Mutation Spectrum of the P53 Gene in Bone and Soft Tissue Sarcomas1

ICANCER RESEARCH 52.6194-6199, November 15, 1992] Mutation Spectrum of the p53 Gene in Bone and Soft Tissue Sarcomas1

Junya Toguchida, Toshikazu Yamaguchi, Bruce Ritchie, Roberta L. Beauchamp, Siri H. Dayton, Guillermo E. Herrera, Takao Yamamuro, Yoshihiko Kotoura, Musan S. Sasaki, John B. Little, Ralph R. Weichselbaum, Kanji Ishizaki, and David W. Yandell2

Howe Laboratory of Ophthalmology, Massachusetts Eye and Ear Infirmary, Boston, Massachusetts 02114 [J. T., R. L. B., S. H. D., G. E. H., D. W. Y.]; Department of Orthopaedic Surgery fJ. T., To. Y., Ta. Y., Y. K.J and Radiation Biology Center fTo. Y., M. S. S., K. /./, Kyoto University, Kyoto 606, Japan; Department of Biochemistry, University of Alberta, Edmonton, Alberta, Canada T6G 2H7 [B. R.f; Department of Cancer Biology, Harvard School of Public Health, Boston, Massachusetts 02115 [ J. B. L., D. W. Y.J; and Department of Radiation and Cellular Oncology, University of Chicago Medical Center, Chicago, Illinois 60637 /R. R. W.]

ABSTRACT These include a high mutation frequency at CpG sites in colorectal cancer (10) and lymphoid malignancies (11), a predom We present here an analysis of the spectrum of mutations of the p53 inance of G to T transversions in non-small cell lung cancer gene seen in 127 bone and soft tissue sarcomas of various histolÃ³gica! classifications. Gross rearrangements were analyzed by Southern blot (12), and a predominance of G to T transversions at codon 249 ting using a complementary DNA probe from the p53 gene, and subtle in hepatocellular carcinomas (13, 14). Osteosarcoma, a repre alterations in the entire coding sequence (exons 2 through 11) were sentative of malignant tumors derived from bone and soft tis identified by a combination of single-strand conformation polymor sue, is one of the first human tumors in which p53 gene muta phism analysis and direct genomic sequencing. A total of 42 somatic tions were found (15). We describe here a comprehensive study alterations of the p53 gene were found, of which 21 were gross rear of the spectrum ofp53 gene mutations found in a large number rangements and 21 were subtle alterations. These included 17 cases of of bone and soft tissue sarcomas. Our goal was to compare the a single base substitution, 3 small deletions, and one single base inser spectrum ofp53 mutations in sarcomas with that seen in other tion. In contrast to reported findings for other types of cancer, we found tumors in the hope that useful information about the role of p53 that mutations of the p53 gene in sarcomas are quite heterogeneous both in sarcoma progression could be found. in their distribution throughout the gene and in the type of genetic alterations that result. All 13 missense mutations we found occurred at highly conserved residues, whereas 8 nonsense mutations occurred at MATERIALS AND METHODS sites that spanned the gene from codons 46 to 316. Surprisingly, DNA Samples. Tumor tissues were obtained at surgical resection, approximately one-half of the osteosarcomas with allelic deletions on dissected, rinsed to remove adjacent normal tissue and blood, flash 17p did not have detectable alterations in the coding sequence of the frozen, and stored at -70Â°C until DNA extraction. Nonmalignant in p53 gene. filtrate or stromal cell content was not quantitated, but histopatholog- ical examination was carried out, and only those samples that contained INTRODUCTION predominantly neoplastic cells were used for molecular studies. High- molecular-weight DNA from tumor tissues and peripheral leukocytes The p53 gene, located at chromosome 17pl3, encodes a M, were prepared as described elsewhere according to standard protocols 53,000 nuclear phosphoprotein that has been characterized ex (16). tensively. Several studies have shown that reintroduction of a Southern Blot Analysis. Gross rearrangements of the p53 gene were wild-type p53 gene into p53-deficient cells leads to suppression analyzed using a cDNA3 probe for the p53 gene (pR4-2) (17). This of the neoplastic phenotype; hence this gene has been catego cDNA probe hybridizes with three Â£coRI-digested fragments (15, 15, rized as a tumor suppressor (1, 2). This suppressor activity may and 3.5 kilobases) (18). The 3.5-kilobase fragment, corresponding be exerted through the transcriptional control of proliferation- to exon 1 sequences, is too faint to be seen on normal autoradiographic related genes, and several experiments have identified a tran exposure. The presence of these fragments was confirmed by additional, scription-activating sequence in the p53 protein (3, 4). Another longer exposure of all blots (data not shown). Allelic deletions on 17p were analyzed using six polymorphic probes (pi0.5, pA 10-41, possible function of this protein is the regulation of DNA rep pHF12-l, pmCT35.1, pmCT35.2, and pYNZ22) as previously de lication through its association with DNA replication com plexes. In simian virus 40-transformed cells, the p53 protein scribed (19, 20). Restriction endonuclease digestion of DNA samples, agarose gel electrophoresis, Southern hybridization, labeling of probes, has been shown to bind large T-antigen, inhibiting T-antigen and autoradiography were performed by standard procedures (16). from binding a viral replication origin (5) or DNA polyrnerase SSCP Analysis. Each primer sequence was obtained from published Â«(6). Recently, it was shown that DNA fragments that bind to data or by sequencing genomic clones of the human p53 gene provided the p53 protein contain sequences similar to potential replica by Dr. L. Crawford. PCR fragments were generated from 50 ng of tion origins (7). Although the exact function of this gene is still genomic DNA in a 50-^1 mixture containing: 20 UMdATP, dTTP, unknown, alterations of this gene have been found to be closely dGTP; 2 UMdCTP; 1.0 to 2.5 min MgCl2; 20 pmol of each primer; associated with the formation of various human cancers (8, 9). 20 mivi Tris (pH 8.4 or 8.6); 50 mivi KCl; 50 Mg/ml bovine serum albumin; 0.5 units Taq polyrnerase (Perkin-Elmer Cetus); and 0.1 ^1 Intensive analysis of p53 gene mutations has been carried out (7 nm) [Â«-12P]dCTP(3000 Ci/mmol). PCR was carried out using 30 on a variety of human cancers, and tumor-specific mutation cycles (30 s at 94Â°C,90 s at 52Â°to 60Â°C,and 120 s at 71Â°C)on a spectra have been found in several types of malignant tumors. programmable thermal controller (MJ Research, Inc.). One-tenth of the amplified product was diluted with 15 to 40 u\ of a 0.1% sodium Received 2/27/92; accepted 9/11/92. dodecyl sulfate-10 miviEDTA mixture, followed by 1:1 dilution with a The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accord 95% formamide, 89 mM Tris, 2 min EDTA, 89 miviboric acid, 0.05% ance with 18 U.S.C. Section 1734 solely to indicate this fact. bromophenol blue, 0.05% xylene cyanol loading solution. Dilute sam 1Supported by grants from the NIH (D. W. Y., R. R. W.), the Center for ples were heat denatured at 95Â°Cfor 2 min and then were loaded on Radiation Therapy (D. W. Y., R. R. W.), and the Japanese Ministry of Education, 6% nondenaturing polyacrylamide gels: once on a gel containing 10% Science and Culture (M. S. S., T. Y.). D. W. Y. is a Research to Prevent Blindness Dolly Green Scholar. glycerol, and a second time on a gel that did not contain glycerol. 2To whom requests for reprints should be addressed, at Howe Laboratory. Molecular Genetics, Room 575, Massachusetts Eye and Ear Infirmary, 243 Charles 1The abbreviations used are: cDNA, complementar)1 DNA; SSCP, single-strand Street. Boston. MA 02114. conformation polymorphism: PCR, polyrnerase chain reaction. 6194

Electrophoresis was performed at room temperature with a constant power of 8 W for 8 to 16 h. Autoradiography was carried out for 12-24 123456789 10 11 h without an intensifying screen. Direct Genomic Sequencing. Direct sequencing of double-stranded PCR fragments was performed as previously described (21). Amplified PCR products were purified through Sepharose CL-6B (Pharmacia) and combined with 7 pmol of 32P-end-labeled primer. Primer-template mixtures were heat-denatured, and sequencing'reactions were carried out with Sequenase (U.S. Biochemical). Electrophoresis was performed on 6% denaturing polyacrylamide gels. Autoradiography was carried out for 12-16 h without the use of an intensifying screen. 4.4

RESULTS Fig. 1. Rearrangements of the p53 gene in osteosarcomas. High-molecular- Rearrangements of the p53 Gene. DN A from 127 bone and weight DNA was digested with fcoRI, and fragments were separated on a 0.7% agarose gel, blotted onto a nylon membrane, and hybridized with a cDNA probe soft tissue sarcomas was examined by Southern blot analysis from lhep53 gene (pR4-2). Lane 1, leukocyte DNA from a normal control; Lanes using a cDNA probe from the p53 gene (pR4-2) (17). The 2-11, DNAs from osteosarcoma tumors (see "Materials and Methods"). pathological diagnosis for these samples was: osteosarcoma in 76 cases; malignant fibrous histiocytoma in 13 cases; chondro- sarcoma in 9 cases; synovial sarcoma and Ewing's sarcoma dure (22). Separate pairs of oligonucleotide primers were used to amplify each of the/753 exons 2-11 except exon 5, for which (5 cases each); liposarcoma and rhabdomyosarcoma (4 cases two overlapping PCR fragments were analyzed (Table 2). The each); chordoma in 3 cases; fibrosarcoma in 2 cases; malignant exon-containing PCR fragments included at least 10 base pairs schwannoma; alveolar soft part sarcoma; leiomyosarcoma; ma of 5' and 3' flanking sequences surrounding each exon. To lignant hemangiopericytoma; epithelioid sarcoma; and ter- increase the sensitivity of the SSCP technique for some regions, atoma (one case each). Gross rearrangements of the p53 locus PCR-amplified DNA fragments from some exons were digested were detected in 21 tumors (Table 1). These gross rearrange by an appropriate restriction endonuclease to reduce the size of ments were identified by an abnormal restriction pattern, usu the PCR fragments to approximately 200 base pairs (Table 2). ally involving the presence of additional fragments of abnormal To further characterize variants, samples that showed a variant size (Fig. 1). Abnormally migrating bands in Fig. 1 have arisen alÃeleby SSCP analysis were analyzed by direct genomic se from structural rearrangements within a 15-kilobase EcoRl quencing (21). To confirm that the majority of mutations in the fragment containing exons 2-10 of thep53 gene; the remaining p53 gene were detected by this screening process, we carried out faint 15-kilobase band is due to a second EcoRl fragment con DNA sequence analysis on 36 "SSCP-negative" samples in taining the unrearranged 3' end of the gene (18). In all cases the exon 5 and 48 samples in exon 7. This analysis revealed no rearrangements were not observed in DNA of leukocytes taken additional point mutations (data not shown). from the same patient, excluding the possibility of neutral poly A total of 21 subtle alterations including point mutations, morphisms at the enzyme recognition sites (data not shown). small deletions, and an insertion were identified and character Of the 21 rearrangements we found, 18 occurred in osteosar ized by this screening method (Table 3). Examples of SSCP coma tumors, 2 in malignant fibrous histiocytomas, and 1 in a analysis and sequences showing mutations are presented in fibrosarcoma. Figs. 2 and 3, respectively. Of these 21 mutations, 14 were Screening for Point Mutations of the pS3 Gene. Mutations found in osteosarcomas, 4 occurred in chondrosarcomas, 2 in too small to be resolved by Southern blotting were identified in malignant fibrous histiocytoma, and one mutation was found in two steps. In the first step, SSCP analysis was used to identify a liposarcoma. None of these tumors had a gross alteration of samples with DNA sequence variations. SSCP was performed thep53 gene except one case (KS-103), in which a heterozygous with only minor modifications of the original published proce- rearrangement was found. The point mutation found in this tumor was also heterozygous. These results suggest that two Table 1 Gross alterations of the p53 gene in sarcoma different mutations occurred in each of two copies of the p53 IDKS-41KS-61KS-73KS-102KS-162KS-72KS-115KS-121KS-149KS-150KS-74K.S-82KS-103KS-1typeOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaOsteosarcomaMFH"MFHFibrosarcomaProposedalterationHomozygous gene in this case. Although we cannot exclude the possibility deletionHomozygouspartial that two mutations occurred on the same alÃele,we believe that deletionHomozygouspartial this is unlikely. deletionHomozygouspartial Characteristics of Point Mutations Found in Sarcomas. The deletionHomozygouspartial deletionHomozygouspartial locations of the 21 point mutations we found are shown in Fig. rearrangementHomozygous 4. Of these, 13 mutations were single-base changes that cause rearrangementHomozygous amino acid substitutions in the p53 protein, and 6 are nonsense rearrangementHomozygous rearrangementHomozygous mutations that result in premature termination codons due to rearrangementHeterozygous deletion, insertion, or the direct creation of a stop codon due to rearrangementHeterozygous rearrangementHeterozygous a single base substitution. The remaining two mutations were rearrangementHeterozygous intronic mutations at canonical splice junctions. The majority 11KS-127KS-I63KS-1 rearrangementHeterozygous ofp53 gene mutations in various types of cancers were found in rearrangementHeterozygous rearrangementHeterozygous five evolutionarily conserved domains (8, 9, 23). Of the 21 point 68KS-173KS-4SKS-71KS-80Tumor rearrangementHeterozygous mutations described in this study, 10 (48%) occurred in the rearrangementHeterozygous conserved domains; all 10 of these were missense mutations. rearrangementHeterozygous Three more missense mutations (162"c to 162phc, 193His to rearrangementHeterozygous rearrangement 193Gln, 259Asp to 259Val) were found outside the conserved " Malignant fibrous histiocytoma domains but occurred at codons that are identical in human, 6195

Table 2 Oligonucleotide primer pairs to amplify SSCP fragments of each exon in the p53 gene of of amplifiedfragment(base digestedfragment(base sequence(sense/antisense)5 Exon2345 pairs)132,131,18184176,159,105189162201171204185148,81178Tablepairs)281184440189162201171204185229178Restrictionendonucleaseft/millNo -TGGAAGTGTCTCATGCTGGA5 -CAGAACGTTGTTTTCAGGAA5'-AGCGAAAATTCCATGGGACT5

digestionMsplNo -TCCATTGCTTGGGACGGCAA5'-ACTTCCTGAAAACAACGTTCT5'-CAGGCATTGAAGTCTCATGG5

(5'end)5 -TTATCTGTTCACTTGTGCCC5 digestionNo -TCATGTGCTGTGACTGCTTGS'-TTCCACACCCCCGCCCGGCA5

(3'end)678910IIPrimer digestionNo -ACCCTGGGCAACCAGCCCTG5

-ACGACAGGGCTGGTTGCCCA5'-CTCCCAGAGACCCCAGTTGC5 digestionNo

-GGCCTCATCTTGGGCCTGTG5 digestionNo -CAGTGTGCAGGGTGGCAAGT5

-CTGCCTCTTGCTTCTCTTTT5 digestionNo -TCTCCTCCACCGCTTCTTGT5'-GCAGTTATGCCTCAGATTCA5

digestionAlulNo -GGCATTTTGAGTGTrAGACT5

GGTACTGTGTATATACTTAC5 -ATGAGAATGGAATCCTATGG5

-AGACCCTCTCACTCATGTGAS'-GGGGGAGGGAGGCTGTCAGTGSize digestionSize

sarcomasIDKS-146KS-131KS-57KS-93308-OTKS-134KS-133KS-211KS-140KS-198KS-208KS-283KS-1S4258-OTKS-96KS-241KS-81KS-103KS-197KS-39KS-107Tumortype"OSOScscsOSOSMFHOSOSOSOScsOSOSMFHOSOSOSOScsLSExon3 Somatic point mutations of the p53 gene in

acidchange Amino Codon4 change1 46-74 221base pair deletion Stop at 1 1125 22ATCbase pair deletion Stop at 1 1625 PheGTGto TTC Ile to 1735 AlaCGCto GCG Val to 1756 HisCATto CAC Arg to 1936 GinCGAto CAA His to 1966 SlopGAGto TGA Arg to 2217 Slop4 to TAG Glu to 227-87 245TCCbase pair deletion Stop at 2417 TyrGGCto TAC Ser to 2447 ValAGGto GTC Gly to 2497 ThrCCCto ACG Arg to 2507 LeuGACto CTC Pro to 2598 ValCGTto GTC Asp to 2738 HisCGTto CAT Arg to 2738 HisGACto CAT Arg to 2818 HisGACto CAC Asp to 2819 AsnaaTGto AAC Asp to site9 Splice acceptor toggTCG1 316-79 336AGgtbase pair insertion Stop at Splice donor siteWithinconserveddomains?NoNoNoYesYesNoNoNoNoYesYesYesYesNoYesYesYesYesNoNoNoNucleotideto AGttWild-typealÃ•ele-â€”+â€”+â€”+++â€”â€”+â€”â€”+â€”â€”+â€”+ 'OS, osteosarcoma; MFH. malignant fibrous histiocytoma; LS. liposarcoma. monkey, rat, and mouse (23). Therefore, all 13 of the missense (KS-146, deletion of one C from a string of 4 Cs; KS-131, mutations we found occurred at highly conserved residues of deletion of one C after a 3-string of G's; KS-39, insertion of one lhep53 gene, whereas nonsense mutations appeared to occur at C in a string of 4 Cs). Finally, a 4-base pair deletion was found random. in a region within a direct repeat (KS-140, GCTCTGACTG to Of the 21 point mutations we found, 17 are single base sub GCTCTG). stitutions. The nature of these base substitutions is shown in Clinical Phenotypes of Osteosarcomas with pS3 Gene Muta Table 4; 8 were transitions (4 of which occurred at CpG dinu- tions. Of all osteosarcoma patients in this study, clinical fol cleotides), and 9 were transversions. Although the total number low-up of 2 or more years after initial treatment is available for of mutations is small, our data show no clear hotspots and no only 36 patients. Lung mÃ©tastasesdeveloped in 21 of 36 cases; preponderance of one particular type of mutation. Two in 10 of these (48%) occurred in patients whose primary tumors stances of a single base deletion and one instance of a single carried one or more p53 gene mutations. Fifteen osteosarcoma base insertion occurred in strings of G or C nucleotides patients showed no evidence of disease during the 2 years that 6196

Fig. 2. a, SSCP analysis of exon 7 of the p53 gene in a patient with osteosarcoma (KS-154). Control and KS-154 are DNAs from leukocytes, and KS-154-T is DNA from tumor tissues, b, SSCP analysis of exon 9 of the p53 gene in a patient with malignant fibrous histiocytoma (KS-39). c, SSCP analysis of exon 9 of the p53 gene in a patient with liposarcoma (KS-107). Arrows, variant bands.

248Ara< G KS-154-T 319Lys/A CTAG CTAG

Tc\ \250Leu ro C7

252L

KS-107-T

CTAG CIAG

- g/t

Fig. 3. Direct genomic sequence analysis of the p53 gene in patients shown in Fig. 2. a, homozygous C to T transition at codon 250 in exon 7. h, homozygous insertion of one C in a string of 4 Cs spanning codons 316-317 in exon 9. c, heterozygous G to T transversion at the splice donor site of intron 9. 6197

kemia were found to occur in intron 1, and tumors with rear 1TTW rangements were shown to have no detectable mRNA of the/753 V13 WTi WVl gene (27-29), indicating that rearrangements of the p53 gene NH 1iExons 11ii567l l8 COOH usually cause loss-of-function mutations. A similar pattern of rearrangements was observed in our study, although a precise 21Amino 41 910l !100T ll200ÃŒ !300113< analysis of the rearrangement could not be performed in many cases because DNA from the primary tumor was limited. AcidsV The fraction of sarcomas with loss-of-function mutations in Fig. 4. The distribution of somatic point mutations of the p53 gene in sarco the p53 gene increases significantly if point mutations leading mas. Top. schematic diagram of the p53 coding sequences with five conserved to nonsense errors are included. Of the 21 point mutations we domains (3). Bottom, regions spanned by exons 2 through 11. T. missense mu tation: ". other types of mutations (nonsense or splicing mutations). found, 6 mutations create a premature stop codon downstream, leading to the truncation of important regions known to com plex with viral antigens or wild-type p53 protein (30, 31). Al Table 4 Nature of base substitutions in the p53 gene mutations in sarcomas though it is likely that the two mutations found at splicing sites of exon 9 are also loss-of-function mutations, neither RNA nor SubstitutionsTransitionG:C (%)8(47)6(35)2(12)9(53)4(23)2(12)0 protein studies could be carried out on these tumors. Therefore, toA:TA:T at least 27 (21 rearrangements and 6 nonsense mutations) of 42 toG:CTransversionG:C (64%) of thep53 gene mutations we identified in 127 sarcomas can be regarded as loss-of-function mutations. toT:AG:C Interestingly, we found a similar mutation spectrum among toC:GA:T germ-line p53 gene mutations in sarcoma patients. Although toC:GA:T (0)3(18) to T:ANumber the number of cases was much smaller, 4 of 8 patients with germ-line p53 gene mutations carried loss-of-function muta tions (32). This predominance of loss-of-function mutations in followed their initial treatment. p53 gene mutations were iden sarcomas is considerably different from the mutation spectrum tified in 7 patients from this group (47%). Therefore, no defi reported for other types of cancer such as colorectal carcinomas or non-small cell lung cancer, where missense errors accounted nite association was observed between p53 gene mutation and the incidence of lung metastasis in the 36 patients for whom a for 94% (30 of 32 cases) or 91% (21 of 23) of all mutations, 24-month clinical follow-up was available. respectively (10, 12). Since the number of potential targets for Association of pS3 Gene Mutations with AlÃeleLoss on 17p. nonsense mutations is theoretically much greater than that for Allelic deletions on 17p were previously found in approxi functionally significant missense mutations, it is reasonable to mately 70% of osteosaroma tumors, and the common region expect that the spectrum of single base substitutions would be broad in tumors with a tendency toward loss-of-function muta of alÃeleloss was assigned to 17pl3, where the p53 gene is located (19, 24). These data suggest that allelic deletions on 17p tions. Indeed, the mutations we observed in 127 sarcomas occur as a second event following an initial mutation on the spanned a wide region of the p53 gene, from codons 46 to 316. homologous copy of p53 gene. Of 76 cases of osteosarcoma Our findings emphasize the importance of screening, at a min analyzed in this study, 57 cases were informative (constitution imum, the entire p53 coding region if an accurate evaluation of ally heterozygous) for the analysis of alÃeleloss on 17p (Table the spectrum of p53 gene mutations is sought. 5). In 39 of 57 cases (68%), tumor cells lost one alÃeleat one or Our detection of a disproportionately low frequency of p53 gene mutations among tumors with alÃeleloss on 17p is quite more polymorphic loci on 17p. Alterations in the p53 gene, interesting with respect to the "two-hit hypothesis" of tumor including either gross rearrangements or point mutations, were identified in 51% (20 of 39) of tumors with alÃeleloss on 17p. suppressor gene action. By comparison, a study ofp53 mutation No detectable mutations were found in the remaining 49% of and allelic loss on 17p in colorectal carcinoma has shown that tumors with alÃeleloss on 17p. Genetic alterations of the p53 86% of tumors with 17p allelic loss carried a mutation in the gene were found in 50% (9 of 18) of tumors that were informa p53 gene (10). Several explanations could account for the dis tive for 17p markers and which retained both alÃelesat the p53 parate findings in these two studies. First, studies that do not locus. include a detailed analysis of the promoter and exon 1 might underestimate the overall frequency ofp53 mutations by failing to detect mutations in regulatory regions, as have been de DISCUSSION scribed for another tumor suppressor, the retinoblastoma gene A number of studies have been reported concerning the inci (33). Since the promoter region of the p53 gene was not ana dence of p53 gene mutations in human cancers, allowing a lyzed in our study, the possibility exists that we missed such comparison of the mutation spectrum we found in sarcomas mutations; hence, it is possible that most of the tumors with with that seen in other types of malignant tumors. Our study alÃeleloss in our study do carry p53 mutations, but they went revealed a relatively high incidence (21 of 126) of gross rear undetected. A second possibility is that the p53 gene was not rangements of thep5J gene in sarcomas. This is consistent with previous reports describing p53 gene mutations in sarcomas (15, 25-27). Point mutations of the p53 gene have also been Table 5 The association of allelic deletions on 17p with the p53 gene mutations found with a high frequency in various other types of cancers. mutationRearrange LOH detectable However, only chronic myelogenous leukemia at blast crisis on17p+Detectable mutation showed an equivalent frequency of gross rearrangements of the ments107Point mutations102Total20 Total19 p53 gene (28, 29). In these previous studies, the majority of rearrangements in both sarcomas and chronic myelogenous leu 9No 9 6198

Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 1992 American Association for Cancer Research. p53 GENE MUTATIONS IN SARCOMAS mutated in some tumors with allelic losses on 17p. The pres 13. Hsu, I., Metcalf, R.. Sun, T., Welsh, J., Wang, N., and Harris, C. Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Nature (Lond.). ence of another tumor suppressor gene on 17p telomeric to the 550:427-428, 1991. p53 locus has been postulated in studies of breast cancer (34) 14. Bressac, B., Kew. M.. Wands, J., and Ozturk, M. Selective G to T mutations and hepatocellular carcinoma (35) and could account for our of p53 in hepatocellular carcinoma from southern Africa. Nature (Lond.), 550:429-431. 1991. data. Finally, a third possibility is that allelic loss at the p53 15. Masuda, H., Miller. C.. Koeffler, H., Battifora, H., and Cline, M. Rearrange locus might itself have oncogenic potential in some target cells ment of the p53 gene in human osteogenic sarcomas. Proc. Nati. Acad. Sci. and would thus precede detectable mutations at the remaining USA, Â«4:7716-7719, 1987. 16. Maniatis, T., Fritsch, J., and Sambrook, J. (eds.). Molecular Cloning: a locus in these cases. In colorectal carcinomas, missense muta Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Press, tions are supposed to precede allelic deletions; the mutant pro 1982. teins are assumed to create a growth advantage through a "dom 17. Harlow. E., Williamson, N.. Ralston, R., Helfman. D.. and Adams, T. Mo inant negative" effect. Therefore, cells with one mutant alÃele lecular cloning and in vitro expression of a cDNA clone for human cellular tumor antigen p53. Mol. Cell. Biol., 5: 1601-1610, 1985. may lose the remaining normal alÃeleduring a phase of rapid 18. Lamb. P., and Crawford, L. Characterization of the human p53 gene. Mol. proliferation (10). Thus, a simple quantitative decrease of the Cell. Biol.. 6: 1379-1385, 1986. 19. Toguchida, J., Ishizaki, K., Nakamura. Y., Sasaki, M., Ikenaga, M., Kalo, p53 gene product might be enough to endow cells with a growth M., Sugimoto, M.. Kotoura, Y., and Yamamuro. T. Assignment of common advantage in a tissue-specific manner. The fact that approxi alÃeleloss in osteosarcoma to the subregion 17pl3. Cancer Res., 49: 6247- mately one-half of tumors without allelic deletions on 17p in 6251, 1989. 20. Nakamura, Y., Lathrop. M., O'Connell, P., Leppert, M.. Barker, D., Wright. this study have an alteration of the p53 gene may support this E.. Skolonick, M.. Kondoleon, S., Litt, S., Lalouel, J., and White, R. A model. This hypothesis would be more compelling if expression mapped set of DNA markers for human chromosome 17. Genomics, 2: of the two alÃelesofthe p53 gene is not equivalent in all cells, as 302-309, 1988. 21. Yandell, D., and Dryja, T. Detection of DNA sequence polymorphisms by has been shown for other genes (36, 37). A precise analysis of enzymatic amplification and direct genomic sequencing. Am. J. Hum. Gen the expression of the p53 gene in tumors without detectable et., 45: 547-555, 1989. mutations would further our understanding of this issue. 22. Orila. M., Suzuki. Y., Sekiya, T., and Hayashi, K. Rapid and sensitive de tection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5: 874-879, 1989. ACKNOWLEDGMENTS 23. Soussi, T., de Fromentel, C., and May. P. Structural aspects of the p53 protein in relation to gene evolution. Oncogene, 5: 945-952, 1990. 24. Toguchida. J., Ishizaki, K., Sasaki, M., Ikenaga, M., Sugimoto, M., Kotoura, We thank Dr. T. Dryja for his cooperation; Drs. N. Takada, T. Y.. and Yamamuro, T. Chromosomal reorganization for the expression of Umeda, N. Kawaguchi, Y. Kaneko, I. Spiro, A. Rosenberg, and H. recessive mutation of rctinoblastoma susceptibility gene in the development Halprin for providing materials and clinical information; Dr. Y. Naka- of osteosarcoma. Cancer Res., 48: 3939-3943, 1988. mura for polymorphic probes on 17p; Drs. H. Koeffler and C. Miller for 25. Mulligan, L., Matlashewski, G., Scrable, H., and Cavenee, W. Mechanisms a cDNA clone of the p53 gene; Drs. L. Crawford and S. Tuck for a of p53 loss in human sarcomas. Proc. Nati. Acad. Sci. USA, 87: 5863-5867, 1990. genomic clone containing the p53 gene; and Drs. B. Ludeke, R. Chung, 26. Stratton, M., Moss. S., Warren, W., Patterson, H., Clark. J., Fisher, C., J. Whaley, G. Cowley, and B. Seizinger for technical advice. Fletcher, C., Ball, A., Thomas, M., Gusterson, B.. and Cooper, C. Mutation of the p53 gene in human soft tissue sarcomas: association with abnormalities of the RBI gene. Oncogene, 5: 1297-1301. 1990. REFERENCES 27. Miller, C, Aslo, A., Tsay, C., Slamon, D.. Ishizaki, K., Toguchida. J., Yama 1. Finlay. C., Hinds, P., and Levine, A. The p53 proto-oncogene can act as a muro. T., Lampkin. B., and Koeffler, H. Frequency and structure of p53 suppressor of transformation. Cell, 57: 1083-1093, 1989. rearrangements in human osteosarcoma. Cancer Res., 50: 7950-7954. 1990. 28. Ahuja, H., Bar-Eli. M., Advani, S., Benchimol, S., and Cline, M. Alterations 2. Baker, S., Markowitz, S., Fearon, E., Willson, J., and Vogelstein, B. Sup pression of human colorectal carcinoma cell growth by wild-type p53. Science in the p53 gene and the clonal evolution of the balst crisis of chronic myelo- (Washington DC). 249: 912-915, 1990. cytic leukemia. Proc. Nati. Acad. Sci. USA. Â«6:6783-6787, 1989. 3. Fields. S., and Jang, S. Presence of a potent transcription activating sequence 29. Kelman, Z., Prokocimer, M., Peller, S., Kahn, Y.. Rechavi. G., Manor, Y., in the p53 protein. Science (Washington DC), 249: 1046-1049, 1990. Cohen. A., and Rotter, V. Rearrangements in the p53 gene in Philadelphia 4. Raycroft, L., Wu, H., and Lozano, G. Transcriptional activation by wild-type chromosome positive chronic myelogenous leukemia. Blood, 74: 2318-2324, but not transforming mutants of thep53 anti-oncogene. Science (Washington 1989. DC), 249: 1049-1051, 1990. 30. Soussi, T., de Fromental, C, Sturzbecher, H., Ullrich, S., Jenkins. J., and 5. Braithwaite, A., Sturzbecher, H-W., Addison, C., Palmer, C.. Rudge. K., and May, P. Evolutionary conservation of the biochemical properties of p53: Jenkins, J. Mouse p53 inhibits SV 40 origin-dependent DNA replication. specific interactions of Xenopus laevis p53 with simian virus large T antigen Nature (Lond.), 329: 458-460, 1987. and mammalian heat shock proteins 70. J. Virol., 63: 3894-3901, 1989. 6. Gannon, J., and Lane, D. pS3 and DNA polymerase a compete for binding to 31. Milner, J., Medcalf. E.. and Cook, A. Tumor suppressor p53: analysis of SV 40 antigen. Nature (Lond.), 329: 456-458, 1987. wild-type and mutant p53 complexes. Mol. Cell. Biol., //: 12-19, 1991. 7. Kern, S.. Kinzler, K., Bruskin, A.. Jarosz, D., Friedman, P., Prives, C., and 32. Toguchida, J.. Yamaguchi, T., Dayton. S., Beauchamp, R.. Herrera, G., Vogelstein, B. Identification o(p53 as a sequence-specific DNA-binding pro Ishizaki. K., Yamamuro.T., Meyers. P., Little, J., Sasaki, M., Weichselbaum, tein. Science (Washington DC), 252: 1708-1711, 1991. R., and Yandell. D. Prevalence and spectrum of germ-line p53 gene muta 8. Levine, A., Momand, J., and Finlay. C. The p53 tumor suppressor gene. tions among patients with sarcoma. N. Engl. J. Med., 326:1301-1308. 1992. Nature (Lond.), 351: 453-456, 1991. 33. Sakai, T.. Ohtani, N., McGee, T., Robins, P., and Dryja, T. Oncogenic 9. Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. p53 mutations in germ-line mutations in Spl and AFT sites in the human retinoblastoma gene. human cancer. Science (Washington DC), 25J: 49-53, 1991. Nature (Lond.), 353: 83-86, 1991. 10. Baker. S.. Presinger. A., Jessup, J., Paraskeva, C., Markowitz. S.. Willson. J., 34. Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F., Kasumi, F., Sakamoto, Hamilton, S., and Vogelstein. B. p53 gene mutations occur in combination G., and Nakamura. Y. Allelotypc of breast cancer: accumulative alÃelelosses with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer promote tumor progression in primary breast cancer. Cancer Res.. 50: 7184- Res., 50:7717-7722, 1990. 7189, 1990. 11. Gaidano. G., Ballerini, P., Gong, J., Inghirami. G., Neri, A., Newcomb, E., 35. Fujimori, M., Tokino, T., HiÃ±o,O., Kitagawa. T.. Imamura, T.. Okamolo, Magrath, I., Knowles, D., and Dalia-Pavera. R. pS3 mutations in human E., Mitsunobu, M., Ishikawa, T., Nakagama, H., Harada, H., Yagura. M., lymphoid malignancies: association with Burkitt lymphoma and chronic lym- Matsubara, K.. and Nakamura. Y. Allelotype study of primary hepatocellular phocytic leukemia. Proc. Nati. Acad. Sci. USA, 88: 5413-5417, 1991. carcinoma. Cancer Res., 51: 89-93, 1991. 12. Chiba, I., Takahashi, T., Ã‘au, M., D'Amico, D., Curie!, D., Mitsudomi, T., 36. Barlow. D., Sloger, R., Herrmann, B., Saito, K., and Schweifer, N. The Buchhagen, D., Carbone. D., Piantadosi, S., Koga, H., Reissman, P., Sla- mouse insulin-like growth factor type-2 receptor is imprinted and closely mon. D., Holmes, E., and Minna. J. Mutations in the p53 gene are frequent linked to the 7m? locus. Nature (Lond.), 349: 84-87. 1991. in primary, resected non-small cell lung cancer. Oncogene. 5: 1603-1610, 37. DeChiara, T., Robertson, E., and Efstratiadis. A. Parental imprinting of the 1990. mouse insulin-like growth factor II gene. Cell, 64: 849-859, 1991.

6199

Junya Toguchida, Toshikazu Yamaguchi, Bruce Ritchie, et al.

Cancer Res 1992;52:6194-6199.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/52/22/6194

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/52/22/6194. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.