Unit-4,Central Dogma(Adaptor Hypothesis)Genetic Code
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Braking the Genetic Code by Nierenberg
1 REVIEW The Invention of Proteomic Code and mRNA Assisted Protein Folding. by Jan C. Biro Homulus Foundation, 612 S Flower St. #1220, 90017 CA, USA. [email protected] Keywords: Gene, code, codon, translation, wobble-base, Abbreviations (excluding standard abbreviations: 2 Abstract Background The theoretical requirements for a genetic code were well defined and modeled by George Gamow and Francis Crick in the 50-es. Their models failed. However the valid Genetic Code, provided by Nirenberg and Matthaei in 1961, ignores many theoretical requirements for a perfect Code. Something is simply missing from the canonical Code. Results The 3x redundancy of the Genetic code is usually explained as a necessity to increase the resistance of the mutation resistance of the genetic information. However it has many additional roles. 1.) It has a periodical structure which corresponds to the physico-chemical and structural properties of amino acids. 2.) It provides physico-chemical definition of codon boundaries. 3.) It defines a code for amino acid co-locations (interactions) in the coded proteins. 4.) It regulates, through wobble bases the free folding energy (and structure) of mRNAs. I shortly review the history of the Genetic Code as well as my own published observations to provide a novel, original explanation of its redundancy. Conclusions The redundant Genetic Code contains biological information which is additional to the 64/20 definition of amino acids. This additional information is used to define the 3D structure of coding nucleic acids as well as the coded proteins and it is called the Proteomic Code and mRNA Assisted Protein Folding. -
Evolution of Genomic Expression
C H A P T E R 5 Evolution of Genomic Expression Bernardo Lemos, Christian R. Landry, Pierre Fontanillas, Susan P. Renn, Rob Kulathinal, Kyle M. Brown, and Daniel L. Hartl Introduction Genomic regulation is key to cellular differentiation, tissue morphogenesis, and development. Increasing evidence indicates that evolutionary diversity of phenotypes—from cellular to organismic—may also be, in large part, the result of variation in the regulation of genomic expression. In this chapter we explore the complexity of gene regulation from the perspective of single genes and whole genomes. The first part describes the major factors affecting gene expression levels, from rates of gene transcrip- tion—as mediated by promoter–enhancer interactions and chromatin mod- ifications—to rates of mRNA degradation. This description underscores the multiple levels at which genomic expression can be regulated as well as the complexity and variety of mechanisms used. We then briefly describe the major experimental and computational biology techniques for analyzing gene expression variation and its underlying causes. The final section reviews our understanding of the role of regulatory variation in evolution, including the molecular evolution and population genetics of noncoding DNA, as well as the inheritance and phenotypic evolution of levels of mRNA abundance. The Complex Regulation of Genomic Expression The regulation of gene expression is a complex and dynamic process. It is not a simple matter to turn a gene on and off, let alone precisely regulate its level of expression. Regulation can be accomplished through various mech- anisms at nearly every step of the process of gene expression. Furthermore, each mechanism may require a variety of elements, including DNA sequences, RNA molecules, and proteins, acting in combination to deter- 2 Chapter Five Evolution of Genomic Expression 3 mine the final amount, timing, and location of functional gene product. -
The Medical & Scientific Library of W. Bruce
The Medical & Scientific Library of W. Bruce Fye New York I March 11, 2019 The Medical & Scientific Library of W. Bruce Fye New York | Monday March 11, 2019, at 10am and 2pm BONHAMS LIVE ONLINE BIDDING IS INQUIRIES CLIENT SERVICES 580 Madison Avenue AVAILABLE FOR THIS SALE New York Monday – Friday 9am-5pm New York, New York 10022 Please email bids.us@bonhams. Ian Ehling +1 (212) 644 9001 www.bonhams.com com with “Live bidding” in Director +1 (212) 644 9009 fax the subject line 48 hrs before +1 (212) 644 9094 PREVIEW the auction to register for this [email protected] ILLUSTRATIONS Thursday, March 7, service. Front cover: Lot 188 10am to 5pm Tom Lamb, Director Inside front cover: Lot 53 Friday, March 8, Bidding by telephone will only be Business Development Inside back cover: Lot 261 10am to 5pm accepted on a lot with a lower +1 (917) 921 7342 Back cover: Lot 361 Saturday, March 9, estimate in excess of $1000 [email protected] 12pm to 5pm REGISTRATION Please see pages 228 to 231 Sunday, March 10, Darren Sutherland, Specialist IMPORTANT NOTICE for bidder information including +1 (212) 461 6531 12pm to 5pm Please note that all customers, Conditions of Sale, after-sale [email protected] collection and shipment. All irrespective of any previous activity SALE NUMBER: 25418 with Bonhams, are required to items listed on page 231, will be Tim Tezer, Junior Specialist complete the Bidder Registration transferred to off-site storage +1 (917) 206 1647 CATALOG: $35 Form in advance of the sale. -
INTRODUCTION Sirna and Rnai
J Korean Med Sci 2003; 18: 309-18 Copyright The Korean Academy ISSN 1011-8934 of Medical Sciences RNA interference (RNAi) is the sequence-specific gene silencing induced by dou- ble-stranded RNA (dsRNA). Being a highly specific and efficient knockdown tech- nique, RNAi not only provides a powerful tool for functional genomics but also holds Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National a promise for gene therapy. The key player in RNAi is small RNA (~22-nt) termed University, Seoul, Korea siRNA. Small RNAs are involved not only in RNAi but also in basic cellular pro- cesses, such as developmental control and heterochromatin formation. The inter- Received : 19 May 2003 esting biology as well as the remarkable technical value has been drawing wide- Accepted : 23 May 2003 spread attention to this exciting new field. V. Narry Kim, D.Phil. Institute of Molecular Biology and Genetics and School of Biological Science, Seoul National University, San 56-1, Shillim-dong, Gwanak-gu, Seoul 151-742, Korea Key Words : RNA Interference (RNAi); RNA, Small interfering (siRNA); MicroRNAs (miRNA); Small Tel : +82.2-887-8734, Fax : +82.2-875-0907 hairpin RNA (shRNA); mRNA degradation; Translation; Functional genomics; Gene therapy E-mail : [email protected] INTRODUCTION established yet, testing 3-4 candidates are usually sufficient to find effective molecules. Technical expertise accumulated The RNA interference (RNAi) pathway was originally re- in the field of antisense oligonucleotide and ribozyme is now cognized in Caenorhabditis elegans as a response to double- being quickly applied to RNAi, rapidly improving RNAi stranded RNA (dsRNA) leading to sequence-specific gene techniques. -
Molecular Biology and Applied Genetics
MOLECULAR BIOLOGY AND APPLIED GENETICS FOR Medical Laboratory Technology Students Upgraded Lecture Note Series Mohammed Awole Adem Jimma University MOLECULAR BIOLOGY AND APPLIED GENETICS For Medical Laboratory Technician Students Lecture Note Series Mohammed Awole Adem Upgraded - 2006 In collaboration with The Carter Center (EPHTI) and The Federal Democratic Republic of Ethiopia Ministry of Education and Ministry of Health Jimma University PREFACE The problem faced today in the learning and teaching of Applied Genetics and Molecular Biology for laboratory technologists in universities, colleges andhealth institutions primarily from the unavailability of textbooks that focus on the needs of Ethiopian students. This lecture note has been prepared with the primary aim of alleviating the problems encountered in the teaching of Medical Applied Genetics and Molecular Biology course and in minimizing discrepancies prevailing among the different teaching and training health institutions. It can also be used in teaching any introductory course on medical Applied Genetics and Molecular Biology and as a reference material. This lecture note is specifically designed for medical laboratory technologists, and includes only those areas of molecular cell biology and Applied Genetics relevant to degree-level understanding of modern laboratory technology. Since genetics is prerequisite course to molecular biology, the lecture note starts with Genetics i followed by Molecular Biology. It provides students with molecular background to enable them to understand and critically analyze recent advances in laboratory sciences. Finally, it contains a glossary, which summarizes important terminologies used in the text. Each chapter begins by specific learning objectives and at the end of each chapter review questions are also included. -
Actin Gene Requires Myod1, Carg-Box Binding Factor, and Spl
Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press Muscle-specific expression of the cardiac -actin gene requires MyoD1, CArG-box binding factor, and Spl Vittorio Sartorelli, Keith A. Webster, 1 and Larry Kedes 2 Program in Molecular Biology and Genetics, Institute for Genetic Medicine, and Departments of Biochemistry and Medicine, University of Southern California School of Medicine, Los Angeles, California 90033 USA Expression of the human cardiac ~-actin gene (HCA) depends on the interactions of multiple transcriptional regulators with promoter elements. We report here that the tissue-specific expression of this promoter is determined by the simultaneous interaction of at least three specific protein-DNA complexes. The myogenic determinant gene MyoD1 activated the transcription of transfected HCA-CAT promoter constructs in nonmuscle cells, including CV-1 and HeLa cells. Gel mobility-shift and footprinting assays revealed that MyoD1 specifically interacted with a single consensus core sequence, CANNTG, at -50. Previously characterized sites interact with a protein identical with or related to the serum response factor (SRF) at - 100 and Spl at -70. All three elements must be intact to support transcription in muscle cells: site-specific mutation within any one of these three elements eliminated transcriptional expression by the promoter. Furthermore, expression of the promoter in embryonic Drosophila melanogaster cells that lack MyoD1 and Spl is strictly dependent on all three sites remaining intact and on the presence of exogenously supplied Spl and MyoD1. These experiments suggest that the presence of three sequence-specific binding proteins, including MyoD1, and their intact target DNA sequences are minimal requirements for muscle-specific expression of the HCA gene. -
Chapter 12 Gene Expression and Regulation
PYF12 3/21/05 8:04 PM Page 191 Chapter 12 Gene expression and regulation Bacterial genomes usually contain several thousand different genes. Some of the gene products are required by the cell under all growth conditions and are called house- keeping genes. These include the genes that encode such proteins as DNA poly- merase, RNA polymerase, and DNA gyrase. Many other gene products are required under specific growth conditions. These include enzymes that synthesize amino acids, break down specific sugars, or respond to a specific environmental condition such as DNA damage. Housekeeping genes must be expressed at some level all of the time. Frequently, as the cell grows faster, more of the housekeeping gene products are needed. Even under very slow growth, some of each housekeeping gene product is made. The gene prod- ucts required for specific growth conditions are not needed all of the time. These genes are frequently expressed at extremely low levels, or not expressed at all when they are not needed and yet made when they are needed. This chapter will examine gene regulation or how bacteria regulate the expression of their genes so that the genes that are being expressed meet the needs of the cell for a specific growth condition. Gene regulation can occur at three possible places in the production of an active gene product. First, the transcription of the gene can be regulated. This is known as transcriptional regulation. When the gene is transcribed and how much it is transcribed influences the amount of gene product that is made. Second, if the gene encodes a protein, it can be regulated at the translational level. -
IGA 8/E Chapter 8
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? Answer: The arrows for genes 1 and 2 indicate the direction of transcription, which is always 5 to 3. The two genes are transcribed from opposite DNA strands, which are antiparallel, so the genes must be transcribed in opposite directions to maintain the 5 to 3 direction of transcription. 2. In Figure 8-5, draw the “one gene” at much higher resolution with the following components: DNA, RNA polymerase(s), RNA(s). Answer: At the higher resolution, the feathery structures become RNA transcripts, with the longer transcripts occurring nearer the termination of the gene. The RNA in this drawing has been straightened out to illustrate the progressively longer transcripts. 3. In Figure 8-6, describe where the gene promoter is located. Chapter Eight 271 Answer: The promoter is located to the left (upstream) of the 3 end of the template strand. From this sequence it cannot be determined how far the promoter would be from the 5 end of the mRNA. 4. In Figure 8-9b, write a sequence that could form the hairpin loop structure. Answer: Any sequence that contains inverted complementary regions separated by a noncomplementary one would form a hairpin. One sequence would be: ACGCAAGCUUACCGAUUAUUGUAAGCUUGAAG The two bold-faced sequences would pair and form a hairpin. The intervening non-bold sequence would be the loop. 5. How do you know that the events in Figure 8-13 are occurring in the nucleus? Answer: The figure shows a double-stranded DNA molecule from which RNA is being transcribed. -
How the Techniques of Molecular Biology Are Developed from Natural Systems
How the techniques of molecular biology are developed from natural systems Isobel Ronai [email protected] School of Life and Environmental Sciences, The University of Sydney, Sydney, NSW, Australia. Abstract A striking characteristic of the highly successful techniques in molecular biology is that they are derived from natural systems. RNA interference (RNAi), for example, utilises a mechanism that evolved in eukaryotes to destroy foreign nucleic acid. Other examples include restriction enzymes, the polymerase chain reaction, green fluorescent protein and CRISPR-Cas. I propose that biologists exploit natural molecular mechanisms for their effectors’ (protein or nucleic acid) activity and biological specificity (protein or nucleic acid can cause precise reactions). I also show that the developmental trajectory of novel techniques in molecular biology, such as RNAi, is four characteristic phases. The first phase is discovery of a biological phenomenon, typically as curiosity driven research. The second is identification of the mechanism’s trigger(s), the effector and biological specificity. The third is the application of the technique. The final phase is the maturation and refinement of the molecular biology technique. The development of new molecular biology techniques from nature is crucial for biological research. These techniques transform scientific knowledge and generate new knowledge. Keywords: mechanism; experiment; specificity; scientific practice; PCR; GFP. 1 Introduction Molecular biology is principally concerned with explaining the complex molecular phenomena underlying living processes by identifying the mechanisms that produce such processes (Tabery et al. 2015). In order to access the causal structure of molecular mechanisms it is generally necessary to manipulate the components of the mechanism and to observe the resulting effects with sophisticated molecular techniques. -
Integrating Single-Molecule Visualization and DNA
VU Research Portal The DNA double helix challenged by force Gross, P. 2011 document version Publisher's PDF, also known as Version of record Link to publication in VU Research Portal citation for published version (APA) Gross, P. (2011). The DNA double helix challenged by force. General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal ? Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. E-mail address: [email protected] Download date: 24. Sep. 2021 The DNA double helix challenged by force This thesis was reviewed by: prof.dr. Ulrich Bockelmann ESPCI CNRS UMR Gulliver, Paris prof.dr. Fred C. MacKintosh VU University, Amsterdam prof.dr. Antoine M. van Oijen University of Groningen prof.dr. Helmut Schiessel Leiden University prof.dr. Mark C. Williams Northeastern University, Boston prof.dr. Gijs J. L. Wuite VU University, Amsterdam This work is part of the research programme ATLAS, a European Commission-funded Marie Curie early stage training network. -
Origins of Gene, Genetic Code, Protein and Life: Comprehensive View of Life Systems from a GNC-SNS Primitive Genetic Code Hypothesis*
Review Origins of gene, genetic code, protein and life: comprehensive view of life systems from a GNC-SNS primitive genetic code hypothesis* K IKEHARA Department of Chemistry, Faculty of Science, Nara Women’s University, Kita-uoya-nishi-machi, Nara, Nara 630-8506, Japan (Fax, 742-20-3402; Email, [email protected]) We have investigated the origin of genes, the genetic code, proteins and life using six indices (hydropathy, a-helix, b-sheet and b-turn formabilities, acidic amino acid content and basic amino acid content) necessary for appropriate three-dimensional structure formation of globular proteins. From the analysis of microbial genes, we have concluded that newly-born genes are products of nonstop frames (NSF) on antisense strands of microbial GC-rich genes [GC-NSF(a)] and from SNS repeating sequences [(SNS)n] similar to the GC-NSF(a) (S and N mean G or C and either of four bases, respectively). We have also proposed that the universal genetic code used by most organisms on the earth presently could be derived from a GNC-SNS primitive genetic code. We have further presented the [GADV]-protein world hypothesis of the origin of life as well as a hypothesis of protein production, suggesting that proteins were originally produced by random peptide formation of amino acids restricted in specific amino acid compositions termed as GNC-, SNS- and GC-NSF(a)-0th order structures of proteins. The [GADV]-protein world hypothesis is primarily derived from the GNC-primitive genetic code hypothesis. It is also expected that basic properties of extant genes and proteins could be revealed by considerations based on the scenario with four stages. -
Central Dogma3
Conversation on Central Dogma Page 1 of 11 A Conversation about Central Dogma sequences code for proteins of differing of Molecular Biology sequences. Student: OK. Now, what does the Central Dogma Student: What is the Central Dogma of Molecular state? Biology? Teacher: Again, in Crick’s words, the Central Teacher: The Central Dogma of Molecular Dogma states that “ that once ‘information’ has Biology was proposed by Sir Francis Crick in passed into protein it cannot get out again .” The paper he published in 1958 [1]. In this paper, Crick ‘information’ in a nucleic acid is its sequence of discussed a theoretical framework for the nucleotides. The ‘information’ in a protein is its mechanisms leading to protein synthesis; for this sequence of amino acids. This statement by Crick Crick presented two general principles, which he means that a sequence of amino acids cannot be termed the Sequence Hypothesis and the Central used to provide instruction for synthesis of either a Dogma, though there was scant experimental nucleic acid or a protein. Crick elaborated on this evidence for either. point as follows “the transfer of information from nucleic acid to nucleic acid, or from nucleic acid Student: OK. So what does the Sequence to protein may be possible, but transfer from Hypothesis state? protein to protein, or from protein to nucleic acid is impossible .” Teacher: In Crick’s own words, the sequence hypothesis “ assumes that the specificity of a piece Student: This sounds clear enough. But I of nucleic acid is expressed solely by the sequence 2 remember reading on Wikipedia that the Central of its bases, and that this sequence is a simple Dogma relates to the ‘residue by residue transfer code for the amino acid sequence of a particular of sequential information ’, which sounded quite protein .” complicated.