DOCSLIB.ORG

Identification of Genes Promoting Skin Youthfulness by Genome-Wide Association Study

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification of Genes Promoting Skin Youthfulness by Genome-Wide Association Study ORIGINAL ARTICLE Identification of Genes Promoting Skin Youthfulness by Genome-Wide Association Study Anne L.S. Chang1, Gil Atzmon2,AvivBergman2, Samantha Brugmann3, Scott X. Atwood1, Howard Y. Chang1 and Nir Barzilai2 To identify genes that promote facial skin youthfulness (SY), a genome-wide association study on an Ashkenazi Jewish discovery group (n ¼ 428) was performed using Affymetrix 6.0 Single-Nucleotide Polymorphism (SNP) Array. After SNP quality controls, 901,470 SNPs remained for analysis. The eigenstrat method showed no stratification. Cases and controls were identified by global facial skin aging severity including intrinsic and extrinsic parameters. Linear regression adjusted for age and gender, with no significant differences in smoking history, body mass index, menopausal status, or personal or family history of centenarians. Six SNPs met the À 8 À 8 Bonferroni threshold with Palleleo10 ; two of these six had Pgenotypeo10 . Quantitative trait loci mapping confirmed linkage disequilibrium. The six SNPs were interrogated by MassARRAY in a replication group (n ¼ 436) with confirmation of rs6975107, an intronic region of KCND2 (potassium voltage-gated channel, Shal-related family member 2) (Pgenotype ¼ 0.023). A second replication group (n ¼ 371) confirmed rs318125, downstream of DIAPH2 (diaphanous homolog 2 (Drosophila)) (Pallele ¼ 0.010, Pgenotype ¼ 0.002) and rs7616661, downstream of EDEM1 (ER degradation enhancer, mannosidase a-like 1) (Pgenotype ¼ 0.042). DIAPH2 hasbeenassociatedwith premature ovarian insufficiency, an aging phenotype in humans. EDEM1 associates with lifespan in animal models, although not humans. KCND2 is expressed in human skin, but has not been associated with aging. These genes represent new candidate genes to study the molecular basis of healthy skin aging. Journal of Investigative Dermatology (2014) 134, 651–657; doi:10.1038/jid.2013.381; published online 17 October 2013 INTRODUCTION Prior skin aging studies have categorized skin aging Genes promoting overall youthfulness in the form of delayed parameters into intrinsic versus extrinsic characteristics, aging have been reported in the centenarian population believed to reflect genetic versus environmental factors (Perls et al., 2002; Barzilai et al., 2003; Atzmon et al., contributing to skin aging features, respectively (e.g., Fisher 2009b; Tazearslan et al., 2011), but whether these genes et al., 2002; Vierko¨tter and Krutmann, 2012). However, also promote skin youthfulness (SY) is unclear. In fact, genes data suggest that extrinsic skin aging parameters can have a that promote SY have, to date, not been identified. Multiple strong genetic basis. For instance, MC1R gene mutations sources have estimated that over US$140 billion yearly is can promote severe photoaging (Elfakir et al., 2010). spent on cosmetics worldwide (Oh, 2006), testifying to the Heritability analyses in twins have shown that extrinsic intense and broad interest in promoting SY. Anecdotally, some skin aging parameters such ‘‘sun damage’’ exhibit 60% centenarians possess facial skin that appears decades younger heritability (Gunn et al., 2009). Recently, extrinsic skin aging than their chronologic age. This dissociation between parameters of facial photoaging have been linked to a phenotypic and chronologic age may be a unique window genetic change, a single-nucleotide polymorphism (SNP) in to examine whether particular genotypes associate with SY. the intronic area of the STXBP5L gene, in a genome- wide association study of French women (Le Clerc et al., 2013). Hence, this study aims to examine skin aging 1Department of Dermatology, Stanford University School of Medicine, in a global sense, and includes both intrinsic and extrinsic 2 Redwood City, California, USA; Albert Einstein College of Medicine, Bronx, skin aging parameters, both of which have genetic New York, USA and 3Department of Pediatrics, Cincinnati Children’s Hospital and Medical Center, University of Cincinnati, Cincinnati, Ohio, USA underpinnings. Correspondence: Anne L.S. Chang, Department of Dermatology, Stanford The primary objective of this study was to assess whether University School of Medicine, 450 Broadway Street, Mail Code 5334, there may be genes that confer SY in a unique centenarian Redwood City, California 94603, USA. E-mail: [email protected] population, by identifying individuals that lack global skin Abbreviations: GWAS, genome-wide association study; LC, Langerhans cell; aging features (both intrinsic and extrinsic as both have a SAS, skin aging score; SNP, single-nucleotide polymorphism; SY, skin genetic basis) compared with individuals of similar chrono- youthfulness logic age. The secondary objective of this study was to Received 31 January 2013; revised 10 August 2013; accepted 12 August 2013; accepted article preview online 13 September 2013; published online determine whether SY genes overlap with longevity genes in 17 October 2013 this centenarian population. & 2014 The Society for Investigative Dermatology www.jidonline.org 651 ALS Chang et al. Genes Promoting Skin Youthfulness RESULTS 2012). Identity-by-descent analysis showed that all individuals Cases and controls for facial SY phenotype were identified in the discovery group were unrelated (Supplementary Figure using a global skin aging score (SAS) incorporating intrinsic S3 online). Quantile–quantile plots of the P-values are shown and extrinsic skin aging parameters (Guinot et al., 2002). The in Supplementary Figure S4 online. À 8 average difference between chronologic age and SAS (i.e., CA Six SNPs met the Bonferroni threshold with Palleleo10 ; À 8 minus SAS), or average ‘‘delta,’’ for the entire discovery group two of these six had Pgenotypeo10 (Table 2a). A Manhattan was 15.5. To avoid bias in assigning SY cases and controls for plot of the discovery group is shown in Figure 1. Quantitative the genome-wide association study (GWAS), individuals trait loci mapping confirmed linkage disequilibrium (Figure 2). whose ‘‘deltas’’ were greater than the average ‘‘delta’’ were To explore the effects of the asymmetry in percent of defined as cases (individuals with SY), and those whose centenarians between SY cases and SY controls in the ‘‘deltas’’ were less than or equal to the group average were discovery group, we corrected for this and report the effect defined as controls (individuals without SY). There were no on the Palleles for each of the six SNPs Supplementary Table S1 individuals whose ‘‘delta’’ equaled the group average. online. These P-values remain significant when the asymmetry The global SASs were determined by a board-certified is corrected for. dermatologist experienced in assessing skin aging parameters A gene network to assess coexpression of the six significant (see Materials and Methods section). Bland–Altman analysis SNPs identified in the discovery group is shown in Supple- showed the differences in skin aging ratings at two time points mentary Figure S5 online. The six SNPs form four clusters of (Supplementary Figure S1 online). The rating differences at coexpression but no physical interaction. two time points that fell outside the 95th percentile were To confirm these findings of the discovery group, the six distributed across the range of average skin ages, indicating candidate SNPs were interrogated by MassARRAY in a lack of bias in rating for any particular skin age (Supple- replication group (n ¼ 436). Clinical characteristics of the case mentary Figure S1 online). and control groups of the replication group are reported in Clinical characteristics of the case and control groups are Supplementary Table S2a online. After covariate correction reported in Table 1. Linear regression adjusted for age, gender, for age and gender, the significance of rs6975107 was con- and personal or family history of centenarians. There were no firmed. This SNP is located in the intronic region of KCND2 significant differences in smoking history, body mass index, or (potassium voltage-gated channel, Shal-related family personal history of skin cancer between cases and controls. All member 2) (Pgenotype ¼ 0.023). female subjects in the discovery group were postmenopausal. The six candidate SNPs were interrogated by MassARRAY A conventional genome-wide association study on an in a second replication group (n ¼ 371). Clinical character- Ashkenazi Jewish discovery group (n ¼ 428) was performed istics of the case and control groups of the second replication using Affymetrix 6.0 SNP Array. SNP quality controls included group are reported in Supplementary Table S2B online. After removal of 22,118 SNPs that were not in Hardy–Weinberg covariate correction for age and gender, the significance of equilibrium, with 901,470 SNPs remaining for analysis. rs318125 and rs7616661 were confirmed (Tables 2b and c). Eigenstrat method showed no stratification, with good homo- The SNP rs318125 is downstream of DIAPH2 (diaphanous geneity between cases and controls (Supplementary Figure S2 homolog 2 (Drosophila)) (Pallele ¼ 0.010, Pgenotype ¼ 0.002). online). Isolation-by-distance studies in this Jewish diaspora The SNP rs7616661 is downstream of EDEM1 (ER degradation were reported previously (Atzmon et al., 2010; Kenny et al., enhancer, mannosidase a-like 1) (Pgenotype ¼ 0.042). Table 1. Characteristics of cases (SY group) and controls (no-SY group) in the discovery group (n ¼ 428) Cases: SY Controls: no-SY Characteristic Delta4avg. delta Deltapavg. delta P-value N 218 210 Chronologic age, mean in years±SD 79.3±15.4 93.3±10.4 o0.0001 Delta SY, mean±SD 24.6±6.6
Load more

Recommended publications
  • Exceptional Conservation of Horse–Human Gene Order on X Chromosome Revealed by High-Resolution Radiation Hybrid Mapping
    Exceptional conservation of horse–human gene order on X chromosome revealed by high-resolution radiation hybrid mapping Terje Raudsepp*†, Eun-Joon Lee*†, Srinivas R. Kata‡, Candice Brinkmeyer*, James R. Mickelson§, Loren C. Skow*, James E. Womack‡, and Bhanu P. Chowdhary*¶ʈ *Department of Veterinary Anatomy and Public Health, ‡Department of Veterinary Pathobiology, College of Veterinary Medicine, and ¶Department of Animal Science, College of Agriculture and Life Science, Texas A&M University, College Station, TX 77843; and §Department of Veterinary Pathobiology, University of Minnesota, 295f AS͞VM, St. Paul, MN 55108 Contributed by James E. Womack, December 30, 2003 Development of a dense map of the horse genome is key to efforts ciated with the traits, once they are mapped by genetic linkage aimed at identifying genes controlling health, reproduction, and analyses with highly polymorphic markers. performance. We herein report a high-resolution gene map of the The X chromosome is the most conserved mammalian chro- horse (Equus caballus) X chromosome (ECAX) generated by devel- mosome (18, 19). Extensive comparisons of structure, organi- oping and typing 116 gene-specific and 12 short tandem repeat zation, and gene content of this chromosome in evolutionarily -markers on the 5,000-rad horse ؋ hamster whole-genome radia- diverse mammals have revealed a remarkable degree of conser tion hybrid panel and mapping 29 gene loci by fluorescence in situ vation (20–22). Until now, the chromosome has been best hybridization. The human X chromosome sequence was used as a studied in humans and mice, where the focus of research has template to select genes at 1-Mb intervals to develop equine been the intriguing patterns of X inactivation and the involve- orthologs.
    [Show full text]
  • Snapshot: Formins Christian Baarlink, Dominique Brandt, and Robert Grosse University of Marburg, Marburg 35032, Germany
    SnapShot: Formins Christian Baarlink, Dominique Brandt, and Robert Grosse University of Marburg, Marburg 35032, Germany Formin Regulators Localization Cellular Function Disease Association DIAPH1/DIA1 RhoA, RhoC Cell cortex, Polarized cell migration, microtubule stabilization, Autosomal-dominant nonsyndromic deafness (DFNA1), myeloproliferative (mDia1) phagocytic cup, phagocytosis, axon elongation defects, defects in T lymphocyte traffi cking and proliferation, tumor cell mitotic spindle invasion, defects in natural killer lymphocyte function DIAPH2 Cdc42 Kinetochore Stable microtubule attachment to kinetochore for Premature ovarian failure (mDia3) chromosome alignment DIAPH3 Rif, Cdc42, Filopodia, Filopodia formation, removing the nucleus from Increased chromosomal deletion of gene locus in metastatic tumors (mDia2) Rac, RhoB, endosomes erythroblast, endosome motility, microtubule DIP* stabilization FMNL1 (FRLα) Cdc42 Cell cortex, Phagocytosis, T cell polarity Overexpression is linked to leukemia and non-Hodgkin lymphoma microtubule- organizing center FMNL2/FRL3/ RhoC ND Cell motility Upregulated in metastatic colorectal cancer, chromosomal deletion is FHOD2 associated with mental retardation FMNL3/FRL2 Constituently Stress fi bers ND ND active DAAM1 Dishevelled Cell cortex Planar cell polarity ND DAAM2 ND ND ND Overexpressed in schizophrenia patients Human (Mouse) FHOD1 ROCK Stress fi bers Cell motility FHOD3 ND Nestin, sarcomere Organizing sarcomeres in striated muscle cells Single-nucleotide polymorphisms associated with type 1 diabetes
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Comparative Transcriptomics Reveals Similarities and Differences
    Seifert et al. BMC Cancer (2015) 15:952 DOI 10.1186/s12885-015-1939-9 RESEARCH ARTICLE Open Access Comparative transcriptomics reveals similarities and differences between astrocytoma grades Michael Seifert1,2,5*, Martin Garbe1, Betty Friedrich1,3, Michel Mittelbronn4 and Barbara Klink5,6,7 Abstract Background: Astrocytomas are the most common primary brain tumors distinguished into four histological grades. Molecular analyses of individual astrocytoma grades have revealed detailed insights into genetic, transcriptomic and epigenetic alterations. This provides an excellent basis to identify similarities and differences between astrocytoma grades. Methods: We utilized public omics data of all four astrocytoma grades focusing on pilocytic astrocytomas (PA I), diffuse astrocytomas (AS II), anaplastic astrocytomas (AS III) and glioblastomas (GBM IV) to identify similarities and differences using well-established bioinformatics and systems biology approaches. We further validated the expression and localization of Ang2 involved in angiogenesis using immunohistochemistry. Results: Our analyses show similarities and differences between astrocytoma grades at the level of individual genes, signaling pathways and regulatory networks. We identified many differentially expressed genes that were either exclusively observed in a specific astrocytoma grade or commonly affected in specific subsets of astrocytoma grades in comparison to normal brain. Further, the number of differentially expressed genes generally increased with the astrocytoma grade with one major exception. The cytokine receptor pathway showed nearly the same number of differentially expressed genes in PA I and GBM IV and was further characterized by a significant overlap of commonly altered genes and an exclusive enrichment of overexpressed cancer genes in GBM IV. Additional analyses revealed a strong exclusive overexpression of CX3CL1 (fractalkine) and its receptor CX3CR1 in PA I possibly contributing to the absence of invasive growth.
    [Show full text]
  • Identification of Common Gene Networks Responsive To
    Cancer Gene Therapy (2014) 21, 542–548 © 2014 Nature America, Inc. All rights reserved 0929-1903/14 www.nature.com/cgt ORIGINAL ARTICLE Identification of common gene networks responsive to radiotherapy in human cancer cells D-L Hou1, L Chen2, B Liu1, L-N Song1 and T Fang1 Identification of the genes that are differentially expressed between radiosensitive and radioresistant cancers by global gene analysis may help to elucidate the mechanisms underlying tumor radioresistance and improve the efficacy of radiotherapy. An integrated analysis was conducted using publicly available GEO datasets to detect differentially expressed genes (DEGs) between cancer cells exhibiting radioresistance and cancer cells exhibiting radiosensitivity. Gene Ontology (GO) enrichment analyses, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and protein–protein interaction (PPI) networks analysis were also performed. Five GEO datasets including 16 samples of radiosensitive cancers and radioresistant cancers were obtained. A total of 688 DEGs across these studies were identified, of which 374 were upregulated and 314 were downregulated in radioresistant cancer cell. The most significantly enriched GO terms were regulation of transcription, DNA-dependent (GO: 0006355, P = 7.00E-09) for biological processes, while those for molecular functions was protein binding (GO: 0005515, P = 1.01E-28), and those for cellular component was cytoplasm (GO: 0005737, P = 2.81E-26). The most significantly enriched pathway in our KEGG analysis was Pathways in cancer (P = 4.20E-07). PPI network analysis showed that IFIH1 (Degree = 33) was selected as the most significant hub protein. This integrated analysis may help to predict responses to radiotherapy and may also provide insights into the development of individualized therapies and novel therapeutic targets.
    [Show full text]
  • Download Validation Data
    PrimePCR™Assay Validation Report Gene Information Gene Name dachshund homolog 2 (Drosophila) Gene Symbol DACH2 Organism Human Gene Summary This gene is one of two genes which encode a protein similar to the Drosophila protein dachshund a transcription factor involved in cell fate determination in the eye limb and genital disc of the fly. The encoded protein contains two characteristic dachshund domains: an N-terminal domain responsible for DNA binding and a C-terminal domain responsible for protein-protein interactions. This gene is located on the X chromosome and is subject to inactivation by DNA methylation. The encoded protein may be involved in regulation of organogenesis and myogenesis and may play a role in premature ovarian failure. Multiple transcript variants encoding different isoforms have been found for this gene. Gene Aliases FLJ31391, MGC138545 RefSeq Accession No. NC_000023.10, NT_011651.17, NG_012817.1 UniGene ID Hs.86603 Ensembl Gene ID ENSG00000126733 Entrez Gene ID 117154 Assay Information Unique Assay ID qHsaCID0009489 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000373131, ENST00000373125, ENST00000508860, ENST00000510272, ENST00000484479, ENST00000344497, ENST00000400297 Amplicon Context Sequence AGCAAGTGGAGCAGGCACTTAAGCAAGCCACCACTAGTGACAGTGGCCTGAGG ATGTTAAAAGATACTGGAATTCCAGATATTGAAATAGAAAACAATGGGACTCCTC ATGATAGTGCTGCTATGCAAGGAGGTAACTATTACTGTTTAGAAATGGC Amplicon Length (bp) 126 Chromosome Location X:86069775-86087136 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%)
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family
    Rockefeller University Digital Commons @ RU Student Theses and Dissertations 2018 A High-Throughput Approach to Uncover Novel Roles of APOBEC2, a Functional Orphan of the AID/APOBEC Family Linda Molla Follow this and additional works at: https://digitalcommons.rockefeller.edu/ student_theses_and_dissertations Part of the Life Sciences Commons A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY A Thesis Presented to the Faculty of The Rockefeller University in Partial Fulfillment of the Requirements for the degree of Doctor of Philosophy by Linda Molla June 2018 © Copyright by Linda Molla 2018 A HIGH-THROUGHPUT APPROACH TO UNCOVER NOVEL ROLES OF APOBEC2, A FUNCTIONAL ORPHAN OF THE AID/APOBEC FAMILY Linda Molla, Ph.D. The Rockefeller University 2018 APOBEC2 is a member of the AID/APOBEC cytidine deaminase family of proteins. Unlike most of AID/APOBEC, however, APOBEC2’s function remains elusive. Previous research has implicated APOBEC2 in diverse organisms and cellular processes such as muscle biology (in Mus musculus), regeneration (in Danio rerio), and development (in Xenopus laevis). APOBEC2 has also been implicated in cancer. However the enzymatic activity, substrate or physiological target(s) of APOBEC2 are unknown. For this thesis, I have combined Next Generation Sequencing (NGS) techniques with state-of-the-art molecular biology to determine the physiological targets of APOBEC2. Using a cell culture muscle differentiation system, and RNA sequencing (RNA-Seq) by polyA capture, I demonstrated that unlike the AID/APOBEC family member APOBEC1, APOBEC2 is not an RNA editor. Using the same system combined with enhanced Reduced Representation Bisulfite Sequencing (eRRBS) analyses I showed that, unlike the AID/APOBEC family member AID, APOBEC2 does not act as a 5-methyl-C deaminase.
    [Show full text]
  • Loss of DACH2 Is a Candidate Early Event in Breast and Ovarian Carcinogenesis
    Loss of DACH2 is a candidate early event in breast and ovarian carcinogenesis By Rania Chehade A thesis submitted in conformity with the requirements for Degree of Master of Science Medical Biophysics Department University of Toronto Copyright by Rania Chehade 2013 Loss of DACH2 is a candidate early event in breast and ovarian carcinogenesis Rania Chehade Master of Science Medical Biophysics Department University of Toronto 2013 Abstract Mechanistic insights into how enduring menstrual cycle hormonal signaling promotes tumorigenesis are emerging. We performed a genome-wide screen in primary epithelial cells to identify hormonally-regulated candidates that initiate pro-tumorigenic phenotypes in normal cells. One candidate, DACH2, has been described as part of a network that regulates organogenesis during development. In vitro, we find that DACH2 expression is regulated by estrogen and progesterone in a dosage dependent manner. Lentiviral-mediated shRNA silencing of DACH2 in hormonally responsive tissues promotes expansion of cells with progenitor characteristics. Within gene expression profiles of fallopian tubes, DACH2 is a member of a minimal gene classifier that distinguishes follicular versus luteal phases. Decreased DACH2 is characteristic of luteal-phase tubal cells and the majority of ovarian serous carcinomas. These studies suggest that DACH2 may orchestrate a physiological program that, when deregulated, locks cells in a progenitor-state, induces uncontrolled proliferation, and predisposes cells for breast and ovarian carcinogenesis. ii Acknowledgements Graduate school has been a bountiful journey of learning opportunities in academic, work and life relationships. I have developed various skills and I have matured both as a researcher and a human being. First and foremost, I would like to acknowledge my supervisor Dr.
    [Show full text]
  • Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis
    Prediction of Human Disease Genes by Human-Mouse Conserved Coexpression Analysis Ugo Ala1., Rosario Michael Piro1., Elena Grassi1, Christian Damasco1, Lorenzo Silengo1, Martin Oti2, Paolo Provero1*, Ferdinando Di Cunto1* 1 Molecular Biotechnology Center, Department of Genetics, Biology and Biochemistry, University of Turin, Turin, Italy, 2 Department of Human Genetics and Centre for Molecular and Biomolecular Informatics, University Medical Centre Nijmegen, Nijmegen, The Netherlands Abstract Background: Even in the post-genomic era, the identification of candidate genes within loci associated with human genetic diseases is a very demanding task, because the critical region may typically contain hundreds of positional candidates. Since genes implicated in similar phenotypes tend to share very similar expression profiles, high throughput gene expression data may represent a very important resource to identify the best candidates for sequencing. However, so far, gene coexpression has not been used very successfully to prioritize positional candidates. Methodology/Principal Findings: We show that it is possible to reliably identify disease-relevant relationships among genes from massive microarray datasets by concentrating only on genes sharing similar expression profiles in both human and mouse. Moreover, we show systematically that the integration of human-mouse conserved coexpression with a phenotype similarity map allows the efficient identification of disease genes in large genomic regions. Finally, using this approach on 850 OMIM loci characterized by an unknown molecular basis, we propose high-probability candidates for 81 genetic diseases. Conclusion: Our results demonstrate that conserved coexpression, even at the human-mouse phylogenetic distance, represents a very strong criterion to predict disease-relevant relationships among human genes. Citation: Ala U, Piro RM, Grassi E, Damasco C, Silengo L, et al.
    [Show full text]