DOCSLIB.ORG

Short Communication Non-Invasive Genetic Identification Confirms the Presence of the Endangered Okapi Okapia Johnstoni South-West of the Congo River

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Short Communication Non-Invasive Genetic Identification Confirms the Presence of the Endangered Okapi Okapia Johnstoni South-West of the Congo River Short Communication Non-invasive genetic identification confirms the presence of the Endangered okapi Okapia johnstoni south-west of the Congo River D AVID W. G. STANTON,JOHN H ART,ASHLEY V OSPER,NOËLLE F. KÜMPEL J INLIANG W ANG,JOHN G. EWEN and M ICHAEL W. BRUFORD Abstract The okapi Okapia johnstoni, a rainforest giraffid he okapi Okapia johnstoni is a monotypic species of the endemic to the Democratic Republic of Congo, was recate- Tfamily Giraffidae, endemic to the Democratic Republic gorized as Endangered on the IUCN Red List in . of Congo. In the species was recategorized as Historical records and anecdotal reports suggest that a dis- Endangered on the IUCN Red List but there is still a lack junct population of okapi may have occurred south-west of of information regarding its range and population sizes the Congo River but the current distribution and status (Mallon et al., ). Most of the okapi’s range lies to the of the okapi in this region are not well known. Here we de- north and east of the Congo River (Kingdon, ; Stuart scribe the use of non-invasive genetic identification for this & Stuart, ; IUCN, ; Hart, ). However, there species and assess the success of species identification from are anecdotal historical (dating back at least to ; Royal dung in the wild, which varied throughout the range. This Museum for Central Africa, Tervuren) and present-day re- variation is probably attributable to varying okapi popu- ports of okapi also occurring south-west of the river (Fig. ), lation densities and/or different sample collection strategies although these are unconfirmed. It is important to deter- across the okapi’s distribution. Okapi were confirmed to mine the validity of these reports because rediscovery of a occur south-west of the Congo River, in scattered localities southern okapi population would imply a geographically west of the Lomami River. We demonstrated that non-in- and potentially evolutionarily distinct population and re- vasive genetic methods can provide information on the dis- inforce efforts to gazette protected areas within this region. tribution of cryptic, uncommon species that is difficult to Okapi are elusive (the first camera-trap image of an okapi obtain by other methods. Further investigation is required was obtained in ; Nixon & Lusenge, ) and are to genetically characterize the okapi across its range and consequently difficult to monitor in the wild. Previously, to investigate the biogeographical processes that have led dung counts have been used to determine okapi presence/ to the observed distribution of okapi and other fauna in absence (Beyers, ; Vosper et al., ). However, studies the region. of other species have shown that accurate visual identifi- cation of animal dung can be difficult (Busby et al., ; Keywords Democratic Republic of Congo, dung sample, Faria et al., ). According to field researchers okapi Endangered, endemic species, Giraffidae, okapi, protected dung is likely to be confused with bongo Tragelaphus eury- area cerus dung in the wild (J. Hart & S. Nixon, pers. comm.). This paper contains supplementary material that can be Non-invasive genetic methods provide a useful way of test- found online at http://journals.cambridge.org ing this possibility (Taberlet & Luikart, ; Busby et al., ; Faria et al., ). Here we present an update on the distribution of the okapi south and west of the Congo River, based on genetic identification of putative okapi dung. Our results show the DAVID W. G. STANTON (Corresponding author) and MICHAEL W. BRUFORD School of Biosciences, Cardiff University, Cardiff CF10 3AX, UK potential utility of this non-invasive, cost-effective method E-mail [email protected] as a means to confirm species’ identities where numbers JOHN HART Lukuru Foundation, Projet Tshuapa-Lomami-Lualaba, Kinshasa, are low and confusion with other species is possible. We Democratic Republic of Congo used two mitochondrial DNA (mtDNA) primers, OJ and ASHLEY VOSPER Wildlife Conservation Society, Okapi Faunal Reserve, OJ (OJ-F (–, based on Genbank okapi mt gen- Democratic Republic of Congo ome, Genbank accession number: NC_.): ATGA NOËLLE F. KÜMPEL Conservation Programmes, Zoological Society of London, – London, UK ATCGGAGGACAACCA, OJ -R ( ): GGCCTC TTCTTTGAGTCTTAGG, bp; OJ-F (–): JINLIANG WANG and JOHN G. EWEN Institute of Zoology, Zoological Society of – London, London, UK CCTAAGACTCAAAGAAGAGGCC, OJ -R ( ): Received March . Revision requested June . TGCTGCGTTAAGGCTGTG, bp) from Stanton et al. Accepted July . First published online November . (). Primer OJ is sited in the okapi cytochrome b Oryx, 2016, 50(1), 134–137 © 2014 Fauna & Flora International doi:10.1017/S0030605314000593 Downloaded from https://www.cambridge.org/core. IP address: 170.106.33.14, on 01 Oct 2021 at 04:55:18, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0030605314000593 Okapi south-west of the Congo River 135 FIG. 1 Map of the study area in the Democratic Republic of Congo, showing the locations where dung samples with viable DNA were found, and of historical records of okapi Okapia johnstoni presence (Royal Museum for Central Africa, Tervuren, and the Centre de Recherche en Science Naturelles, Lwiro, DRC). The study area is divided into four sampling regions. Areas with local knowledge of okapi presence and/ or evidence of okapi observed in a local village are delineated by dashed lines, based on information collected from the Okapi Conservation Workshop. (Cyt b) and tRNA genes, whereas the reverse primer for OJ is respectively. Products were visualized on a % agarose gel sited in the control region. Cyt b is usually more conserved and sequenced by Macrogen Europe. For successfully se- between taxa than the control region, and therefore whereas quenced PCR products, species were identified using the primer OJ may amplify DNA from other taxa as well as GenBank (BLAST) database. The formulae from Faria okapi, primer OJ should only amplify DNA from okapi. et al. () were used to quantify and describe the accuracy This combination of primers may therefore be useful for spe- of species identification based on the observed pattern of cies identification, based on their relative amplification suc- PCR bands on agarose gel before DNA sequencing had cesses, without the need for DNA sequencing. We analysed been carried out. These formulae estimate the error of omis- putative okapi dung samples collected during – sion (where dung from a given species is overlooked by this throughout the okapi’s known range. Seven samples were method), error of commission (where dung is incorrectly at- from sampling region , from region , seven from region tributed to a particular species) and identification accuracy and from region (Fig. ). Faecal samples were collected (rate of identification accuracy, both within species and either by () walking along randomly placed transects through overall). Here, the estimation of identification accuracy re- forest sites and collecting any faeces observed, or ()identify- flects only the accuracy of this method for identifying okapi ing putative okapi sign (dung or prints, for which the re- and is therefore equivalent to one minus the error of liability of correctly identifying okapi in the wild is omission. unknown) and searching the surrounding area for faeces. Of the dung samples tested did not amplify suc- Sampling methodology () was used in areas of high okapi cessfully using either of the mtDNA primers (four of seven density (the Okapi Faunal Reserve; Fig. )and()wasused (.%), sampling region ; of (.%), sampling re- in areas of low okapi density (everywhere else in the range gion ; four of seven (.%), sampling region ; of where faecal samples were found). Sample collection in the (.%), sampling region ), probably because of degraded Reserve was carried out as part of a separate large-mammal DNA. Details of OJ and OJ primer amplification and spe- survey (Vosper et al., ). Elsewhere in the range, areas for cies identification are in Supplementary Material . All sam- sample collection were chosen based on the historical distri- ples in which primer OJ could be amplified were okapi bution of okapi (Fig. ; Kingdon, ;Stuart&Stuart,; samples, based on a Genbank (BLAST) of sequenced PCR IUCN, ;Hart,), attempting to maximize spatial products. Primer OJ failed to amplify a fragment in all coverage within logistical limits. In sampling locations bongo samples. Successful PCR amplification of primer whereitwasnotclearwhetherdungpileswerefromoneor OJ can therefore be used to differentiate between okapi more individuals, samples were genotyped with microsatel- and bongo without the need for DNA sequencing, with pri- lites (Stanton et al., ) to distinguish between individuals. mer OJ acting as a positive control. Using the species Details of mtDNA PCR (polymerase chain reaction) re- identification formulae from Faria et al. () we estimate agents and conditions are in Supplementary Tables S &S, an error of omission of %, an error of commission of % Oryx, 2016, 50(1), 134–137 © 2014 Fauna & Flora International doi:10.1017/S0030605314000593 Downloaded from https://www.cambridge.org/core. IP address: 170.106.33.14, on 01 Oct 2021 at 04:55:18, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0030605314000593 136 D. W. G. Stanton et al. and an identification accuracy of % for correctly identify- apparently no longer exists in some areas where it was re- ing an okapi individual by the presence/absence of a band ported historically, whereas bongo appear to be more com- for primer OJ. This is because the primer pair OJ primes mon in the areas surveyed south-west of the Congo River in the Cyt b and tRNA genes, whereas the reverse primer of than in the Okapi Faunal Reserve (J. Hart, pers. comm.). the OJ primer pair primes in the control region, which is These differences in density may account for the higher oc- much less conserved between species (Supplementary currence of bongo dung samples in sampling region .In Table S).
Load more

Recommended publications
  • EAZA Best Practice Guidelines Bonobo (Pan Paniscus)
    EAZA Best Practice Guidelines Bonobo (Pan paniscus) Editors: Dr Jeroen Stevens Contact information: Royal Zoological Society of Antwerp – K. Astridplein 26 – B 2018 Antwerp, Belgium Email: [email protected] Name of TAG: Great Ape TAG TAG Chair: Dr. María Teresa Abelló Poveda – Barcelona Zoo [email protected] Edition: First edition - 2020 1 2 EAZA Best Practice Guidelines disclaimer Copyright (February 2020) by EAZA Executive Office, Amsterdam. All rights reserved. No part of this publication may be reproduced in hard copy, machine-readable or other forms without advance written permission from the European Association of Zoos and Aquaria (EAZA). Members of the European Association of Zoos and Aquaria (EAZA) may copy this information for their own use as needed. The information contained in these EAZA Best Practice Guidelines has been obtained from numerous sources believed to be reliable. EAZA and the EAZA APE TAG make a diligent effort to provide a complete and accurate representation of the data in its reports, publications, and services. However, EAZA does not guarantee the accuracy, adequacy, or completeness of any information. EAZA disclaims all liability for errors or omissions that may exist and shall not be liable for any incidental, consequential, or other damages (whether resulting from negligence or otherwise) including, without limitation, exemplary damages or lost profits arising out of or in connection with the use of this publication. Because the technical information provided in the EAZA Best Practice Guidelines can easily be misread or misinterpreted unless properly analysed, EAZA strongly recommends that users of this information consult with the editors in all matters related to data analysis and interpretation.
    [Show full text]
  • Congolius, a New Genus of African Reed Frog Endemic to The
    www.nature.com/scientificreports OPEN Congolius, a new genus of African reed frog endemic to the central Congo: A potential case of convergent evolution Tadeáš Nečas1,2*, Gabriel Badjedjea3, Michal Vopálenský4 & Václav Gvoždík1,5* The reed frog genus Hyperolius (Afrobatrachia, Hyperoliidae) is a speciose genus containing over 140 species of mostly small to medium-sized frogs distributed in sub-Saharan Africa. Its high level of colour polymorphism, together with in anurans relatively rare sexual dichromatism, make systematic studies more difcult. As a result, the knowledge of the diversity and taxonomy of this genus is still limited. Hyperolius robustus known only from a handful of localities in rain forests of the central Congo Basin is one of the least known species. Here, we have used molecular methods for the frst time to study the phylogenetic position of this taxon, accompanied by an analysis of phenotype based on external (morphometric) and internal (osteological) morphological characters. Our phylogenetic results undoubtedly placed H. robustus out of Hyperolius into a common clade with sympatric Cryptothylax and West African Morerella. To prevent the uncovered paraphyly, we place H. robustus into a new genus, Congolius. The review of all available data suggests that the new genus is endemic to the central Congolian lowland rain forests. The analysis of phenotype underlined morphological similarity of the new genus to some Hyperolius species. This uniformity of body shape (including cranial shape) indicates that the two genera have either retained ancestral morphology or evolved through convergent evolution under similar ecological pressures in the African rain forests. African reed frogs, Hyperoliidae Laurent, 1943, are presently encompassing almost 230 species in 17 genera.
    [Show full text]
  • Bonobo (Pan Paniscus)
    Bonobo (Pan paniscus) Conservation Strategy 2012–2022 About IUCN IUCN, International Union for Conservation of Nature, helps the world find pragmatic solutions to our most pressing environment and development challenges. IUCN’s work focuses on valuing and conserving nature, ensuring effective and equitable governance of its use, and deploying nature- based solutions to global challenges in climate, food and development. IUCN supports scientific research, manages field projects all over the world, and brings governments, NGOs, the UN and companies together to develop policy, laws and best practice. IUCN is the world’s oldest and largest global environmental organization, with more than 1,200 government and NGO Members and almost 11,000 volunteer experts in some 160 countries. IUCN’s work is supported by over 1,000 staff in 45 offices and hundreds of partners in public, NGO and private sectors around the world. IUCN Species Survival Commission The Species Survival Commission (SSC) is the largest of IUCN’s six volunteer commissions with a global membership of 8,000 experts. SSC advises IUCN and its members on the wide range of technical and scientific aspects of species conservation and is dedicated to securing a future for biodiversity. SSC has significant input into the international agreements dealing with biodiversity conservation. www.iucn.org/themes/ssc IUCN Species Programme The IUCN Species Programme supports the activities of the IUCN Species Survival Commission and individual Specialist Groups, as well as implementing global species conservation initiatives. It is an integral part of the IUCN Secretariat and is managed from IUCN’s international headquarters in Gland, Switzerland.
    [Show full text]
  • Understanding Bushmeat Hunting in the Congo Rainforest
    Understanding bushmeat hunting in the Congo rainforest By Aida Cuni Sanchez, 5th March 2020 Hunting of local wildlife for human consumption (bushmeat) is a major threat to biodiversity in many protected areas. In areas such as the rainforests of the Congo Basin where the presence of tsetse flies limits cattle rearing, bushmeat is the most important source of protein, iron and fat. Our study explored the reasons why people hunt in these areas and investigated how this threat to wildlife populations can be reduced. Lomami National Park was created in 2016 in the Democratic Republic of the Congo, in an area where three unique primates occur: the bonobo Pan paniscus, the Dryas monkey Cercopithecus dryas, which was previously known only from one other park, and the Lesula monkey Cercopithecus lomamiensis, which is endemic to Lomami. The Park is also home to forest elephants and okapis, among other animals. Left: Lomami National Park. Right: Lesula monkeys Cercopithecus lomamiensis, endemic to Lomami. Photo: Hart et al. (2012). Although the Park managers were familiar with the exceptional wildlife found within the Park, they were eager to determine which species people preferred to consume and sell, which were most threatened by hunting, and whether there were any local taboos regarding what kinds of animals can and cannot be hunted. To help answer these questions, we used a participatory research approach. We visited 24 villages in the area that are inhabited by people belonging to various ethnic groups and asked members of local communities which species they preferred to eat, which sold for the highest prices in urban markets, and which they thought had become scarce because of overhunting.
    [Show full text]
  • Lesula: a New Species of Cercopithecus Monkey Endemic to the Democratic Republic of Congo and Implications for Conservation of Congo’S Central Basin
    City University of New York (CUNY) CUNY Academic Works Publications and Research Hunter College 2012 Lesula: A New Species of Cercopithecus Monkey Endemic to the Democratic Republic of Congo and Implications for Conservation of Congo’s Central Basin John A. Hart Lukuru Wildlife Research Foundation Kate M. Detwiler Florida Atlantic University Christopher C. Gilbert CUNY Hunter College Andrew S. Burrell New York University James L. Fuller New York Consortium in Evolutionary Primatology See next page for additional authors How does access to this work benefit ou?y Let us know! More information about this work at: https://academicworks.cuny.edu/hc_pubs/158 Discover additional works at: https://academicworks.cuny.edu This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Authors John A. Hart, Kate M. Detwiler, Christopher C. Gilbert, Andrew S. Burrell, James L. Fuller, Maurice Emetshu, Terese B. Hart, Ashley Vosper, Eric J. Sargis, and Anthony J. Tosi This article is available at CUNY Academic Works: https://academicworks.cuny.edu/hc_pubs/158 Lesula: A New Species of Cercopithecus Monkey Endemic to the Democratic Republic of Congo and Implications for Conservation of Congo’s Central Basin John A. Hart1,2, Kate M. Detwiler3*, Christopher C. Gilbert4,5, Andrew S. Burrell6, James L. Fuller5,7, Maurice Emetshu1, Terese B. Hart1,2, Ashley Vosper8, Eric J. Sargis2,9, Anthony J. Tosi6 1 Lukuru Wildlife Research Foundation, Kinshasa, Gombe, Democratic Republic of Congo, 2 Division of Vertebrate
    [Show full text]
  • Pan Paniscus, Bonobo
    The IUCN Red List of Threatened Species™ ISSN 2307-8235 (online) IUCN 2008: T15932A102331567 Scope: Global Language: English Pan paniscus, Bonobo Assessment by: Fruth, B. et al. View on www.iucnredlist.org Short citation: Fruth, B. et al. 2016. Pan paniscus. The IUCN Red List of Threatened Species 2016: e.T15932A102331567. http://dx.doi.org/10.2305/IUCN.UK.2016-2.RLTS.T15932A17964305.en [see full citation at end] Copyright: © 2017 International Union for Conservation of Nature and Natural Resources Reproduction of this publication for educational or other non-commercial purposes is authorized without prior written permission from the copyright holder provided the source is fully acknowledged. Reproduction of this publication for resale, reposting or other commercial purposes is prohibited without prior written permission from the copyright holder. For further details see Terms of Use. The IUCN Red List of Threatened Species™ is produced and managed by the IUCN Global Species Programme, the IUCN Species Survival Commission (SSC) and The IUCN Red List Partnership. The IUCN Red List Partners are: Arizona State University; BirdLife International; Botanic Gardens Conservation International; Conservation International; NatureServe; Royal Botanic Gardens, Kew; Sapienza University of Rome; Texas A&M University; and Zoological Society of London. If you see any errors or have any questions or suggestions on what is shown in this document, please provide us with feedback so that we can correct or extend the information provided. THE IUCN RED LIST OF THREATENED SPECIES™ Taxonomy Kingdom Phylum Class Order Family Animalia Chordata Mammalia Primates Hominidae Taxon Name: Pan paniscus Schwarz, 1929 Common Name(s): • English: Bonobo, Dwarf Chimpazee, Gracile Chimpanzee, Pygmy Chimpanzee • French: Bonobo • Spanish: Bonobo Taxonomic Source(s): Mittermeier, R.A., Rylands, A.B.
    [Show full text]
  • Behavioral Ecology of Cercopithecus Lomamiensis in the Lomami National Park and Buffer Zone, Democratic Republic of the Congo
    BEHAVIORAL ECOLOGY OF CERCOPITHECUS LOMAMIENSIS IN THE LOMAMI NATIONAL PARK AND BUFFER ZONE, DEMOCRATIC REPUBLIC OF THE CONGO by Charlene S. Fournier Korchia A Thesis Submitted to the Faculty of The Charles E. Schmidt College of Science In Partial Fulfillment of the Requirement for the Degree of Master of Science Florida Atlantic University Boca Raton, FL May 2020 Copyright 2020 by Charlene S. Fournier Korchia ii BEHAVIORAL ECOLOGY OF CERCOPITHECUS LOMAMIENSIS IN THE LOMAMI NATIONAL PARK AND BUFFER ZONE, DEMOCRATIC REPUBLIC OF THE CONGO by Charlene S. Fournier Korchia This thesis was prepared under the direction of the candidate’s thesis advisor, Dr. Kate M. Detwiler, Departments of Anthropology and Biological Sciences, and has been approved by all members of the supervisory committee. It was submitted to the faculty of the Charles E. Schmidt College of Science and was accepted in partial fulfillment of the requirements for the degree of Master of Science. SUPERVISORY COMMITTEE: ____________________________________ Kate M. Detwiler, PhD. Thesis Advisor ____________________________________ Erik G. Noonburg, PhD. ____________________________________ Rindy C. Anderson, PhD. ____________________________________ Sarah L. Milton, PhD. Interim Chair, Department of Biological Sciences ____________________________________ Ata Sarajedini, PhD. Dean, Charles E. Schmidt College of Science April 24th, 2020 ____________________________________ ________________________ Robert W. Stackman Jr., PhD. Date Dean, Graduate College iii ACKNOWLEDGEMENTS I would like to thank our collaborators, Drs. John and Terese Hart, and all the field assistants from the Democratic Republic of the Congo, without whom nothing would have been possible. Field work is too often regarded as a mean to an end, but I am grateful for your determination to work daily in the harsh conditions of the Congolese forests.
    [Show full text]
  • Natural World Heritage in Africa PROGRESS and PROSPECTS
    Natural World Heritage in Africa PROGRESS AND PROSPECTS APRIL 2020 DonorsDonors & Implementing & Implementing Partners Partners Natural World Heritage in Africa PROGRESS AND PROSPECTS PETER C. HOWARD, BASTIAN BERTZKY APRIL 2020 REPORT TITLE The designation of geographical entities in this book, and the presentation of material do not imply the expression of any opinion whatsoever on the part of IUCN or other participating organisations concerning the legal status of any country, territory, or area, or of its authorities, or concerning the delimitation of its frontiers or boundaries. This publication has been produced under the Biodiversity and Protected Areas Management (BIOPAMA) Programme with support of the 11th European Development Fund (EDF) and does not necessarily reflect the views of the European Union nor of the African, Caribbean and Pacific (ACP) Group of States. The views expressed in this publication do not necessarily reflect those of IUCN or other participating organisations. The contents of this publication are solely the responsibility of the authors and should not be interpreted as reflecting the views of any of the individuals or organizations that contributed to the publication or any of its elements. The recommendations are without prejudice whatsoever to either the decision of any State Party to consider nominations on its territory, whether mentioned or not mentioned in this volume, or to the potential evaluation of IUCN’s World Heritage Panel (or of the equivalent body in ICOMOS) regarding any future nomination of any property for World Heritage status. Published by the Biodiversity and Protected Areas Management (BIOPAMA) Programme, an initiative jointly implemented by the International Union for Conservation of Nature (IUCN) and the Joint Research Centre (JRC) of the European Commission.
    [Show full text]
  • PROTECTED AREAS in the CONGO BASIN: FAILING BOTH PEOPLE and BIODIVERSITY? Aili Pyhälä, Ana Osuna Orozco and Simon Counsell
    PROTECTED AREAS IN THE CONGO BASIN: FAILING BOTH PEOPLE AND BIODIVERSITY? Aili Pyhälä, Ana Osuna Orozco and Simon Counsell April 2016 PART OF THE UNDER THE CANOPY SERIES CONTENT ACKNOWLEDGMENTS 2 LIST OF ACRONYMS 3 EXECUTIVE SUMMARY 5 Key findings 6 Key recommendations 9 1. INTRODUCTION 13 2. METHODS AND APPROACH 19 2.1 Selected Protected Areas and Case Studies 22 3. LEGAL AND POLICY FRAMEWORKS FOR CONSERVATION IN THE CONGO BASIN 25 3.1 National and regional conservation policies and community rights 26 3.2 Statutory obligations and commitments of governments, international donors and NGOs 37 4. PROTECTED AREA REALITIES IN THE CONGO BASIN 43 4.1 Protected area types and characteristics 44 4.2 Funding for conservation in the Congo Basin: where is all the money going? 45 4.3 Are protected areas in the Congo Basin conserving biodiversity? 47 4.4 Development models based on resource extraction 50 4.5 Combatting poaching in the Congo Basin: questions and contradictions 53 4.6 Protected Area engagement with local communities 56 4.7 Impacts of protected areas on local and indigenous communities 62 5. CASE STUDIES 73 5.1 Tumba Lediima Nature Reserve, Democratic Republic of Congo 76 5.2 Boumba-Bek and Nki National Parks, Cameroon 84 5.3 Ivindo National Park, Gabon 90 5.4 Odzala-Kokoua National Park, Republic of Congo 95 5.5 Summary: case study trends, commonalities and lessons learnt 102 6. CONCLUSIONS AND RECOMMENDATIONS 105 6.1 Recommendations to national governments 106 6.2 Recommendations to main donors 108 6.3 Recommendations to international NGOs 109 6.4 Recommendations to relevant international bodies 110 6.5 Recommendations to academics and research institutions 111 REFERENCES 112 ANNEXES 121 1 ACKNOWLEDGMENTS This report is the result of a truly collective effort.
    [Show full text]
  • World Bank Document
    Document of The World Bank FOR OFFICIAL USE ONLY Public Disclosure Authorized Report No: ICR00005009 IMPLEMENTATION COMPLETION AND RESULTS REPORT (ICR) IDA-H8980, TF-15910, TF-54463, TF-94033 ON A GRANT FROM THE GLOBAL ENVIRONMENT FACILITY TRUST FUND Public Disclosure Authorized IN THE AMOUNT OF US$ 7.0 MILLION AND AN IDA GRANT IN THE AMOUNT OF SDR 2.0 MILLION (US$ 3.0 MILLION EQUIVALENT) AND Public Disclosure Authorized A GRANT FROM THE GLOBAL ENVIRONMENT FACILITY TRUST FUND IN THE AMOUNT OF US$ 11.64 MILLION TO THE Democratic Republic of Congo FOR THE NATIONAL PARKS NETWORK REHABILITATION PROJECT (PREPAN) July 31, 2020 Public Disclosure Authorized Environment, Natural Resources & The Blue Economy Global Practice Africa Region CURRENCY EQUIVALENTS (Exchange Rate Effective Dec 31, 2019) Currency Unit = US$ CDF 1687 = US$1 0.0006 US$ = CDF 1 FISCAL YEAR January 1 – December 31 Regional Vice President: Hafez M. H. Ghanem Country Director: Jean-Christophe Carret Regional Director: Ede Jorge Ijjasz-Vasquez Practice Manager: Africa Eshogba Olojoba Task Team Leader(s): Raymond Sinsi Lumbuenamo ICR Main Contributor: Juha Antti Kalevi Seppala ABBREVIATIONS AND ACRONYMS AF Additional Financing APN African Parks Network APN Nyabirehe Pygmy Association CAS Country Assistance Strategy CBA Cost-benefit assessment CBD Convention on Biological Diversity CBFP Congo Basin Forest Partnership CDF Congolese franc CITES Convention on International Trade in Endangered Species of Wild Fauna and Flora COMIFAC Commission in Charge of Central African Forests (Commission
    [Show full text]
  • Surveillance and Law Enforcement in DR Congo's Lomami Park
    www.bonoboincongo.com www.lukuru.org Surveillance and Law Enforcement in DR Congo’s Lomami Park Annual Report to The Wildcat Foundation February 2015 – January 2016 Terese Hart: Director 1235 Poids Lourd John Hart: Scientific and Technical Director Gombe, Kinshasa Willy Mekombo: ProJect Manager DR Congo CONTENTS 1. Summary Page 2 2. Context Page 3 3. Progress and developments relative to proJect obJectives in 2015 Page 4 4. Outlook for 2016 and beyond Page 12 5. Acknowledgements Page 13 LIST OF FIGURES FIGURE 1 Lomami National Park FIGURE 2 Arrests for Illegal killing of bonobos FIGURE 3 PALL: missions, informants and monitoring FIGURE 4 Ivory and elephant meat: networks and arrests FIGURE 5 Wildlife legal chain: actors and inputs FIGURE 6 African Grey Parrot exports from Kindu and Kisangani FIGURE 7 2015 Patrols in park FIGURE 8 2015 Security sweeps in the park and buffer Zone LIST OF TABLES TABLE 1 Bonobo killings and commerce; closed hunting season TABLE 2 Arrests and follow-up for ivory poaching network TABLE 3 Supply chain supporting criminal militias TABLE 4 List of new Lomami park guards ANNEXES OBJECTIVE 1 Develop an EAGLE-like initiative in the TL2 Landscape OBJECTIVE 2 Reinforce patrols and security operations in the park OBJECTIVE 3 Extend security sweeps, particularly in elephant Zone OBJECTIVE 4 Integrate new ICCN park guars into security operations Lukuru Foundation Annual Report, 2015 1 1. Summary: Robust surveillance and active law enforcement are necessary to ensure conservation of vulnerable wildlife in DR Congo. Over the last two decades, following Congo’s civil war, many of the country’s remaining wilderness areas became magnets for criminal gangs, including the TL2 area straddling the three rivers, Tshsuapa, Lomami and Lualaba (Figure 1).
    [Show full text]
  • Using Local Knowledge and Camera Traps to Investigate Occurrence and Habitat Preference of an Endangered Primate: the Endemic Dr
    Using local knowledge and camera traps to investigate occurrence and habitat preference of an Endangered primate: the endemic dryas monkey in the Democratic Republic of the Congo D ANIEL A LEMPIJEVIC,JOHN A. HART,TERESE B. HART and K ATE M. DETWILER Abstract The Endangered dryas monkey Cercopithecus dryas, the type locality, description of Cercopithecus salongo as a endemic to the Democratic Republic of the Congo, is one of new species, and lack of specimens have led to taxonomic Africa’s most enigmatic primates. The discovery of a dryas confusion (Schwarz, ; Dandelot, ; Thys van den monkey killed by a hunter in the buffer zone of Lomami Audenaerde, ; Kuroda et al., ; Groves, ). National Park in prompted field research on the species’ Cercopithecus salongo specimens were eventually deter- distribution, habitat use and stratum preference. We used local mined to be the adult of the juvenile C. dryas type spe- knowledge to determine the distribution of this species and to cimen (Colyn et al., ), although this remains disputed select sites for camera-trap surveys in Lomami National Park (Sarmiento, ; Kingdon, ). Recent genomic studies and its buffer zone. We employed a multi-strata (– m) cam- have confirmed that the dryas monkey is a sister lineage era-trap placement technique to determine habitat use at Camp to savannah monkeys of the genus Chlorocebus, suggest- Bartho in Lomami National Park and Bafundo Forest in the ing the Cercopithecus group is paraphyletic (Guschanski Park’s buffer zone. We confirmed the occurrence of the dryas et al., ; van der Valk et al., ). Here we accept monkey at seven locations over a total area of , km ,inboth Chlorocebus as the appropriate generic affiliation, pending theParkanditsbufferzone.Dryasmonkeysweredetected further analyses of available specimens, and accept salongo most frequently (.
    [Show full text]