DOCSLIB.ORG

Molecular Cloning and Sequence Analysis of Trp-Lac Fusion Deletions

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Cloning and Sequence Analysis of Trp-Lac Fusion Deletions d. ,llol. Biol. (1984) 172, 3,55-362 Molecular Cloning and Sequence Analysis of trp-lac Fusion Deletions I)NA fragments containing deletions that fllse tile trp operon to the lac operon were cloned and the end-points of the fllsions were determined. The results from I)NA sequence analysis correlated well with those from genetic, biochemical and physinlogical studies previously reported. The sequence data from this study, in combinatio,i with the known properties of these fi~sion strains, provided information on: (i) the precise lac operon distal boundary of the lac operator; (2) tile nature of the trp operon terminator; and (3) tile messenger RNA sequences that result in inhibition of lacZ translation initiation in Irp-lae fi~sctl mRNAs. The fllsion of Escherichia colt genes or operons has been useful in tile genetic analysis of ol)eron structures and regulation (Bassford et al., 1978). Of Ilarticular interest are tile trp-lac flmions, whose isolation was (leseribed by Mitchell el al. (1975). The deletions that. generated these fusions all have their lac end-points within tile lac regulatory region. Genetic, ilhysiologieal and biochemical exl)eriments with some of these trp-lac fusion deletions suggested that tile)" have some interesting properties, which we have studied by DNA sequence analysis in this letter. For instance, two (leletions (F36a and W205) fuse lac to lrp but do not cut into the trp structural genes, thus they hel l) define tile lrp oI)eron terminator. Two other deletions (W211 and x,V225) appear to define the operon distal boundary of tile lac operator, since they reduce the represser-operator affinity by twofold an(l l 1-fold, respectively (Reznikoff el al., 1974b). Finally, tile in rive fl-galaetosidase content of these filsion strains varies within a 60-fold range, and this was found to i)e partially due to the differing effieiencies of translational initiation for different fusions (Reznikoff et at., 1974a). The bL colt trp-lac filsion deletions F36a, W200, x,V205, ~V2I 1, W225, W227 and R189 are shown schematically in Figure 1 (,Miller et at., 1970; Mitchell et at., 1975). In order to fitcilitate tile sequence analysis of these deletions, they were crossed onto a ColEI derivative (pRZ115-11.189) that carries tile trp+-lac - filsion R189. This was accomplished by transformiug each of tile alll)ropriate trp-lac fusion strains with pRZ115-R189 and isolating tile plasmid I)NA, which was then used to transform a l,ac- strain. The resulting transformants that were Lae + were assumed to contain plasmids that had incorporated the relevant Lac + fusion via homologous recombination events between tile chromosome and plasmid pRZ115- 11189. These plasmids were checked by restriction endonuelease analyses. The llindlI fi'agments containing some of the trl~lac fusions were subeloned into pVll51 prior to sequence analysis. The I)NA sequence analysis by primed synthesis was performed as described by Smith (1980). The 1)NA sequence analysis by chain ehemical cleavage was carried out as described by Maxam & Gilbert (1980). :155 0022-2836]84[03035Tr-08 $0a.00/0 ~ 1984 Academic Press Inc. {London) Ltd. 35(i YU XIAN-MING, L. M. MUNSON AND W. S. REZNIKOFF trp lac C B A tonB att~ 80 I PcAP PRNP 0 Z Y l F36a ! W2CO I I W205 I [ W211 I I W225 l I w227 I I Rl8Cj I Fro. I. lac and trp ends of fusion deletions. The symbols trpC, B and A and lacZ and }" refer to structural genes in the trp and Iac operons. The other genetic designations include tonB (encodes a function required for ~bS0 infection and colicin V and B killing), attr (an attachment site for the r prophage), I (encodes the lac rei)ressor), Pc^P (the site required for CAP binding in the lac controlling elements), PR.~e (the RNA polymerase binding site for lac) and O (the lac operator). (a) Specificity of deletion end-points The sequenced end-points of the trp-lac fusions F36a, W200, W205, W211, W225 an(l W227 are shown in Figure 2. It has been observed that in many cases spontaneous deletions occur between repeated sequences (Miller, 1978). None of the six sequenced fusion deletions described in this letter occurred between extensively repeated sequences (the W200 deletion has end-points within the repeated sequence G-J-A-A, the W225 deletion was between the related sequences A-A-T-G-T (lrp) and A-A-T-T-G-T (lac), the W211 deletion within repeated sequence T-G) (see Fig. 2). The lack of ot)vious extensive sequence homology between deletion end-points may reflect the fact that the fusion strains were obtained through specific selection procedures constraining their end-points. (b) The trp end-point of the deletions Sequence data presentcd here in(licaie that fusion strains F36a and W205 have intact trpA genes, while the W211 and W227 deletions have removed 23 and 25 base-pairs from the C-terminal end of trpA gene. Because the stop codon at the end of the trpA gene was deleted, translation from the trpA gene could read through into the lac regulatory region, terminating at an UGA eodon about 30 nueleotides before the initiation eodon of lacZ (see Fig. 2). As a result, the trpA l)roduet made in W211 is six amino acids shorter than normal. In the case of W227, seven C-terminal amino acid residues were removed, and 18 amino acid residues were added. There is no sequence!homology between the amino acid residues removed and-added (see Fig. 3). The sequence results are in good agreement with the results from genetic mapi)ing and physiological and protein structure studies, which indicate that F36a and W205 made a normal trpA product, whereas W211 and W227 made a mutant trpA protein that retained part of trpA enzyme activity at 37~ (Mitchell et at., 1975,1976). Ai)parently, the removal of six to seven amino acid residues from the C-terminal end of the trpA LETTERS TO TIlE EI)ITOR 357 trp Operon End of/roB TrpB 119~ trpA CGATATTTTGA~GCACGAGGGGAAATCTGATGGAACGC-- - CCGGEACAAIGUITGAAA---TTTTTGTACAACC.GA,TGAAAGCGGCEACGCGCAGTI~ "-" 1 Start of trpA Z U --- /~u ]. W227 End of trpA TCCCACAGCCGCCAGTTCCGCTGGEGGCAI111AACIIICITTAATGAAGCCGGAAAAAICCTAAhIICATTTAhTATHATCTTI.TTACCGIIICGC--- End of trp mRNA---CAIJUUU { W205 '[ F36a ... Ioc cperon -70 -60 -SO -40 -30 -20 -I0 +I +i0 +20 AACGCAATTAATGT.GAG~TAG~[ACTCA~AGGCA~CAGGC~A~A~H~AIGC~CCGGCTCGTATGTTG~GTGGAAT~GTC`AGCGGA~AACAATTT _~o ~... ,,,~, ~ ... w~,, H ,,~o~! § +~0 *SO *60 *tO +80 w225 ] CACACAGGAAACAGCIAIGACf.AIGAHACCGAIICACTGGECGTCGITTTACAACGTCGTC-A w200 f Start of lacZ FIO. 2. End-l)oints of fusion deletions F36a, W200, W205, W211, W225 and W227 in trp and lac operons. Base-pairs in the trp operon are numbered relative to the start sites of the trpB or trpA genes. Base-pairs in the hie operon are numbered relative to the site of lacZ transcription initiation. The translation initiation co(Ion of the trpA gene, the translation termination codons of lrpB and trpA, the -35 and - 10 consensus sequences of the lac promoter and the translation initiation codon of the lacZ gene are underlined. The 2 potential translation termination eodons in the lac regulatory region are also underlined. Translation readthrough from trp in fusion strains W21 l, W225 and W227 stops at a UGA codon positioned at base-pair +6. Translation readthrough from trpB in fusion strain W200 stops at a U-G-A co(Ion positioned at base-pair +83. Arrows in trp operon regions indicate that the nuc]eotides downstream ark deleted. Arrows in the lac operon region indicate that the nucleotides upstream are deleted. The trp and lac operon sequence is according to Nichols & Yanofsky (1979) and Dickson ~t al. (1975). Hyl)hcns have been omitted from the sequences for clarity. product does not totally inactivate the enzyme, although cells with these deletion mutations cannot grow under very stringent conditions (at 42~ with 5-methyltryI)tophan). In flzsion W225, the deletion removed two thirds of the trpA gene, and in W200 the entire trpA gene was deleted. These strains had becn previously shown to l)e phenotyI)ically TrI)A- (Mitchell et at., 1975). The W200 deletion also removed the last five amino acids from the trpB gene and allowed the synthesis of a readthrouoh protein that contained 18 additional amino acids. Since previous studies have shown that the trpB protein in W200 is active (,Mitchell et al., 1975), it is evident that the five C-terminal amino acids are not required for, and the additional amino acids do not interfere with, the trpB protein activity. (c) The trp terminator Fusion strains F36a and W205 are characterized as phenotypieaily TrpA +, that is, they make perfectly normal trpA protein (tryptophan synthetase A) (Mitchell et at., 1976). Since the fusion of two operons requires the elimination of the transcriptional terminators between them, it was proposed that the trp end-points of deletions F36a and W205 were located in between the trpA gene and the transcription terminator of the trp operon. The deletion end-points of F36a and 35S YU XIAN-MING, L. 31. MUNSON ANI) W. S. REZNIKOFF Wt CAA CCG ATG AAA GCG GCG.e.s CC~ AGT TAA I/'IgA Gin Pro Met Lys AIa AIo Thr Arg Ser End W227 C,I~ CCT AGGCACOOC I~3GCTT TAC ACT TTA TGC TTC OCvGCTC GTA TGT TGT GTG GAA'I-fG TGA trpA Gin Pro ,~rq His Pro Arq Leu Tyr Thr Le~ Cys ~ Arq keu Val Cys Cys Vat Glu Leu End W211 C.AA CCG ATG TGA trpA Gin Pro Met End Wt TTG A~ CK~ GGA GGGG~ ATC TG~ IrpB Lea Lys Ala Arg Gly Glu lie E.nd T TG AAA A~C AC,C TAT C,AC CAT GAT TAC CC~ TTC ACT GGCC, GT C.,GTTTT ACA ACG TC,G TGA /rpB Leu Lys Ash Ser Tyr Asp His Asp Tyr Arg Rae Thr Gilt Arg Arg Phe Thr Thr Set End Fro.
Load more

Recommended publications
  • Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for Cellular Control and Differentiation
    Chapter 18 Regulation of Gene Expression Regulation of Gene Expression • Important for cellular control and differentiation. • Understanding “expression” is a “hot” area in Biology. General Mechanisms 1. Regulate Gene Expression 2. Regulate Protein Activity Operon Model • Jacob and Monod (1961) - Prokaryotic model of gene control. • Always on the National AP Biology exam! Operon Structure 1. Regulatory Gene 2. Operon Area a. Promoter b. Operator c. Structural Genes Gene Structures Regulatory Gene • Makes Repressor Protein which may bind to the operator. • Repressor protein blocks transcription. Promoter • Attachment sequence on the DNA for RNA polymerase to start transcription. Operator • The "Switch”, binding site for Repressor Protein. • If blocked, will not permit RNA polymerase to pass, preventing transcription. Structural Genes • Make the enzymes for the metabolic pathway. Lac Operon • For digesting Lactose. • Inducible Operon - only works (on) when the substrate (lactose) is present. If no Lactose • Repressor binds to operator. • Operon is "off”, no transcription, no enzymes made If Lactose is absent If Lactose is present • Repressor binds to Lactose instead of operator. • Operon is "on”, transcription occurs, enzymes are made. If Lactose is present Enzymes • Digest Lactose. • When enough Lactose is digested, the Repressor can bind to the operator and switch the Operon "off”. Net Result • The cell only makes the Lactose digestive enzymes when the substrate is present, saving time and energy. Animation • http://www.biostudio.com/d_%20Lac%20Ope ron.htm trp Operon • Makes/synthesizes Tryptophan. • Repressible Operon. – Predict how it is different from the inducible operon… If no Tryptophan • Repressor protein is inactive, Operon "on” Tryptophan made. • “Normal” state for the cell.
    [Show full text]
  • RNA-Based Regulation of Genes of Tryptophan Synthesis and Degradation, in Bacteria
    REVIEW RNA-based regulation of genes of tryptophan synthesis and degradation, in bacteria CHARLES YANOFSKY Department of Biological Sciences, Stanford University Stanford, California 94305, USA ABSTRACT We are now aware that RNA-based regulatory mechanisms are commonly used to control gene expression in many organisms. These mechanisms offer the opportunity to exploit relatively short, unique RNA sequences, in altering transcription, translation, and/or mRNA stability, in response to the presence of a small or large signal molecule. The ability of an RNA segment to fold and form alternative hairpin secondary structures—each dedicated to a different regulatory function—permits selection of specific sequences that can affect transcription and/or translation. In the present paper I will focus on our current understanding of the RNA-based regulatory mechanisms used by Escherichia coli and Bacillus subtilis in controlling expression of the tryptophan biosynthetic operon. The regulatory mechanisms they use for this purpose differ, suggesting that these organisms, or their ancestors, adopted different strategies during their evolution. I will also describe the RNA-based mechanism used by E. coli in regulating expression of its operon responsible for tryptophan degradation, the tryptophanase operon. Keywords: trp operon; trp suboperon; aro supraoperon; tna operon; transcription attenuation; T box regulation; tryptophan as a regulatory signal; tRNATrp as a regulatory signal; peptidyl-tRNA; ribosome mediated regulation INTRODUCTION A second regulatory lesson learned over the years is that information within mRNAs, or other RNAs, as well as small Studies over the past 50+ years have revealed that metabolites and other molecules—in addition to DNA and optimization of gene expression has been a major evolu- proteins—often provides specific regulatory signals, or tionary objective for most species.
    [Show full text]
  • Chapter 3. the Beginnings of Genomic Biology – Molecular
    Chapter 3. The Beginnings of Genomic Biology – Molecular Genetics Contents 3. The beginnings of Genomic Biology – molecular genetics 3.1. DNA is the Genetic Material 3.6.5. Translation initiation, elongation, and termnation 3.2. Watson & Crick – The structure of DNA 3.6.6. Protein Sorting in Eukaryotes 3.3. Chromosome structure 3.7. Regulation of Eukaryotic Gene Expression 3.3.1. Prokaryotic chromosome structure 3.7.1. Transcriptional Control 3.3.2. Eukaryotic chromosome structure 3.7.2. Pre-mRNA Processing Control 3.3.3. Heterochromatin & Euchromatin 3.4. DNA Replication 3.7.3. mRNA Transport from the Nucleus 3.4.1. DNA replication is semiconservative 3.7.4. Translational Control 3.4.2. DNA polymerases 3.7.5. Protein Processing Control 3.4.3. Initiation of replication 3.7.6. Degradation of mRNA Control 3.4.4. DNA replication is semidiscontinuous 3.7.7. Protein Degradation Control 3.4.5. DNA replication in Eukaryotes. 3.8. Signaling and Signal Transduction 3.4.6. Replicating ends of chromosomes 3.8.1. Types of Cellular Signals 3.5. Transcription 3.8.2. Signal Recognition – Sensing the Environment 3.5.1. Cellular RNAs are transcribed from DNA 3.8.3. Signal transduction – Responding to the Environment 3.5.2. RNA polymerases catalyze transcription 3.5.3. Transcription in Prokaryotes 3.5.4. Transcription in Prokaryotes - Polycistronic mRNAs are produced from operons 3.5.5. Beyond Operons – Modification of expression in Prokaryotes 3.5.6. Transcriptions in Eukaryotes 3.5.7. Processing primary transcripts into mature mRNA 3.6. Translation 3.6.1.
    [Show full text]
  • Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the Tna Operon of Escherichia Coli
    JOURNAL OF BACTERIOLOGY, Aug. 1995, p. 4451–4456 Vol. 177, No. 15 0021-9193/95/$04.0010 Copyright 1995, American Society for Microbiology Bicyclomycin Sensitivity and Resistance Affect Rho Factor-Mediated Transcription Termination in the tna Operon of Escherichia coli CHARLES YANOFSKY* AND VIRGINIA HORN Department of Biological Sciences, Stanford University, Stanford, California 94305-5020 Received 13 March 1995/Accepted 27 May 1995 The growth-inhibiting drug bicyclomycin, known to be an inhibitor of Rho factor activity in Escherichia coli, was shown to increase basal level expression of the tryptophanase (tna) operon and to allow growth of a tryptophan auxotroph on indole. The drug also relieved polarity in the trp operon and permitted growth of a trp double nonsense mutant on indole. Nine bicyclomycin-resistant mutants were isolated and partially characterized. Recombination data and genetic and biochemical complementation analyses suggest that five have mutations that affect rho, three have mutations that affect rpoB, and one has a mutation that affects a third locus, near rpoB. Individual mutants showed decreased, normal, or increased basal-level expression of the tna operon. All but one of the resistant mutants displayed greatly increased tna operon expression when grown in the presence of bicyclomycin. The tna operon of the wild-type drug-sensitive parent was also shown to be highly expressed during growth with noninhibitory concentrations of bicyclomycin. These findings demonstrate that resistance to this drug may be acquired by mutations at any one of three loci, two of which appear to be rho and rpoB. Zwiefka et al. (24) found that the antibiotic bicyclomycin segment and interacts with the transcribing RNA polymerase (bicozamycin), an inhibitor of the growth of several gram- molecule, causing it to terminate transcription (7, 9).
    [Show full text]
  • I = Chpt 15. Positive and Negative Transcriptional Control at Lac BMB
    BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac B M B 400 Part Four: Gene Regulation Section I = Chapter 15 POSITIVE AND NEGATIVE CONTROL SHOWN BY THE lac OPERON OF E. COLI A. Definitions and general comments 1. Operons An operon is a cluster of coordinately regulated genes. It includes structural genes (generally encoding enzymes), regulatory genes (encoding, e.g. activators or repressors) and regulatory sites (such as promoters and operators). 2. Negative versus positive control a. The type of control is defined by the response of the operon when no regulatory protein is present. b. In the case of negative control, the genes in the operon are expressed unless they are switched off by a repressor protein. Thus the operon will be turned on constitutively (the genes will be expressed) when the repressor in inactivated. c. In the case of positive control, the genes are expressed only when an active regulator protein, e.g. an activator, is present. Thus the operon will be turned off when the positive regulatory protein is absent or inactivated. Table 4.1.1. Positive vs. negative control BMB 400 Part Four - I = Chpt 15. Positive and Negative Transcriptional Control at lac 3. Catabolic versus biosynthetic operons a. Catabolic pathways catalyze the breakdown of nutrients (the substrate for the pathway) to generate energy, or more precisely ATP, the energy currency of the cell. In the absence of the substrate, there is no reason for the catabolic enzymes to be present, and the operon encoding them is repressed. In the presence of the substrate, when the enzymes are needed, the operon is induced or de-repressed.
    [Show full text]
  • Binds Multiple Sites Within the Aroh and Trp Operators
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Escherichia cod tryptophan repressor binds multiple sites within the aroH and trp operators Andrew A. Kumamoto, ~ William G. Miller, 2 and Robert P. GunsalusL2 1Molecular Biology Institute and the 2Department of Microbiology, University of Califomia, Los Angeles, Califomia 90024 USA DNase I footprinting and methylation protection studies have been used to analyze the binding of Escherichia coli Trp repressor to the trpR, aroH, and trp operators. The methylation protection assay shows that Trp repressor binds in two successive major grooves of the trpR operator, three successive major grooves of the aroH operator, and four successive major grooves of the trp operator. The simplest model that explains the difference in Trp repressor interaction at the three operators is that the aroH and trp operators are composed of multiple, helically stacked binding sites. When viewed in three dimensions, each site is positioned on a different face of the DNA, and together process up the surface of the DNA helix. Analysis of a deletion derivative of the trp operator supports this model. [Key Words" Trp repressor; aroH operator; trp operator; repressor binding] Received February 23, 1987; revised version accepted June 6, 1987. The Trp repressor of Escherichia coli coordinately regu- and by the isolation of constitutive mutations within lates the expression of the trp, aroH, and trpR operons in the trp operator {Bennett and Yanofsky 1978). These op- response to the intracellular levels of L-tryptophan erator constitutive mutations map at positions -16, (Cohen and Jacob 1959; Brown 1968; Rose et al.
    [Show full text]
  • The Tryptophan Biosynthetic Pathway Trp Biosynthesis Is a Biologically Expensive, Complicated Process
    E. Coli Trp repressor The tryptophan repressor proteins The trp repressor proteins regulate transcription of several diferent operons located at separate sites on the E. coli chromosome. In addition to the trp operon, this repressor represses transcription of aroH, a single-gene operon that encodes an enzyme required for the synthesis of all aromatic amino acids, and trpR, another single-gene operon encoding the trp repressor itself. Such coordinately regulated operons constitute a regulon. Although all three operons in this regulon are repressed by the trp repressor, the extent of repression varies from about twofold for the aroH operon to seventyfold for the trp operon. This variation results from diferences in the afnity of trp repressor for the specific operator in each of these operons, diferences in the position of the operators relative to the −10 and −35 sequences of each promoter, and diferences in the strengths of the three promoters. Thus the specific nucleotide sequences of the promoters and operators in a regulon allow the same repressor to diferentially regulate transcription of the component operons. The tryptophan biosynthetic pathway Trp biosynthesis is a biologically expensive, complicated process. In fact, the products of four other pathways are essential contributors of carbon or nitrogen during tryptophan formation. Thus, the principal pathway precursor, chorismate, is also the precursor of the other aromatic amino acids, phenylalanine and tyrosine, as well as serving as the precursor of p- aminobenzoic acid and several other metabolites. In addition, glutamine, phosphoribosylpyrophosphate, and L-serine contribute nitrogen and/or carbon during tryptophan formation. FIGURE 1. The genes, enzymes, and reactions of the tryptophan biosynthetic pathway.
    [Show full text]
  • Open Smarajit Mondal Dissertation
    The Pennsylvania State University The Graduate School Eberly College of Science REGULATION OF TRANSCRIPTION BY NusA AND NusG IN Bacillus subtilis A Dissertation in Biochemistry, Microbiology, and Molecular Biology by Smarajit Mondal © 2016 Smarajit Mondal Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy May 2016 The dissertation of Smarajit Mondal was reviewed and approved* by the following: Paul Babitzke Professor Biochemistry and Molecular Biology Dissertation Adviser Chair of Committee David S. Gilmour Professor of Biochemistry and Molecular Biology Joseph C. Reese Professor of Biochemistry and Molecular Biology Katsuhiko Murakami Professor of Biochemistry and Molecular Biology Philip C. Bevilacqua Professor Chemistry Scott B. Selleck Head of the Department of Biochemistry and Molecular Biology *Signatures are on file in the Graduate School. ii ABSTRACT Transcription in bacteria is regulated at the level of initiation, elongation and termination. Although the regulation of transcriptional initiation is well studied, the regulation of elongation and termination are not well understood. This thesis focuses on understanding the role of NusA on intrinsic termination and the role of NusG on RNA polymerase pausing using genomic, biochemical and computational analyses. Tight regulation of transcription termination is required to maintain proper levels of gene expression in bacteria, because termination failure abolishes operon boundaries, leading to misregulation of downstream genes. NusA is a negative transcription elongation factor that was known to cause a slight stimulation of termination at intrinsic terminators in vitro, but its impact on termination and global gene expression in vivo was not known. In this thesis, I describe the mapping of intrinsic terminators genome wide in B subtilis and measure the effect of NusA on the efficiency of these terminators in vivo using a novel high resolution 3’ end-mapping technique coupled with mRNA profiling.
    [Show full text]
  • In Vitro Analysis of a Transcription Termination Site for RNA Polymerase II DEBRA K
    MOLECULAR AND CELLULAR BIOLOGY, Nov. 1990, p. 5782-5795 Vol. 10, No. 11 0270-7306/90/115782-14$02.00/0 Copyright © 1990, American Society for Microbiology In Vitro Analysis of a Transcription Termination Site for RNA Polymerase II DEBRA K. WIEST' 2 AND DIANE K. HAWLEY' 3* Institute of Molecular Biology' and Departments ofBiology2 and Chemistry, University of Oregon, Eugene, Oregon 97403 Received 11 June 1990/Accepted 8 August 1990 Transcription from the adenovirus major late (ML) promoter has previously been shown to pause or terminate prematurely in vivo and in vitro at a site within the first intron of the major late transcription unit. We are studying the mechanism of elongation arrest at this site in vitro to define the DNA sequences and proteins that determine the elongation behavior of RNA polymerase II. Our assay system consists of a nuclear extract prepared from cultured human cells. With standard reaction conditions, termination is not observed downstream of the ML promoter. However, in the presence of Sarkosyl, up to 80% of the transcripts terminate 186 nucleotides downstream of the start site. Using this assay, we showed that the DNA sequences required to promote maximal levels of termination downstream of the ML promoter reside within a 65-base-pair region and function in an orientation-dependent manner. To test whether elongation complexes from the ML promoter were functionally homogeneous, we determined the termination efficiency at each of two termination sites placed in tandem. We found that the behavior of the elongation complexes was different at these sites, with termination being greater at the downstream site over a wide range of Sarkosyl concentrations.
    [Show full text]
  • Mechanisms of Prokaryotic Gene Regulation
    Overview: Conducting the Genetic Orchestra • Prokaryotes and eukaryotes alter gene expression in response to their changing environment • In multicellular eukaryotes, gene expression regulates development and is responsible for differences in cell types • RNA molecules play many roles in regulating gene expression in eukaryotes Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Fig. 18-1 1 Concept 18.1: Bacteria often respond to environmental change by regulating transcription • Natural selection has favored bacteria that produce only the products needed by that cell • A cell can regulate the production of enzymes by feedback inhibition or by gene regulation • Gene expression in bacteria is controlled by the operon model Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings Fig. 18-2 Precursor Feedback inhibition trpE gene Enzyme 1 trpD gene Regulation of gene expression Enzyme 2 trpC gene trpB gene Enzyme 3 trpA gene Tryptophan (a) Regulation of enzyme (b) Regulation of enzyme activity production 2 Operons: The Basic Concept • A cluster of functionally related genes can be under coordinated control by a single on-off “switch” • The regulatory “switch” is a segment of DNA called an operator usually positioned within the promoter • An operon is the entire stretch of DNA that includes the operator, the promoter, and the genes that they control Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings • The operon can be switched off by a protein repressor • The repressor prevents gene transcription by binding to the operator and blocking RNA polymerase • The repressor is the product of a separate regulatory gene Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings 3 • The repressor can be in an active or inactive form, depending on the presence of other molecules • A corepressor is a molecule that cooperates with a repressor protein to switch an operon off • For example, E.
    [Show full text]
  • The Trp Operon (BIOT 4006: Genetics and Molecular Biology)
    The trp Operon (BIOT 4006: Genetics and Molecular Biology) Dr. Saurabh Singh Rathore Department of Biotechnology MGCU Introduction • Synthesis of the enzymes involved in the biosynthesis of tryptophan is controlled by the trptophan/trp operon in E. coli. • Charles Yanofsky and others have studied in detail the working of the five structural genes and the close regulatory elements of the trp operon. • The precursor for biosynthesis of the amino acid tryptophan is “chorismic acid”. • The five structural genes of the trp operon code for enzymes required for conversion of chorismic acid to tryptophan. • There are two levels of regulation of this operon: 1. Repression: works at the level of transcription initiation 2. Attenuation: works at the level of transcription termination Repression of the trp operon • The repression regulation works negatively. • The trpR gene coding for repressor of trp operon is distantly located from the operon itself. • P1 is for primary promoter region and it contains the operator (O) region. • P2 is a weak promoter found at that end of the trpD gene which is more far from the operator. Its function is to increase the basal transcription level of the trpC, trpB & trpA genes. • There are two termination regions, namely t and t’ placed downstream to the trpA gene. The trpL denotes a region for a mRNA leader sequence (162 nucleotides in length). E. Coli trp operon organization • The biosynthesis of tryptophan is shown at the bottom. • The five structural genes coding for enzymes needed for tryptophan biosynthesis are: trpE, trpD, trpC, trpB & trpA. • trpL is the regulatory segment. • The gene lengths and the intergenic distances are shown as bp’s.
    [Show full text]
  • Regulation of Gene Expression
    CAMPBELL BIOLOGY IN FOCUS URRY • CAIN • WASSERMAN • MINORSKY • REECE 15 Regulation of Gene Expression Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University © 2016 Pearson Education, Inc. SECOND EDITION Overview: Beauty in the Eye of the Beholder . Prokaryotes and eukaryotes alter gene expression in response to their changing environment . Multicellular eukaryotes also develop and maintain multiple cell types © 2016 Pearson Education, Inc. Concept 15.1: Bacteria often respond to environmental change by regulating transcription . Natural selection has favored bacteria that produce only the gene products needed by the cell . A cell can regulate the production of enzymes by feedback inhibition or by gene regulation . Gene expression in bacteria is controlled by a mechanism described as the operon model © 2016 Pearson Education, Inc. Figure 15.2 Precursor Genes that encode enzymes 1, 2, and 3 Feedback trpE inhibition Enzyme 1 trpD Regulation of gene expression Enzyme 2 trpC – trpB – Enzyme 3 trpA Tryptophan (a) Regulation of enzyme (b) Regulation of enzyme activity production © 2016 Pearson Education, Inc. Operons: The Basic Concept . A group of functionally related genes can be coordinately controlled by a single “on-off switch” . The regulatory “switch” is a segment of DNA called an operator, usually positioned within the promoter . An operon is the entire stretch of DNA that includes the operator, the promoter, and the genes that they control © 2016 Pearson Education, Inc. The operon can be switched off by a protein repressor . The repressor prevents gene transcription by binding to the operator and blocking RNA polymerase . The repressor is the product of a separate regulatory gene © 2016 Pearson Education, Inc.
    [Show full text]