DOCSLIB.ORG

World Journal of Clinical Oncology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
World Journal of Clinical Oncology World Journal of W J C O Clinical Oncology Submit a Manuscript: http://www.wjgnet.com/esps/ World J Clin Oncol 2017 February 10; 8(1): 67-74 Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx ISSN 2218-4333 (online) DOI: 10.5306/wjco.v8.i1.67 © 2017 Baishideng Publishing Group Inc. All rights reserved. ORIGINAL ARTICLE Basic Study NDRG2 gene copy number is not altered in colorectal carcinoma Anders Lorentzen, Cathy Mitchelmore Anders Lorentzen, Cathy Mitchelmore, Eucaryotic Cell Accepted: December 27, 2016 Biology, Department of Science and Environment, Roskilde Article in press: December 28, 2016 University, 4000 Roskilde, Denmark Published online: February 10, 2017 Author contributions: Lorentzen A conceived the idea of the study and performed the experimental analysis; Lorentzen A and Mitchelmore C were both involved in interpretation of data, drafting the article and revising it critically for important Abstract intellectual content. AIM To investigate if the down-regulation of N-myc Down- Supported by The Danish Cancer Society, No. DP05117. stream Regulated Gene 2 (NDRG2 ) expression in Institutional review board statement: Human genomic DNA colorectal carcinoma (CRC) is due to loss of the NDRG2 was purchased from Biochain Inc., whose IRB is registered with allele(s). the Office for Human Research Protections (OHRP) with the registration number IRB00008283. METHODS The following were investigated in the human colorectal Conflict-of-interest statement: There is no conflict of interest. cancer cell lines DLD-1, LoVo and SW-480: NDRG2 mRNA expression levels using quantitative reverse transcription- Data sharing statement: No additional data are available. polymerase chain reaction (qRT-PCR); interaction of the Open-Access: This article is an open-access article which was MYC gene-regulatory protein with the NDRG2 promoter selected by an in-house editor and fully peer-reviewed by external using chromatin immunoprecipitation; and NDRG2 reviewers. It is distributed in accordance with the Creative promoter methylation using bisulfite sequencing. Further- Commons Attribution Non Commercial (CC BY-NC 4.0) license, more, we performed qPCR to analyse the copy numbers which permits others to distribute, remix, adapt, build upon this of NDRG2 and MYC genes in the above three cell lines, work non-commercially, and license their derivative works on 8 normal colorectal tissue samples and 40 CRC tissue different terms, provided the original work is properly cited and samples. the use is non-commercial. See: http://creativecommons.org/ licenses/by-nc/4.0/ RESULTS Manuscript source: Invited manuscript As expected, NDRG2 mRNA levels were low in the three colorectal cancer cell lines, compared to normal colon. Correspondence to: Cathy Mitchelmore, PhD, Associate Endogenous MYC protein interacted with the NDRG2 Professor, Department of Science and Environment, Roskilde core promoter in all three cell lines. In addition, the University, Universitetsvej 1, Postbox 260, 4000 Roskilde, NDRG2 promoter was heavily methylated in these cell Denmark. [email protected] lines, suggesting an epigenetic regulatory mechanism. Telephone: +45-46743201 Unaltered gene copy numbers of NDRG2 were observed Fax: +45-46743011 in the three cell lines. In the colorectal tissues, one Received: June 15, 2016 normal and three CRC samples showed partial or Peer-review started: June 18, 2016 complete loss of one NDRG2 allele. In contrast, the MYC First decision: August 16, 2016 gene was amplified in one cell line and in more than Revised: November 11, 2016 40% of the CRC cases. WJCO|www.wjgnet.com 67 February 10, 2017|Volume 8|Issue 1| Lorentzen A et al . NDRG2 in colorectal carcinoma CONCLUSION homolog, a known tumor suppressor in the PI3K-AKT Our study suggests that the reduction in NDRG2 expres- pathway[13,16]. sion observed in CRC is due to transcriptional repression Several mechanisms have been suggested as by MYC and promoter methylation, and is not due to possible regulators of NDRG2 expression, of which epig- allelic loss. enetic silencing, due to promoter hypermethylation, is the most widely observed[4,8,9,13,14,17]. However, other Key words: N-myc downstream-regulated gene 2; regulatory mechanisms may also play a role. One Colorectal carcinoma; MYC; Tumor suppressor; Allelic example could be the transcription factor MYC, which loss; Gene amplification; Copy number is characterised as a proto-oncogene often altered in human cancers[18]. The biological function of MYC seems © The Author(s) 2017. Published by Baishideng Publishing to be to either activate or repress the transcription of Group Inc. All rights reserved. target genes[19,20]. Zhang et al[21] have previously shown that ectopically expressed MYC is able, via Miz-1, to Core tip: NDRG2 is a putative tumor suppressor gene interact with and to repress transcription from the whose expression is reduced in many cancer forms, NDRG2 promoter. Moreover, correlation of high MYC including colorectal carcinoma (CRC). We set out with reduced NDRG2 expression has been observed in therefore to investigate if down-regulation of NDRG2 [15,22-24] expression was due to loss of one or both alleles and/or different cancers and cancer cell lines . However, to other mechanisms. In our paper, we show that allelic an inverse relation between MYC levels and NDRG2 [25] loss of NDRG2 is a rare event in CRC. To our knowledge, expression seems not to apply to all cancer types . this is the first study that has specifically investigated CRC is, like most other cancers, a malignant disease gene copy number of NDRG2 in CRC. Furthermore, our with a combination of both genetic and epigenetic results suggest that MYC is amplified in more than 40% changes. One of these changes is chromosome instabi- of CRC cases. MYC is known to repress transcription lity, which affects one or several chromosomal regions. of NDRG2. Our results lead us to suggest that it is the Many groups have analysed changes in gene copy transcriptional control of NDRG2 expression, including numbers in CRC by different approaches and found repression by MYC and epigenetic regulation, that numerous chromosomal gains and losses[26-29]. In the results in decreased NDRG2 mRNA levels in CRC, rather study by Lagerstedt et al[29], the status of CRC samples than allelic loss of NDRG2. classified as Dukes stages A-D was analysed, showing an increasing frequency of allelic losses at more severe stages (Dukes C and D). According to their data, allelic Lorentzen A, Mitchelmore C. NDRG2 gene copy number deletions in chromosome 14, containing the NDRG2 is not altered in colorectal carcinoma. World J Clin Oncol gene, is already found at earlier stages (Dukes A and 2017; 8(1): 67-74 Available from: URL: http://www.wjgnet. B) and becomes more frequent at the later stages. com/2218-4333/full/v8/i1/67.htm DOI: http://dx.doi.org/ Although chromosome 14 is not considered one of the 10.5306/wjco.v8.i1.67 deletion hot spot regions, such as chromosome 8p or 18q[27,28,30,31], we hypothesised that deletions in chromo- some 14 could lead to loss of one or both of the NDRG2 alleles. On the other hand, the MYC gene is found on INTRODUCTION chromosome 8q, and gains of this large chromosome N-myc downstream regulated gene 2 (NDRG2) arm are frequently found in CRC[26,28,32]. Analysing the is one of four genes belonging to the NDRG gene gene copy number of MYC is therefore of interest with family. Common for these genes is an NDR domain, regards to its possible regulatory effect on NDRG2. a protein motif covering almost the entire protein, In this study, we demonstrate a frequent increase but the cellular functions of these genes are currently in the gene copy number of MYC in CRC. In contrast, unclear[1,2]. NDRG2 expression has been found to be we find that changes in the copy number of theNDRG2 down-regulated in several human cancers including locus are rare in CRC, and we suggest that reduced colorectal carcinoma (CRC), hepatocellular carcinoma, expression of NDRG2 in CRC is due to epigenetic and glioblastoma and thyroid cancer[3-7]. NDRG2 is a candi- MYC-related transcriptional repression. date tumor suppressor gene, with a better overall survival for CRC, hepatocellular carcinoma and glioma patients displaying expression of the gene compared MATERIALS AND METHODS [8-12] to low or no expression . Further evidence of the Cell lines and genomic DNA tumor suppressor function of NDRG2 comes from the The DLD-1, LoVo and SW-480 colorectal cancer cell lines observation that NDRG2-lacking mice develop various were a gift from Associate Professor Ole Vang, Roskilde types of tumors, and from xenograft studies showing University. Cells lines were incubated and maintained that NDRG2-expressing tumor cells implanted in nude at 37 ℃ in an environment of humidified air with 5% mice form smaller tumors and fewer metastases than CO2 in McCoy’s 5A + GlutaMaxTM-1 media with 10% control cells[13-15]. NDRG2 has a number of downstream Fetal Bovine Serum and 1% Penicillin-Streptomycin targets, including activation of phosphatase and tensin (Invitrogen). RNA from cell lines was purified with WJCO|www.wjgnet.com 68 February 10, 2017|Volume 8|Issue 1| Lorentzen A et al . NDRG2 in colorectal carcinoma the SV total RNA isolation kit (Promega) and genomic ggtgagatgagg; MYC: CCAGAGGAGGAACGAGCTAA DNA was purified by ethanol precipitation after an and TTGGACGGACAGGATGTATG; GFAP: TGACCC- overnight Proteinase K treatment. Reference human TCTCCACCCCATAGTGAC and CAGCAGCAGTGC- genomic DNA, purified from blood lymphocytes, was CCTGAAGATTAG; and MECP2: TCAGAGGGTGTG- obtained from Roche Diagnostics, United States (Cat. CAGGTGAA and TTGAAAAGGCATCTTGACAAGGA. In a No.11691112001). As a normal colonic control we used validation experiment using a control sample, a dilution commercially available DNA (BioChain Institute Inc., series was produced and assayed for NDRG2, MYC, D4234090). Human colon genomic DNA from tissue GFAP and MECP2.
Load more

Recommended publications
  • Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice
    Loyola University Chicago Loyola eCommons Biology: Faculty Publications and Other Works Faculty Publications 2013 Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice Mihaela Palicev Gunter P. Wagner James P. Noonan Benedikt Hallgrimsson James M. Cheverud Loyola University Chicago, [email protected] Follow this and additional works at: https://ecommons.luc.edu/biology_facpubs Part of the Biology Commons Recommended Citation Palicev, M, GP Wagner, JP Noonan, B Hallgrimsson, and JM Cheverud. "Genomic Correlates of Relationship QTL Involved in Fore- Versus Hind Limb Divergence in Mice." Genome Biology and Evolution 5(10), 2013. This Article is brought to you for free and open access by the Faculty Publications at Loyola eCommons. It has been accepted for inclusion in Biology: Faculty Publications and Other Works by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. © Palicev et al., 2013. GBE Genomic Correlates of Relationship QTL Involved in Fore- versus Hind Limb Divergence in Mice Mihaela Pavlicev1,2,*, Gu¨ nter P. Wagner3, James P. Noonan4, Benedikt Hallgrı´msson5,and James M. Cheverud6 1Konrad Lorenz Institute for Evolution and Cognition Research, Altenberg, Austria 2Department of Pediatrics, Cincinnati Children‘s Hospital Medical Center, Cincinnati, Ohio 3Yale Systems Biology Institute and Department of Ecology and Evolutionary Biology, Yale University 4Department of Genetics, Yale University School of Medicine 5Department of Cell Biology and Anatomy, The McCaig Institute for Bone and Joint Health and the Alberta Children’s Hospital Research Institute for Child and Maternal Health, University of Calgary, Calgary, Canada 6Department of Anatomy and Neurobiology, Washington University *Corresponding author: E-mail: [email protected].
    [Show full text]
  • The DNA Methylation Landscape of Glioblastoma Disease Progression Shows Extensive Heterogeneity in Time and Space
    bioRxiv preprint doi: https://doi.org/10.1101/173864; this version posted August 9, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The DNA methylation landscape of glioblastoma disease progression shows extensive heterogeneity in time and space Johanna Klughammer1*, Barbara Kiesel2,3*, Thomas Roetzer3,4, Nikolaus Fortelny1, Amelie Kuchler1, Nathan C. Sheffield5, Paul Datlinger1, Nadine Peter3,4, Karl-Heinz Nenning6, Julia Furtner3,7, Martha Nowosielski8,9, Marco Augustin10, Mario Mischkulnig2,3, Thomas Ströbel3,4, Patrizia Moser11, Christian F. Freyschlag12, Jo- hannes Kerschbaumer12, Claudius Thomé12, Astrid E. Grams13, Günther Stockhammer8, Melitta Kitzwoegerer14, Stefan Oberndorfer15, Franz Marhold16, Serge Weis17, Johannes Trenkler18, Johanna Buchroithner19, Josef Pichler20, Johannes Haybaeck21,22, Stefanie Krassnig21, Kariem Madhy Ali23, Gord von Campe23, Franz Payer24, Camillo Sherif25, Julius Preiser26, Thomas Hauser27, Peter A. Winkler27, Waltraud Kleindienst28, Franz Würtz29, Tanisa Brandner-Kokalj29, Martin Stultschnig30, Stefan Schweiger31, Karin Dieckmann3,32, Matthias Preusser3,33, Georg Langs6, Bernhard Baumann10, Engelbert Knosp2,3, Georg Widhalm2,3, Christine Marosi3,33, Johannes A. Hainfellner3,4, Adelheid Woehrer3,4#§, Christoph Bock1,34,35# 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Department of Neurosurgery, Medical University of Vienna, Vienna, Austria. 3 Comprehensive Cancer Center, Central Nervous System Tumor Unit, Medical University of Vienna, Austria. 4 Institute of Neurology, Medical University of Vienna, Vienna, Austria. 5 Center for Public Health Genomics, University of Virginia, Charlottesville VA, USA. 6 Department of Biomedical Imaging and Image-guided Therapy, Computational Imaging Research Lab, Medical University of Vi- enna, Vienna, Austria.
    [Show full text]
  • NDRG2 Combined with EGFR Improved Its Prognostic Value for Lung Adenocarcinoma
    NDRG2 combined with EGFR improved its prognostic value for lung adenocarcinoma Bo Yang ( [email protected] ) Tianjin First Central Hospital https://orcid.org/0000-0003-0052-048X Xiao-Ping Li Tianjin First Central Hospital Hong-Gang Zhou Nankai University College of Pharmacy Tao Jiang Fourth Military Medical University Ting Xiao Nankai University College of Pharmacy Yu-Li Wei Nankai University College of Pharmacy Liang Zhang Tianjin First Central Hospital Wen-Chen Wang PLA Army General Hospital Wei-Dong Zhang Tianjin First Central Hospital Research article Keywords: N-Myc downstream-regulated gene2; Epidermal growth factor receptor; Adenocarcinoma; Prognosis Posted Date: September 10th, 2019 DOI: https://doi.org/10.21203/rs.2.14181/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/10 Abstract Background N-Myc downstream-regulated gene2 (NDRG2) plays an important role in lung adenocarcinoma (LUAD). Epidermal growth factor receptor (EGFR) mutation has signicantly improved prognosis in patients with adenocarcinoma. We aimed to elucidate the clinical value of NDRG2/EGFR as a prediction of prognosis in patients with lung adenocarcinoma. Materials and Methods Immunohistochemistry and western blot analysis were conducted to detect the expression of NDRG2 protein. Association between NDRG2/EGFR expression and clinicopathological parameters of the patients were examined. Serum Carcinoembryonic antigen (CEA) level was examined prior to treatment in patients with LUAD. Patients’ survival rate was assessed by Kaplan–Meier. Candidates for independent prognostic biomarkers were analyzed using a COX proportional hazard model. Results NDRG2 levels were signicantly decreased in patients with lung adenocarcinoma. NDRG2 levels were positively correlated with CEA and EGFR.
    [Show full text]
  • Integrative Genomic Analysis Identifies NDRG2 As a Candidate Tumor Suppressor Gene Frequently Inactivated in Clinically Aggressive Meningioma
    Research Article Integrative Genomic Analysis Identifies NDRG2 as a Candidate Tumor Suppressor Gene Frequently Inactivated in Clinically Aggressive Meningioma Eriks A. Lusis,1 Mark A. Watson,2 Michael R. Chicoine,3 Meghan Lyman,4 Peter Roerig,5 Guido Reifenberger,5 David H. Gutmann,4 and Arie Perry1 1Division of Neuropathology, Departments of 2Pathology and Immunology, 3Neurosurgery, and 4Neurology, Washington University School of Medicine, St. Louis, Missouri; and 5Department of Neuropathology, Heinrich-Heine-University, Du¨sseldorf, Germany Abstract and TSLC1 are also common (2, 4–6). However, there are few Although meningiomas are common central nervous system known genetic changes associated with the malignant progression tumors, little is known about the genetic events responsible of meningioma. Although losses of chromosomal arms 14q and 1p for malignant progression. In this study, we employed gene are common in anaplastic tumors (WHO grade III) and are expression profiling to identify transcripts whose expression generally associated with poor prognosis (7, 8), the relevant tumor was lost in anaplastic (WHO grade III) versus benign (WHO suppressor genes that map to these loci have not been identified. grade I) meningioma. Approximately 40% of genes down- Loss of heterozygosity studies have had limited success in regulated in anaplastic meningioma were localized to chro- identifying minimal regions of deletion, in part, due to the fact mosomes 1p and 14q. One specific gene located at 14q11.2, that the entire chromosome or chromosomal arm is lost in most NDRG2, was consistently down-regulated in grade III menin- examples. In the current study, we used a strategy combining expression profiling with known cytogenetic alterations, leading gioma, a finding which we validated at both the transcript and protein levels in independent sets of clinically and patholog- to the identification of NDRG2 as a potential meningioma- ically diverse meningiomas.
    [Show full text]
  • Research2007herschkowitzetvolume Al
    Open Access Research2007HerschkowitzetVolume al. 8, Issue 5, Article R76 Identification of conserved gene expression features between comment murine mammary carcinoma models and human breast tumors Jason I Herschkowitz¤*†, Karl Simin¤‡, Victor J Weigman§, Igor Mikaelian¶, Jerry Usary*¥, Zhiyuan Hu*¥, Karen E Rasmussen*¥, Laundette P Jones#, Shahin Assefnia#, Subhashini Chandrasekharan¥, Michael G Backlund†, Yuzhi Yin#, Andrey I Khramtsov**, Roy Bastein††, John Quackenbush††, Robert I Glazer#, Powel H Brown‡‡, Jeffrey E Green§§, Levy Kopelovich, reviews Priscilla A Furth#, Juan P Palazzo, Olufunmilayo I Olopade, Philip S Bernard††, Gary A Churchill¶, Terry Van Dyke*¥ and Charles M Perou*¥ Addresses: *Lineberger Comprehensive Cancer Center. †Curriculum in Genetics and Molecular Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. ‡Department of Cancer Biology, University of Massachusetts Medical School, Worcester, MA 01605, USA. reports §Department of Biology and Program in Bioinformatics and Computational Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. ¶The Jackson Laboratory, Bar Harbor, ME 04609, USA. ¥Department of Genetics, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA. #Department of Oncology, Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC 20057, USA. **Department of Pathology, University of Chicago, Chicago, IL 60637, USA. ††Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132, USA. ‡‡Baylor College of Medicine, Houston, TX 77030, USA. §§Transgenic Oncogenesis Group, Laboratory of Cancer Biology and Genetics. Chemoprevention Agent Development Research Group, National Cancer Institute, Bethesda, MD 20892, USA. Department of Pathology, Thomas Jefferson University, Philadelphia, PA 19107, USA. Section of Hematology/Oncology, Department of Medicine, Committees on Genetics and Cancer Biology, University of Chicago, Chicago, IL 60637, USA.
    [Show full text]
  • Original Article N-Myc Downstream-Regulated Gene 2 Is Related to Insulin Resistance Through IL-6/STAT3 Pathways in Type 2 Diabetic Mice
    Int J Clin Exp Med 2019;12(4):3409-3419 www.ijcem.com /ISSN:1940-5901/IJCEM0088700 Original Article N-myc downstream-regulated gene 2 is related to insulin resistance through IL-6/STAT3 pathways in type 2 diabetic mice Xingxing Zhang1,2*, Pengpeng Jin3*, Weihui Yu1, Qi Zhou1, Xuejiang Gu1, Xiong Chen1, Shuangxing Hou4, Cai Lin2,5 1Department of Endocrinology, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China; 2Center of Diabetic Foot, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, China; 3Center of Medical Research and Innovation, Shanghai Pudong Hospital, Fudan University Pudong Medical Center, 2800 Gongwei Road, Shanghai 201399, China; 4Department of Neurology, Shanghai Pudong Hospital, Fu- dan University Pudong Medical Center, 2800 Gongwei Road, Pudong, Shanghai 201399, China; 5Burn and Wound Healing Center, The First Affiliated Hospital of Wenzhou Medical University, Wenzhou 325000, Zhejiang Province, China. *Equal contributors. Received November 20, 2018; Accepted January 8, 2019; Epub April 15, 2019; Published April 30, 2019 Abstract: N-myc downstream-regulated gene 2 (Ndrg2) is related to cell development. Previous studies have shown that Ndrg2 is highly expressed in pancreatic β cells. However, whether Ndrg2 participates in the pathogenesis of type 2 diabetic mellitus remains unknown. The current study hypothesized that Ndrg2 may participate in the patho- genesis of type 2 diabetic mellitus (T2DM) through inflammatory related IL-6/STAT3 pathways. Mice were divided into the diabetic and control group (normal mice). Diabetic mice were induced by a high-fat diet for 12 weeks, while the control group was feed with normal diet. Body weight, blood biochemical indexes, and IL-6 levels of the two groups were examined.
    [Show full text]
  • An Expanded Proteome of Cardiac T-Tubules☆
    Cardiovascular Pathology 42 (2019) 15–20 Contents lists available at ScienceDirect Cardiovascular Pathology Original Article An expanded proteome of cardiac t-tubules☆ Jenice X. Cheah, Tim O. Nieuwenhuis, Marc K. Halushka ⁎ Department of Pathology, Division of Cardiovascular Pathology, Johns Hopkins University SOM, Baltimore, MD, USA article info abstract Article history: Background: Transverse tubules (t-tubules) are important structural elements, derived from sarcolemma, found Received 27 February 2019 on all striated myocytes. These specialized organelles create a scaffold for many proteins crucial to the effective Received in revised form 29 April 2019 propagation of signal in cardiac excitation–contraction coupling. The full protein composition of this region is un- Accepted 17 May 2019 known. Methods: We characterized the t-tubule subproteome using 52,033 immunohistochemical images covering Keywords: 13,203 proteins from the Human Protein Atlas (HPA) cardiac tissue microarrays. We used HPASubC, a suite of Py- T-tubule fi Proteomics thon tools, to rapidly review and classify each image for a speci c t-tubule staining pattern. The tools Gene Cards, Caveolin String 11, and Gene Ontology Consortium as well as literature searches were used to understand pathways and relationships between the proteins. Results: There were 96 likely t-tubule proteins identified by HPASubC. Of these, 12 were matrisome proteins and 3 were mitochondrial proteins. A separate literature search identified 50 known t-tubule proteins. A comparison of the 2 lists revealed only 17 proteins in common, including 8 of the matrisome proteins. String11 revealed that 94 of 127 combined t-tubule proteins generated a single interconnected network. Conclusion: Using HPASubC and the HPA, we identified 78 novel, putative t-tubule proteins and validated 17 within the literature.
    [Show full text]
  • (NDRG3) Protein
    biomolecules Article Structural and Biophysical Analyses of Human N-Myc Downstream-Regulated Gene 3 (NDRG3) Protein Kyung Rok Kim 1, Kyung A. Kim 1, Joon Sung Park 1 , Jun Young Jang 1, Yuri Choi 2, Hyung Ho Lee 2, Dong Chul Lee 3, Kyung Chan Park 4, Young Il Yeom 3, Hyun-Jung Kim 5,* and Byung Woo Han 1,* 1 Research Institute of Pharmaceutical Sciences, College of Pharmacy, Seoul National University, Seoul 08826, Korea; [email protected] (K.R.K.); [email protected] (K.A.K.); [email protected] (J.S.P.); [email protected] (J.Y.J.) 2 Department of Chemistry, College of Natural Sciences, Seoul National University, Seoul 08826, Korea; [email protected] (Y.C.); [email protected] (H.H.L.) 3 Immunotherapy Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Korea; [email protected] (D.C.L.); [email protected] (Y.I.Y.) 4 Personalized Genomic Medicine Research Center, Korea Research Institute of Bioscience and Biotechnology, Daejeon 34141, Korea; [email protected] 5 Laboratory of Molecular and Stem Cell Pharmacology, College of Pharmacy, Chung-Ang University, Seoul 06974, Korea * Correspondence: [email protected] (H.-J.K.); [email protected] (B.W.H.); Tel.: +82-02-816-5619 (H.-J.K.); +82-02-880-7898 (B.W.H.) Received: 18 October 2019; Accepted: 1 January 2020; Published: 6 January 2020 Abstract: The N-Myc downstream-regulated gene (NDRG) family belongs to the α/β-hydrolase fold and is known to exert various physiologic functions in cell proliferation, differentiation, and hypoxia-induced cancer metabolism.
    [Show full text]
  • Mouse Ndrg2 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Ndrg2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Ndrg2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Ndrg2 gene (NCBI Reference Sequence: NM_013864 ; Ensembl: ENSMUSG00000004558 ) is located on Mouse chromosome 14. 16 exons are identified, with the ATG start codon in exon 2 and the TGA stop codon in exon 16 (Transcript: ENSMUST00000004673). Exon 2~6 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Ndrg2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-30G2 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Mice homozygous for a null allele develop various types of tumors, including T-cell lymphomas, and have a shorter lifespan. Homozygotes for a second null allele show vertebral transformations. Homozygotes for a third null allele show reduced astrogliosis and inflammatory response after brain injury. Exon 2 starts from about 100% of the coding region. The knockout of Exon 2~6 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 1776 bp, and the size of intron 6 for 3'-loxP site insertion: 1123 bp. The size of effective cKO region: ~1983 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 8 9 10 16 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Homology arm Exon of mouse Ndrg2 cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Array-Based Comparative Genomic Hybridization of Mapped BAC DNA Clones to Screen for Chromosome 14 Copy Number Abnormalities in Meningiomas
    European Journal of Human Genetics (2008) 16, 1450–1458 & 2008 Macmillan Publishers Limited All rights reserved 1018-4813/08 $32.00 www.nature.com/ejhg ARTICLE Array-based comparative genomic hybridization of mapped BAC DNA clones to screen for chromosome 14 copy number abnormalities in meningiomas Ana Bele´n Espinosa1, Carlos Mackintosh2, Angel Maı´llo3, Laura Gutierrez4, Pablo Sousa3, Marta Merino3, Javier Ortiz5, Enrique de Alava2, Alberto Orfao4 and Marı´a Dolores Tabernero*,1,6 1Unidad de Investigacio´n, Hospital Universitario de Salamanca, Salamanca, Spain; 2Laboratory of Molecular Pathology, Centro de Investigacio´n del Ca´ncer-IBMCC, Universidad de Salamanca-CSIC, Salamanca, Spain; 3Neurosurgery Service, Hospital Universitario de Salamanca, Salamanca, Spain; 4Centro de Investigacio´n del Ca´ncer-IBMCC (CSIC-USAL), Cytometry General Service and Department of Medicine, University of Salamanca, Salamanca, Spain; 5Pathology Service, Hospital Universitario de Salamanca, Salamanca, Spain; 6IECSCYL-Hospital Universitario de Salamanca, Salamanca, Spain Chromosome 14 loss in meningiomas are associated with more aggressive tumour behaviour. To date, no studies have been reported in which the entire chromosome 14q of meningioma tumour cells has been studied by high-resolution array comparative genomic hybridization (a-CGH). Here, we used a high-resolution a-CGH to define the exact localization and extent of numerical changes of chromosome 14 in meningioma patients. An array containing 807 bacterial artificial chromosome clones specific for chromosome 14q (average resolution of B130 Kb) was constructed and applied to the study of 25 meningiomas in parallel to the confirmatory interphase fluorescence in situ hybridization (iFISH) analyses. Overall, abnormalities of chromosome 14q were detected in 10/25 cases (40%).
    [Show full text]
  • Genome-Scale Analysis of DNA Methylation in Lung Adenocarcinoma and Integration with Mrna Expression
    Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Research Genome-scale analysis of DNA methylation in lung adenocarcinoma and integration with mRNA expression Suhaida A. Selamat,1 Brian S. Chung,1 Luc Girard,2 Wei Zhang,2 Ying Zhang,3 Mihaela Campan,1 Kimberly D. Siegmund,3 Michael N. Koss,4 Jeffrey A. Hagen,5 Wan L. Lam,6 Stephen Lam,6 Adi F. Gazdar,2 and Ite A. Laird-Offringa1,7 1Department of Surgery, Department of Biochemistry and Molecular Biology, Norris Comprehensive Cancer Center, Keck School of Medicine, University of Southern California, Los Angeles, California 90089-9176, USA; 2The Hamon Center for Therapeutic Oncology Research and Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas 75390, USA; 3Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California 90089-9176, USA; 4Department of Pathology, Keck School of Medicine, University of Southern California, Los Angeles, California 90089-9176, USA; 5Department of Surgery, Keck School of Medicine, University of Southern California, Los Angeles, California 90089-9176, USA; 6BC Cancer Research Center, BC Cancer Agency, Vancouver, BC V521L3, Canada Lung cancer is the leading cause of cancer death worldwide, and adenocarcinoma is its most common histological subtype. Clinical and molecular evidence indicates that lung adenocarcinoma is a heterogeneous disease, which has important implications for treatment. Here we performed genome-scale DNA methylation profiling using the Illumina Infinium HumanMethylation27 platform on 59 matched lung adenocarcinoma/non-tumor lung pairs, with genome-scale verifi- cation on an independent set of tissues.
    [Show full text]
  • Ndrg2 Is a PGC-1Α/Errα Target Gene That Controls Protein Synthesis and Expression of Contractile-Type Genes in C2C12 Myotubes
    Biochimica et Biophysica Acta 1833 (2013) 3112–3123 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Ndrg2 is a PGC-1α/ERRα target gene that controls protein synthesis and expression of contractile-type genes in C2C12 myotubes Victoria C. Foletta a,⁎,ErinL.Browna, Yoshitake Cho b,RodJ.Snowa, Anastasia Kralli b, Aaron P. Russell a a Centre for Physical Activity and Nutrition Research, School of Exercise and Nutrition Sciences, Deakin University, Burwood 3125, Australia b Department of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037, USA article info abstract Article history: The stress-responsive, tumor suppressor N-myc downstream-regulated gene 2 (Ndrg2) is highly expressed in Received 14 February 2013 striated muscle. In response to anabolic and catabolic signals, Ndrg2 is suppressed and induced, respectively, in Received in revised form 17 June 2013 mouse C2C12 myotubes. However, little is known about the mechanisms regulating Ndrg2 expression in muscle, Accepted 9 August 2013 as well as the biological role for Ndrg2 in differentiated myotubes. Here, we show that Ndrg2 is a target of a per- Available online 2 September 2013 oxisome proliferator-activated receptor-gamma coactivator-1α (PGC-1α) and estrogen-related receptor alpha (ERRα) transcriptional program and is induced in response to endurance exercise, a physiological stress Keywords: α α fi N-myc downstream-regulated gene 2 (Ndrg2) known also to increase PGC-1 /ERR activity. Analyses of global gene and protein expression pro les in Peroxisome proliferator-activated receptor- C2C12 myotubes with reduced levels of NDRG2, suggest that NDRG2 affects muscle growth, contractile proper- gamma coactivator-1α (PGC-1α) ties, MAPK signaling, ion and vesicle transport and oxidative phosphorylation.
    [Show full text]