Transcription by an Indirect Mechanism

Home , DNA methylation

Proc. Nati. Acad. Sci. USA Vol. 89, pp. 10119-10123, November 1992 Biochemistry Methylation in the preinitiation domain suppresses gene transcription by an indirect mechanism (transient transfections/transcription factor TFHID and TFUA binding/in vitro trasription/transcription reinitiation) ALEX LEVINE*t, GiULIo L. CANTONIt, AND AHARON RAZIN* *Department of Cellular Biochemistry, The Hebrew University, Hadassah Medical School, Jerusalem, Israel 91010; and tLaboratory of General and Comparative Biochemistry, National Institute of Mental Health, Bethesda, MD 20892 Contributed by Giulio L. Cantoni, July 28, 1992

ABSTRACT Although the first observations of the inhib- The present study provides evidence that the inhibition of itory effect of methylation on gene activity were made almost promoter activity is correlated with the density ofmCpG sites a decade ago, the mechanism by which methyl groups affect at the preinitiation domain but not at sequences flanking this transcription is still obscure. Here we use engineered promot- region. The results also suggest that a methylcytosine- ers methylated in vitro in transient tranections to study the binding protein is involved in this inhibition, most probably mechanism by which methylation mediates promoter repres- by binding to the domain involved in formation of the sion. The results clearly show that the location of the methyl preinitiation complex. However, templates that escape inac- groups within the promoter region determines the extent of tivation and succeed in establishing a functional preinitiation promoter repression. The most effective suppression was ob- complex support transcription and repeated reinitiations served when methylation was in the preinitiation domain. The even in their methylated state. results also support a previous suggestion that a mediator protein is involved in the mechanism of promoter inhibition. The suppressor effect of methylation at sequences flanking the MATERIALS AND METHODS TATA box can be partially overcome in the presence of the Preparation ofConstructs, Ollgonucleotides, and PCR Prod- simian virus 40 enhancer. In addition, results obtained by ucts and in Vitro Methylation. pmMTIhGH used for the transient thymidine labeling ofLtk- cells that were transfected studies on the effect ofmethylation ofthe mouse metallothio- with a methylated thymidine kinase gene from herpes simplex nein I (mMTI) promoter (see map in Fig. 1) has been virus, at the level of approximately one template per cell, described previously (14). pSV2hGH (see map in Fig. 2) was further support the conclusion that methylation affects pri- constructed by excision of the simian virus 40 (SV40) early marily banscription preinitiation. promoter from pSV2CAT (HindIII/Pvu II fragment), filling in the ends, and ligation into the HincII site of the polylinker A correlation between gene-specific methylation patterns of the pOGH (Nichols Institute, San Juan Capistrano, CA). and expression is well established: many genes have been The orientation of the insert was determined by digestion shown to be inactive when methylated and expressed when with Bgi I. The SV40 enhancer was deleted by digesting the undermethylated. Several studies show that methylation at parental plasmid pSV2hGH with HindIII/Nsi I, which re- the promoter region is sufficient to repress gene activity (1). moves most of the 72-base-pair (bp) repeats, resulting in the Recent progress in the identification and characterization of loss of enhancer activity (15). Duplex oligonucleotides with transcription factors and in the clarification ofthe mechanism Nco I overhangs, synthesized by the Applied Biosystems of transcription initiation in eukaryotes has made it possible automatic oligonucleotide synthesizer, were annealed and to investigate the mechanism whereby methylation at the ligated into the Nco I site or end filled and inserted into Bgl promoter region results in repression of gene activity (1, 2). I, Xba I, or HindIII sites by blunt-end ligation. Methylation Three different mechanisms have been suggested: (i) Meth- with methylases M.Sss I, M.Hpa II, M.Hha I, and M.FnuDII ylation of specific DNA sites can directly inhibit the binding was performed as described previously (8). Completion ofthe of transcription factors, such as the major late transcription in vitro methylation reaction was verified by digestion of the factor (MLTF) (3) or the cAMP-responsive element binding methylated product with the corresponding restriction en- factor (CREB) (4). However, this mechanism does not apply zyme. to all transcription factors; the transcription factor Spl, for Transfections and Assay of Promoter Activity. Transient instance, binds and facilitates transcription even when Spl transfection experiments were performed as previously de- sites are fully methylated (5). (ii) The binding oftranscription scribed (8) with the following modifications: Ltk- cells, factors may be prevented indirectly by proteins capable of which are mouse L cells lacking a thymidine kinase (tk) gene, binding to methylated DNA. One such protein might be the were plated into six-well culture plates (3.5 x 105 cells per recently identified meCPl, which has been shown to bind plate). After 24 hr of incubation in Dulbecco's modified more efficiently to densely methylated DNA sequences in Eagle's medium (DMEM) + 10% fetal bovine serum the vitro (6) and has been postulated to do so in vivo (7, 8). The medium was replaced by a transfection mixture consisting of efficiency of meCP1 binding and the extent of promoter 300 ng of plasmid DNA in 250 ,ul of Opri-MEM (GIBCO) activity suppression is a function of the density of mCpG mixed with 12.5 Al of N-[1-(2,3-dioleoyloxy)propylJ-NN,N- (mC, methylcytosine) sites in the promoter region (6, 9). (iii) trimethylammonium methyl sulfate (DOTAP) transfection DNA methylation has also been correlated with the organi- reagent (Boehringer-Mannheim, Germany) in 250 A.l ofOPTi- zation of the chromatin structure (10-12), perhaps through MEM. After 6 hr with this mix the volume in the wells was the participation of mCpG-binding proteins in this process brought to 2.5 ml with DMEM + 10%6 fetal bovine serum. The (13). promoter activity was assayed after 48 hr by measuring the

The publication costs of this article were defrayed in part by page charge Abbreviations: MLTF, major late transcription factor; mMTI, payment. This article must therefore be hereby marked "advertisement" mouse metallothionein I; SV40, simian virus 40; tk, thymidine in accordance with 18 U.S.C. §1734 solely to indicate this fact. kinase; hGH, human growth hormone. 10119 Downloaded by guest on September 24, 2021 10120 Biochemistry: Levine et al. Proc. Natl. Acad. Sci. USA 89 (1992) levels of human growth hormone (hGH) in the culture me- striking synergistic effect is consistent with the hypothesis dium as described previously (8). that the interaction between methylated sites may result in a In Situ Autoradiography. Ltk- cells were transfected with cooperative binding of suppressor protein molecules to the pHSVtk (plasmid containing the herpes simplex virus tk promoter region. However, other interpretations of the re- gene) that had been methylated in vitro by M.Hpa II, M.Hha sults are possible. It should be noted, for instance, that mMTI I, and M.FnuDII at a concentration of 500 or 100 ng per and other native promoters may contain more than one 60-mm plate. After 16 hr of transfection in Opri-MEM, the recognition site for various transcription factors (17). Meth- medium was replaced by 1 ml of DMEM + 10% fetal bovine ylation of these recognition sites could interfere directly with serum containing 10 ,Ci (370 kBq) of [3H]thymidine (48 the binding of the factors. For example, the relatively strong Ci/mmol) (Amersham) for another 24 hr. Cells were washed effect obtained by methylation of the FnuDII site might be and plated on microscope slides and incubated for 6 hr. As a explained by the location of these sites within the MLTF control of expression of single-copy tk gene we used CHO element. In addition, the results presented in Fig. 1 do not (Chinese hamster ovary) cells labeled with [3H]thymidine allow us to determine whether the extent of inhibition is under the same conditions. By lowering the DNA concen- dependent on the density ofthe methyl groups, their position, trations that were used in the transfection experiments we or a combination of the two. Therefore, this type of exper- have arrived at a DNA concentration that resulted in a iment cannot distinguish between the three mechanisms smaller number of positive cells with a relative homogenous outlined above-namely, a direct effect of methylation on the grain density comparable to that obtained with CHO cells. binding of transcription factors, an indirect effect mediated Cells were fixed with methanol/acetone (1:1, vol/vol) for 2 by a repressor which binds to the methylated sites, or an min at room temperature, washed with phosphate-buffered overall effect on chromatin structure. Previous reports in the saline, and dehydrated by incubating the slides in gradually literature with regard to these questions were also inconclu- increasing concentrations ofethanol (60% to 100%1o in steps of sive. A study with the late SV40 promoter revealed that a 10%). After drying, the slides were submerged in 1:1 dilution single methylated site is sufficient to inhibit promoter activity of NTB (Kodak) in water and exposed for 12 days. Devel- (18). On the other hand, when the y-globin promoter was oping was with D-19 developer (Kodak) for 2 min at 80C. studied it was suggested that a minimum stretch of unmeth- Slides were stained with Giemsa stain and visualized and ylated DNA in the promoter region is required for expression photographed in a Zeiss Axioplan microscope equipped with of the gene, suggesting a global effect on chromatin structure a 35-mm camera. (19). To distinguish between the various interpretations it would be advantageous to use promoters in which the position and RESULTS number of methyl groups along the promoter region can be We have previously demonstrated that in vitro methylation of controlled with precision. the mMTI promoter with bacterial methylases resulted in a We decided, therefore, to use constructs in which the hGH decrease in promoter activity in transient transfection exper- gene is driven by the early SV40 promoter (pSVhGH), taking iments (8). To gain a better understanding of how methylated advantage of the fact that the early SV40 promoter is devoid sites at various positions within the promoter region exert of Hpa II, Hha I, or FnuDII sites, so that insertion of their suppressor effect we have methylated specific sites in chemically synthesized oligonucleotides that contain these the mMTI promoter by treatment in vitro with M.Hpa II, sites into various positions along the promoter region will yield M.Hha I, and M.FnuDII singly or in combination (see constructs in which the position and number of methylated restriction map in Fig. 1). The methylated constructs were sites can be correlated with the effects ofboth methyl density used to transfect mouse L cells, and promoter activity was and location with respect to the initiation complex assembly determined by measurement of hGH in the culture medium region. As shown in Fig. 2, we have inserted into four different (8). The rate of hGH production has been shown previously locations of the enhancer-containing and enhancerless early to reflect the rate oftranscription ofthe gene (14). The results SV40 promoter a methylatable 51-mer oligonucleotide (for presented in Fig. 1 show that methylation of a single Hpa II sequence and methylatable sites see Fig. 2). Insertions were at site at position -45 had no effect on promoter activity and the HindIII site located (in the enhancerless construct) around that methylation of four Hha I sites had a small inhibitory 100 bp upstream from the TATA box, the Nco I site located effect; however, the combined methylation of the single Hpa 17 bp upstream from the TATA box, the Bgl I site located 17 II site and the four Hha I sites resulted in 78% inhibition. This bp downstream from the TATA box, and the Xba I site located

140 -

120 -

CD 60

c' 40

20 -

0 MLTF TATA r .= I ON 6, I I A A i a a i A A i + C) c ~~~~c+ LL -200 160 +1 x t-12A0 -80 T t-40

x H H F HF H M

FIG. 1. Effect of methylation on the mMTI promoter activity. A construct in which the hGH gene is driven by the mMTI promoter (8) was methylated in vitro by M.Hpa II, M.Hha I, M.FnuDII, or a combination of two or three of these methylases. Mouse L cells were transfected with the methylated and mock-methylated constructs, and hGH was assayed in the cell culture medium 48 hr after transfection. The mMTI promoter region and methylated sites are mapped on the right. Numbers are bp. H, Hha I sites; F, FnuDII sites; and M, Hpa II sites. The region recognized by MLTF (16) is indicated. Downloaded by guest on September 24, 2021 Biochemistry: Levine et al. Proc. NatL. Acad. Sci. USA 89 (1992) 10121

5' CATGACGCGCCGGTACCCGGACTAGTCGCGTCCGGTAGCGCCGGACGCGA 3' 3' TGCGCGGCCATGGGCCTGATCAGCGCAGGCCATCGCGGCCTGCGCTGTACitS I It III 5' F H M M F M H M F

Hindull Ncol Bglt Xba -enhancer -enhancer +enhancer -enhancer +enhancer +enhancer

100

50 -

mock M.Hhal M.FnuDII M.Hpall * M.Hha+M.Fnu+M.Hpa methylated

HindIll :0B' Xb

enhancer pSV2hGH TATA

Hindu' Ncol Bali Xba

PSV hGH

TATA

FIG. 2. Suppressor effect of methyl groups positioned at various locations in the SV40 promoter. A 51-mer synthetic duplex oligonucleotide (sequence and methylatable sites are presented in the upper part of the figure) was inserted into the HindIII, Nco I, Bgl I, and Xba I sites of the SV40 promoter with and without enhancer (see scheme at the lower part of the figure). The promoter was ligated to the structural domains of the hGH gene. The constructs were methylated in vitro by using the bacterial methylases M.FnuDII (F), M.Hha I (H), M.Hpa 11 (M), or a combination of two or three methylases. The methylated and mock-methylated counterpart constructs were transfected into mouse L cells and promoter activity was determined by assaying hGH production in the culture medium; results are presented in percent production relative to mock-methylated. The lower limit of activity of the hGH assay is 0.05 ng/ml.

at the translation initiation site (see scheme at the bottom of To discriminate further between a direct and indirect mech- Fig. 2). The constructs were methylated in vitro with M.Hpa anism we have examined, in an in vitro assay, the effect of II, M.Hha I, M.FnuDII, or a combination of two or three promoter methylation on the binding of purified transcription methylases and then used, in parallel with mock-methylated factors TFIIA and TFEID to the TATA box region (Fig. 3B). constructs, to transfect mouse L cells. Promoter activity was Transcription factors TFHA and TFIID were used in this determined by assaying hGH production as described above. experiment because they occupy the region spanningpositions Hormone levels after transfection with mock-methylated en- -17 to -45 and are the first factors to bind to the promoters hancerless constructs were in the range of 1.3-2.5 ng/ml and to form the preinitiation complex (22). All CpG sites within a with enhancer 12-19 ng/ml. The results presented in Fig. 2 150-bp fragment of the mMTI promoter (Fig. 3A) were meth- show that insertion of the 51-mer at the HindIII or Xba I site ylated by means of the Spiroplasma methylase M.Sss 1 (23), which methylates specifically and completely all CpG sites. caused no inhibition after methylation with M.Hha I, M.Fnu- The experiment showed that methylation of all CpG sites of DII, or M.Hpa II and only minimal inhibition when plurime- the promoter had no effect on the binding of transcription constructs were used. By contrast, insertions of thylated factors to the TATA box region (Fig. 3B), even though four into the enhancerless promoter at methylated oligonucleotides CpG sites are located in the very region that TETID and TFIIA the Nco I and Bgl I sites, which flank the TATA box, resulted occupy (Fig. 3A). To test the effect ofmethylation in the entire in a degree ofinhibition ofpromoter activity that was roughly region occupied by the transcription initiation complex (Fig. correlated with the density of inserted mCpG sites; almost 3A), we have performed an in vitro transcription experiment complete repression of promoter activity was achieved as the using the mMTIhGH plasmid as template; we found no effect result ofinsertion of a 51-mer having multiple methylated sites of M.Sss I methylation on transcription (Fig. 3C). The failure dispersed along its length. The presence of the SV40 strong to show an effect of methylation either on binding of TFIIA enhancer resulted in partial alleviation of the inhibition by and TFIID or on in vitro transcription while the same meth- methylation at the TATA box region, in agreement with earlier ylated promoter is dramatically suppressed in vivo [see ref. 7 observations (9, 20). and experiments described above (Fig. 1)] strongly supports Downloaded by guest on September 24, 2021 10122 Biochemistry: Levine et al. Proc. Natl. Acad. Sci. USA 89 (1992)

n t a t -orl ! Orr. D' > A (a -F cT -TF 4 >-F!I +o ~-o 1-7 #-

-D-^ ----

I i # ; < i --- + I

B C

I 2 3 4 23 M .i F-- 1Il 1 + I Is- 4- _An

FIG. 3. Assay of binding of TFIID and TFIIA to mMTI promoter and in vitro transcription. (A) A 150-bp fragment of the mMTI promoter was prepared by PCR using 17-mer oligonucleotide primers; the fragment represents the region spanning from position -132 to +18 relative to the transcription initiation site. Arrows designate CpG sites methylated by M.Sss I in vitro. The regions occupied by TFIID and TFIIA and by the entire initiation complex (Pol II, RNA polymerase II) are indicated. The fragments were mock-methylated or methylated with M.Sss I, labeled with T4 polynucleotide kinase and [y-32P]ATP, and purified on a Sephadex G-50 column. (B) The binding reaction mixtures contained the 32P-labeled DNA probe (2 x 104 cpm), 1 ,ug (each) ofpurified factors TFIID or TFIIA, 1 ,ug ofpoly(dI-dC)-poly(dI-dC), bovine serum albumin at 300 .tg/ml, 12 mM Hepes at pH 7.9, 4 mM Tris at pH 7.9, 60 mM KCI, 1 mM EDTA, 1 mM dithiothreitol, and 11% (vol/vol) glycerol in a final volume of 15 Al. Samples were incubated for 30 min at room temperature, electrophoresed through a 4% polyacrylamide gel in 0.5x TBE buffer (45 mM Tris borate, pH 8.0/1 mM EDTA), and autoradiographed. Lanes 1, free probe; lanes 2, probe with TFIID + TFIIA (1 pg ofeach); lanes 3, probe with TFIIA alone (1 Ag); lanes 4, with TFIID + TFIIA in the presence of 50-fold excess of unlabeled probe; - lanes, mock-methylated template; + lanes, M.Sss I-methylated template. (C) In vitro transcription was carried out as follows: After preincubation for 40 min at 300C, 1 Ag ofcircular supercoiled template (pmMTIhGH) with HeLa whole cell extract prepared according to Manley et al. (21), 0.25 mM NTPs, and 4 mM creatine phosphate were added to initiate transcription. The transcription reaction was carried out for an additional 40 min at 300C. Transcripts were identified by reverse transcription using as primer the labeled oligonucleotide 5'-GCGCTTACCTGTAGCCAT- TGC-3' taken from the hGH gene sequence. The product of this reaction is a 140-base fusion transcript of mMTI and hGH. Lane 1, mock-methylated; lane 2, M.Hpa II + M.Hha 1-methylated; lane 3, M.Sss I-methylated; lane M, size markers (pBR322 Hpa II fragments). the hypothesis that suppression of promoter activity is medi- methylated or M.Hpa I-methylated constructs. Signifi- ated by a methyl-binding protein. The reported inhibition ofin cantly, however, each labeled cell contained approximately vitro transcription when high extract-to-DNA ratios were used the same number of silver grains. Assuming that the average might be explained by postulating that the binding factors are grain density within a single cell represents activity ofa single competed out by excess of methylated template DNA used in template molecule, it is reasonable to conclude that methyl- the routine in vitro transcription experiments or, alternatively, ation interferes with initiation of transcription rather than that the methyl-binding protein is inactivated or partially lost with the rate of transcription and that a successful preiniti- during cell extract preparation (7). It has been shown that ation will lead to uninterrupted reinitiations. TFIID remains bound to the promoter for multiple rounds of transcription (24); it could be argued, therefore, that once a DISCUSSION preinitiation complex has been formed transcription will take In an attempt to decipher the mechanism by which promoter place repeatedly with normal reinitiations. methylation suppresses transcription we have used a number To test this argument we have transfected Ltk- cells with ofconstructs methylated in vitro as transcription templates in Hpa II-, Hha I-, or FnuDII-methylated herpes simplex virus transient transfection experiments. In vitro methylation of tk gene driven by its own promoter. The tk gene was chosen various sites in the mMTI promoter resulted in various because one of the two CGCG sites (FnuDII) located within degrees of suppression of promoter activity (Fig. 1). Al- the initiation complex formation region can be methylated in though the results suggested a cooperative effect of adjacent vitro by M.Hha I (Fig. 4). We used very low DNA concen- methylated sites, it was impossible to conclude whether the trations that, as described in Materials and Methods, will extent of inhibition is determined primarily by the density of result in approximately a single active transcription complex methylated CpGs rather than by the position of the methyl- per cell (15). Since no Hpa II sites are present in the promoter ated cytosines within the promoter. A more satisfactory region we used cells transfected with the Hpa I-methylated answer to this question was provided by experiments in construct as control for the cells transfected with M.Hha I- which a methylated oligonucleotide was inserted at four or FnuDII-methylated plasmids. The transfected cells were different positions in the SV40 promoter region. Methylated labeled with [3H]thymidine and autoradiographed. As can be oligonucleotides inserted at two sites flanking the TATA box seen in Fig. 4D, many fewer labeled cells were obtained when (Nco I and Bgl I sites, Fig. 2) caused a much greater one or two CpG sites (Hha I or FnuDII) had been methylated suppression of promoter activity than that observed with within the preinitiation complex assembly region as com- constructs in which the methylated oligonucleotide was in- pared with control cells transfected with the mock- serted at the downstream site Xba I (Fig. 2). These results Downloaded by guest on September 24, 2021 Biochemistry: Levine et al. Proc. Natl. Acad. Sci. USA 89 (1992) 10123

A Af B

o# FIG. 4. In situ autoradiography of cells transfected b with the in vitro methylated tk gene from herpes .. simplex virus. Mouse Ltk- cells were transfected with J., '* ,'4 * oh a 100 or 500 ng per plate ofpHSVtk (see physical map at 44 bottom; arrows indicate sites methylated in vitro). %' . %e _a Shown are the results of the 100 ng per plate transfec- D tions. The Hpa I-methylated construct gave the same number of positive cells as obtained with a mock- 4F methylated construct. The numbers of tk+ cells ob- ~~~~~d~ ~ A methylated expressing cells tained with the pHSVtk (methylated with M.Hpa II or site (x1 0-4 M.Hha I) at 500 ng per plate were 7-fold higher in all samples having an extent of inhibition comparable to A. CCGG (HpaIl) 8 0 that for 100 ng per plate. Enlargements oftypical fields B. GCGC (Hhal) 3 0 (x400) show the grain density within the positive cells C. CGCG (FnuDII) 4 (indicated by arrows). The average grain density of positive cells was practically the same in all transfections and equal to the density observed in CHO (tk+) cells that were labeled under the same conditions. Quantitative data of the number of positive cells were

F - u U. :. obtained by counting many fields to score a total of tihe' . -A 10,000 cells. (A) Hpa I-methylated control. (B) M.Hha 1-methylated. (C) M.FnuDII-methylated. (D) Quanti- ., . --..., tative presentation of results. clearly suggest that promoter methylation may affect the promoter activity, also revealed that enhancers affect initi- formation of the preinitiation complex rather than the rate of ation rather than rate of transcription (15). transcription. Once the initiation complex has been formed elongation appears to proceed normally. This conclusion is The in vitro transcription assays of the methylated and nonmeth- ylated mMTI promoter were performed under the guidance of Dr. further supported by an in situ autoradiography experiment Edna Ben-Asher in Prof. YosefAloni's laboratory ofthe Weitzmann in which the number of expressing cells and the extent of Institute of Science (Rehovot, Israel). We are grateful to Drs. Yosef expression were estimated after transfection with an in vitro Aloni, Howard Cedar, Gary Felsenfeld, and Maxine Singer for methylated tk gene (Fig. 4). In this experiment in response to thoughtful reading of the manuscript and to Sara Ivry for preparing promoter methylation we observed a decrease in the number the manuscript. This study was supported by a U.S.-Israel Bina- of expressing cells rather than a diminution of the degree of tional Science Foundation Grant 8500015 and National Institutes of expression per cell, as measured by the intensity of label. Health Grant GM 20483. Apparently, therefore, once the initiation complex is formed 1. Razin, A. & Cedar, H. (1991) Microbiol. Rev. 55, 451-458. it serves multiple initiations giving rise to normal levels oftk 2. Roeder, R. G. (1991) Trends Genet. 16, 402-408. per DNA template. 3. Watt, F. & Molloy, P. L. (1988) Genes Dev. 2, 1136-1143. The discrepancy between the lack of effect of promoter 4. Iguchi-Ariga, S. & Schaffner, W. (1989) Genes Dev. 3, 612-619. methylation on binding of transcription factors or transcrip- 5. Hoelier, M., Westin, G., Jiricny, J. & Schaffner, W. (1988) Genes Dev. 2, 1127-1135. tion in vitro (Fig. 3) and the suppressor effect of promoter 6. Meehan, R. R., Lewis, J. D., McKay, S., Kleiner, E. L. & Bird, methylation on gene activity in vivo (Figs. 1 and 2) suggests A. P. (1989) Cell 58, 499-507. that the mechanism of inhibition must be indirect. This 7. Boyes, J. & Bird, A. (1991) Cell 64, 1123-1134. mechanism postulates the existence of a protein capable of 8. Levine, A., Cantoni, G. L. & Razin, A. (1991) Proc. Nat!. Acad. binding to methyl moieties in the promoter region, thereby Sci. USA 88, 6515-6518. preventing access or binding of transcription factors. Previ- 9. Boyes, J. & Bird, A. (1992) EMBO J. 11, 327-333. 10. Keshet, I., Lieman-Hurwitz, J. & Cedar, H. (1986) Cell4, 535-543. ous studies suggested that meCP1, a protein with such 11. Buschhausen, E., Wittig, B., Graessmann, M. & Graessmann, A. properties (6), may indeed mediate the suppressor effect of (1987) Proc. Nat!. Acad. Sci. USA 84, 1177-1181. methylation at the promoter region (7, 8). 12. Weih, F., Nitsch, D., Reik, A., Schutz, G. & Becker, P. B. (1991) The failure to demonstrate effects of methylation in a EMBO J. 10, 2559-2567. cell-free system can most probably be ascribed to the lack of 13. Lewis, J. & Bird, A. (1991) FEBS Lett. 285, 155-159. or an soluble mediator in the 14. Selden, R. F., Burke Howie, K., Rowe, M. E., Goodman, H. M. & meCPl analogous protein Moore, D. D. (1986) Mol. Cell. Biol. 6, 3173-3179. reconstituted in vitro system. Purified meCP1 is not yet 15. Weintraub, H. (1988) Proc. Nat!. Acad. Sci. USA 85, 5819-5823. available in amounts required for in vitro studies (7, 9), 16. Carthew, R. W., Chodosh, L. A. & Sharp, P. A. (1987) Genes Dev. therefore direct experimental verification ofthe hypothesis is 1, 973-980. not possible at present. 17. Mueller, P. R., Salser, S. J. & Wold, B. (1986) Genes Dev. 2,412-427. The experiments described in this paper support the indi- 18. Fradin, A., Manley, J. L. & Prives, C. L. (1982) Proc. Natd. Acad. Sci. USA 79, 5142-5146. rect mechanism described above. Considering the fact that 19. Murray, E. J. & Grosveld, F. (1987) EMBO J. 6, 2329-2335. once TFIID is bound to the TATA box region it remains 20. Weisshar, B., Langer, K. D., Juettermann, R., Mueller, V., Zock, bound for multiple rounds of transcriptions (24), it stands to C., Klimkait, T. & Doerfler, W. (1988) J. Mol. Biol. 202, 255-270. reason that a mediator protein such as meCPl would compete 21. Manley, J. L., Fire, A., Samuels, M. & Sharp, P. A. (1983) Methods with TFIID for binding when the TATA box region is Enzymol. 101, 568-581. methylated. However, once TFIID is successfully bound no 22. Maldonado, E., Ha, I., Cortes, P., Weis, L. & Reinberg, D. (1991) Mol. Cell. Biol. 10, 6335-6347. inhibition by methylation is expected. This is strongly sup- 23. Renbaum, P., Abrahamove, D., Fainsod, A., Wilson, G., Rottem, ported by the results ofthe experiment described in Fig. 4. It S. & Razin, A. (1990) Nucleic Acids Res. 18, 1145-1152. is interesting to note that a similar experimental approach, 24. Van Dyke, M. W., Roeder, R. G. & Sawadogo, M. (1988) Science which has been designed to analyze the effect ofenhancer on 241, 1335-1338. Downloaded by guest on September 24, 2021