DOCSLIB.ORG

Organic Chemistry Option II: Chemical Biology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Organic Chemistry Option II: Chemical Biology Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Organic Chemistry Option II: Chemical Biology Dr Stuart Conway Department of Chemistry, Chemistry Research Laboratory, University of Oxford email: [email protected] Teaching webpage (to download hand-outs): http://conway.chem.ox.ac.uk/Teaching.html Recommended books: Biochemistry 4th Edition by Voet and Voet, published by Wiley, ISBN: 978-0-470-57095-1. Foundations of Chemical Biology by Dobson, Gerrard and Pratt, published by OUP (primer) ISBN: 0-19-924899-0 1 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford RNA synthesis: Transcription slide 39 • • It catalyses the DNA-directed coupling of nucleotide triphosphates to synthesise new RNA. • The newly synthesised RNA is complementary to the template DNA. Transcription slide 40 • • Hence, the incoming nucleotide is added to the free 3’-OH of the growing RNA chain. • RNA polymerase selects the nucleotide it incorporates into the growing RNA chain based on the requirement that it forms a Watson-Crick base pair with the DNA strand that is being transcribed (the template strand - only one strand of DNA is transcribed at a time). • The RNA polymerase moves along the DNA duplex that it is transcribing and separates a short (~14 base pairs) segment of the DNA helix to form a transcription bubble. • • The DNA-RNA hybrid helix consists of antiparallel strands, hence the DNA’s template strand is read in its 3’→5’ direction. 2 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford RNA polymerase slide 41 • • The outer surface of the protein is almost uniformly negatively charges, whereas the surfaces that interact with nucleic acids are positively charged. • The DNA occupies the main channel, which directs the template strand to the active site. • There the DNA base-pairs with the incoming nucleotide triphosphate (not in structure). Translation slide 42 • • Although the formation of a peptide bond is relatively simple, the translational process in highly complicated. • This complexity arises from the need to link 20 different amino acids residues accurately in the order specified by a particular mRNA. • • As the base sequence of DNA is the only variable element in this otherwise monotonously repeating polymer, the base sequence and the protein sequence must be linked. 3 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Translation slide 43 “The problem of how a sequence of four things can determine a sequence of twenty things is known as the coding problem.” Translation slide 44 • With only 4 bases in DNA to code for 20 amino acids, a group of several bases (a codon) is necessary to specify a single amino acid. • • A doublet code would only allow 42 = 16 codons, which is insufficient to specify 20 amino acids. • In a triplet code as many as 44 codons might not code for amino acids. • Alternatively, some amino acids might be specified by more than one codon - a degenerate code. 4 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford The genetic code slide 45 • How is DNA’s continuous sequence grouped into codons? • Is the code overlapping? E.g. ABC codes for the first amino acids and BDC codes for the second etc. The genetic code slide 46 • Or is the code non-overlapping? • E.g. ABC specifies the first amino acid and DEF the second etc. The genetic code slide 47 • • The genetic code is highly degenerate: Three amino acids (L, R, S) are each specified by six codons. • Only Met and Trp, two of the least common amino acids in proteins, are specified by a single codon. 5 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford The genetic code slide 48 • Sydney Brenner and Francis Crick formed the following hypotheses on the genetic code: 1. The code is a triplet code. 2. The code is read in a sequential manner starting from a fixed point in the gene. The insertion or deletion of a nucleotide shifts the frame (grouping) in which in which the succeeding nucleotides are read as codons. Thus the code has no internal punctuation that indicates the reading frame - the code is comma free. 3. The genetic code slide 49 • The sentence represents a gene in which the words (codons) each contain three letters (bases). • The spaces have no physical significance; they only present to indicate the reading frame. • The deletion of the fourth letter (B) shifts the reading frame so that all of the words after the deletion are meaningless - specify the wrong amino acids. The genetic code slide 50 • Insertion of a letter (X) passed the point of the original mutation restores the original reading frame. • Hence on the words (codons) between the two changes (mutations) are altered. • Therefore the sentence may still be intelligible (the gene could still specify a functional protein), particularly if the changes are close together. 6 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford The genetic code slide 51 • The major breakthrough in deciphering the genetic code came in 1961 when Nirenberg and Matthaei established that UUU is the codon specifying Phe. • They added poly(U) to a cell-free protein synthesising system and showed that this stimulated synthesis of only poly(Phe). • In similar experiments, poly(A) was shown to specify poly(Lys) and poly(C) was found to specify poly(Pro). • • These stop codons are also known (somewhat inappropriately) as nonsense codons as they are the only codons that do not specify amino acids. • UAG, UAA and UGA are sometimes referred to as ambre, ochre and opal codons. • • These codons also specify amino acids, Met and Val, respectively. • The arrangement of the genetic code is not random. • Most synonyms (codons that only differ in their third nucleotide) occupy the same box in the table. • XYU and XYC always specify the same amino acids; XYA and XYG do so in all by two cases. • Changes in the first codon position tend to specify the same or similar amino acids. • Codons with second position pyrimidines (C AND U) tend to specify hydrophobic amino acids. • Codons with second position purines (A and G) encode mostly polar amino acids. • 7 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford The genetic code slide 52 • How does the information in DNA actually translate into polypeptide sequences? • In 1955 Francis Crick proposed the adaptor hypothesis stating that translation occurs through the mediation of adaptor molecules. • • Each adaptor was postulated to carry a specific amino acid and to recognise the corresponding codon. • At a similar time it was shown that in the course of protein synthesis 14C labelled amino acids become bound to low molecular mass fractions of RNA. • Translation slide 53 • All tRNAs contain: • A 5’-terminal phosphate. • A 7-base pair step that includes the 5’- terminal nucleotide and may include non-Watson-Crick base pairs, such as G ⋅ U. This assembly is known as the acceptor stem as the amino acid is appended to the 3’-OH group. • A 3- or 4-base stem ending in a loop that that frequently contains the modified base dihydrouridine (D), known as the D arm. • A 5-base-pair stem ending in a loop that usually contains the sequence TΨC (Ψ = pseudouridine). • All tRNAs terminate in the sequence CCA, with a free 3’-OH group. • There are 15 invariant positions and 8 semi-invariant (only a purine or only a pyrimidine) positions. 8 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Modified nucleotides that occur in tRNA slide 54 Phe The structure of yeast tRNA slide 55 9 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Synthesis of tRNA slide 56 • • This mixed anhydride then reacts with tRNA to form aminoacyl-tRNA and AMP. Ribosome slide 57 • For translation to occur, mRNA and tRNA must bind to each other, and the amino acids carried by the tRNA must react to form the polypetide chain. • • • Elucidating the molecular structure of the ribosome has been extremely challenging. 10 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Ribosome slide 59 11 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Translation slide 60 Translation slide 61 12 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Translation slide 62 • The ribosomal peptidyl transfer reaction occurs ~107-fold faster than the uncatalysed reaction. • Translation slide 63 • • The ribosome may also play a role in excluding water from the preorganised electrostatic environment of the active site. 13 Dr Stuart Conway Organic Option II: Chemical Biology University of Oxford Translation slide 64 • 14 .
Load more

Recommended publications
  • Braking the Genetic Code by Nierenberg
    1 REVIEW The Invention of Proteomic Code and mRNA Assisted Protein Folding. by Jan C. Biro Homulus Foundation, 612 S Flower St. #1220, 90017 CA, USA. [email protected] Keywords: Gene, code, codon, translation, wobble-base, Abbreviations (excluding standard abbreviations: 2 Abstract Background The theoretical requirements for a genetic code were well defined and modeled by George Gamow and Francis Crick in the 50-es. Their models failed. However the valid Genetic Code, provided by Nirenberg and Matthaei in 1961, ignores many theoretical requirements for a perfect Code. Something is simply missing from the canonical Code. Results The 3x redundancy of the Genetic code is usually explained as a necessity to increase the resistance of the mutation resistance of the genetic information. However it has many additional roles. 1.) It has a periodical structure which corresponds to the physico-chemical and structural properties of amino acids. 2.) It provides physico-chemical definition of codon boundaries. 3.) It defines a code for amino acid co-locations (interactions) in the coded proteins. 4.) It regulates, through wobble bases the free folding energy (and structure) of mRNAs. I shortly review the history of the Genetic Code as well as my own published observations to provide a novel, original explanation of its redundancy. Conclusions The redundant Genetic Code contains biological information which is additional to the 64/20 definition of amino acids. This additional information is used to define the 3D structure of coding nucleic acids as well as the coded proteins and it is called the Proteomic Code and mRNA Assisted Protein Folding.
    [Show full text]
  • Chem 431C-Lecture 8A Central Dogma of Molecular Biology Proteins
    Chem 431c-Lecture 8a Reminder: Wednesday is Test 2 Day Covers Chapters 25 and 26 in toto. 90 points Translation: mRNA directed 6 discussion questions. 15 points each. Work protein synthesis quickly and concisely. Answer the question asked. Some students answer more than is asked. Penalty will be levied. Chapter 27: Will the test be difficult? For some, Yes. Protein Metabolism Study major concepts. Sample Question: Describe Mismatch Repair giving unique enzymes involved and describing when it is used. Copyright © 2004 by W. H. Freeman & Company Central dogma of molecular Proteins biology Typical cell needs 1000’s of proteins. • Proteins =the Protein biosynthesis elucidation-one of greatest endproducts of the challenges in biochemistry; information There are >70 ribosomal proteins; 90% of chem pathways energy used by cell; 15,000 ribosomes; 100,000 molecules of protein factors and enzymes; 200,000 tRNA molecules, Process is complex yet fast: protein of 100 aa’s/5 sec in E.coli. Ribosomes line the endoplasmic reticulum Genetic Code -nucleotide triplet codon/amino acid -non overlapping (overlap would be limiting) -first 2 letters usu. fixed but 3rd may be variable -degenerate: more than 1 codon/amino acid - reading frame determined by initiation codon – AUG; termination codons are UAA, UAG and UGA 1 Crick’s adaptor hypothesis Triplet non-overlapping code Just like assembling a Lego molecule? How many possible unique triplet codons can you have? Reading Frame in genetic code Open reading frame (ORF) In a random sequence of nucleotides, probability of 1/ 20 codons in each reading frame is a termination codon. So if it doesn’t have a termination codon among 50 or more, it’s an “open reading frame”(ORF).
    [Show full text]
  • Structure and Function of the Ribosome
    7 OCTOBER 2009 Scientifc Background on the Nobel Prize in Chemistry 2009 STRUCTURE AND FUNCTION OF THE RIBOSOME THE ROYAL SWEDISH ACADEMY OF SCIENCES has as its aim to promote the sciences and strengthen their infuence in society. BOX 50005 (LILLA FRESCATIVÄGEN 4 A), SE-104 05 STOCKHOLM, SWEDEN Nobel Prize® and the Nobel Prize® medal design mark TEL +46 8 673 95 00, FAX +46 8 15 56 70, [email protected] HTTP://KVA.SE are registrated trademarks of the Nobel Foundation Structure and function of the ribosome This year’s Nobel Prize in Chemistry is awarded to Venkatraman Ramakrishnan, Thomas A. Steitz and Ada E. Yonath for their studies of the structure and function of the ribosome. Their scientific contributions and the historical context are summarized below. Brief introduction to the ribosome The ribosome and the central dogma. The genetic information in living systems is stored in the genome sequences of their DNA (deoxyribonucleic acid). A large part of these sequences encode proteins which carry out most of the functional tasks in all extant organisms. The DNA information is made available by transcription of the genes to mRNAs (messenger ribonucleic acids) that subsequently are translated into the various amino acid sequences of all the proteins of an organism. This is the central dogma (Crick, 1970) of molecular biology in its simplest form (Figure 1) DNA () gene →transcription RNA ( mRNA )→translation Protein ( peptide sequence) Figure 1. The central dogma revisited. The genetic information in DNA is preserved by replication of the genome (Watson and Crick, 1953a, b) carried out by DNA polymerase (Kornberg, 1969) so that each daughter cell can receive one genome copy at every cell division.
    [Show full text]
  • Ribonucleobase Interactions and Their Potential for Ribosome-Free Encoding
    www.nature.com/scientificreports OPEN Cross-species conservation of complementary amino acid- ribonucleobase interactions and Received: 31 March 2015 Accepted: 02 November 2015 their potential for ribosome-free Published: 10 December 2015 encoding John G. D. Cannon1, Rachel M. Sherman2,3, Victoria M. Y. Wang4,† & Grace A. Newman5 The role of amino acid-RNA nucleobase interactions in the evolution of RNA translation and protein- mRNA autoregulation remains an open area of research. We describe the inference of pairwise amino acid-RNA nucleobase interaction preferences using structural data from known RNA- protein complexes. We observed significant matching between an amino acid’s nucleobase affinity and corresponding codon content in both the standard genetic code and mitochondrial variants. Furthermore, we showed that knowledge of nucleobase preferences allows statistically significant prediction of protein primary sequence from mRNA using purely physiochemical information. Interestingly, ribosomal primary sequences were more accurately predicted than non-ribosomal sequences, suggesting a potential role for direct amino acid-nucleobase interactions in the genesis of amino acid-based ribosomal components. Finally, we observed matching between amino acid- nucleobase affinities and corresponding mRNA sequences in 35 evolutionarily diverse proteomes. We believe these results have important implications for the study of the evolutionary origins of the genetic code and protein-mRNA cross-regulation. Despite having been discovered more than 50 years ago1,2 and studied for nearly as long3, the evolutionary basis of the universal genetic code remains an elusive challenge4. Even before the discovery of messenger RNA (mRNA) and the elucidation of the genetic code George Gamow proposed a stereochemical hypothesis based on the then recently determined structure of DNA5.
    [Show full text]
  • Francis Crick, James Watson
    Francis Crick and James Watson: And the Building Blocks of Life Edward Edelson Oxford University Press Francis Crick and James Watson And the Building Blocks of Life Image Not Available XFORD PORTRAITS INSCIENCE Owen Gingerich General Editor Francis Crick and James Watson And the Building Blocks of Life Edward Edelson Oxford University Press New York • Oxford Fondly dedicated to Hannah, the newest member of the family. Oxford University Press Oxford New York Athens Auckland Bangkok Bogotá Bombay Buenos Aires Calcutta Cape Town Dar es Salaam Delhi Florence Hong Kong Istanbul Karachi Kuala Lumpur Madras Madrid Melbourne Mexico City Nairobi Paris Singapore Taipei Tokyo Toronto Warsaw and associated companies in Berlin Ibadan Copyright © 1998 by Edward Edelson Published by Oxford University Press, Inc., 198 Madison Avenue, New York, New York 10016 Oxford is a registered trademark of Oxford University Press All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise, without the prior permission of Oxford University Press. Design: Design Oasis Layout: Leonard Levitsky Picture research: Lisa Kirchner Library of Congress Cataloging-in-Publication Data Edelson, Edward James Watson and Francis Crick and the building blocks of life / Edward Edelson. p. c. — (Oxford portraits in science) Includes bibliographical references and index. ISBN 0-19-511451-5 (library edition) 1. Watson, James D., 1928– —Juvenile literature. 2. Crick, Francis, 1916– —Juvenile literature. 3. DNA—Research—Juvenile literature. 4. Molecular biolo- gists—Biography—Juvenile literature. [1.Watson, James D., 1928– . 2. Crick, Francis, 1916– .
    [Show full text]
  • On the Uniqueness of the Standard Genetic Code
    life Article On the Uniqueness of the Standard Genetic Code Gabriel S. Zamudio and Marco V. José * Theoretical Biology Group, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, México D.F. 04510, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +52-5562-3894 Academic Editor: Koji Tamura Received: 15 December 2016; Accepted: 8 February 2017; Published: 13 February 2017 Abstract: In this work, we determine the biological and mathematical properties that are sufficient and necessary to uniquely determine both the primeval RNY (purine-any base-pyrimidine) code and the standard genetic code (SGC). These properties are: the evolution of the SGC from the RNY code; the degeneracy of both codes, and the non-degeneracy of the assignments of aminoacyl-tRNA synthetases (aaRSs) to amino acids; the wobbling property; the consideration that glycine was the first amino acid; the topological and symmetrical properties of both codes. Keywords: RNY code; Standard genetic code; evolution of the genetic code; frozen code; degeneracy; aminoacyl-tRNA synthetases; symmetry 1. Introduction A fundamental feature of all life forms existing on Earth is that, with several minor exceptions, they share the same standard genetic code (SGC). This universality led Francis Crick to propose the frozen accident hypothesis [1], i.e., the SGC does not change. According to Crick [1], the SGC code remained universal because any change would be lethal, or would have been very strongly selected against and extinguished. The astonishing diversity of living beings in the history of the biosphere has not been halted by a frozen SGC. The inherent structure of the frozen SGC, in concert with environmental influences, has unleashed life from determinism.
    [Show full text]
  • Environmental Perturbations Lift the Degeneracy of the Genetic Code to Regulate Protein Levels in Bacteria
    Environmental perturbations lift the degeneracy of the genetic code to regulate protein levels in bacteria Arvind R. Subramaniama, Tao Panb, and Philippe Cluzela,1 aFAS Center for Systems Biology, Department of Molecular and Cellular Biology, and School of Engineering and Applied Sciences, Harvard University, Cambridge, MA 02138; and bDepartment of Biochemistry and Molecular Biology and Institute of Biophysical Dynamics, University of Chicago, Chicago, IL 60637 Edited by Rachel Green, Johns Hopkins University, Baltimore, MD, and approved November 16, 2012 (received for review July 9, 2012) The genetic code underlying protein synthesis is a canonical exam- Escherichia coli as a model system to investigate whether the ple of a degenerate biological system. Degeneracies in physical degeneracy of the genetic code can be lifted by environmental and biological systems can be lifted by external perturbations, thus perturbations and how degeneracy lifting could provide a general allowing degenerate systems to exhibit a wide range of behaviors. strategy to adapt protein synthesis to environmental changes. Here we show that the degeneracy of the genetic code is lifted by environmental perturbations to regulate protein levels in living Results cells. By measuring protein synthesis rates from a synthetic reporter DegeneracyLiftinguponAminoAcidLimitation.We considered library in Escherichia coli,wefind that environmental perturbations, synonymous codons for seven amino acids: Leu, Arg, Ser, Pro, Ile, such as reduction of cognate amino acid supply, lift the degeneracy Gln, and Phe. This set of seven amino acids is representative of of the genetic code by splitting codon families into a hierarchy of the degeneracy of the genetic code, in that it includes six-, four-, robust and sensitive synonymous codons.
    [Show full text]
  • Aminoacyl-Trna Synthetases
    Downloaded from rnajournal.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Aminoacyl-tRNA Synthetases Miguel Angel Rubio Gomez1,2 and Michael Ibba1,2, † 1Center for RNA Biology, The Ohio State University, 484 West 12th Avenue, Columbus, Ohio 43210 2Department of Microbiology, The Ohio State University, 318 West 12th Avenue, Columbus, Ohio 43210 †Corresponding author and person to whom requests should be addressed: Michael Ibba, PhD Department of Microbiology The Ohio State University 318 West 12th Avenue, Columbus, Ohio 43210 Phone: 614-292-2120 E-mail: [email protected] Running title: Aminoacyl-tRNA synthetases Keywords: Aminoacyl-tRNA synthetases, tRNA, protein translation Rubio, MA 1 Downloaded from rnajournal.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press The aminoacyl-tRNA synthetases are an essential and universally distributed family of enzymes that play a critical role in protein synthesis, pairing tRNAs with their cognate amino acids for decoding mRNAs according to the genetic code. Synthetases help to ensure accurate translation of the genetic code by using both highly accurate cognate substrate recognition and stringent proofreading of non-cognate products. While alterations in the quality control mechanisms of synthetases are generally detrimental to cellular viability, recent studies suggest that in some instances such changes facilitate adaption to stress conditions. Beyond their central role in translation, synthetases are also emerging as key players in an increasing number of other cellular processes, with far reaching consequences in health and disease. The biochemical versatility of the synthetases has also proven pivotal in efforts to expand the genetic code, further emphasizing the wide-ranging roles of the aminoacyl-tRNA synthetase family in synthetic and natural biology.
    [Show full text]
  • The Death of Francis Crick: the End of a Golden Age in Biology
    Commentary The death of Francis Crick: the end of a golden age in biology Born in 1916, Francis Harry Compton Crick studied physics at University College, London, where he devoted his first scientific efforts to studying the viscosity of water at high temperatures. During the war, he participated in the development of ‘noncontact’ magnetic and acoustic mines. Like many other young physicists, he switched to biology after the Second World War, bored by the now dull studies pursued in physics, and attracted by the new frontier of knowledge that was biology, a discipline where the concepts and techniques of physics were desperately needed. He spent two years at the Strangeways Laboratory in Cambridge studying the physical properties of cytoplasm, and joined the Medical Research Unit at Cavendish laboratory headed by Max Perutz to study protein structure by X-ray diffraction studies. The decision he made with Jim Watson to focus on the structure of DNA, and the huge impact this structure had on the development of molecular biology, are well known. Francis Crick received with Jim Watson and Maurice Wilkins the Nobel Prize in Physiology or Medicine in 1962 for this discovery. To consider that determining the structure of DNA was the right way to understand the power of genes was a brilliant piece of foresight at a time when the results of Oswald Avery showing that genes were made of DNA were largely ignored. Watson was the leader in the construction of the model, adopting a strategy previously used by Linus Pauling for the study of proteins. Given his excellent knowledge of crystallography and X-ray diffraction, Francis Crick had all the skills required to pro- vide the firm materials for the elaboration of the model and to relate it to the X-ray diffraction pattern obtained by Rosalind Franklin.
    [Show full text]
  • The Genetic Code Properties of the Genetic Code
    atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagccMaster course:tcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcc tcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattcTHE atcctcagat GENETIC gagagtttat CODE ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagatA. Schneider gagagtttat ccgtcagcca cttcagtttc tcta aacagaatgattattc atcctcagat gagagtttat ccgtcagcca ct tcagtttc tctaaacagaatgattattc atcctcagat gag agtttat ccgtcagcca cttcagtttc tctaaacagaatgattattc atcctcaga t gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tctaaacaga atgattattc atcctcagat gagagtttat ccgtcagcca cttcagtttc tcta Properties of the genetic code Properties of the genetic code • The genetic code is degenerate -More than one codon specifies the same amino acid -Degeneracy usually occurs at the third base -Nearly all amino acids can be symbolized XY(A/G) or XY(U/C) • The genetic code is (nearly) universal The central dogma prions F. Crick. (1970) Nature, vol. 227, pp. 561-563 Role of tRNAs 3’-end (becomes charged
    [Show full text]
  • BIOCHEMICAL PROPERTIES of CLASS I LYSYL-Trna
    BIOCHEMICAL PROPERTIES OF CLASS I LYSYL-tRNA SYNTHETASE DISSERTATION A Thesis Presented in Partial Fulfillment of the Requirements for The Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jeffrey David Levengood, B.S. ***** The Ohio State University 2007 Dissertation Committee: Professor Michael Ibba, Adviser Professor Russ Hille Approved by Professor John Reeve _______________________________________ Professor Zucai Suo Adviser The Ohio State Biochemistry Graduate Program ABSTRACT The family of aminoacyl-tRNA synthetases (aaRSs) performs the essential cellular function of charging tRNA molecules with their cognate amino acids. This enzyme family can be divided into two unrelated classes with each evolving from different origins. Lysyl-tRNA synthetase (LysRS) is the only synthetase known to have a form in each class. The class I form (LysRS1) is found in most archaea and a few bacteria while the class II form (LysRS2) is found in all eucarya, most bacteria, and a few archaea. Steady-state kinetics were used to study the mechanisms which LysRS1 employs to recognize its substrates. The binding of both amino acid and tRNA were examined. The binding of lysine was analyzed by studying the ability of several lysine analogues to inhibit the aminoacylation reaction. It was found that the R-group plays a critical role in discrimination rather than the functional groups at the α-carbon. Within the R-group, the size of the chain was a very important point for discrimination. The binding of tRNALys was examined using both LysRS, mutated based on the modeled tRNALys bound to LysRS1, and tRNALys with mutations in the anticodon.
    [Show full text]
  • Adaptor Hypothesis, 29 Aminoacylsite(A-Site)
    Index Adaptor hypothesis, 29 order of addition of components, 47 role of 3'end in mRNA binding, Aminoacylsite(A-site), 19,21,36,41,43, ribosome binding sites from, 14,52 15,24,52 49 role of initiation factors in formation of, sequences in, 23 Aminoacyl tRNA synthetases, 33, 35, 38 49,53 23S RNA, 23 Antibiotics, role of initiator tRNA in formation of, Ribosomal subunits chloramphenicol, 38 47 preparation of, 18 cycloheximide, 38 role of mRNA in formation of, 50 role in initiation, 43, 47 edeine,47 role of rRNA in formation of, 52 subunit cycle, 59 erythromycin, 27 Initiation factors Ribosomes fusidic acid, 28, 43 Factor F, , 43 assembly map, 26 kasugamycin, 27 Factor F2 , 43, 49 biosynthesis, 28 puromycin, 20, 27, 49 Factor F 43, 53 partial reactions of, 19 spiramycin, 27 Initiator tRNA" properties of, 17 streptomycin, 27 primary sequence of, 39 reconstitution of, 25 thiostrepton, 43 properties of, 37 role in initiation complex formation, 53 role in initiation complex formation. 14, Bacteriophage, 20,32,47,55 Suppression, 37 T4,IO,24,58 Interferon, 58 Small RNA, 10, 14,37,54 Termination factors, 44 Bacteriophage RNA, Methods Termination of polypeptide synthesis, 60 cistron order of, 15 column chromatography, 13, 24, 3 I, 41 Transfer RNA coat protein gene sequences, 16, 50 electron microscopy, 9, I 7 classification of, 33 control of translation of, 53, 54, 62 NMR,36 cross linking, 27, 36,40 ribosome binding sites of, 14,52,54,62 polyacrylamide gels, 12 modulation of, 57 protein fingerprinting, 13 mutants of, 36 Cell-free systems, 10, 18
    [Show full text]