *p<0.05 **p<0.01 IL-34 TEC: * 10 1500

4 * * ** n=3/group *p<0.05 5 # F4/80+ cells Toxilight IU x10 0 0 TNF- –+ +++ Hypoxia ––––++++ Mø (WT) –– + + + Mø – –++––++ IL-34Ab –– –+– KO WT Rabbit-IgG –– ––+

Figure 6. Intrarenal Mø proliferation and Mø-mediated TEC apoptosis are suppressed in IL-34 KO MRL-Faslpr mice. (A) Proliferation of myeloid progenitors in BM (left panel) and myeloid cells in peripheral blood (right panel) of IL-34 KO and WT MRL-Faslpr mice at 5 months of age analyzed by FACS. (B) Intrarenal Mø proliferation quantified by dual staining for Ki-67 and F4/80 in IL-34 KO, WT, and +/-MRL-Faslpr mice (5 months of age). (C) Intrarenal apoptosis identified using caspase-3 in IL-34 KO, WT, and +/- MRL-Faslpr mice at 5 months of age. Arrows, caspase-3+ cells. 1. Representative photos of tubules and interstitial infiltrates. Graph, analysis of ten HPFs/ sample. 2. TEC apoptosis. Quantitation of caspase-3+ e-cadherin+ cell number analyzed by FACS. Dotted line in (B and C) indicates mean at 1.5 months of age. (D) Scheme for in vitro analysis of TECs cocultured with Mø under hypoxic conditions (1% O2 for 48 hours) 2 or with TNF-a (25 ng/ml for 18 hours). 1. Hypoxia: Apoptotic TECs (Annexin V+ CD45 )analyzedbyFACS.2.TNF-a (25 ng/ml for 18 hours): Apoptotic TECs analyzed by toxilight assay. 3. Hypoxia: Mø (F4/80+) number after coculture with TECs analyzed by FACS. Data are mean6SEM. Mann–Whitney U test was used for statistical analysis.

254 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH

A Activated B cell within the Kidney IL-34: KO +/- *p<0.05 39.6 54.9 )

3 Number IL-34: Frequency +p<0.07 7 80 * KO n=5-6/group * CD86

+/– cells + cells (x10 + 32.4 55.2 + * CD19 + CD19 CD69 +

0 %CD45 0

#CD45 CD86 CD69 CD23 CD86 CD69 CD23 41.8 63.4 CD23 B Kidney B cell proliferation SSC-A 1. Immunostaining 2. Flow cytometry Number Frequency + + 16 20 6 * + ) Ki67 n=5/group n=4/group cells 3 + +p<0.07 *p<0.05 + /CD19 + CD19 CD19 + + cells (x10 cells (HPF) %Ki67+ among %Ki67

0 0 CD45 0 IL-34: KO WT #CD45 KO +/- KO +/- C Splenic B cell proliferation 1. Immunostaining 2. Flow cytometry n=4-5/group Frequency 3 *p<0.05 Number 6

+ **p<0.01 * 12 ** ** cells + BrdU ) 3 + among + CD19 CD19 + + cells (x10 %BrdU #Ki67+/CD19+ area 0 0 CD45 0 n= 10 55 736 #CD45 KO +/- KO +/- KO +/- KO +/- IL-34: WT+/-KOWT+/-KO 1.5 mo 3.0 mo 1.5 mo 3.0 mo 1.5 mo 3.0 mo

Figure 7. Intrarenal activated B cells and proliferating B cells in the kidney and spleen are reduced in IL-34 KO MRL-Faslpr mice. (A) Activated B cell number and frequency in IL-34 KO and WT MRL-Faslpr mice (5 months of age) analyzed by FACS. (B) Proliferating B cells in IL-34 KO and WT MRL-Faslpr kidney (5 months of age): 1. Dual cryo-sections stained for CD19 and Ki67 (5 HPF/sample) and 2. gated on CD45+CD19+ Ki67+ cells in whole kidney; FACS analysis. Dotted lines indicate mean levels at 1.5 months of age (n=2). (C) Proliferating B cells in IL-34 KO and WT MRL-Faslpr spleens (1.5 and 3.0 months of age) quantified using: 1. Cryo-sections immuno- stained for CD19 and Ki67 (5 HPF/sample) and 2. FACS by gating on CD45+CD19+BrdU+ cells. Data are mean6SEM. Mann–Whitney U test was used for statistical analysis. patients with lupus nephritis. Collectively, our data suggest that increase during the progression of lupus nephritis; (2) IL-34 IL-34 is a promising therapeutic target for lupus nephritis. is largely expressed by TECs, cFMS is mainly expressed by Mø, whereas PTPRZ is expressed by systemic and intrarenal T and B cells and monocytes/Mø;(3) lupus nephritis, along with the DISCUSSION systemic illness, is suppressed in IL-34 KO mice, and thereby extends survival; (4) fewer intrarenal Mø, T, and B cells accu- We now report that targeting IL-34 is a potential therapeutic mulate in IL-34 KO mice, a finding congruent with a reduction target for lupus nephritis. Using a reliable and reproducible in chemokines known to recruit Mø,T,andBcells;(5) intra- model of lupus, MRL-Faslpr mice, we determined that: (1) renal Mø accumulation is dependent on IL-34 fostering an intrarenal IL-34, and IL-34 receptors, cFMS and PTPRZ, expansion of monocytes in the BM and the subsequent rise

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 255 BASIC RESEARCH www.jasn.org

A B Serum/Urine IL-34 IL-34/CSF-1 Serum Lupus Nephritis Healthy control **** 1000 IL-34 CSF-1 IL-34 CSF-1 750 500 250 0

IL-34 serum (pg/ml) serum IL-34 n = 120 62 20µm 20µm 20µm 20µm Urine 400 **** TEC TEC 60 * n=25 *p<0.05 200 30 *

0

IL-34 urine (pg/ml) control n = 72 45 0 % positive TEC/HPF SLE with Lupus Nephritis IL-34CSF-1 Healthy control only IL-34 ****p<0.0001 dual-positive only CSF-1

C IL-34/CSF-1 Receptors C1. PTPRZ on parenchymal cells Lupus Nephritis Healthy control cFMS PTPRZ cFMS PTPRZ cFMS & PTPRZ

40 * n=15 * 20 *p<0.05

20µm 20µm 20µm 20µm control 0 % positive TEC/HPF cFMS PTPRZ only cFMS dual-positiveonly PTPRZ

C2. PTPRZ renal infiltrates (monocytes cFMS PTPRZ kDa Ø PBLs stimulated) T cells (CD3) B-cells (CD19) Monocyte (CD14) M Jurkat 250 PTPRZ SLE 43 Actin

Healthy 250 PTPRZ 20µm 20µm Control 43 Actin

Figure 8. Serum and urine IL-34 are elevated in patients with SLE and IL-34 receptors are expressed on distinct cell types in patients with lupus nephritis. (A) Serum and urine IL-34 in patients with lupus nephritis or healthy controls. (B) IL-34/CSF-1 expression in renal TEC of lupus nephritis biopsy specimens and healthy controls (kidney biopsy specimen without inflammatory kidney disease); representative photos (original magnification [340], bottom part shows enlarged extracted part of the original image) and graph of expression. (C) 1. cFMS and PTPRZ expression in TECs of lupus nephritis biopsy specimens and healthy controls; representative photos (original magnification, 340) and graph of expression. Data are mean6SEM. Mann–Whitney U test was used for statistical analysis. 2. Left panel: Intrarenal infiltrates expressing cFMS and PTPRZ by immunostaining. Right panel: PTPRZ expression in leukocyte subpopulations isolated from whole blood (T and B cells, monocytes/Mø). Jurkat cells served as positive control (n=3 SLE, n=4 healthy control). Volunteers (healthy controls) were screened for exclusion of prior kidney and autoimmune diseases, diabetes, and hypertension.

256 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH in circulating monocytes that are recruited to the kidney; neoantigens and thereby induce autoantibodies that deposit (6) within the kidney, TEC expression of IL-34 induces Mø in glomeruli.7 With the novel discovery of PTPRZ expression proliferation which amplifies Mø-mediated TEC apoptosis; on Tand B cells along with monocytes/Mø, IL-34 may directly and (7) there are fewer proliferating intrarenal and splenic stimulate autoantibodies by binding to PTPRZ on B cells. Add- B cells in IL-34 KO mice, a finding consistent with reduced ing complexity to a potential role for PTPRZ in lupus nephritis, antibodies in the circulation and glomeruli. Moreover, our PTPRZ engages a multitude of other ligands,48 including hepa- IL-34–dependent findings in mice and patients with lupus rin binding growth factors midkine and pleiotrophin,49 the cell nephritis are translatable. Collectively, we suggest that IL-34 surface protein contactin,50 and the extracellular matrix protein is a potential therapeutic target for patients with lupus nephri- tenacin-R.51 Therefore, even though PTPRZ is expressed by tis and other systemic forms of this illness. Tand B cells and monocytes/Mø in lupus nephritis, ligands other Intrarenal and circulating IL-34 promotes lupus. We show than IL-34 may activate these leukocytes. The biologic signifi- that systemically depleted IL-34 suppresses pathology in mul- cance of the newly discovered PTPRZ expression on Tand B cells tiple tissues, including kidney, skin, and salivary glands, and monocytes/Mø has yet to be elucidated and undoubtedly lpr targeted for autoimmune destruction in MRL-Fas mice. Be- will seed future in-depth analyses in lupus nephritis and a broad cause IL-34 is expressed within tissues, for example by TECs in range of other diseases. the kidney, keratinocytes in the mouse skin,40 and ductal Our studies indicate that IL-34 drives disease, at least in the epithelial cells in human salivary glands,41 and IL-34 fosters kidney. However, one group reported that IL-34 inhibited allo- intrarenal proliferation of destructive Mø,19 eliminating IL-34 genic rejection in a rat cardiac transplant model and showed that within tissues likely attenuates lupus. On the other hand, IL-34 IL-34–stimulated human Mø expand Tregs.52 This finding is not in the circulation alone may contribute to renal disease. This consistent with a rise in serum IL-34 during kidney transplant concept is on the basis of the present and previous findings rejection,19 nor a rise in serum IL-34 in inflammatory bowel indicating that IL-34 promotes an increase in monocytes in disease53 in patients. On the other hand, CSF-1 promotes repair the BM that are recruited to the inflamed kidney and subse- in an acute model of renal injury19 and drives CKD in MRL-Faslpr quently mediate injury.19 Moreover, we show that serum IL-34 mice.14 Thus, the actions of IL-34 may differ depending on the lpr is elevated in MRL-Fas mice with lupus nephritis and that species, tissue, model, mechanism, microenvironment etc. serum IL-34 is upregulated and tracks with histopathology Clearly, unraveling the possible diverse actions of IL-34 in various disease activity in lupus patients with nephritis. Importantly, diseases requires further clarification. others previously reported that serum IL-34 is upregulated Why target IL-34, rather than CSF-1, or IL-34 along with CSF-1? and tracks with disease activity in patients with lupus.42,43 IL-34 is likely a safer therapeutic target for lupus nephritis than Taken together, we suggest that blocking IL-34 within the kid- CSF-1. This is on the basis of several findings. Mice deficient in ney and/or the circulation will suppress lupus nephritis. CSF-1 (osteopetrotic, op/op mice) are fraught with abnormalities, IL-34 induces intrarenal chemokines, known to recruit Mø,T, including infertility, altered estrogen and androgen regulation, low and B cells. Our prior data suggest that IL-34 indirectly recruits body weight, abnormal lipid metabolism, deafness, blindness, skel- fl 19 Mø into the in amed kidney. In support of this, IL-34 upre- etal abnormalities, osteopetrosis, reduced B cell lymphopoiesis, and 44 b a45 gulates cytokines such as IL-6, IL-1 ,andTNF- that induce dermal and synovial defects.54,55 Moreover, cFMS KO mice do not MCP-1. Alternatively, because IL-34 stimulates the expression of survive.56 Because IL-34 and CSF-1 are the sole ligands for this chemokines, such as MCP-1, IP-10, and IL-8, in whole human receptor, blocking both cytokines undoubtedly will be problem- 46 blood, it is possible that IL-34 directly stimulates leukocytes atic. By comparison, IL-34 KO mice do not express overt phe- in blood to express chemokines that within the kidney foster notypic abnormalities, other than a decline in Langerhans cells – further leukocyte recruitment. This is compatible with IL-34 and microglia that occurs during development.22 However, mediated events outside of the kidney contributing to intrarenal even if IL-34 reduced Langerhans cells and microglia after de- fl in ammation. Irrespective of the exact mechanism, eliminating velopment, blocking IL-34 in the adult is not a concern for IL-34 reduces intrarenal chemokines, leukocytes, and inflamma- lpr several reasons: (1) cutaneous (discoid) lupus is suppressed in tion and, in turn, suppresses lupus nephritis in MRL-Fas mice. IL-34 KO MRL-Faslpr mice, thus eliminating some Langerhans Intriguingly, IL-34 induces antibodies that lodge in glomer- cells is not apparently harmful; and (2) antibodies are unlikely to uli and subsequently compromise renal function in MRL-Faslpr fi cross the blood-brain barrier. Thus, IL-34 is an appealing ther- mice. We nd that IgG/C3 and serum anti-dsDNA antibody apeutic target for lupus nephritis and by extension other in- levels are suppressed in IL-34 KO MRL-Faslpr mice. IL-34 may flamed tissues in patients with lupus. indirectly induce autoantibodies in lupus-prone mice by sev- eral mechanisms. IL-34, produced by follicular dendritic cells in germinal centers, may expand a monocyte subset in the spleen that stimulates activated B cell proliferation.47 Alterna- ACKNOWLEDGMENTS tively, IL-34 may foster Mø accumulation and thereby pro- mote TEC apoptosis. Moreover, the defective MRL-Faslpr Mø We wish to acknowledge Anu Khanna and Lin Chen for proofreading clearance of apoptotic TECs (not published) may release the manuscript.

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 257 BASIC RESEARCH www.jasn.org

This work was supported by the Lupus Research Alliance (V.R.K.), nephritis treated with combined pulses of cyclophosphamide and Pfizer Centers for Therapeutic Innovation (V.R.K.), the National methylprednisolone. Lupus 12: 287–296, 2003 Council on Science and Technology (CONACyT, Fellowship No. 5. Lee S, Huen S, Nishio H, Nishio S, Lee HK, Choi BS, et al.: Distinct macrophage phenotypes contribute to kidney injury and repair. JAm 265757) (H.M.G.-S.), and the Deutsche Forschungsgemeinschaft Soc Nephrol 22: 317–326, 2011 (ME3194/2-1) (J.W.-M.). 6. Lech M, Gröbmayr R, Ryu M, Lorenz G, Hartter I, Mulay SR, et al.: V.R.K. designed the study; Y.W., H.M.G.-S., J.W.-M., Y.I., A.K.A., Macrophage phenotype controls long-term AKI outcomes--kidney re- and M.M. carried out the experiments; Y.W., H.M.G.-S., J.W.-M., Y.I., generation versus atrophy. J Am Soc Nephrol 25: 292–304, 2014 A.K.A., and M.M. analyzed the data; Y.W., H.M.G.-S., J.W.-M., Y.I., 7. Iwata Y, Boström EA, Menke J, Rabacal WA, Morel L, Wada T, et al.: fi Aberrant macrophages mediate defective kidney repair that triggers A.K.A., and V.R.K. made the gures; V.R.K. drafted the manuscript; nephritis in lupus-susceptible mice. J Immunol 188: 4568–4580, 2012 and H.M.G.-S., J.W.-M., and V.R.K. edited/revised the manuscript. 8. Moore KJ, Naito T, Martin C, Kelley VR: Enhanced response of mac- rophages to CSF-1 in autoimmune mice: A gene transfer strategy. J Immunol 157: 433–440, 1996 DISCLOSURES 9. Guilbert LJ, Stanley ER: Specific interaction of murine colony-stimulating factor with mononuclear phagocytic cells. J Cell Biol 85: 153–159, 1980 fi V.R.K. is funded by P zer Centers for Therapeutic Innovation and has an 10. Sherr CJ, Rettenmier CW, Sacca R, Roussel MF, Look AT, Stanley ER: equity interest in Biogen-Idec, a company with research and development The c-fms proto-oncogene product is related to the receptor for the interests in lupus. mononuclear phagocyte growth factor, CSF-1. Cell 41: 665–676, 1985 11. Tushinski RJ, Oliver IT, Guilbert LJ, Tynan PW, Warner JR, Stanley ER: Survival of mononuclear phagocytes depends on a lineage-specific SUPPLEMENTAL MATERIAL growth factor that the differentiated cells selectively destroy. Cell 28: 71–81, 1982 12. Byrne PV, Guilbert LJ, Stanley ER: Distribution of cells bearing recep- This article contains the following supplemental material online at tors for a colony-stimulating factor (CSF-1) in murine tissues. JCellBiol http://jasn.asnjournals.org/lookup/suppl/doi:10.1681/ASN.2018090901/-/ 91: 848–853, 1981 DCSupplemental. 13. Wiktor-Jedrzejczak W, Bartocci A, Ferrante AW Jr., Ahmed-Ansari A, Supplemental Figure 1. IL-34 and CSF-1 are expressed with ad- Sell KW, Pollard JW, et al.: Total absence of colony-stimulating factor 1 lpr in the macrophage-deficient osteopetrotic (op/op) mouse. Proc Natl vancing lupus nephritis in MRL-Fas mice. – fl Acad Sci U S A 87: 4828 4832, 1990 SupplementalFigure2.Submandibularin ammation(sialadenitis)is 14. Menke J, Iwata Y, Rabacal WA, Basu R, Yeung YG, Humphreys BD, lpr suppressed in IL-34 KO MRL-Fas mice. et al.: CSF-1 signals directly to renal tubular epithelial cells to mediate Supplemental Figure 3. Mø, T, and B cell accumulation is suppressed repair in mice. JClinInvest119: 2330–2342, 2009 in IL-34 KO MRL-Faslpr mice. 15. Menke J, Kriegsmann J, Schimanski CC, Schwartz MM, Schwarting A, Kelley VR: Autocrine CSF-1 and CSF-1 receptor coexpression promotes Supplemental Figure 4. CSF-1 does not compensate for the absence – lpr renal cell carcinoma growth. Cancer Res 72: 187 200, 2012 of IL-34 in the kidney of IL-34 KO MRL-Fas mice. 16. Lin H, Lee E, Hestir K, Leo C, Huang M, Bosch E, et al.: Discovery of a Supplemental Figure 5. Mø skew toward cyto-destructive M1 cytokine and its receptor by functional screening of the extracellular phenotype during lupus nephritis in MRL-Faslpr mice and in BM Mø proteome. Science 320: 807–811, 2008 cocultured with hypoxic TECs. 17. Wei S, Nandi S, Chitu V, Yeung YG, Yu W, Huang M, et al.: Functional overlap butdifferentialexpressionofCSF-1andIL-34intheirCSF-1receptor-medi- Supplemental Figure 6. Proliferating B cells are suppressed in IL-34 – lpr ated regulation of myeloid cells. JLeukocBiol88: 495 505, 2010 KO MRL-Fas mice with lupus nephritis. 18. Nandi S, Cioce M, Yeung YG, Nieves E, Tesfa L, Lin H, et al.: Receptor- Supplemental Figure 7. IL-34 correlates with Mø and T cells and type protein-tyrosine phosphatase z is a functional receptor for in- histopathology disease activity in type II–IV lupus nephritis. terleukin-34. JBiolChem288: 21972–21986, 2013 Supplement Table 1. Study cohort demographic and clinical 19. Baek JH, Zeng R, Weinmann-Menke J, Valerius MT, Wada Y, Ajay AK, characteristics. et al.: IL-34 mediates acute kidney injury and worsens subsequent chronic kidney disease. JClinInvest125: 3198–3214, 2015 Supplement Table 2. Antibodies used for immunostaining. 20. Sasmono RT, Oceandy D, Pollard JW, Tong W, Pavli P, Wainwright BJ, Supplement Table 3. qPCR primers used to detect mRNAs. et al.: A macrophage colony-stimulating factor receptor-green fluo- Supplement Table 4. Antibodies used for FACS. rescent protein transgene is expressed throughout the mononuclear phagocyte system of the mouse. Blood 101: 1155–1163, 2003 21. Ryan GR, Dai XM, Dominguez MG, Tong W, Chuan F, Chisholm O, REFERENCES et al.: Rescue of the colony-stimulating factor 1 (CSF-1)-nullizygous mouse (Csf1(op)/Csf1(op)) phenotype with a CSF-1 transgene and identification of sites of local CSF-1 synthesis. Blood 98: 74–84, 2001 1. Klippel JH: Systemic lupus erythematosus: Demographics, prognosis, 22. Wang Y, Szretter KJ, Vermi W, Gilfillan S, Rossini C, Cella M, et al.: IL-34 and outcome. J Rheumatol Suppl 48: 67–71, 1997 is a tissue-restricted ligand of CSF1R required for the development of 2. Petri M: Long-term outcomes in lupus. Am J Manag Care 7[Suppl]: Langerhans cells and microglia. Nat Immunol 13: 753–760, 2012 S480–S485, 2001 23. Menke J, Amann K, Cavagna L, Blettner M, Weinmann A, Schwarting A, 3. Hill GS, Delahousse M, Nochy D, Thervet E, Vrtovsnik F, Rémy P, et al.: et al.: Colony-stimulating factor-1: A potential biomarker for lupus Outcome of relapse in lupus nephritis: Roles of reversal of renal fibrosis nephritis. JAmSocNephrol26: 379–389, 2015 and response of inflammation to therapy. Kidney Int 61: 2176–2186, 2002 24. Hochberg MC: Updating the American College of Rheumatology re- 4. Cortés-Hernández J, Ordi-Ros J, Labrador M, Segarra A, Tovar JL, vised criteria for the classification of systemic lupus erythematosus. Balada E, et al.: Predictors of poor renal outcome in patients with lupus Arthritis Rheum 40: 1725, 1997

258 Journal of the American Society of Nephrology J Am Soc Nephrol 30: 244–259, 2019 www.jasn.org BASIC RESEARCH

25. Kobayashi A, Valerius MT, Mugford JW, Carroll TJ, Self M, Oliver G, patients with Sjogren’s syndrome and is associated with the local ex- et al.: Six2 defines and regulates a multipotent self-renewing nephron pansion of pro-inflammatory CD14(bright)CD16+ monocytes. Rheu- progenitor population throughout mammalian kidney development. matology (Oxford) 52: 1009–1017, 2013 Cell Stem Cell 3: 169–181, 2008 42. Wang H, Cao J, Lai X: Serum interleukin-34 levels are elevated in pa- 26. Ajay AK, Kim TM, Ramirez-Gonzalez V, Park PJ, Frank DA, Vaidya VS: tients with systemic lupus erythematosus. Molecules 22:E35,2016 A bioinformatics approach identifies signal transducer and activator of 43. Xie HH, Shen H, Zhang L, Cui MY, Xia LP, Lu J: Elevated serum in- transcription-3 and checkpoint kinase 1 as upstream regulators of kidney terleukin-34 level in patients with systemic lupus erythematosus is as- injury molecule-1 after kidney injury. J Am Soc Nephrol 25: 105–118, 2014 sociated with disease activity. Sci Rep 8: 3462, 2018 27. Faust J, Menke J, Kriegsmann J, Kelley VR, Mayet WJ, Galle PR, et al.: 44. Biswas P, Delfanti F, Bernasconi S, Mengozzi M, Cota M, Polentarutti N, Correlation of renal tubular epithelial cell-derived interleukin-18 up- et al.: Interleukin-6 induces monocyte chemotactic protein-1 in pe- regulation with disease activity in MRL-Faslpr mice with autoimmune ripheral blood mononuclear cells and in the U937 cell line. Blood 91: lupus nephritis. Arthritis Rheum 46: 3083–3095, 2002 258–265, 1998 28. Lenda DM, Stanley ER, Kelley VR: Negative role of colony-stimulating 45. Parry GC, Martin T, Felts KA, Cobb RR: IL-1beta-induced monocyte factor-1 in macrophage, T cell, and B cell mediated autoimmune dis- chemoattractant protein-1 gene expression in endothelial cells is ease in MRL-Fas(lpr) mice. JImmunol173: 4744–4754, 2004 blocked by proteasome inhibitors. Arterioscler Thromb Vasc Biol 18: 29. Kikawada E, Lenda DM, Kelley VR: IL-12 deficiency in MRL-Fas(lpr) mice 934–940, 1998 delays nephritis and intrarenal IFN-gamma expression, and diminishes 46. Eda H, Zhang J, Keith RH, Michener M, Beidler DR, Monahan JB: systemic pathology. JImmunol170: 3915–3925, 2003 Macrophage-colony stimulating factor and interleukin-34 induce chemokines 30. Schaldecker T, Kim S, Tarabanis C, Tian D, Hakroush S, Castonguay P, in human whole blood. Cytokine 52: 215–220, 2010 et al.: Inhibition of the TRPC5 ion channel protects the kidney filter. 47. Yamane F, Nishikawa Y, Matsui K, Asakura M, Iwasaki E, Watanabe K, JClinInvest123: 5298–5309, 2013 et al.: CSF-1 receptor-mediated differentiation of a new type of 31. Menke J, Lucas JA, Zeller GC, Keir ME, Huang XR, Tsuboi N, et al.: monocytic cell with B cell-stimulating activity: Its selective dependence Programmed death 1 ligand (PD-L) 1 and PD-L2 limit autoimmune on IL-34. J Leukoc Biol 95: 19–31, 2014 kidney disease: Distinct roles. J Immunol 179: 7466–7477, 2007 48. Peles E, Schlessinger J, Grumet M: Multi-ligand interactions with re- 32. Menke J, Zeller GC, Kikawada E, Means TK, Huang XR, Lan HY, et al.: ceptor-like protein tyrosine phosphatase beta: Implications for in- CXCL9, but not CXCL10, promotes CXCR3-dependent immune-me- tercellular signaling. Trends Biochem Sci 23: 121–124, 1998 diated kidney disease. J Am Soc Nephrol 19: 1177–1189, 2008 49. Li YS, Milner PG, Chauhan AK, Watson MA, Hoffman RM, Kodner CM, 33. Menke J, Rabacal WA, Byrne KT, Iwata Y, Schwartz MM, Stanley ER, et al.: Cloning and expression of a developmentally regulated protein et al.: Circulating CSF-1 promotes monocyte and macrophage that induces mitogenic and neurite outgrowth activity. Science 250: phenotypes that enhance lupus nephritis. J Am Soc Nephrol 20: 1690–1694, 1990 2581–2592, 2009 50. Peles E, Nativ M, Campbell PL, Sakurai T, Martinez R, Lev S, et al.: The 34. Menke J, Bork T, Kutska B, Byrne KT, Blanfeld M, Relle M, et al.: Targeting carbonic anhydrase domain of receptor tyrosine phosphatase beta is a transcription factor Stat4 uncovers a role for interleukin-18 in the patho- functional ligand for the axonal cell recognition molecule contactin. genesis of severe lupus nephritis in mice. Kidney Int 79: 452–463, 2011 Cell 82: 251–260, 1995 35. Sanchez-Niño MD, Sanz AB, Ortiz A: Chronicity following ischaemia- 51. Milev P, Chiba A, Häring M, Rauvala H, Schachner M, Ranscht B, et al.: reperfusion injury depends on tubular-macrophage crosstalk involving High affinity binding and overlapping localization of neurocan and two tubular cell-derived CSF-1R activators: CSF-1 and IL-34. Nephrol phosphacan/protein-tyrosine phosphatase-zeta/beta with tenascin-R, Dial Transplant 31: 1409–1416, 2016 amphoterin, and the heparin-binding growth-associated molecule. 36. Elman SA, Joyce C, Nyberg F, Furukawa F, Goodfield M, Hasegawa M, J Biol Chem 273: 6998–7005, 1998 et al.: Development of classification criteria for discoid lupus eryth- 52. Bézie S, Picarda E, Ossart J, Tesson L, Usal C, Renaudin K, et al.: IL-34 ematosus: Results of a Delphi exercise. J Am Acad Dermatol 77: is a Treg-specific cytokine and mediates transplant tolerance. JClin 261–267, 2017 Invest 125: 3952–3964, 2015 37. Maloney KC, Ferguson TS, Stewart HD, Myers AA, De Ceulaer K: 53. Franzè E, Monteleone I, Cupi ML, Mancia P, Caprioli F, Marafini I, et al.: Clinical and immunological characteristics of 150 systemic lupus er- Interleukin-34 sustains inflammatory pathways in the gut. Clin Sci ythematosus patients in Jamaica: A comparative analysis. Lupus 26: (Lond) 129: 271–280, 2015 1448 –1456, 2017 54. Dai XM, Zong XH, Sylvestre V, Stanley ER: Incomplete restoration of 38. Lucas JA, Menke J, Rabacal WA, Schoen FJ, Sharpe AH, Kelley VR: colony-stimulating factor 1 (CSF-1) function in CSF-1-deficient Csf1op/ Programmed death ligand 1 regulates a critical checkpoint for auto- Csf1op mice by transgenic expression of cell surface CSF-1. Blood 103: immune myocarditis and pneumonitis in MRL mice. JImmunol181: 1114–1123, 2004 2513–2521, 2008 55. Alikhan MA, Jones CV, Williams TM, Beckhouse AG, Fletcher AL, Kett 39. Theofilopoulos AN, Dixon FJ: Etiopathogenesis of murine SLE. Im- MM, et al.: Colony-stimulating factor-1 promotes kidney growth and munol Rev 55: 179–216, 1981 repair via alteration of macrophage responses. Am J Pathol 179: 40. Greter M, Lelios I, Pelczar P, Hoeffel G, Price J, Leboeuf M, et al.: 1243–1256, 2011 Stroma-derived interleukin-34 controls the development and mainte- 56. Dai XM, Ryan GR, Hapel AJ, Dominguez MG, Russell RG, Kapp S, et al.: nance of Langerhans cells and the maintenance of microglia. Immunity Targeted disruption of the mouse colony-stimulating factor 1 receptor 37: 1050–1060, 2012 gene results in osteopetrosis, mononuclear phagocyte deficiency, 41. Ciccia F, Alessandro R, Rodolico V, Guggino G, Raimondo S, Guarnotta increased primitive progenitor cell frequencies, and reproductive C, et al.: IL-34 is overexpressed in the inflamed salivary glands of defects. Blood 99: 111–120, 2002

J Am Soc Nephrol 30: 244–259, 2019 IL-34 Promotes Lupus Nephritis 259 Supplement Table of Contents:

Materials and Methods Supplement.

Supplement Figure 1. IL-34 and CSF-1 are expressed with advancing lupus nephritis in

MRL-Faslpr mice

Supplement Figure 2. Submandibular inflammation (sialadenitis) is suppressed in IL-34 KO

MRL- Faslpr mice.

Supplement Figure 3. Mø, T and B cell accumulation is suppressed in IL-34 KO MRL- Faslpr mice.

Supplement Figure 4. CSF-1 does not compensate for the absence of IL-34 in the kidney of

IL-34 KO MRL- Faslpr mice.

Supplement Figure 5. Mø skew towards cyto-destructive M1 phenotype during lupus nephritis in MRL- Faslpr mice and in BM Mø co-cultured with hypoxic TEC.

Supplement Figure 6. Proliferating B cells are suppressed in IL-34 KO MRL-Faslpr mice with lupus nephritis.

Supplement Figure 7. IL-34 correlates with Mø and T cells and histopathology disease activity in type II-IV lupus nephritis

Supplement Table 1. Study cohort demographic and clinical characteristics.

Supplement Table 2. Antibodies used for immunostaining.

Supplement Table 3. qPCR primers used to detect mRNAs.

Supplement Table 4. Antibodies used for FACS.

Supplement Materials and Methods

Skin Lesions

We scored the skin lesions by gross pathology using a grade of 0–3 (0 = none; 1 = mild

(snout and ears); 2 = moderate, < 2 cm (snout, ears, and intrascapular); 3 = severe, 2-4 cm

(snout, ears, and intrascapular); and 4 = very severe, >4 cm (snout, ears, and intrascapular).

Moreover, we assessed the incidence of skin lesions that showed grade 2 or more.

β-Galactosidase

Kidneys were fixed in 4% paraformaldehyde for 3 hours at 4°C, embedded and sectioned at

20-µm thick sections. Cryosections were stained with X-gal (Cat. X4281C10; Gold

Biotechnology) overnight at 37°C and subsequently counterstained with Nuclear Fast Red

(Cat. N3020; Sigma-Aldrich). We scored expression in tubules on a scale of 0-4 (0 = none; 1

= weak; 2 = moderate; 3 = strong; 4 = very strong) under x40 magnification in at least 20 high power fields per section.

Histopathology

Kidney

Kidneys were fixed in 10% neutral buffered formalin, embedded in paraffin, sectioned (4 µm), and stained with PAS. To score kidney pathology we evaluated glomerular, tubulo-intestitial and perivascular pathology as follows. Glomerular pathology was assessed by examining 20 glomerular cross-sections (gcs) per kidney and scoring each glomerulus on a semiquantitative scale: 0 = normal (35–40 cells/gcs); 1 = mild (glomeruli with few lesions showing slight proliferative changes, mild hypercellularity (41–50 cells/gcs), and/or minor exudation; 2 = moderate (glomeruli with moderate hypercellularity (51–60 cells/gcs), including segmental and/or diffuse proliferative changes, hyalinosis, and moderate exudates); and 3 = severe (glomeruli with segmental or global sclerosis and/or severe hypercellularity (>60 cells/gcs), necrosis, crescent formation, and heavy exudation). Tubulo-interstitial pathology was assessed in 10 randomly selected high power fields (>400) on a scale of 0–3 according to the number of infiltrates and damaged tubules: 0 = normal, 1 = mild, 2 = moderate, and 3 = maximum. Perivascular cell accumulation was determined semi-quantitatively by scoring the number of cell layers surrounding the majority of vessel walls (score: 0 = none; 1 = < 5; 2 = 5–

10; and 3 = >10).

Salivary Gland

The salivary glands were fixed in 10% neutral buffered formalin. Paraffin sections (4 µm) were stained with H&E and pathology was evaluated. We scored the salivary gland inflammation on a scale of 0–3 (0 = no inflammatory cells); 1 = few perivascular and periductal inflammatory infiltrates (<100 cells); 2 = moderate number of perivascular and periductal inflammatory infiltrates (100–500 cells); 3 = extensive inflammation with large inflammatory foci (>500 cells).

Renal Function

Albuminuria

To quantify albuminuria levels, we analyzed 20 µl of urine collected over 8 hours by SDS-

PAGE. Briefly, bovine serum albumin standards (0.25, 0.5, 1.0, 2.5, and 5.0 µg) were run on the same gel and used to identify and quantify urinary albumin bands. Gels were stained with

Coomassie blue, the bands were captured and quantified using ChemiDoc MP imaging system (Bio-Rad). The values of the sample bands were translated into albumin concentrations using the standard curve, which were extrapolated to the 8-hour total urine volume. BUN

BUN levels were evaluated using a colorimetric analysis kit (Urea Nitrogen kit; Sigma-Aldrich,

St. Louis, MO) according to manufacturer’s instructions. A standard curve was generated and used to determine the concentration of urea nitrogen in the serum samples, collected at the time of sacrifice.

Serum Creatinine

Serum creatinine concentration was measured using an autoanalyzer (Beckman Instruments,

Inc., Fullerton, CA) according to manufacturer’s instructions.

Immunofluorescence

To determine IgG and C3 deposits in the glomeruli, we incubated cryostat sectioned tissue with 10% normal goat serum, followed by FITC-conjugated goat anti-mouse IgG and FITC- conjugated goat IgG fraction of mouse C3 (Cappel Laboratory, Malvern, PA). The fluorescence intensity within the peripheral glomerular capillary walls and mesangium were scored on a scale of 0-3 (0 = none; 1 = weak; 2 = moderate; 3 = strong) in at least 10 glomeruli per section.

To determine the number of intra-renal proliferating Mø, cryostat sectioned tissues were stained with anti–mouse F4/80 Ab (clone BM-8, Invitrogen, Carlsbad, CA), and anti–mouse

Ki-67 Ab (clone SP6, Vector Laboratories, Burlingame, CA), followed by Cy3-conjugated goat anti-rat IgG Ab (clone polyclonal, Jackson ImmunoResearch, West Grove, PA) and FITC- conjugated goat anti-rabbit IgG Ab (clone polyclonal, Jackson ImmunoResearch, West Grove,

PA). We enumerated the number of F4/80+/Ki-67+ cells in 10 HPF.

Immunoperoxidase

Mouse: We stained frozen kidney sections, fixed in 25% ethanol/75%acetone for 10 min at room temperature, and blocked endogenous peroxidase activity and nonspecific binding of avidin and biotin. We detected the presence of Mø, T cell, double negative T cells, and apoptotic cells in TEC using the antibodies listed in Supplement Table 2. Optimal concentrations of primary Abs were diluted in Ab dilution buffer and incubated with the tissue sections overnight in a humidified chamber at 4°C. We incubated tissue sections with biotinylated anti-rat IgG Ab (BA-4001; Vector Laboratory, Burlingame, CA) for 1 h at room temperature, followed by incubation with ABC complex (PK-6100; Vector Laboratories) for 1 h at room temperature. Then, the stain was developed using DAB (SK-4100; Vector

Laboratories), followed by counterstain with Mayer’s Hematoxylin (Sigma-Aldrich, St. Louis,

MO). Immunostaining was analyzed by counting for the presence of F4/80, CD4, B220, and caspase-3-positive cells in 20 randomly selected HPF.

Human: Kidney formalin fixed tissue sections obtained from human kidney biopsy specimens were stained for the presence of IL-34, CSF-1, cFMS, PTPRZ, Mø (CD68), and T cells (CD3).

Antibodies used for immunostaining are listed in Supplement Table 2. Antigens were retrieved by immersion in citrate buffer followed by blocking of endogenous peroxidase activity and nonspecific binding of avidin and biotin. We incubated kidney sections with a primary antibody and detected the primary antibody by incubation with biotinylated rabbit anti-goat antibody or goat anti-rabbit antibody or goat anti-mouse antibody, followed by development with 3-3- diaminobenzidine (Vector Laboratories; Burlingame, CA). Immunostaining was analyzed by counting for the presence of positive cells in 10 randomly selected HPF.

ELISA

Total IgG: Plates were coated overnight at 4°C with goat anti-mouse Ig capture Ab (Southern

Biotechnology, Cat. 1010-01) in PBS. The wells were washed 3 times and blocked for 1 h with 1% BSA in PBS. We added Ig standards (mouse IgG-UNLB, Southern Biotechnology, cat. 0107-01) to the plate using a series of 2-fold dilutions, and assessed serum samples at

1/10000 dilution. Standards and serum samples were incubated 2 h at RT, and bound Ig was detected with goat anti-mouse detection Ab conjugated with HRP (Southern Biotechnology, cat.1030-05) and TMB solution (Zymed, cat. 0020-23). The absorbance was measured at 450 nm.

dsDNA: Immunolon (Dynex, cat. 3355) plates were coated for 1h at RT with 2 µg/mL of dsDNA (calf thymus DNA, Sigma) in PBS. To get dsDNA, 400 µL of 0.5 mg/mL thymus DNA was treated with 5 µL of 40 U/µL Mung Bean Nuclease (Amershan cat. E2420Y) for 1 min at

370C. The wells were blocked for 1 h at RT with 1% BSA 0.1% Tween 10% in PBS. We added serum 100 µL/well , 1h at RT (dilutions 1:50 to 1:2000). Bound IgG was detected with goat anti-mouse detection Ab conjugated with HRP (Southern Biotechnology, cat.1030-05) and TMB solution (Zymed, cat. 0020-23). The absorbance was measured at 450 nm.

CSF-1: The tissues used for homogenates were from mice perfused with PBS through the heart to flush out CSF-1 in the circulation. Briefly, we homogenized frozen tissue samples in

ELISA-lysis buffer (20 mM Tris-Hcl pH 7.5 , 150 mM NaCl, 1% NP-40, with proteinase inhibitors from Sigma) using a homogenizer. Samples were spun down and the supernatant fraction of the homogenates was used for the ELISA. We determined the protein concentration of each sample (supernatant of homogenate) using the BCA Protein Assay Kit

(PIERCE, Rockford, IL) and evaluated 200 µg of protein per tissue sample. The ELISA Capture (Cat. 552513), detection (cat. 552514) antibodies and reagents were purchased from

BD Bioscience (San Jose, CA).

IL-34: Plates were coated for 24 h with 0.5 µg/mL of the capture Ab (R&D, Cat. AF5195), blocked with 1% BSA in PBS at RT for 1.5 h and serum samples were added undiluted and incubated at 4oC overnight. Detection Ab (BioLegend, cat. 519303) is prepared in 1 % BSA

0.05 % Tween-20 in PBS and incubated at RT for 1 h. Bound Ab was detected with a Strep-

HRP Ab and TMB solution (Zymed, cat. 0020-23). The absorbance was measured at 450 nm.

Leukocyte isolation whole blood (human)

B cells (CD19+; Miltenyi, Cat. 130-050-301)), T cells (CD3+; Miltenyi, Cat. 130-050-101)) and monocytes (CD14+; Miltenyi, Cat. 130-050-201)) (Miltenyi Biotec)were isolated from whole blood. Cells subsets were separated using the magnetic cell isolation and cell separation system from Miltenyi Biotec following the manufactures instructions. We used the following

Abs for detection: rabbit anti-human IL34, dilution 1:1000 (Origene/Acris), rabbit anti-human

PTPRZ, dilution 1:200, goat anti-human M-CSF, dilution 1:200, rabbit anti-cFMS, dilution

1:200 (Santa Cruz), GAPDH, dilution 1:5000 (Cell signaling), anti-goat HRP and anti-rabbit

HRP, dilution 1:10000 (Santa Cruz).

qPCR qPCR was performed using real-time, 2-step, quantitative PCR. Total RNA was isolated from snap-frozen whole kidney, primary TECs, and BMMø using TRIzol (Life Technologies,

Gaithersburg, MD). The RT reaction was performed on 100 µg of RNA using an oligo (dT) primer and Superscript II reverse transcriptase (Life Technologies). Relative quantitation with real-time two-step RT-PCR was performed with SYBR Green PCR reagents (Qiagen, Valencia, CA) and an ABI PRISM 7700 sequence detection system (PE Applied Biosystems,

Foster City, CA) according to the manufacturer’s instructions. Reactions were performed using 1.0 µl of cDNA at a concentration of 100 ng/ml in a reaction volume of 25 µl. The PCR consists of HotStar Taq activation for 10 min at 95°C, followed by 40 cycles with heating to

95°C for 15 s and cooling to 60°C for 1 min. The mRNA levels were normalized to those of

GAPDH. The data were analyzed by the ΔΔ-CT method. Primers are listed in Supplement

Table 3.

SLE Patient’s Disease Activity

Disease activity was evaluated by the following standard clinical serological activity parameters: (complement 3 (C3c), complement 4 (C4), antinuclear antibodies (ANA), anti- double stranded DNA (dsDNA) antibodies and urine parameters: proteinuria (24h collection).

The following standard values of serological activity markers were determined: C3 (0.9-1.8 g/l); C4 (0.1-0.4) by enzyme immunoassay; ANA (1:80-1:5120) by immunofluorescence; dsDNA (30 IU/ml - 200 IU/ml) by ELISA; creatinine (0.5-0.8 mg/dl) by isotope dilution mass spectrometry; proteinuria (<150 mg/24h) by immunoturbidimetric assay.

Supplement Figure 1

A. B. * Age (mo) * * 20 * 1.5 4"

5 Cortex * *p<0.05 Medulla

*p<0.05 expression Grade/HPF Relative mRNA RelativemRNA 0 0" IL-34 CSF-1 Age (mo) 1.5 5.0 1.5 5.0

n= 3 7 3 7 n= 3 3 3 3 2 2 4 4 IL-34 CSF-1

C. IL-34 D. IL-34 ***" 300 n=10/group ***" 800

/ml) /ml) ***" pg /mL) /mL)

***p<0.001 pg IL-34 ( IL-34

0 ( IL-34 0 Age (mo) 1.0 3.0 5.0 3.0 3.0 n= 15 15 10 10 10 +/&" WT"

MRL-Faslpr B6 BALB/c MRL-Faslpr

Supplement Figure 1. IL-34 and CSF-1 are expressed with advancing lupus nephritis in

MRL-Faslpr mice. (A) IL-34 and CSF-1 transcript levels in MRL-Faslpr WT kidneys by qPCR.

Values were normalized to GAPDH transcripts and expressed as relative ratio. (B) IL-34 and

CSF-1 expression in kidney of MRL-Faslpr mice identified by reporter mouse (LacZ under control of IL-34 or CSF-1) stained for ß-galactosidase activity (X-gal). Graph of X-gal intensity comparing the cortex and medulla. (C) IL-34 in serum of MRL-Faslpr mice and B6 and BALB/c mice analyzed using an ELISA. (D) IL-34 in serum of IL-34 +/- and WT MRL-Faslpr mice at 5 mo of age using a different ELISA than in C. IL-34 KO= 0. Data are mean ± SEM. Mann-

Whitney U test was used for statistical analysis.

Supplement Figure 2. IL-34 (MRL-Faslpr): WT KO WT

Submandibular Submandibular 50 µm 50 µm 50 µm

1.5 mo 5.0 mo

Supplement Figure 2. Submandibular inflammation (sialadenitis) is suppressed in IL-34

lpr KO MRL-Fas mice. We analyzed the submandibular gland at 1.5 and 5 mo age in IL-34 KO and WT MRL-Faslpr mice. Representative photos (x 40) stained with H&E. Note the infiltrating cells in the WT, but not in the IL-34 KO mice. Data are mean ± SEM. Mann-Whitney U test was used for statistical analysis.

Supplement Figure 3 A. Glomerular (intra, peri) F4/80 CD4 B220 Glomerular (intra, peri) IL-34:

** KO 35 ** ** +/ WT KO *

*p<0.05

50 µm 50 µm 50 µm **p<0.01 #/HPF IL-34 * ** 0 WT F4/80 CD4 B220 50 µm 50 µm 50 µm n= 11-14 11-14 8-13

B.Tubulo-interstitial F4/80 CD4 B220 Tubulo-interstitial

* *p<0.05 * **p<0.01 40 ** KO *

* 100 µm 100 µm 100 µm IL-34 #/HPF 0 WT F4/80 CD4 B220

100 µm 100 µm 100 µm n= 11-14 11-14 8-13

Supplement Figure 3. Mø, T and B cell accumulation is suppressed in IL-34 KO MRL-

Faslpr mice. The following were compared: IL-34 KO, WT and +/- MRL-Faslpr mice (5 mo of age). Mø (F4/80), T cell (CD4), and CD4-CD8- T cell and B cells (B220) were identified by immunostaining in (A) Glomeruli: Representative photos (x 40) and (B) tubulo-interstitium

(x20). Adjacent graphs show quantification of 10 randomly selected HPF. Data are mean ±

SEM. Mann-Whitney U test was used for statistical analysis.

Supplement Figure 4 A. Kidney

10 n=8-9/group 10 n=6/group CSF-1 (ng/ml) CSF-1(ng/ml) RelativeCSF-1

mRNA expression mRNA 0 0 IL-34: KO / WT KO / WT TEC B. Scheme Homogenates Supernatants IL-34 (TEC):

n=6-7/group n=4-7/group

12 5 KO Hypoxia or TNF-α IL-34 KO WT 24h WT Serum-free

TEC supernatant CSF-1(ng/ml) RelativeCSF-1

cells expression mRNA 0 0 Not stimulated TNF-α Hypoxia Not stimulated TNF-α Hypoxia

KO#TNF.α#WT#TNF.α# KO#TNF.α#WT#TNF.α# KO#Hypoxia#WT#Hypoxia# KO#Hypoxia#WT#Hypoxia# KO#Normoxia#WT#Normoxia# KO#Normoxia#WT#Normoxia# Supplement Figure 4. CSF-1 does not compensate for the absence of IL-34 in the kidney of IL-34 KO MRL-Faslpr mice. (A) Intra-renal CSF-1 transcript and protein levels analyzed by qPCR and ELISA in IL-34 KO, WT and +/- MRL-Faslpr mice (5 mo of age). Values are normalized to GAPDH transcript and expressed as relative quantification. Dotted lines are

lpr MRL-Fas at 1.5 mo of age (n=3). (B) Scheme, in vitro analysis of CSF-1 generated by TEC.

CSF-1 in TEC from IL-34 KO and WT MRL-Faslpr mice analyzed by qPCR and ELISA, respectively. Data are mean ± SEM. Mann-Whitney U test was used for statistical analysis.

Supplement Figure 5 A. In vivo (Kidney- MRL-Faslpr at 5 mo of age) Cell number (Gated on CD45+CD11b+Ly6G-F4/80+)

3.5

M1

* M2

) 4 n=4-6/group

(X10 *p<0.05

# cells/kidney

0 TNF-α+ Arg-1+NOS-II+ IL-10+

B. In vitro (MRL-Faslpr BM Mø co-cultured with hypoxic TEC)

Cell number

1350 * M1 M2

n=4/group *p<0.05

Mø +p<0.06 # +

0 TNF-α+ Arg-1+ NOS-II+ IL-10+

C. Polarization in kidney (MRL-Faslpr – 5 mo of age) 1. Frequency (Gated on CD45+CD11b+Ly6G-F4/80+) n=6-10/group + + + IL-10+Mø (M2) TNF-α Mø (M1) NOS-II Mø (M1) Arginase-I Mø (M2) *p<0.05 * 30 30 50 30

Φ M % of total total %of

0 0 0 0 KO / WT KO / WT KO / WT KO / WT

2. M1/M2 ratio

TNF-α/Arginase-I TNF-α/IL-10 NOS-II/Arginase-I NOS-II/IL-10

4.5 1.5 3 3

ratio

0 0 0 0 KO +/- WT KO +/- WT KO +/- WT KO +/- WT Supplement Figure 5. Mø skew towards cyto-destructive M1 phenotype during lupus nephritis in MRL-Faslpr mice and in BM Mø co-cultured with hypoxic TEC. Quantified

+ + + cyto-destructive (M1, TNF−α+ NOS-II ) and cyto-protective (M2, Arg-1 IL-10 ) Mø in (A) MRL-

Faslpr mice (5 mo of age) and in (B) BM Mø co-cultured with hypoxic TEC analyzed by FACS.

(C) Mø polarization in MRL-Faslpr kidney at 5 mo of age. 1. Frequency of M1 and M2 markers in IL-34 KO, WT and +/- MRL-Faslpr kidney. 2. M1/M2 ratio in IL-34 KO, WT and +/- MRL-

Faslpr kidney. Data are mean ± SEM. Mann-Whitney U test was used for statistical analysis.

Supplement Figure 6 Kidney B cell proliferation Immunostaining

MRL-Faslpr mice ( 5 mo)

IL-34: Ki67 CD19

KO

WT

Supplement Figure 6. Proliferating B cells are suppressed in IL-34 KO MRL-Faslpr mice with lupus nephritis. Representative photos of dual staining CD19 and Ki67 in IL-34 KO and

WT MRL-Faslpr kidney cryosections at 5 mo of age (x40, inset x160).

Supplement Figure 7

A. IL-34 vs Mø & T cells B. IL-34 vs pathology

Mø + T cells Activity + Chronicity % IL-34 TEC/HPF n=25 n=25 % IL-34 TEC/HPF 100 n=25 100 20 10 n=25 r=0.38 r= 0.39 r= 0.51 r=0.04 p=0.05 *p=0.04 *p=0.01 p=0.86

50 50 10 5 CD3 CD68 cells/HPF cells/HPF Activity indexActivity Chronicityindex # Type II-IV II-IV Type 0 0 0 0 40 80 40 80 40 80 40 80 % IL-34+ TEC/HPF % IL-34+ TEC/HPF

Mø T cells Activity Chronicity n=40 n=40 100 n=40 100 20 10 n=40 r=0.23 r= 0.17 r= 0.26 r=0.02 p=0.1 p=0.3 p=0.1 p=0.9

50 50 10 5 CD3 CD68 cells/HPF cells/HPF Activity indexActivity Type I-V I-V Type Chronicityindex # 0 0 0 0 40 80 40 80 40 80 40 80 % IL-34+ TEC/HPF % IL-34+ TEC/HPF

Supplement Figure 7. IL-34 correlates with the number of Mø and T cells and histopathology disease activity in type II-IV lupus nephritis. (A) Correlation of intra- renal Mø (CD68+) and T cells (CD3) with IL-34 in lupus nephritis in Type II-IV (n=25, corresponding demographic information in supplement Table 1) and Type I-V (n=40, corresponding demographic information in supplement Table 1). (B) Correlation of IL-34 with kidney histopathology activity and chronicity indices in lupus nephritis in Type II-IV and Type

1-V. IL-34, CSF-1, CD68 and CD3 are detected in renal biopsy by immunostaining. Statistical analysis using Spearman Correlation Coefficient.

Supplement Table 1. Study cohort demographic and clinical characteristics

LN Healthy control Biopsy-proven LN Healthy control Biopsy-proven LN SLE for WB* Healthy control WB n=120 n=62 n=25 n=15 n=40 n=3 n=4 Race White 105 62 23 15 35 3 4 Asian 11 0 1 0 3 0 0 Others 3 0 1 0 2 0 0 Sex Female 109 51 22 10 35 3 4 Male 11 11 3 5 5 0 0 Age (years) at study Mean 44.1±2.1 48.5±1.9 32.3±2.1 40.7±3.7 34.1±2.7 42.1±2.3 33.5±4.1 Range 22-75 23-76 17-69 22-67 17-69 25-58 25-41 Age at SLE diagnosis (years) Mean 32.9±2.2 29.1±1.9 33.1±1.9 29.1±1.7 Range 12.1-72.3 10.7-67.1 10.7-67.1 18.1-43.4 Age at diagnosis of LN (years) Mean 38.6±4.2 32.3±2.1 34.1±2.7 29.1±1.7 Range 14.3-58.2 17.5-69.3 17.5-69.8 18.1-43.4 Disease duration at time of LN onset (years) Mean 9.1±1.9 4.3±1.1 4.2±1.1 0 Range 0-34.8 0-30.2 0-30.2 0 Overall duration of SLE in this cohort (years) Mean 10.4±1.4 8.7±1.1 9.2±1.2 11±1.8 Range 0.7-43.7 0.8-25 0.8-25 2.1-28.2 Clinical parameter at the time of LN diagnosis Creatinine (mg/dl) 1.2±0.2 1.0±0.2 1.4±0.1 0.9±0.2 1.6±0.3 1.1±0.2 1.0±0.1 Proteinurie (24h collection) >0.5g n 120 25 15 38 0 Mean 1.3±0.5 2.7±0.4 0.1±0.03 3.4±0.6 0.4±0.4 Range 0.2-14.5 g/d 0.4-14.5 g/d 0.01-0.4 g/d 0.4-14.5 g/d 0.4-1.2 g/d ANA positive n 114 25 25 3 anti-dsDNA positive n 101 25 25 3 Depressed serum C3 level n 78 25 25 2 Mean 0.67±0.6 0.54±0.5 0.54±0.5 0.74±0.5 Range 0.2-1.4 0.2-1.4 0.2-1.4 0.4-1.5 ISN/RPS class Class I n 5 - 2 1 Class II n 12 3 3 1 Class III n 13 7 7 1 Class IV n 35 15 15 0 Class V n 42 - 13 0 Medication Prednisolone dose (mg) dose 3.8±0.7 7.8±0.6 6.3±0.7 5.4±0.4 Prednisolone n 102 20 31 3 Mycophenolat mofetil n 35 14 20 2 Cyclophophamide (only as induction therapy) n 24 13 13 0 Azathioprin n 32 4 4 0 Hydroxychlororquin n 81 20 32 3 Angiotensin-blocking agent n 53 14 26 2 includes only LN includes only LN *Western Blot (WB) type II-IV type I-V

Supplement Table 2. Antibodies used for immunostaining.

Immunofluorescence Antigen Clone Cat. No. Supplier IgG 30-F11 55493 Cappel C3 1A8 55500 Cappel Ki-67 SP6 VP-RM04 Vector Laboratories CD19 6D5 115508 BioLegend F4/80 BM-8 MF48000 Invitrogen Immunohistochemistry Mouse Antigen Clone Cat. No. Supplier F4/80 BM-8 MF48000 Invitrogen CD4 RM4-5 14-0042-85 eBioscience B220 RA3-6B2 14-0452-85 eBioscience Cleaved Caspase-3 Polyclonal 9661 Cell Signaling Technology CD3 SP7 16669-500 Abcam F4/80 CI:A3-1 MCAP 497 Serotec CD20 M-20 Sc-7735 Santa Cruz Human Antigen Clone Cat. No. Supplier IL-34 C-19 sc-243072 Santa Cruz Biotechnology CSF-1 N-16 sc-1324 Santa Cruz Biotechnology c-FMS C-20 sc-692 Santa Cruz Biotechnology PTPRZ Polyclonal ab126497 Abcam CD68 PG-M1 M0876 Dako CD3 SP-7 RM-9107-S1 Neomarkers CD19 Polyclonal ab99965 abcam Western blot Mouse Antigen Clone Cat. No. Supplier Developmental Studies PTPRZ 3F8 - Hybridoma Bank α-Tubulin TU-02 sc8035 Santa Cruz

ERK2:p42 MAPK Polyclonal 9108 Cell Signaling

GAPDH 0411 sc-47724 Santa Cruz Human Antigen Clone Cat. No. Supplier

PTPRZ 122.2 sc33664 Santa Cruz

GAPDH 14C10 2118 Cell Signaling ß-Actin 13E5 4970 Cell Signaling ERK: p44/42 MAPK Polyclonal 9102 Cell Signaling Supplement Table 3. qPCR primers to detect mRNAs.

Gene Forward primer sequence Reverse primer sequence β-actin 5’- GATTACTGCTCTGGCTCCTAGC -3’ 5’-GACTCATCGTACTCCTGCTTG-3’

Bca-1/Cxcl13 5’- CTCTCCAGGCCACGGTATT -3’ 5’- TAACCATTTGGCACGAGGAT -3’

Csf1 5′- GGCTTGGCTTGGGATGATTCT -3’ 5′- GAGGGTCTGGCAGGTACTC -3′

Fms 5′- TGTCATCGAGCCTAGTGGC -3′ 5′- CGGGAGATTCAGGGTCCAAG -3′

Gapdh 5’-AGGTCGGTGTGAACGGATTTG-3′ 5’- TGTAGACCATGTAGTTGAGGTCA -3′

Ifn-γ 5’- AGCTCTTCCTCATGGCTGTT -3’ 5’- TTTTGCCAGTTCCTCCAGAT -3’

Il-1β 5’- GCCTCGTGCTGTCGGACCCA -3’ 5’- TGAGGCCCAAGGCCACAGGTAT -3’

Il-10 5’-GCTCTTACTGACTGGCATGAG-3’ 5’- CGCAGCTCTAGGAGCATGTG-3’

Il34 5′- TTGCTGTAAACAAAGCCCCAT -3′ 5′- CCGAGACAAAGGGTACACATTT -3′

Ip10/Cxcl10 5’- TGAAATTATTCCTGCAAGCCAA -3’ 5’- CAGACATCTCTTCTCACCCTTCTTT -3’

I-tac/Cxcl11 5’- AGTAACGGCTGCGACAAAGT -3’ 5’- GCATGTTCCAAGACAGCAGA -3’

Mcp-1/Ccl2 5’- GCTTGAGGTGGTTGTGGAAAA- 3’ 5’- CTCACCTGCTGCTACTCATTC -3’

Mig/Cxc9 5’- TCCTTTTGGGCATCATCTTC -3’ 5’- TTCCCCCTCTTTTGCTTTTT -3’

Mip1a/Ccl3 5’- TCTCCACCACTGCCCTTGCT -3’ 5’- GGCGTGGAATCTTCCGGCTGT -3’ 5’- GGAGTATCCAACAGTTCAGAGGC Ptprz1 5’- AAGTCAGGGCAGACACGATCAC -3’ -3’ Rantes/Ccl5 5’- TGCCAACCCAGAGAAGAAGT-3’ 5’- AAGCTGGCTAGGACTAGAGCAA -3’

Tnf-α 5’- CCCTCACACTCAGATCATCTTCT -3’ 5’- GCTACGACGTGGGCTACAG -3’

Supplement Table 4. Antibodies used for FACS.

Antigen Clone Fluorochrome Supplier

CD45 30-F11 Pacific blue BioLegend

Ly6G 1A8 APC-Cy7 BioLegend

CD11b M1/70 Brillant Violet 510 BioLegend

F4/80 BM-8 PE-Cy7 BioLegend

CD19 6D5 APC BioLegend

CD3e 145.2C11 PE eBioscience

E-cadherin DECMA-1 Alexa-Fluor 647 BioLegend

Annexin-V - APC BioLegend

Ki-67 16A8 FITC BioLegend

IL-10 JES5-16E3 PE-Cy7 BioLegend

TNFa MP6-XT22 PerCP/Cy5.5 BioLegend iNOS CXNFT PE eBioscience

Arginase-1 Polyclonal FITC R&D Systems

CD86 GL-1 PE-Cy7 BioLegend

CD69 H1.2F3 APC-Cy7 BioLegend

CD23 B3B4 PE eBioscience

BrdU Bu20a PE BioLegend

Cleaved Caspase-3 Asp175 Unconjugated Cell Signaling Technology

Rat IgG2a RTK2758 PE/Cy7 BioLegend

Rat IgG2b 30-F11 Pacific Blue BioLegend

Rat IgG1 G0114F7 PerCP/Cy5.5 BioLegend

Armenian Hamster IgG HTK888 PE BioLegend

Rat IgG2a RTK2758 PE BioLegend

Rat IgG2a RTK2758 APC/Cy7 BioLegend

Rat IgG2a eBR2a APC eBioscience

Rat IgG2a RTK2758 FITC BioLegend

Anti-rabbit IgG Poly4064 PE BioLegend