DOCSLIB.ORG

Inhibition of EZH2 Prevents Fibrosis and Restores Normal Angiogenesis in Scleroderma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibition of EZH2 Prevents Fibrosis and Restores Normal Angiogenesis in Scleroderma Inhibition of EZH2 prevents fibrosis and restores normal angiogenesis in scleroderma Pei-Suen Tsoua, Phillip Campbella, M. Asif Amina, Patrick Coita, Shaylynn Millera, David A. Foxa, Dinesh Khannaa,b, and Amr H. Sawalhaa,c,1 aDivision of Rheumatology, Department of Internal Medicine, University of Michigan, Ann Arbor, MI 48109; bScleroderma Program, University of Michigan, Ann Arbor, MI 48109; and cCenter for Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI 48109 Edited by Lawrence Steinman, Stanford University School of Medicine, Stanford, CA, and approved December 20, 2018 (received for review July 30, 2018) Scleroderma (SSc) is a complex disease that involves activation of EGFR and PDGFR pathways through up-regulation of PTEN the immune system, vascular complications, and tissue fibrosis. The (8, 16). In addition, miR-132, MeCP2, and EZH2 operate in histone methyltransferase enhancer of zeste homolog 2 (EZH2) regulatory epigenetic relay pathways that result in transcriptional mediates trimethylation of lysine 27 of histone 3 (H3K27me3), which repression of PPARγ, ultimately leading to stimulation of myofi- acts as a repressive epigenetic mark. Both EZH2 and H3K27me3 were broblast transdifferentiation (17, 19). elevated in SSc dermal fibroblasts and endothelial cells compared In this study, we focused on the involvement of EZH2 in SSc with healthy controls. EZH2 inhibitor DZNep halted fibrosis both in angiogenesis and fibrosis, utilizing dermal ECs and fibroblasts vitro and in vivo. In SSc fibroblasts, DZNep dose-dependently reduced isolated from healthy controls and SSc patients. We first estab- the expression of profibrotic genes and inhibited migratory activity lished the expression profile of EZH2 in both cell types in SSc, of SSc fibroblasts. We show that epigenetic dysregulation and over- then assessed its functional roles in SSc ECs and fibroblasts, as expression of LRRC16A explains EZH2-mediated fibroblast migration well as in vivo in an animal model. Through DNA methylation in SSc. In endothelial cells, inhibition of EZH2 restored normal angio- profiling and literature mining, we were able to identify key genesis in SSc via activating the Notch pathway, specifically by up- regulating the Notch ligand DLL4. Our results demonstrate that genes involved in mediating the fibroblast migratory and anti- overexpression of EZH2 in SSc fibroblasts and endothelial cells is angiogenic effects of EZH2 in SSc, then validate their roles with profibrotic and antiangiogenic. Targeting EZH2 or EZH2-regulated functional assays. MEDICAL SCIENCES genes might be of therapeutic potential in SSc. Materials and Methods Patients. All patients were recruited from the University of Michigan Scleroderma | epigenetics | EZH2 | angiogenesis | fibrosis Scleroderma Program and met the American College of Rheumatology/ European League Against Rheumatism criteria for the classification of SSc (20). ystemic sclerosis (Scleroderma, SSc) is a systemic disease The demographics and clinical characteristics of enrolled patients are sum- Scomprised of blood vascular dysfunction, autoimmunity, and marized in SI Appendix, Table S1. Two 4-mm punch biopsies from the distal excessive fibroblast activation that ultimately results in tissue forearm of healthy volunteers and diffuse or limited cutaneous SSc patients damage and organ failure. The underlying cause of SSc appears were obtained for fibroblast and EC isolation. All subjects included in this to be multifactorial as various cell types and pathways have been study signed a written informed consent. All procedures in this study were implicated. Recent studies have provided strong support for the reviewed and approved by the Institutional Review Board of the University involvement of epigenetic mechanisms in SSc pathogenesis (1–5). of Michigan. Alterations of histone marks, DNA methylation, and noncoding RNAs were observed in immune cells, endothelial cells (ECs), and Cell Culture. Dermal fibroblasts and ECs were isolated as described (3, 21–23). fibroblasts isolated from patients with SSc, pointing to the im- After digestion, ECs were magnetically labeled with anti-CD31 antibodies portance of examining epigenetic regulation in this disease (6). (CD31 MicroBead Kit) and added to LS Columns (Miltenyi Biotech) at- The impact of a histone methyltransferase, the enhancer of tached to MidiMACS Separator. Negatively selected cells, which were fi- broblasts, were cultured in RPMI 1640 with 10% FBS and antibiotics. The zeste homolog 2 (EZH2), in SSc pathogenesis was examined in this study. This enzyme is involved in T cell differentiation, EC- mediated angiogenesis, as well as myofibroblast transformation Significance and tissue fibrosis—essentially all three aspects of SSc patho- genesis (7–9). EZH2 induces histone H3 lysine 27 trimethylation The key epigenetic regulator EZH2 plays a central role in fibrosis (H3K27me3) and is the catalytic component of the highly con- and abnormal angiogenesis in scleroderma. EZH2-target genes served polycomb-repressive complex 2 (PRC2) that represses mediating profibrotic and antiangiogenic effects in scleroderma transcription. However, in certain circumstances, EZH2 activates patients have been identified and characterized. Inhibiting transcription, which is PRC2-independent (10). EZH2 is involved EZH2 by repurposing already-existing EZH2 inhibitors currently in the regulation of EC function, particularly by affecting genes being trialed in cancer might provide a therapeutic approach to associated with cell adhesion (7, 11). In the tumor microenviron- scleroderma. ment, EZH2 is regulated by hypoxia, where EZH2 appears to in- – Author contributions: P.-S.T. and A.H.S. designed research; P.-S.T., P.C., M.A.A., P.C., and duce angiogenesis (12 14). In contrast, other studies showed that S.M. performed research; D.A.F. and D.K. contributed new reagents/analytic tools; P.-S.T., EZH2 silencing or EZH2 inhibitors enhanced migration and an- P.C., M.A.A., P.C., and S.M. analyzed data; A.H.S. conceived the study; and P.-S.T. and giogenesis of ECs (15). In addition, EZH2 inhibitor DZNep in- A.H.S. wrote the paper. creased angiogenesis in ischemic muscles, the circulating levels The authors declare no conflict of interest. of proangiogenic cells, and blood flow recovery in mice (15). EZH2 This article is a PNAS Direct Submission. appears to promote fibrosis. Its expression is increased in patients This open access article is distributed under Creative Commons Attribution-NonCommercial- with idiopathic pulmonary fibrosis and chronic kidney disease (8, NoDerivatives License 4.0 (CC BY-NC-ND). 16), as well as in animal models including bleomycin-induced lung 1To whom correspondence should be addressed. Email: [email protected]. fibrosis, carbon tetrachloride liver fibrosis, and unilateral ureteral This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. obstruction kidney fibrosis (8, 16–18). Inhibition of EZH2 reduces 1073/pnas.1813006116/-/DCSupplemental. TGFβ-Smad signaling pathways and suppresses activation of the Published online February 12, 2019. www.pnas.org/cgi/doi/10.1073/pnas.1813006116 PNAS | February 26, 2019 | vol. 116 | no. 9 | 3695–3702 Downloaded by guest on September 25, 2021 + positively selected CD31 ECs were grown in EBM-2 media with growth factors Bleomycin Skin Fibrosis Model. A bleomycin-induced skin fibrosis model was (Lonza). Cells between passages 3 and 6 were used in the experiments. used similar to what was described (26, 27). Fifteen-week-old C57BL/6 mice (Jackson Laboratory) were preconditioned on supplemental DietGel 76A mRNA Extraction and qRT-PCR. Total RNA was isolated using Direct-zol RNA (ClearH2O) for 2 wk before starting the experiment. Skin fibrosis was in- MiniPrep Kit (Zymo Research), followed by preparation of cDNA using the duced by intracutaneous injection of 100 μL of bleomycin (0.5 mg/mL) in PBS, 2 Verso cDNA synthesis kit (Thermo Scientific). Primers along with Power SYBR every day for 2 wk in a defined area (∼1cm) on the upper back. In- μ Green PCR master mix (Applied Biosystems) were used for qPCR run by the tracutaneous injection of 100 L of PBS was used as control. One group of ViiA 7 Real-Time PCR System. Primer sequences are as follows: VEGF FW: mice received injections of PBS, and the other two were challenged with ATGAACTTTCTGCTGTCTTGGGT; RV: TGGCCTTGGTGAGGTTTGATCC; TGFB1 FW: bleomycin. Daily oral administration of DZNep (2 mg/kg in 20% DMSO/50% TTGCTTCAGCTCCACAGAGA; RV: GTTGGACAACTGCTCCACCT; DNMT1 FW: CG- PEG 400/30% PBS) was initiated together with the first challenge of bleo- ACTACATCAAAGGCAGCAACCTG; RV: TGGAGTGGACTTGTGGGTGTTCTC; DNMT3A: mycin and continued for 2 wk. Vehicle control consisting of 20% DMSO/50% PEG 400/30% PBS was used. Oral gavage was performed by the Unit for FW: CGAGTCCAACCCTGTGATGATTG; RV: CGTGGTCTTTGCCCTGCTTTATG; NOTCH1 Laboratory Animal Medicine’s In-Vivo Animal Core. In a separate study, daily FW: TCCACCAGTTTGAATGGTCA; RV: AGCTCATCATCTGGGACAGG; NOTCH4 i.p. administration of GSK126 (0.5 mg/kg or 5 mg/kg in 20% DMSO/50% PEG FW: AACTCCTCCCCAGGAATCTG; RV: CCTCCATCCAGCAGAGGTT; JAG2 FW: 400/30% PBS) or vehicle control (20% DMSO/50% PEG 400/30% PBS) was GGTCGTACTTGCACTCACAATACC; RV: GTAGCAAGGCAGAGGGTTGC; NUMB FW: used in the bleomycin fibrosis model described above. Mice were killed by AGCGCAAGCAGAAGCGGGAG; RV: CGGCGTGGGA-TGGCATGAGG; FBXW7 FW: GG- CO inhalation, and the skin from the defined area was harvested at the end CGCCGCGGCTCTTTTCTA; RV: GCTGCCCACAGAGAGCAGTTCC;
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • Dna Methylation Post Transcriptional Modification
    Dna Methylation Post Transcriptional Modification Blistery Benny backbiting her tug-of-war so protectively that Scot barrel very weekends. Solanaceous and unpossessing Eric pubes her creatorships abrogating while Raymundo bereave some limitations demonstrably. Clair compresses his catchings getter epexegetically or epidemically after Bernie vitriols and piffling unchangeably, hypognathous and nourishing. To explore quantitative and dynamic properties of transcriptional regulation by. MeSH Cochrane Library. In revere last check of man series but left house with various gene expression profile of the effect of. Moreover interpretation of transcriptional changes during COVID-19 has been. In transcriptional modification by post transcriptional repression and posted by selective breeding industry: patterns of dna methylation during gc cells and the study of dna. DNA methylation regulates transcriptional homeostasis of. Be local in two ways Post Translational Modifications of amino acid residues of histone. International journal of cyclic gmp in a chromatin dynamics: unexpected results in alternative splicing of reusing and diagnosis of dmrs has been identified using whole process. Dam in dna methylation to violent outbursts that have originated anywhere in england and post transcriptional gene is regulated at the content in dna methylation post transcriptional modification of. A seven sample which customers post being the dtc company for analysis. Fei zhao y, methylation dynamics and modifications on lysine is an essential that. Tag-based our Generation Sequencing. DNA methylation and histone modifications as epigenetic. Thc content of. Lysine methylation has been involved in both transcriptional activation H3K4. For instance aberrance of DNA methylation andor demethylation has been. Chromosome conformation capture from 3C to 5C and will ChIP-based modification.
    [Show full text]
  • DNA Methylation, Imprinting and Cancer
    European Journal of Human Genetics (2002) 10, 6±16 ã 2002 Nature Publishing Group All rights reserved 1018-4813/02 $25.00 www.nature.com/ejhg REVIEW DNA methylation, imprinting and cancer Christoph Plass*,1 and Paul D Soloway*,2 1Division of Human Cancer Genetics and the Comprehensive Cancer Center, The Ohio State University, Columbus, Ohio, OH 43210, USA; 2Department of Molecular and Cellular Biology, Roswell Park Cancer Institute, Buffalo, New York, NY 14263, USA It is well known that a variety of genetic changes influence the development and progression of cancer. These changes may result from inherited or spontaneous mutations that are not corrected by repair mechanisms prior to DNA replication. It is increasingly clear that so called epigenetic effects that do not affect the primary sequence of the genome also play an important role in tumorigenesis. This was supported initially by observations that cancer genomes undergo changes in their methylation state and that control of parental allele-specific methylation and expression of imprinted loci is lost in several cancers. Many loci acquiring aberrant methylation in cancers have since been identified and shown to be silenced by DNA methylation. In many cases, this mechanism of silencing inactivates tumour suppressors as effectively as frank mutation and is one of the cancer-predisposing hits described in Knudson's two hit hypothesis. In contrast to mutations which are essentially irreversible, methylation changes are reversible, raising the possibility of developing therapeutics based on restoring the normal methylation state to cancer-associated genes. Development of such therapeutics will require identifying loci undergoing methylation changes in cancer, understanding how their methylation influences tumorigenesis and identifying the mechanisms regulating the methylation state of the genome.
    [Show full text]
  • Human Catechol O-Methyltransferase Genetic Variation
    Molecular Psychiatry (2004) 9, 151–160 & 2004 Nature Publishing Group All rights reserved 1359-4184/04 $25.00 www.nature.com/mp ORIGINAL RESEARCH ARTICLE Human catechol O-methyltransferase genetic variation: gene resequencing and functional characterization of variant allozymes AJ Shield1, BA Thomae1, BW Eckloff2, ED Wieben2 and RM Weinshilboum1 1Department of Molecular Pharmacology and Experimental Therapeutics, Mayo Medical School, Mayo Clinic, Mayo Foundation, Rochester, MN, USA; 2Department of Biochemistry and Molecular Biology, Mayo Medical School, Mayo Clinic, Mayo Foundation, Rochester, MN, USA Catechol O-methyltransferase (COMT) plays an important role in the metabolism of catecholamines, catecholestrogens and catechol drugs. A common COMT G472A genetic polymorphism (Val108/158Met) that was identified previously is associated with decreased levels of enzyme activity and has been implicated as a possible risk factor for neuropsychiatric disease. We set out to ‘resequence’ the human COMT gene using DNA samples from 60 African-American and 60 Caucasian-American subjects. A total of 23 single nucleotide polymorphisms (SNPs), including a novel nonsynonymous cSNP present only in DNA from African-American subjects, and one insertion/deletion were observed. The wild type (WT) and two variant allozymes, Thr52 and Met108, were transiently expressed in COS-1 and HEK293 cells. There was no significant change in level of COMT activity for the Thr52 variant allozyme, but there was a 40% decrease in the level of activity in cells transfected with the Met108 construct. Apparent Km values of the WT and variant allozymes for the two reaction cosubstrates differed slightly, but significantly, for 3,4-dihydroxybenzoic acid but not for S-adenosyl-L-methionine.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Histone Methylases As Novel Drug Targets. Focus on EZH2 Inhibition. Catherine BAUGE1,2,#, Céline BAZILLE 1,2,3, Nicolas GIRARD1
    Histone methylases as novel drug targets. Focus on EZH2 inhibition. Catherine BAUGE1,2,#, Céline BAZILLE1,2,3, Nicolas GIRARD1,2, Eva LHUISSIER1,2, Karim BOUMEDIENE1,2 1 Normandie Univ, France 2 UNICAEN, EA4652 MILPAT, Caen, France 3 Service d’Anatomie Pathologique, CHU, Caen, France # Correspondence and copy request: Catherine Baugé, [email protected], EA4652 MILPAT, UFR de médecine, Université de Caen Basse-Normandie, CS14032 Caen cedex 5, France; tel: +33 231068218; fax: +33 231068224 1 ABSTRACT Posttranslational modifications of histones (so-called epigenetic modifications) play a major role in transcriptional control and normal development, and are tightly regulated. Disruption of their control is a frequent event in disease. Particularly, the methylation of lysine 27 on histone H3 (H3K27), induced by the methylase Enhancer of Zeste homolog 2 (EZH2), emerges as a key control of gene expression, and a major regulator of cell physiology. The identification of driver mutations in EZH2 has already led to new prognostic and therapeutic advances, and new classes of potent and specific inhibitors for EZH2 show promising results in preclinical trials. This review examines roles of histone lysine methylases and demetylases in cells, and focuses on the recent knowledge and developments about EZH2. Key-terms: epigenetic, histone methylation, EZH2, cancerology, tumors, apoptosis, cell death, inhibitor, stem cells, H3K27 2 Histone modifications and histone code Epigenetic has been defined as inheritable changes in gene expression that occur without a change in DNA sequence. Key components of epigenetic processes are DNA methylation, histone modifications and variants, non-histone chromatin proteins, small interfering RNA (siRNA) and micro RNA (miRNA).
    [Show full text]
  • Functional Implications of DNA Methylation in Adipose Biology
    Diabetes Volume 68, May 2019 871 Functional Implications of DNA Methylation in Adipose Biology Xiang Ma and Sona Kang Diabetes 2019;68:871–878 | https://doi.org/10.2337/dbi18-0057 The twin epidemics of obesity and type 2 diabetes (T2D) variants have not been tested for causality, and even if are a serious health, social, and economic issue. The proven causal, they cannot fully explain many clinical dysregulation of adipose tissue biology is central to the features such as high heritability, high discordance in adult development of these two metabolic disorders, as adi- monozygotic twins, and the close relationship with envi- pose tissue plays a pivotal role in regulating whole-body ronmental factors (2–5). Therefore, it has long been metabolism and energy homeostasis (1). Accumulating speculated that nongenetic variation, such as epigenetic evidence indicates that multiple aspects of adipose bi- alterations, plays a role in pathogenesis. This notion has PERSPECTIVES IN DIABETES ology are regulated, in part, by epigenetic mechanisms. been borne out by a recent epigenome-wide association The precise and comprehensive understanding of the study that linked alterations in DNA methylation to whole- epigenetic control of adipose tissue biology is crucial to body insulin sensitivity (6). identifying novel therapeutic interventions that target DNA methylation is a reversible epigenetic mark in- epigenetic issues. Here, we review the recent findings volving the covalent transfer of a methyl group to the C-5 on DNA methylation events and machinery in regulating the developmental processes and metabolic function of position of a cytosine residue by DNA methyltransferases adipocytes. We highlight the following points: 1) DNA (DNMTs), usually in the context of a cytosine-guanine methylation is a key epigenetic regulator of adipose dinucleotide (CpG) doublet.
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Histone Deacetylase Inhibitors Synergizes with Catalytic Inhibitors of EZH2 to Exhibit Anti-Tumor Activity in Small Cell Carcinoma of the Ovary, Hypercalcemic Type
    Author Manuscript Published OnlineFirst on September 19, 2018; DOI: 10.1158/1535-7163.MCT-18-0348 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Histone deacetylase inhibitors synergizes with catalytic inhibitors of EZH2 to exhibit anti- tumor activity in small cell carcinoma of the ovary, hypercalcemic type Yemin Wang1,2,*, Shary Yuting Chen1,2, Shane Colborne3, Galen Lambert2, Chae Young Shin2, Nancy Dos Santos4, Krystal A. Orlando5, Jessica D. Lang6, William P.D. Hendricks6, Marcel B. Bally4, Anthony N. Karnezis1,2, Ralf Hass7, T. Michael Underhill8, Gregg B. Morin3,9, Jeffrey M. Trent6, Bernard E. Weissman5, David G. Huntsman1,2,10,* 1Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, BC, Canada 2Department of Molecular Oncology, British Columbia Cancer Research Centre, Vancouver, BC, Canada. 3Michael Smith Genome Science Centre, British Columbia Cancer Agency, Vancouver, BC, Canada. 4Department of Experimental Therapeutics, British Columbia Cancer Research Centre, Vancouver, BC, Canada. 5Department of Pathology and Laboratory Medicine and Lineberger Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC, USA. 6Division of Integrated Cancer Genomics, Translational Genomics Research Institute (TGen), Phoenix, AZ, USA. 7Department of Obstetrics and Gynecology, Hannover Medical School, D-30625 Hannover, Germany. 8Department of Cellular and Physiological Sciences and Biomedical Research Centre, University 1 Downloaded from mct.aacrjournals.org on September 26, 2021. © 2018 American Association for Cancer Research. Author Manuscript Published OnlineFirst on September 19, 2018; DOI: 10.1158/1535-7163.MCT-18-0348 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
    [Show full text]
  • EZH2 in Normal Hematopoiesis and Hematological Malignancies
    www.impactjournals.com/oncotarget/ Oncotarget, Vol. 7, No. 3 EZH2 in normal hematopoiesis and hematological malignancies Laurie Herviou2, Giacomo Cavalli2, Guillaume Cartron3,4, Bernard Klein1,2,3 and Jérôme Moreaux1,2,3 1 Department of Biological Hematology, CHU Montpellier, Montpellier, France 2 Institute of Human Genetics, CNRS UPR1142, Montpellier, France 3 University of Montpellier 1, UFR de Médecine, Montpellier, France 4 Department of Clinical Hematology, CHU Montpellier, Montpellier, France Correspondence to: Jérôme Moreaux, email: [email protected] Keywords: hematological malignancies, EZH2, Polycomb complex, therapeutic target Received: August 07, 2015 Accepted: October 14, 2015 Published: October 20, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Enhancer of zeste homolog 2 (EZH2), the catalytic subunit of the Polycomb repressive complex 2, inhibits gene expression through methylation on lysine 27 of histone H3. EZH2 regulates normal hematopoietic stem cell self-renewal and differentiation. EZH2 also controls normal B cell differentiation. EZH2 deregulation has been described in many cancer types including hematological malignancies. Specific small molecules have been recently developed to exploit the oncogenic addiction of tumor cells to EZH2. Their therapeutic potential is currently under evaluation. This review summarizes the roles of EZH2 in normal and pathologic hematological processes and recent advances in the development of EZH2 inhibitors for the personalized treatment of patients with hematological malignancies. PHYSIOLOGICAL FUNCTIONS OF EZH2 state through tri-methylation of lysine 27 on histone H3 (H3K27me3) [6].
    [Show full text]
  • Cpg Islands and the Regulation of Transcription
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW CpG islands and the regulation of transcription Aime´e M. Deaton and Adrian Bird1 The Wellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR, United Kingdom Vertebrate CpG islands (CGIs) are short interspersed DNA In spite of their link with transcription, the functional sequences that deviate significantly from the average significance of CGIs is only just beginning to emerge. CGI genomic pattern by being GC-rich, CpG-rich, and pre- promoters turn out to have distinctive patterns of tran- dominantly nonmethylated. Most, perhaps all, CGIs are scription initiation and chromatin configuration. Their sites of transcription initiation, including thousands that regulation involves proteins (some of which specifically are remote from currently annotated promoters. Shared bind nonmethylated CpG) that influence the modifica- DNA sequence features adapt CGIs for promoter function tion status of CGI chromatin. In addition, the CpG moieties by destabilizing nucleosomes and attracting proteins that themselves are sometimes subject to cytosine methylation, create a transcriptionally permissive chromatin state. which correlates with stable shutdown of the associated Silencing of CGI promoters is achieved through dense promoter. Here we examine the properties shared by ver- CpG methylation or polycomb recruitment, again using tebrate CGIs and how transcription is regulated at these their distinctive DNA sequence composition. CGIs are sites. Recent related reviews include Illingworth and Bird therefore generically equipped to influence local chroma- (2009), Mohn and Schubeler (2009), and Blackledge and tin structure and simplify regulation of gene activity. Klose (2011). Vertebrate genomes are methylated predominantly at the Evolutionary conservation of CGIs dinucleotide CpG, and consequently are CpG-deficient owing to the mutagenic properties of methylcytosine CGIs are distinct in vertebrates due to their lack of DNA (Coulondre et al.
    [Show full text]
  • Dynamics and Function of DNA Methylation in Plants
    REVIEWS Dynamics and function of DNA methylation in plants Huiming Zhang1,2*, Zhaobo Lang1,2 and Jian- Kang Zhu 1,2,3* Abstract | DNA methylation is a conserved epigenetic modification that is important for gene regulation and genome stability. Aberrant patterns of DNA methylation can lead to plant developmental abnormalities. A specific DNA methylation state is an outcome of dynamic regulation by de novo methylation, maintenance of methylation and active demethylation, which are catalysed by various enzymes that are targeted by distinct regulatory pathways. In this Review, we discuss DNA methylation in plants, including methylating and demethylating enzymes and regulatory factors, and the coordination of methylation and demethylation activities by a so- called methylstat mechanism; the functions of DNA methylation in regulating transposon silencing, gene expression and chromosome interactions; the roles of DNA methylation in plant development; and the involvement of DNA methylation in plant responses to biotic and abiotic stress conditions. DNA methylation at the 5ʹ position of cytosine contrib- and regulatory factors are generally not lethal. However, utes to the epigenetic regulation of nuclear gene expres- DNA methylation appears to be more crucial for devel- sion and to genome stability1,2. Epigenetic changes, opment and environmental- stress responses in plants including DNA methylation, histone modifications and that have more complex genomes. Recent findings histone variants and some non- coding RNA (ncRNA) have uncovered important
    [Show full text]