DOCSLIB.ORG

Next Generation Sequencing-Based Genotyping of Human Blood Groups: FY, JK and ABO Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Next Generation Sequencing-Based Genotyping of Human Blood Groups: FY, JK and ABO Genes University of Plymouth PEARL https://pearl.plymouth.ac.uk 04 University of Plymouth Research Theses 01 Research Theses Main Collection 2017 Next Generation Sequencing-Based Genotyping of Human Blood Groups: FY, JK and ABO Genes Altayar, Malik Abdullah http://hdl.handle.net/10026.1/9325 University of Plymouth All content in PEARL is protected by copyright law. Author manuscripts are made available in accordance with publisher policies. Please cite only the published version using the details provided on the item record or document. In the absence of an open licence (e.g. Creative Commons), permissions for further reuse of content should be sought from the publisher or author. Next Generation Sequencing-Based Genotyping of Human Blood Groups: FY, JK and ABO Genes by Malik Abdullah Altayar A thesis submitted to Plymouth University in partial fulfilment for the degree of DOCTOR OF PHILOSOPHY School of Biomedical and Healthcare Sciences September 2016 This copy of the thesis has been supplied on condition that anyone who consults it is understood to recognise that its copyright rests with its author and that no quotation from the thesis and no information derived from it may be published without the author's prior consent. I Acknowledgements First of all, I thank God for all his blessings that enable me to complete this PhD project. My sincere gratitude is to my parents and all my family for their great support. I am sincerely grateful for the support of my wife and daughters. I would like to express my deepest gratitude to Tabuk University for funding my studies and providing great support in my scholarship in the United Kingdom. I would like to express my special appreciation to my supervisors, Professor Neil Avent and Dr. Tracey Madgett for their endless support and guidance. It has been a great pleasure and honour to be part of their research team. I would like to thank Dr. Michele Kiernan, Dr. Kris Jeremy and Dr. Paul Waines for their valuable help. Finally, I would like to thank all my friends and anyone who have been supporting me throughout my scholarship. II AUTHOR'S DECLARATION At no time during the registration for the degree of Doctor of Philosophy has the author been registered for any other University award without prior agreement of the Graduate Sub-Committee. Name: Malik Abdullah Altayar Signature: Date: Word count of the thesis’s main body: 64,612 words III Award Margaret Kenwright Young Scientist Award 2016 from the British Blood Transfusion Society (BBTS) for the following work: Altayar, M.A., Madgett, T.E., Kiernan, M., Halawani, A.J., Avent, N.D. (2016). Next generation sequencing of JK (SLC14A1) gene reveals higher frequency of variant alleles, novel allele-defining SNPs (allele reference fingerprints) and reassignment of a purported JKnull allele. Transfusion Medicine, 26, suppl. 2, 3-24. Publications N. D. Avent, T. E. Madgett, A. J. Halawani, M. A. Altayar, M. Kiernan, A. J. Reynolds, & X. Li. (2015). Next-generation sequencing: academic overkill or high-resolution routine blood group genotyping? ISBT Science Series, 10, suppl. 1, 250-256. IV Conference participation M. Altayar, A. Halawani, M. Kiernan, A. Reynolds, N. Kaushik, T. Madgett & N. Avent (2013) Next Generation Sequencing of ABO, Duffy and Kidd Blood Group Genotyping. Transfusion Medicine, 23, suppl. 2; 30-71. A. J. Halawani, Altayar, M. A., M. Kiernan, N. Kaushik, A. Reynolds, T. Madgett & N. Avent (2013) Comprehensive Genotyping for Kell and Rh Blood Group Systems by Next-generation DNA Sequencing. Transfusion Medicine 23, suppl. 2; 30-71. Altayar, M. A., Halawani, A. J., Kiernan, M., Reynolds, A. J., Kaushik, N., Madgett, T. E. & Avent, N. D. (2014). Extensive Genotyping of Blood Groups Duffy, Kidd and ABO by Next-generation Sequencing. Vox Sang, 107, suppl. 1, 57-248. Halawani, A. J., Altayar, M. A., Kiernan, M., Reynolds, A. J., Kaushik, N., Madgett, T. E. & Avent, N. D. (2014). Can Next-generation DNA Sequencing Solve the RH Complexity for Genotyping? Vox Sang, 107, suppl. 1, 57-248. Altayar, M. A., Halawani, A. J., Kiernan, M., Madgett, T. E. & Avent, N. D. (2015). Complete Gene Sequencing of ABO Blood Group by Next-generation Sequencing. Vox Sang, 109, suppl. 1, 1-379. Halawani, A. J., Altayar, M. A., Kiernan, M., Li, X., Madgett, T. E. & Avent, N. D. (2015). High Resolution Genotyping of the Rh Blood Group System by Next-generation Sequencing Vox Sang, 109, suppl. 1, 1-379. Abstracts are shown in Appendix A V Abstract Next Generation Sequencing-Based Genotyping of Human Blood Groups: FY, JK and ABO Genes. Malik Abdullah Altayar Serological discrepancies in matching blood group antigens between donors and patients for blood transfusion may lead to alloimmunisation, especially in multiply transfused patients. Blood group genotyping (BGG) has contributed in reducing this issue. ABO, Fy and Jk antigens are among those to be causative for alloimmunisation through transfusion or pregnancy. The number of alleles of these clinically significant blood groups is ever increasing. Currently, all commercially available high-throughput BGG platforms are only based on pre-defined polymorphisms. Consequently, novel or rare alleles that might have clinical significance are not identified. Next generation sequencing (NGS) circumvents this issue by providing high-throughput comprehensive genotyping of blood group genes in discovery mode to find all existing and novel mutations. Accordingly, a large number of individuals can be genotyped in a single run. Here, we describe an NGS-based method coupled with long-range polymerase chain reaction (LR-PCR) for high-throughput, rapid and extensive genotyping of FY, JK and ABO blood group genes. The Ion Torrent Personal Genome Machine (PGMTM) was used for sequencing the entire FY, JK and ABO blood group genes including flanking regions. Accordingly, high resolution genotyping was obtained. 53 genomic DNA samples were sequenced and genotyped for FY, 67 for JK and 47 for ABO. Sequencing data were aligned to the gene reference sequence derived from the human genome (hg19) to analyse variants. Analysis was accomplished by software packages, such as Ion Torrent SuiteTM plugins. Sanger sequencing of cDNA and cDNA clones was used to confirm findings in the JK gene. The sequencing data had a coverage depth of more than 5000x for FY, 700x for JK and 600x for ABO. NGS data matched with the serological phenotypes of FY alleles FY*A, FY*B and FY*02 Null main polymorphisms, such as FY*A/FY*B (125G>A) in exon 2 and (-67 T>C) in the promotor region. JK variant analysis revealed that the JK*01W.01 allele (130G>A) is common (10/67 samples) with normal antigenicity. The previously described silencing polymorphism (810G>A), leading to a purported JK*B null allele, restores a splice site and does not correlate with loss of Jkb antigenicity (10/67 samples). JK intron analysis revealed several new JK alleles described in this thesis. All 7 exons, introns and the flanking regions of the ABO gene were covered by only four amplicons. Several rare O alleles were found, such as O73 and O75, while one suggested novel O allele was characterised by a missense SNP 482G>A (Arg161His) in exon 7. The ABO reference sequence from hg19 appeared to resemble (O01 and O02) alleles. The intronic SNPs might be used to distinguish between alleles more accurately as a correlation of the intronic SNPs with the alleles was noted for the homozygous O alleles. It is predicted that NGS-based genotyping will replace not only microarray-based genotyping but also serology in the blood group typing of individuals, with great advancements in technology and molecular knowledge being expected in the near future. VI Table of Contents Chapter 1: Introduction 1 1.1 Introduction to blood groups 1 1.2 Blood group terminology 2 1.3 The molecular basis of blood group polymorphisms 6 1.4 The immunogenicity of blood groups 10 1.4.1 Haemolytic transfusion reaction (HTR) 10 1.4.2 Haemolytic disease of fetus and newborn (HDFN) 11 1.5 ABO blood group system 12 1.5.1 Discovery 13 1.5.2 Biosynthesis of ABO blood group antigens 15 1.5.3 Inheritance and molecular genetics 18 1.5.4 ABO polymorphisms (ABO alleles) 21 1.5.5 ABO antibodies (clinical significance) 24 1.6 Duffy blood group system (FY) 25 1.6.1 Duffy glycoprotein and FY gene. 25 1.6.2 Molecular basis of FY blood group system 27 1.6.3 FY antibodies (clinical significance) 31 1.7 Kidd blood group system (JK) 31 1.7.1 JK glycoprotein and the JK gene 32 1.7.2 Molecular basis of JK blood group system 34 1.7.3 JK antibodies (clinical significance) 35 1.8 Blood group genotyping 36 1.8.1 Serology and genotyping 36 1.8.2 Applications of BGG 38 1.8.3 High throughput 39 1.8.4 Genotyping technology and methodology 40 1.8.5 Next-generation sequencing 45 1.8.6 Ion Torrent Personal Genome MachineTM (Ion PGMTM) 49 1.8.7 NGS and BGG 54 1.9 Thesis aims 56 CHAPTER 2: Materials and Methods 58 2.1 Genomic DNA (gDNA) and RNA from whole blood samples 58 2.2 Sequencing of blood group genes by next-generation sequencing 58 2.2.1 gDNA extraction and purification 61 2.2.2 RNA extraction and purification 62 2.2.2.1 RNA quantification 64 2.2.3 DNA quantitation 65 2.2.4 Amplicon library preparation for next-generation sequencing 66 2.2.4.1 Primers 66 2.2.4.2 LR-PCR amplicon amplification 70 2.2.4.3 Agarose gel electrophoresis 72 2.2.4.4 Purification 74 VII 2.2.4.5 Sample aliquots 77 2.2.4.6 Amplicon library fragmentation (purified fragmented library) 78 2.2.4.7 The Agilent® 2100 Bioanalyzer 80 2.2.4.8 Optimisations of the fragmentation reaction time 83 2.2.4.9 Ligation of barcoded adapters (purified-ligated library) 87 2.2.4.10 Size selection of the library 90 2.2.4.11.
Load more

Recommended publications
  • Other Blood Group Systems—Diego,Yt, Xg, Scianna, Dombrock
    Review: other blood group systems—Diego, Yt, Xg, Scianna, Dombrock, Colton, Landsteiner- Wiener, and Indian K.M. B YRNE AND P.C. B YRNE Introduction Diego Blood Group System This review was prepared to provide a basic The Diego blood group system (ISBT: DI/010) has overview of “Other Blood Groups.” Some of the more expanded from its humble beginnings to now include major blood group systems, i.e., ABO, Rh, Kell, Duffy, up to 21 discrete antigens (Table 1). 3 Band 3, an anion and Kidd, are also reviewed in this issue and are not exchange, multi-pass membrane glycoprotein, is the covered here. The sheer mass of data on the MNS basic structure that carries the Diego system antigenic blood group system is so extensive and complicated determinants. 4 The gene that encodes the Band 3 that it justifies a review all of its own, and it is therefore protein is named SLC4A1 and its chromosomal location not discussed in this article. However, various aspects is 17q12–q21. 4 of MNS were described in recent papers in Di a and Di b are antithetical, resulting from a single Immunohematology. 1,2 nucleotide substitution (2561T>C) that gives rise to The blood group systems that are covered are those amino acid changes in the Band 3 protein (Leu854Pro). that most workers believe to have some degree of To date, the Di(a–b–) phenotype has not been clinical importance or interesting features: Diego (DI), described. The Di a and Di b antigens are resistant to Yt (YT), Xg (XG), Scianna (SC), Dombrock (DO), Colton treatment with the following enzymes/chemicals: (CO), Landsteiner-Wiener (LW), and Indian (IN).
    [Show full text]
  • Genetic Screening for the Vel- Phenotype Circumvents Difficult Serological Screening Due to Variable Vel Expression Levels
    UvA-DARE (Digital Academic Repository) Genetic basis of rare blood group variants Wigman, L. Publication date 2013 Link to publication Citation for published version (APA): Wigman, L. (2013). Genetic basis of rare blood group variants. General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons). Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible. UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl) Download date:28 Sep 2021 Chapter 6 Genetic screening for the Vel- phenotype circumvents difficult serological screening due to variable Vel expression levels Lonneke Haer-Wigman1 Shabnam Solati1 Aïcha Ait Soussan1 Erik Beckers2 Pim van der Harst3 Marga van Hulst-Sundermeijer4 Peter Ligthart1 Dick van Rhenen5 Hein Schepers3 Tamara Stegmann1 Masja de Haas1 C. Ellen van der Schoot1 1 Sanquin Research, Amsterdam and Landsteiner Laboratory, Academic Medical Centre, University of Amsterdam, Amsterdam, the Netherlands 2 Maastricht University Medical Centre+, Maastricht, The Netherlands 3 University Medical Center Groningen, University of Groningen, Groningen, The Netherlands 4 Sanquin Diagnostic Services, Amsterdam, The Netherlands 5 Sanquin Blood Bank, Rotterdam, Netherlands Manuscript under preparation Chapter 6 Abstract Background: Serological determination of the Vel- phenotype is challenging due to variable Vel expression levels.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS
    Journal of Blood Group Serology and Molecular Genetics VOLUME 34, N UMBER 1, 2018 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 34, Number 1, 2018 CONTENTS S EROLOGIC M ETHOD R EVIEW 1 Warm autoadsorption using ZZAP F.M. Tsimba-Chitsva, A. Caballero, and B. Svatora R EVIEW 4 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A brief overview of clinical significance of blood group antibodies M.J. Gandhi, D.M. Strong, B.I. Whitaker, and E. Petrisli C A S E R EPORT 7 Management of pregnancy sensitized with anti-Inb with monocyte monolayer assay and maternal blood donation R. Shree, K.K. Ma, L.S. Er and M. Delaney R EVIEW 11 Proceedings from the International Society of Blood Transfusion Working Party on Immunohaematology Workshop on the Clinical Significance of Red Blood Cell Alloantibodies, Friday, September 2, 2016, Dubai A review of in vitro methods to predict the clinical significance of red blood cell alloantibodies S.J. Nance S EROLOGIC M ETHOD R EVIEW 16 Recovery of autologous sickle cells by hypotonic wash E. Wilson, K. Kezeor, and M. Crosby TO THE E DITOR 19 The devil is in the details: retention of recipient group A type 5 years after a successful allogeneic bone marrow transplant from a group O donor L.L.W.
    [Show full text]
  • Genes and Human History
    Genes and human history Gil McVean, Department of Statistics, Oxford Contact: [email protected] 2 3 • Where does the variation come from? • How old are the genetic differences between us? • Are these differences important? How different are our genomes? 5 Serological techniques for detecting variation Rabbit Anti-A antibodies Human A A B AB O 6 Blood group systems in humans • 28 known systems – 39 genes, 643 alleles System Genes Alleles Knops CR1 24+ ABO ABO 102 Landsteiner- ICAM4 3 Wiener Colton C4A, C4B 7+ Lewis FUT3, FUT6 14/20 Chido-rodgers AQP1 7 Lutheran LU 16 Colton DAF 10 MNS GYPA,GYPB,G 43 Diego SLC4A1 78 YPE Dombrock DO 9 OK BSG 2 Duffy FY 9 P-related A4GALT, 14/5 Gerbich GYPC 9 B3GALT3 GIL AQP3 2 RAPH-MER2 CD151 3 H/h FUT1, FUT2 27/22 Rh RHCE, RHD, 129 I GCNT2 7 RHAG Indian CD44 2 Scianna ERMAP 4 Kell KEL, XK 33/30 Xg XG, CD99 - Kidd SLC14A1 8 YT ACHE 4 http://www.bioc.aecom.yu.edu/bgmut/summary.htm 7 Protein electroporesis • Changes in mass/charge ratio resulting from amino acid substitutions in proteins can be detected Starch or agar gel -- +- + +- - - - -- - + - + +- -- Direction of travel • In humans, about 30% of all loci show polymorphism with a 6% chance of a pair of randomly drawn alleles at a locus being different Lewontin and Hubby (1966) Harris(1966) 8 The rise of DNA sequencing GATAAGACGGTGATACTCACGCGACGGGCTTGGGCGCCGACTCGTTCAGACGGTGACCCAACTTATCCGATCGACCC CGGGTCCCGATTTAGACTCGGTATCATTTCTGGTGATTATCGCCTGCAGGTTCAAGAACACGTTTGCAGCAAGAAGT GAGGGATTTTGTCAGTGATCCCAGTCTACGGAGCCAGTCACCTCTGGTAGTGAAATTTTATTCGTTCATCTTCATAT AAGTCGCAGACCGCACGATGGGGGACAGAATACTCGCACAGGAAGAACCGCGATGAACCGAGGTAACCTAACATCCT
    [Show full text]
  • Análise Integrativa De Perfis Transcricionais De Pacientes Com
    UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Ribeirão Preto – 2012 ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas Tese apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo para obtenção do título de Doutor em Ciências. Área de Concentração: Genética Orientador: Prof. Dr. Eduardo Antonio Donadi Co-orientador: Prof. Dr. Geraldo A. S. Passos Ribeirão Preto – 2012 AUTORIZO A REPRODUÇÃO E DIVULGAÇÃO TOTAL OU PARCIAL DESTE TRABALHO, POR QUALQUER MEIO CONVENCIONAL OU ELETRÔNICO, PARA FINS DE ESTUDO E PESQUISA, DESDE QUE CITADA A FONTE. FICHA CATALOGRÁFICA Evangelista, Adriane Feijó Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas. Ribeirão Preto, 2012 192p. Tese de Doutorado apresentada à Faculdade de Medicina de Ribeirão Preto da Universidade de São Paulo. Área de Concentração: Genética. Orientador: Donadi, Eduardo Antonio Co-orientador: Passos, Geraldo A. 1. Expressão gênica – microarrays 2. Análise bioinformática por module maps 3. Diabetes mellitus tipo 1 4. Diabetes mellitus tipo 2 5. Diabetes mellitus gestacional FOLHA DE APROVAÇÃO ADRIANE FEIJÓ EVANGELISTA Análise integrativa de perfis transcricionais de pacientes com diabetes mellitus tipo 1, tipo 2 e gestacional, comparando-os com manifestações demográficas, clínicas, laboratoriais, fisiopatológicas e terapêuticas.
    [Show full text]
  • In Vitro Selection for Adhesion of Plasmodium Falciparum-Infected Erythrocytes to ABO Antigens Does Not Affect Pfemp1 and RIFIN
    www.nature.com/scientificreports OPEN In vitro selection for adhesion of Plasmodium falciparum‑infected erythrocytes to ABO antigens does not afect PfEMP1 and RIFIN expression William van der Puije1,2, Christian W. Wang 4, Srinidhi Sudharson 2, Casper Hempel 2, Rebecca W. Olsen 4, Nanna Dalgaard 4, Michael F. Ofori 1, Lars Hviid 3,4, Jørgen A. L. Kurtzhals 2,4 & Trine Staalsoe 2,4* Plasmodium falciparum causes the most severe form of malaria in humans. The adhesion of the infected erythrocytes (IEs) to endothelial receptors (sequestration) and to uninfected erythrocytes (rosetting) are considered major elements in the pathogenesis of the disease. Both sequestration and rosetting appear to involve particular members of several IE variant surface antigens (VSAs) as ligands, interacting with multiple vascular host receptors, including the ABO blood group antigens. In this study, we subjected genetically distinct P. falciparum parasites to in vitro selection for increased IE adhesion to ABO antigens in the absence of potentially confounding receptors. The selection resulted in IEs that adhered stronger to pure ABO antigens, to erythrocytes, and to various human cell lines than their unselected counterparts. However, selection did not result in marked qualitative changes in transcript levels of the genes encoding the best-described VSA families, PfEMP1 and RIFIN. Rather, overall transcription of both gene families tended to decline following selection. Furthermore, selection-induced increases in the adhesion to ABO occurred in the absence of marked changes in immune IgG recognition of IE surface antigens, generally assumed to target mainly VSAs. Our study sheds new light on our understanding of the processes and molecules involved in IE sequestration and rosetting.
    [Show full text]
  • Journal of Blood Group Serology and Molecular Genetics Volume 33, Number 3, 2017 CONTENTS
    Journal of Blood Group Serology and Molecular Genetics VOLUME 33, N UMBER 3, 2017 This issue of Immunohematology is supported by a contribution from Grifols Diagnostics Solutions, Inc. Dedicated to advancement and education in molecular and serologic immunohematology Immunohematology Journal of Blood Group Serology and Molecular Genetics Volume 33, Number 3, 2017 CONTENTS C ASE R EPO R T 99 ABO serology in a case of persistent weak A in a recipient following a group O–matched unrelated bone marrow transplant D.E. Grey, E.A. Fong, C. Cole, J. Jensen, and J. Finlayson O R IGINAL R EPO R T 105 Stability guidelines for dithiothreitol-treated red blood cell reagents used for antibody detection methods in patients treated with daratumumab W.L. Disbro C ASE R EPO R T 110 A LU:−16 individual with antibodies C. Éthier, C. Parent, A.-S. Lemay, N. Baillargeon, G. Laflamme, J. Lavoie, J. Perreault, and M. St-Louis C ASE R EPO R T 114 Postpartum acute hemolytic transfusion reactions associated with anti-Lea in two pregnancies complicated by preeclampsia M. Marchese O R IGINAL R EPO R T 119 Red blood cell phenotype prevalence in blood donors who self- identify as Hispanic C.A. Sheppard, N.L. Bolen, B. Eades, G. Ochoa-Garay, and M.H. Yazer R EVIEW 125 DEL Phenotype D.H. Kwon, S.G. Sandler, and W.A. Flegel 133 138 142 144 A NNOUN C EMENTS A DVE R TISEMENTS I NST R U C TIONS S UBS cr IPTION FO R A UTHO R S I NFO R M AT I O N E DITO R - IN -C HIEF E DITO R IAL B OA R D Sandra Nance, MS, MT(ASCP)SBB Philadelphia, Pennsylvania Patricia Arndt, MT(ASCP)SBB Geralyn M.
    [Show full text]
  • Blood Group Genomics
    BLOOD GROUP GENOMICS Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis of 36 blood group alleles among 396 Thai samples reveals region-specific variants Philaiphon Jongruamklang,1 Christoph Gassner,2 Stefan Meyer,2 Aksarakorn Kummasook,3 Marion Darlison,1 Chayanun Boonlum,4 Surin Chanta,5 Beat M. Frey,2 Martin L. Olsson,1,6* and Jill R. Storry 1,6* lood group antigen polymorphism shows great BACKGROUND: Blood group phenotype variation has variation in different world populations. The been attributed to potential resistance to pathogen reason for this is not completely understood; invasion. Variation was mapped in blood donors from however, it has been attributed to both Lampang (northern region) and Saraburi (central region), B Thailand, where malaria is endemic. The previously unknown blood group allele profiles were characterized ABBREVIATIONS: MALDI-TOF MS 5 matrix-assisted laser and the data were correlated with phenotypes. The high desorption/ionization time-of-flight mass spectrometry; PCR- incidence of the Vel-negative phenotype previously ASP 5 polymerase chain reaction with allele-specific reported in Thais was investigated. primers; SNP(s) 5 single nucleotide polymorphism(s). STUDY DESIGN AND METHODS: DNA from 396 From 1Hematology and Transfusion Medicine, Department of blood donors was analyzed by matrix-assisted laser Laboratory Medicine, Lund University, Lund, Sweden; desorption/ionization–time-of-flight mass spectrometry. 2Molecular Diagnostics & Research (MOC), Blood Transfusion Outliers were investigated by serology and DNA Service Zurich,€ Zurich-Schlieren,€ Switzerland; 3Department of sequencing. Allele discrimination assays for SMIM1 Medical Technology, School of Allied Health Sciences, rs1175550A/G and ACKR1 rs118062001C/T were University of Phayao, Phayao, Thailand; 4Transfusion Medicine, performed and correlated with antigen expression.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name erythroblast membrane-associated protein (Scianna blood group) Gene Symbol ERMAP Organism Human Gene Summary The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. Gene Aliases MGC118810, MGC118811, MGC118812, MGC118813, PRO2801, RD, SC RefSeq Accession No. NC_000001.10, NG_008749.1, NT_032977.9 UniGene ID Hs.439437 Ensembl Gene ID ENSG00000164010 Entrez Gene ID 114625 Assay Information Unique Assay ID qHsaCID0021524 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000372517, ENST00000372514, ENST00000328249 Amplicon Context Sequence GACCAAGGGTCTTACCGATGTCTGATCCAAGTTGGAAATCTGAGTAAAGAGGAC ACCGTGATCCTGCAGGTTGCAGCCCCATCTGTGGGGAGTCTCTCCCCCTCAGCA GTGGCTCTGGCTGTGATCCTGCCTGTCCTGGTACTTCTCATCATGGTGTGCCTTT GCCTTATCTGGAAGCA Amplicon Length (bp) 149 Chromosome Location 1:43296711-43300811 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 102 R2 0.9968 cDNA Cq 22.45 cDNA Tm (Celsius) 86 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 40.23 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report ERMAP, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference
    [Show full text]
  • ERMAP Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Partial Recombinant ERMAP
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 ERMAP Antibody (monoclonal) (M01) Mouse monoclonal antibody raised against a partial recombinant ERMAP. Catalog # AT1943a Specification ERMAP Antibody (monoclonal) (M01) - Product Information Application WB, E Primary Accession Q96PL5 Other Accession NM_001017922 Reactivity Human Host mouse Clonality Monoclonal Isotype IgG2a Kappa Calculated MW 52605 ERMAP Antibody (monoclonal) (M01) - Additional Information Antibody Reactive Against Recombinant Protein.Western Blot detection against Gene ID 114625 Immunogen (36.74 KDa) . Other Names Erythroid membrane-associated protein, hERMAP, Radin blood group antigen, Scianna blood group antigen, ERMAP, RD, SC Target/Specificity ERMAP (NP_001017922, 376 a.a. ~ 475 a.a) partial recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Dilution WB~~1:500~1000 Format ERMAP monoclonal antibody (M01), clone Clear, colorless solution in phosphate 6F8 Western Blot analysis of ERMAP buffered saline, pH 7.2 . expression in HeLa ( (Cat # AT1943a ) Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. Precautions ERMAP Antibody (monoclonal) (M01) is for research use only and not for use in diagnostic or therapeutic procedures. ERMAP Antibody (monoclonal) (M01) - Detection limit for recombinant GST tagged Page 1/2 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Protocols ERMAP is approximately 0.1ng/ml as a capture antibody. Provided below are standard protocols that you may find useful for product applications. ERMAP Antibody (monoclonal) (M01) - • Western Blot Background • Blocking Peptides • Dot Blot The protein encoded by this gene is a cell • Immunohistochemistry surface transmembrane protein that may act • Immunofluorescence as an erythroid cell receptor, possibly as a • Immunoprecipitation mediator of cell adhesion.
    [Show full text]
  • Transfusion Medicine
    Transfusion Medicine Dr. Raymond SM Wong Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong Content Blood groups Cross-matching and pre-transfusion tests Blood components and blood products Complications of blood transfusion Blood transfusion in specific situations Blood groups ( 血型) Determined by the red cell antigens ( 紅血球抗原) About 400 red blood cell group antigens have been described Individual who lack a particular blood group antigen may produce antibodies ( 抗體) reacting with that antigen and may lead to a transfusion reaction ( 輸血 反應) ABO and rhesus ( 獼因子) groups are the most clinically significant blood groups Blood group antibodies Naturally occurring antibodies occur in plasma of subjects who lack the corresponding antigen and who have not been transfused or been pregnant Most important are anti-A and anti-B Immune antibodies Develop in response to exposure to antigens by transfusion or by trans-placental passage during pregnancy Most important is the Rhesus (Rh) antibody, anti-D ABO blood group system Consists of 3 allelic genes: A, B and O A and B gene control the synthesis of specific enzymes which transform the H substance Ceramide glu gal gnac gal fuc H antigen galnac Ceramide glu gal gnac gal A antigen fuc gal Ceramide glu gal gnac gal B antigen fuc Cell membrane ABO blood group system Phenotype Genotype Naturally occurring (表型) (基因型) Antigens antibodies O OO O Anti-A, anti-B A AA or AO A Anti-B B BB or BO B Anti-A AB AB AB None The O gene is an amorph (無效基因)
    [Show full text]