Short Communication Non-Invasive Genetic Identification Confirms the Presence of the Endangered Okapi Okapia Johnstoni South-West of the Congo River

Short Communication Non-invasive genetic identification confirms the presence of the Endangered okapi Okapia johnstoni south-west of the Congo River

D AVID W. G. STANTON,JOHN H ART,ASHLEY V OSPER,NOËLLE F. KÜMPEL J INLIANG W ANG,JOHN G. EWEN and M ICHAEL W. BRUFORD

Abstract The okapi Okapia johnstoni, a rainforest giraffid he okapi Okapia johnstoni is a monotypic species of the endemic to the Democratic Republic of Congo, was recate- Tfamily Giraffidae, endemic to the Democratic Republic gorized as Endangered on the IUCN Red List in . of Congo. In  the species was recategorized as Historical records and anecdotal reports suggest that a dis- Endangered on the IUCN Red List but there is still a lack junct population of okapi may have occurred south-west of of information regarding its range and population sizes the Congo River but the current distribution and status (Mallon et al., ). Most of the okapi’s range lies to the of the okapi in this region are not well known. Here we de- north and east of the Congo River (Kingdon, ; Stuart scribe the use of non-invasive genetic identification for this & Stuart, ; IUCN, ; Hart, ). However, there species and assess the success of species identification from are anecdotal historical (dating back at least to ; Royal dung in the wild, which varied throughout the range. This Museum for Central Africa, Tervuren) and present-day re- variation is probably attributable to varying okapi popu- ports of okapi also occurring south-west of the river (Fig. ), lation densities and/or different sample collection strategies although these are unconfirmed. It is important to deter- across the okapi’s distribution. Okapi were confirmed to mine the validity of these reports because rediscovery of a occur south-west of the Congo River, in scattered localities southern okapi population would imply a geographically west of the Lomami River. We demonstrated that non-in- and potentially evolutionarily distinct population and re- vasive genetic methods can provide information on the dis- inforce efforts to gazette protected areas within this region. tribution of cryptic, uncommon species that is difficult to Okapi are elusive (the first camera-trap image of an okapi obtain by other methods. Further investigation is required was obtained in ; Nixon & Lusenge, ) and are to genetically characterize the okapi across its range and consequently difficult to monitor in the wild. Previously, to investigate the biogeographical processes that have led dung counts have been used to determine okapi presence/ to the observed distribution of okapi and other fauna in absence (Beyers, ; Vosper et al., ). However, studies the region. of other species have shown that accurate visual identification of animal dung can be difficult (Busby et al., ; Keywords Democratic Republic of Congo, dung sample, Faria et al., ). According to field researchers okapi Endangered, endemic species, Giraffidae, okapi, protected dung is likely to be confused with bongo Tragelaphus eury- area cerus dung in the wild (J. Hart & S. Nixon, pers. comm.). This paper contains supplementary material that can be Non-invasive genetic methods provide a useful way of test- found online at http://journals.cambridge.org ing this possibility (Taberlet & Luikart, ; Busby et al., ; Faria et al., ). Here we present an update on the distribution of the okapi south and west of the Congo River, based on genetic identification of putative okapi dung. Our results show the DAVID W. G. STANTON (Corresponding author) and MICHAEL W. BRUFORD School of Biosciences, Cardiff University, Cardiff CF10 3AX, UK potential utility of this non-invasive, cost-effective method E-mail [email protected] as a means to confirm species’ identities where numbers JOHN HART Lukuru Foundation, Projet Tshuapa-Lomami-Lualaba, Kinshasa, are low and confusion with other species is possible. We Democratic Republic of Congo used two mitochondrial DNA (mtDNA) primers, OJ and ASHLEY VOSPER Wildlife Conservation Society, Okapi Faunal Reserve, OJ (OJ-F (–, based on Genbank okapi mt gen- Democratic Republic of Congo ome, Genbank accession number: NC_.): ATGA NOËLLE F. KÜMPEL Conservation Programmes, Zoological Society of London,  – London, UK ATCGGAGGACAACCA, OJ -R ( ): GGCCTC TTCTTTGAGTCTTAGG,  bp; OJ-F (–): JINLIANG WANG and JOHN G. EWEN Institute of Zoology, Zoological Society of  – London, London, UK CCTAAGACTCAAAGAAGAGGCC, OJ -R ( ):  Received  March . Revision requested  June . TGCTGCGTTAAGGCTGTG, bp) from Stanton et al. Accepted  July . First published online  November . (). Primer OJ is sited in the okapi cytochrome b

Oryx, 2016, 50(1), 134–137 © 2014 Fauna & Flora International doi:10.1017/S0030605314000593 Downloaded from https://www.cambridge.org/core. IP address: 170.106.33.14, on 01 Oct 2021 at 04:55:18, subject to the Cambridge Core terms of use, available at https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0030605314000593 Okapi south-west of the Congo River 135

FIG. 1 Map of the study area in the Democratic Republic of Congo, showing the locations where dung samples with viable DNA were found, and of historical records of okapi Okapia johnstoni presence (Royal Museum for Central Africa, Tervuren, and the Centre de Recherche en Science Naturelles, Lwiro, DRC). The study area is divided into four sampling regions. Areas with local knowledge of okapi presence and/ or evidence of okapi observed in a local village are delineated by dashed lines, based on information collected from the  Okapi Conservation Workshop.

(Cyt b) and tRNA genes, whereas the reverse primer for OJ is respectively. Products were visualized on a % agarose gel sited in the control region. Cyt b is usually more conserved and sequenced by Macrogen Europe. For successfully se- between taxa than the control region, and therefore whereas quenced PCR products, species were identified using the primer OJ may amplify DNA from other taxa as well as GenBank (BLAST) database. The formulae from Faria okapi, primer OJ should only amplify DNA from okapi. et al. () were used to quantify and describe the accuracy This combination of primers may therefore be useful for spe- of species identification based on the observed pattern of cies identification, based on their relative amplification suc- PCR bands on agarose gel before DNA sequencing had cesses, without the need for DNA sequencing. We analysed been carried out. These formulae estimate the error of omis-  putative okapi dung samples collected during – sion (where dung from a given species is overlooked by this throughout the okapi’s known range. Seven samples were method), error of commission (where dung is incorrectly at- from sampling region ,  from region , seven from region tributed to a particular species) and identification accuracy  and  from region  (Fig. ). Faecal samples were collected (rate of identification accuracy, both within species and either by () walking along randomly placed transects through overall). Here, the estimation of identification accuracy re- forest sites and collecting any faeces observed, or ()identify- flects only the accuracy of this method for identifying okapi ing putative okapi sign (dung or prints, for which the re- and is therefore equivalent to one minus the error of liability of correctly identifying okapi in the wild is omission. unknown) and searching the surrounding area for faeces. Of the  dung samples tested  did not amplify suc- Sampling methodology () was used in areas of high okapi cessfully using either of the mtDNA primers (four of seven density (the Okapi Faunal Reserve; Fig. )and()wasused (.%), sampling region ;  of  (.%), sampling re- in areas of low okapi density (everywhere else in the range gion ; four of seven (.%), sampling region ;  of  where faecal samples were found). Sample collection in the (.%), sampling region ), probably because of degraded Reserve was carried out as part of a separate large-mammal DNA. Details of OJ and OJ primer amplification and spe- survey (Vosper et al., ). Elsewhere in the range, areas for cies identification are in Supplementary Material . All sam- sample collection were chosen based on the historical distri- ples in which primer OJ could be amplified were okapi bution of okapi (Fig. ; Kingdon, ;Stuart&Stuart,; samples, based on a Genbank (BLAST) of sequenced PCR IUCN, ;Hart,), attempting to maximize spatial products. Primer OJ failed to amplify a fragment in all coverage within logistical limits. In sampling locations bongo samples. Successful PCR amplification of primer whereitwasnotclearwhetherdungpileswerefromoneor OJ can therefore be used to differentiate between okapi more individuals, samples were genotyped with microsatel- and bongo without the need for DNA sequencing, with pri- lites (Stanton et al., ) to distinguish between individuals. mer OJ acting as a positive control. Using the species Details of mtDNA PCR (polymerase chain reaction) re- identification formulae from Faria et al. () we estimate agents and conditions are in Supplementary Tables S &S, an error of omission of %, an error of commission of %

and an identification accuracy of % for correctly identify- apparently no longer exists in some areas where it was re- ing an okapi individual by the presence/absence of a band ported historically, whereas bongo appear to be more com- for primer OJ. This is because the primer pair OJ primes mon in the areas surveyed south-west of the Congo River in the Cyt b and tRNA genes, whereas the reverse primer of than in the Okapi Faunal Reserve (J. Hart, pers. comm.). the OJ primer pair primes in the control region, which is These differences in density may account for the higher oc- much less conserved between species (Supplementary currence of bongo dung samples in sampling region .In Table S). Assuming an error of commission of % using addition, given the low abundance of putative okapi dung the pre-sequencing method described above,  of the  outside the Reserve, field teams were asked to collect any- samples containing usable DNA were from okapi and six thing that could be okapi dung, whereas for the surveys from bongo. All six bongo samples, misidentified as okapi, within the Reserve they were asked to differentiate between were from sampling region , south-west of the Congo species. Thus, variation in species identification success be- River. The six okapi samples found in region  were from tween sample collectors does not necessarily reflect the four individuals and were all found on the western side of identification ability of the field workers. Taken together the Lomami River (Fig. ). these results imply that okapi and bongo dung can be ident- Our findings show that okapi still occur south-west of the ified correctly in the field by eye. However, correct identifi- Congo River, although they appear to be localized and at cation should not be assumed, and molecular methods low density, with an encounter rate in the Lomami area of should be used to confirm species identity. , . dung samples per km, even in the zones where okapi Of the samples found in the Lomami National Park, only are known to occur. This compares with encounter rates of the ones west of the Lomami River could be confirmed as .–. dung samples per km in the Okapi Faunal Reserve okapi. This does not imply that okapi are not present else- (Hart et al., ; Vosper et al., ). This study demon- where south-west of the Congo River but we did not have strates the utility of a molecular approach for differentiating enough samples to investigate this. The presence of okapi between dung samples from okapi and bongo, the species south-west of the Congo River raises the possibility that with which okapi are most likely to be confused in the there are genetically differentiated populations either side field. In particular, we demonstrate the possibility of differ- of the Congo (and Lomami) River if, as seems likely, the entiating between okapi and bongo dung without the need river acts as a dispersal barrier for the species. Okapi, lesula for DNA sequencing. These primers provide a simple diag- Cercopithecus lomamiensis and Thollon’s red colobus nostic test to identify okapi from non-invasively collected Procolobus tholloni are all restricted to the west side of the samples, such as dung, using only PCR amplification and Lomami River and absent from the Lomami–Lualaba inter- gel electrophoresis. However, this methodology is only fluve (Hart et al., ). Further studies are needed to inves- being tested for positive identification of okapi samples. tigate the biogeographical processes that have influenced the The % error of omission implies that an investigator fauna of this region, and to genetically characterize okapi using this method may class some okapi as bongo (this is throughout their range. essentially allelic dropout; Taberlet & Luikart, ); however, this is easily accounted for by sequencing the putative  bongo samples. The % error of commission implies a high Acknowledgements accuracy for samples identified as okapi. It is unlikely that the dung of any species other than bongo, which has an We gratefully acknowledge the assistance of the Institut overlapping range with okapi, would be confused with Congolais pour la Conservation de la Nature for allowing that of okapi (J. Hart & S. Nixon, pers. comm.). Duiker the field collection and export of samples. We thank dung has previously been confused with bongo (Faria Gilman International Conservation, the Okapi Conservation et al., ) but we found no evidence of this in our dataset. Project, the Frankfurt Zoological Society, the Wildlife Con- Accurately determining distribution and abundance is a servation Society, the Lukuru Foundation/TL project, the priority for species conservation (Jenkins et al., )andis Zoological Society of London (ZSL) and all those who as- especially challenging in species that are cryptic, uncommon sisted in various ways with sample collection. In particular, and locally distributed, as the okapi is in many parts of its we thank John Fataki Bolingo, Bryna Griffin, Terese Hart, range. Fig.  shows regions within the putative okapi range Chrysostome Kaghoma, Luaison, John Lukas, Kambale where there is local knowledge, based on anecdotal infor- Magloire, Ephrem Mpaka, Stuart Nixon, Linda Penfold, mation such as unconfirmed community reports at the Elise Queslin, Alex Quinn and Rosemary Ruf. This project Okapi Conservation Workshop (ZSL, ). These should be was jointly funded by the UK Natural Environment priority areas for implementing the methods we describe here, Research Council and ZSL (ZSL as NERC CASE industry to improve our knowledge of the current distribution of okapi. partner and via an Erasmus Darwin Barlow Expedition Although we confirmed the occurrence of okapi in grant). We also acknowledge the financial support Congo’s central basin, the species is uncommon and provided by Gilman International Conservation (the Okapi

Conservation Project), the U.S. Fish and Wildlife Service, the Conservation Report No. . The Zoological Society of London, UK’s Darwin Initiative and the Mohamed bin Zayed Species London, UK. Conservation Fund. STANTON, D.W.G., HART, J., GALBUSERA, P., HELSEN, P., SHEPHARD, J., KÜMPEL, N. et al. () Distinct and diverse: range-wide phylogeography reveals ancient lineages and high genetic variation in the Endangered okapi (Okapia johnstoni). PLoS ONE, (),  References e . STANTON, D.W.G., PENFOLD, L.M., ZHAN,X.&BRUFORD, M.W. () Microsatellite loci for the okapi (Okapia johnstoni). BEYERS,R.() Natural and anthropogenic influences on elephants Conservation Genetics Resources, , –. and other ungulates in the Congo forest. Unpublished PhD thesis. STUART,C.&STUART,T.() Field Guide to the Larger Mammals of University of British Columbia, Vancouver, Canada. Africa. Struik Publishers, Cape Town, South Africa. BUSBY, G.B.J., GOTTELLI, D., WACHER, T., MARKER, L., BELBACHIR, TABERLET,P.&LUIKART,G.() Non-invasive genetic sampling F., D E SMET, K. et al. () Genetic analysis of scat reveals leopard and individual identification. Biological Journal of the Linnean Panthera pardus and cheetah Acinonyx jubatus in southern Algeria. Society, , –. Oryx, , –. VOSPER, A., MASSELINK,J.&MAISELS,F.() Great Ape and FARIA, P.J., KAVEMBE, G.D., JUNG’A, J.O., KIMWELE, C.N., ESTES, Human Impact Monitoring in Okapi Faunal Reserve, Democratic L.D., REILLO, P.R. et al. () The use of non-invasive molecular Republic of Congo. Final report to USFWS-GACF. WCS RFO techniques to confirm the presence of mountain bongo Tragelaphus Program. eurycerus isaaci populations in Kenya and preliminary inference of ZSL (ZOOLOGICAL SOCIETY OF LONDON)() Report on a their mitochondrial genetic variation. Conservation Genetics, , workshop to develop a conservation strategy for the okapi, –. – May , Kisangani, Orientale Province, DRC. The HART,J.() Okapia johnstoni, Okapi. In Mammals of Africa, Zoological Society of London, London, UK. Volume VI: Pigs, Hippopotamuses, Chevrotain, Giraffes, Deer and Bovids (eds J. Kingdon & M. Hoffmann), pp. –. Bloomsbury Publishing, London, UK. HART, J., BEYERS, R., GROSSMANN, F., CARBO, M., DINO, S.O. & Biographical sketches KAHINDO,F.() La Reserve de Faune a Okapis. La distribution et frequence de la grande faune et des activites humaines. Avec une DAVID STANTON is a molecular ecologist, whose research interests in- evaluation de l’impact de  ans de conflict: –. Kinshasa: clude inferring the demographic history of populations or species and IMU Rapport No . investigating domestication and human-mediated wildlife transloca- HART, J., DETWILER, K.M., GILBERT, C.C., BURRELL, A.S., FULLER,J. tions. JOHN HART has studied and monitored okapi throughout L., EMETSHU, M. et al. () Lesula: a new species of Cercopithecus their range since . He is involved in the establishment of the monkey endemic to the Democratic Republic of Congo and Lomami National Park in the Democratic Republic of Congo, which implications for conservation of Congo’s central basin. PLoS ONE,  will provide legal protection for okapi and other endemic large mam- (), e. mals of the Congo River’s left-bank forests. ASHLEY VOSPER is a field IUCN () IUCN SSC Antelope Specialist Group . Okapia scientist and has coordinated a large number of conservation surveys, johnstoni.InIUCN Red List of Threatened Species v. .. Http:// predominantly in Central and West Africa. NOËLLE KÜMPEL’s work www.iucnredlist.org [accessed  August ]. focuses on conservation, research and policy, specializing in tropical JENKINS, C.N., PIMM, S.L. & JOPPA, L.N. () Global patterns of forest conservation, in particular wildlife hunting and trade, monitor- terrestrial vertebrate diversity and conservation. Proceedings of the ing, and sustainable livelihoods. She has managed field projects in the National Academy of Sciences of the United States of America, , Democratic Republic of Congo since , including a multi-partner E–E. project on the range-wide conservation of the okapi. JINLIANG KINGDON,J.() The Kingdon Field Guide to African Mammals. WANG is interested in developing population genetics models and Academic Press. London, UK. methods of analysis of empirical data to address issues in evolutionary MALLON, D., KÜMPEL, N., QUINN, A., SHURTER, S., LUKAS, J., HART, and conservation biology. JOHN EWEN’s work focuses on the biology J. & MAPILANGA,J.() Okapia johnstoni. In IUCN Red List of and management of small populations, often involving reintroduction. Threatened Species v. .. Http://www.iucnredlist.org [accessed  MICHAEL BRUFORD is a molecular ecologist who works on threatened November ]. species, especially those in fragmented and disturbed habitats. He is NIXON, S.C. & LUSENGE,T.() Conservation Status of Okapi in also interested in the development of conservation policy and manage- Virunga National Park, Democratic Republic of Congo. ZSL ment tools.