
World Journal of W J C O Clinical Oncology Submit a Manuscript: http://www.wjgnet.com/esps/ World J Clin Oncol 2017 February 10; 8(1): 67-74 Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx ISSN 2218-4333 (online) DOI: 10.5306/wjco.v8.i1.67 © 2017 Baishideng Publishing Group Inc. All rights reserved. ORIGINAL ARTICLE Basic Study NDRG2 gene copy number is not altered in colorectal carcinoma Anders Lorentzen, Cathy Mitchelmore Anders Lorentzen, Cathy Mitchelmore, Eucaryotic Cell Accepted: December 27, 2016 Biology, Department of Science and Environment, Roskilde Article in press: December 28, 2016 University, 4000 Roskilde, Denmark Published online: February 10, 2017 Author contributions: Lorentzen A conceived the idea of the study and performed the experimental analysis; Lorentzen A and Mitchelmore C were both involved in interpretation of data, drafting the article and revising it critically for important Abstract intellectual content. AIM To investigate if the down-regulation of N-myc Down- Supported by The Danish Cancer Society, No. DP05117. stream Regulated Gene 2 (NDRG2 ) expression in Institutional review board statement: Human genomic DNA colorectal carcinoma (CRC) is due to loss of the NDRG2 was purchased from Biochain Inc., whose IRB is registered with allele(s). the Office for Human Research Protections (OHRP) with the registration number IRB00008283. METHODS The following were investigated in the human colorectal Conflict-of-interest statement: There is no conflict of interest. cancer cell lines DLD-1, LoVo and SW-480: NDRG2 mRNA expression levels using quantitative reverse transcription- Data sharing statement: No additional data are available. polymerase chain reaction (qRT-PCR); interaction of the Open-Access: This article is an open-access article which was MYC gene-regulatory protein with the NDRG2 promoter selected by an in-house editor and fully peer-reviewed by external using chromatin immunoprecipitation; and NDRG2 reviewers. It is distributed in accordance with the Creative promoter methylation using bisulfite sequencing. Further- Commons Attribution Non Commercial (CC BY-NC 4.0) license, more, we performed qPCR to analyse the copy numbers which permits others to distribute, remix, adapt, build upon this of NDRG2 and MYC genes in the above three cell lines, work non-commercially, and license their derivative works on 8 normal colorectal tissue samples and 40 CRC tissue different terms, provided the original work is properly cited and samples. the use is non-commercial. See: http://creativecommons.org/ licenses/by-nc/4.0/ RESULTS Manuscript source: Invited manuscript As expected, NDRG2 mRNA levels were low in the three colorectal cancer cell lines, compared to normal colon. Correspondence to: Cathy Mitchelmore, PhD, Associate Endogenous MYC protein interacted with the NDRG2 Professor, Department of Science and Environment, Roskilde core promoter in all three cell lines. In addition, the University, Universitetsvej 1, Postbox 260, 4000 Roskilde, NDRG2 promoter was heavily methylated in these cell Denmark. [email protected] lines, suggesting an epigenetic regulatory mechanism. Telephone: +45-46743201 Unaltered gene copy numbers of NDRG2 were observed Fax: +45-46743011 in the three cell lines. In the colorectal tissues, one Received: June 15, 2016 normal and three CRC samples showed partial or Peer-review started: June 18, 2016 complete loss of one NDRG2 allele. In contrast, the MYC First decision: August 16, 2016 gene was amplified in one cell line and in more than Revised: November 11, 2016 40% of the CRC cases. WJCO|www.wjgnet.com 67 February 10, 2017|Volume 8|Issue 1| Lorentzen A et al . NDRG2 in colorectal carcinoma CONCLUSION homolog, a known tumor suppressor in the PI3K-AKT Our study suggests that the reduction in NDRG2 expres- pathway[13,16]. sion observed in CRC is due to transcriptional repression Several mechanisms have been suggested as by MYC and promoter methylation, and is not due to possible regulators of NDRG2 expression, of which epig- allelic loss. enetic silencing, due to promoter hypermethylation, is the most widely observed[4,8,9,13,14,17]. However, other Key words: N-myc downstream-regulated gene 2; regulatory mechanisms may also play a role. One Colorectal carcinoma; MYC; Tumor suppressor; Allelic example could be the transcription factor MYC, which loss; Gene amplification; Copy number is characterised as a proto-oncogene often altered in human cancers[18]. The biological function of MYC seems © The Author(s) 2017. Published by Baishideng Publishing to be to either activate or repress the transcription of Group Inc. All rights reserved. target genes[19,20]. Zhang et al[21] have previously shown that ectopically expressed MYC is able, via Miz-1, to Core tip: NDRG2 is a putative tumor suppressor gene interact with and to repress transcription from the whose expression is reduced in many cancer forms, NDRG2 promoter. Moreover, correlation of high MYC including colorectal carcinoma (CRC). We set out with reduced NDRG2 expression has been observed in therefore to investigate if down-regulation of NDRG2 [15,22-24] expression was due to loss of one or both alleles and/or different cancers and cancer cell lines . However, to other mechanisms. In our paper, we show that allelic an inverse relation between MYC levels and NDRG2 [25] loss of NDRG2 is a rare event in CRC. To our knowledge, expression seems not to apply to all cancer types . this is the first study that has specifically investigated CRC is, like most other cancers, a malignant disease gene copy number of NDRG2 in CRC. Furthermore, our with a combination of both genetic and epigenetic results suggest that MYC is amplified in more than 40% changes. One of these changes is chromosome instabi- of CRC cases. MYC is known to repress transcription lity, which affects one or several chromosomal regions. of NDRG2. Our results lead us to suggest that it is the Many groups have analysed changes in gene copy transcriptional control of NDRG2 expression, including numbers in CRC by different approaches and found repression by MYC and epigenetic regulation, that numerous chromosomal gains and losses[26-29]. In the results in decreased NDRG2 mRNA levels in CRC, rather study by Lagerstedt et al[29], the status of CRC samples than allelic loss of NDRG2. classified as Dukes stages A-D was analysed, showing an increasing frequency of allelic losses at more severe stages (Dukes C and D). According to their data, allelic Lorentzen A, Mitchelmore C. NDRG2 gene copy number deletions in chromosome 14, containing the NDRG2 is not altered in colorectal carcinoma. World J Clin Oncol gene, is already found at earlier stages (Dukes A and 2017; 8(1): 67-74 Available from: URL: http://www.wjgnet. B) and becomes more frequent at the later stages. com/2218-4333/full/v8/i1/67.htm DOI: http://dx.doi.org/ Although chromosome 14 is not considered one of the 10.5306/wjco.v8.i1.67 deletion hot spot regions, such as chromosome 8p or 18q[27,28,30,31], we hypothesised that deletions in chromo- some 14 could lead to loss of one or both of the NDRG2 alleles. On the other hand, the MYC gene is found on INTRODUCTION chromosome 8q, and gains of this large chromosome N-myc downstream regulated gene 2 (NDRG2) arm are frequently found in CRC[26,28,32]. Analysing the is one of four genes belonging to the NDRG gene gene copy number of MYC is therefore of interest with family. Common for these genes is an NDR domain, regards to its possible regulatory effect on NDRG2. a protein motif covering almost the entire protein, In this study, we demonstrate a frequent increase but the cellular functions of these genes are currently in the gene copy number of MYC in CRC. In contrast, unclear[1,2]. NDRG2 expression has been found to be we find that changes in the copy number of theNDRG2 down-regulated in several human cancers including locus are rare in CRC, and we suggest that reduced colorectal carcinoma (CRC), hepatocellular carcinoma, expression of NDRG2 in CRC is due to epigenetic and glioblastoma and thyroid cancer[3-7]. NDRG2 is a candi- MYC-related transcriptional repression. date tumor suppressor gene, with a better overall survival for CRC, hepatocellular carcinoma and glioma patients displaying expression of the gene compared MATERIALS AND METHODS [8-12] to low or no expression . Further evidence of the Cell lines and genomic DNA tumor suppressor function of NDRG2 comes from the The DLD-1, LoVo and SW-480 colorectal cancer cell lines observation that NDRG2-lacking mice develop various were a gift from Associate Professor Ole Vang, Roskilde types of tumors, and from xenograft studies showing University. Cells lines were incubated and maintained that NDRG2-expressing tumor cells implanted in nude at 37 ℃ in an environment of humidified air with 5% mice form smaller tumors and fewer metastases than CO2 in McCoy’s 5A + GlutaMaxTM-1 media with 10% control cells[13-15]. NDRG2 has a number of downstream Fetal Bovine Serum and 1% Penicillin-Streptomycin targets, including activation of phosphatase and tensin (Invitrogen). RNA from cell lines was purified with WJCO|www.wjgnet.com 68 February 10, 2017|Volume 8|Issue 1| Lorentzen A et al . NDRG2 in colorectal carcinoma the SV total RNA isolation kit (Promega) and genomic ggtgagatgagg; MYC: CCAGAGGAGGAACGAGCTAA DNA was purified by ethanol precipitation after an and TTGGACGGACAGGATGTATG; GFAP: TGACCC- overnight Proteinase K treatment. Reference human TCTCCACCCCATAGTGAC and CAGCAGCAGTGC- genomic DNA, purified from blood lymphocytes, was CCTGAAGATTAG; and MECP2: TCAGAGGGTGTG- obtained from Roche Diagnostics, United States (Cat. CAGGTGAA and TTGAAAAGGCATCTTGACAAGGA. In a No.11691112001). As a normal colonic control we used validation experiment using a control sample, a dilution commercially available DNA (BioChain Institute Inc., series was produced and assayed for NDRG2, MYC, D4234090). Human colon genomic DNA from tissue GFAP and MECP2.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-