d. ,llol. Biol. (1984) 172, 3,55-362 Molecular Cloning and Sequence Analysis of trp-lac Fusion Deletions I)NA fragments containing deletions that fllse tile trp operon to the lac operon were cloned and the end-points of the fllsions were determined. The results from I)NA sequence analysis correlated well with those from genetic, biochemical and physinlogical studies previously reported. The sequence data from this study, in combinatio,i with the known properties of these fi~sion strains, provided information on: (i) the precise lac operon distal boundary of the lac operator; (2) tile nature of the trp operon terminator; and (3) tile messenger RNA sequences that result in inhibition of lacZ translation initiation in Irp-lae fi~sctl mRNAs. The fllsion of Escherichia colt genes or operons has been useful in tile genetic analysis of ol)eron structures and regulation (Bassford et al., 1978). Of Ilarticular interest are tile trp-lac flmions, whose isolation was (leseribed by Mitchell el al. (1975). The deletions that. generated these fusions all have their lac end-points within tile lac regulatory region. Genetic, ilhysiologieal and biochemical exl)eriments with some of these trp-lac fusion deletions suggested that tile)" have some interesting properties, which we have studied by DNA sequence analysis in this letter. For instance, two (leletions (F36a and W205) fuse lac to lrp but do not cut into the trp structural genes, thus they hel l) define tile lrp oI)eron terminator. Two other deletions (W211 and x,V225) appear to define the operon distal boundary of tile lac operator, since they reduce the represser-operator affinity by twofold an(l l 1-fold, respectively (Reznikoff el al., 1974b). Finally, tile in rive fl-galaetosidase content of these filsion strains varies within a 60-fold range, and this was found to i)e partially due to the differing effieiencies of translational initiation for different fusions (Reznikoff et at., 1974a). The bL colt trp-lac filsion deletions F36a, W200, x,V205, ~V2I 1, W225, W227 and R189 are shown schematically in Figure 1 (,Miller et at., 1970; Mitchell et at., 1975). In order to fitcilitate tile sequence analysis of these deletions, they were crossed onto a ColEI derivative (pRZ115-11.189) that carries tile trp+-lac - filsion R189. This was accomplished by transformiug each of tile alll)ropriate trp-lac fusion strains with pRZ115-R189 and isolating tile plasmid I)NA, which was then used to transform a l,ac- strain. The resulting transformants that were Lae + were assumed to contain plasmids that had incorporated the relevant Lac + fusion via homologous recombination events between tile chromosome and plasmid pRZ115- 11189. These plasmids were checked by restriction endonuelease analyses. The llindlI fi'agments containing some of the trl~lac fusions were subeloned into pVll51 prior to sequence analysis. The I)NA sequence analysis by primed synthesis was performed as described by Smith (1980). The 1)NA sequence analysis by chain ehemical cleavage was carried out as described by Maxam & Gilbert (1980). :155 0022-2836]84[03035Tr-08 $0a.00/0 ~ 1984 Academic Press Inc. {London) Ltd. 35(i YU XIAN-MING, L. M. MUNSON AND W. S. REZNIKOFF trp lac C B A tonB att~ 80 I PcAP PRNP 0 Z Y l F36a ! W2CO I I W205 I [ W211 I I W225 l I w227 I I Rl8Cj I Fro. I. lac and trp ends of fusion deletions. The symbols trpC, B and A and lacZ and }" refer to structural genes in the trp and Iac operons. The other genetic designations include tonB (encodes a function required for ~bS0 infection and colicin V and B killing), attr (an attachment site for the r prophage), I (encodes the lac rei)ressor), Pc^P (the site required for CAP binding in the lac controlling elements), PR.~e (the RNA polymerase binding site for lac) and O (the lac operator). (a) Specificity of deletion end-points The sequenced end-points of the trp-lac fusions F36a, W200, W205, W211, W225 an(l W227 are shown in Figure 2. It has been observed that in many cases spontaneous deletions occur between repeated sequences (Miller, 1978). None of the six sequenced fusion deletions described in this letter occurred between extensively repeated sequences (the W200 deletion has end-points within the repeated sequence G-J-A-A, the W225 deletion was between the related sequences A-A-T-G-T (lrp) and A-A-T-T-G-T (lac), the W211 deletion within repeated sequence T-G) (see Fig. 2). The lack of ot)vious extensive sequence homology between deletion end-points may reflect the fact that the fusion strains were obtained through specific selection procedures constraining their end-points. (b) The trp end-point of the deletions Sequence data presentcd here in(licaie that fusion strains F36a and W205 have intact trpA genes, while the W211 and W227 deletions have removed 23 and 25 base-pairs from the C-terminal end of trpA gene. Because the stop codon at the end of the trpA gene was deleted, translation from the trpA gene could read through into the lac regulatory region, terminating at an UGA eodon about 30 nueleotides before the initiation eodon of lacZ (see Fig. 2). As a result, the trpA l)roduet made in W211 is six amino acids shorter than normal. In the case of W227, seven C-terminal amino acid residues were removed, and 18 amino acid residues were added. There is no sequence!homology between the amino acid residues removed and-added (see Fig. 3). The sequence results are in good agreement with the results from genetic mapi)ing and physiological and protein structure studies, which indicate that F36a and W205 made a normal trpA product, whereas W211 and W227 made a mutant trpA protein that retained part of trpA enzyme activity at 37~ (Mitchell et at., 1975,1976). Ai)parently, the removal of six to seven amino acid residues from the C-terminal end of the trpA LETTERS TO TIlE EI)ITOR 357 trp Operon End of/roB TrpB 119~ trpA CGATATTTTGA~GCACGAGGGGAAATCTGATGGAACGC-- - CCGGEACAAIGUITGAAA---TTTTTGTACAACC.GA,TGAAAGCGGCEACGCGCAGTI~ "-" 1 Start of trpA Z U --- /~u ]. W227 End of trpA TCCCACAGCCGCCAGTTCCGCTGGEGGCAI111AACIIICITTAATGAAGCCGGAAAAAICCTAAhIICATTTAhTATHATCTTI.TTACCGIIICGC--- End of trp mRNA---CAIJUUU { W205 '[ F36a ... Ioc cperon -70 -60 -SO -40 -30 -20 -I0 +I +i0 +20 AACGCAATTAATGT.GAG~TAG~[ACTCA~AGGCA~CAGGC~A~A~H~AIGC~CCGGCTCGTATGTTG~GTGGAAT~GTC`AGCGGA~AACAATTT _~o ~... ,,,~, ~ ... w~,, H ,,~o~! § +~0 *SO *60 *tO +80 w225 ] CACACAGGAAACAGCIAIGACf.AIGAHACCGAIICACTGGECGTCGITTTACAACGTCGTC-A w200 f Start of lacZ FIO. 2. End-l)oints of fusion deletions F36a, W200, W205, W211, W225 and W227 in trp and lac operons. Base-pairs in the trp operon are numbered relative to the start sites of the trpB or trpA genes. Base-pairs in the hie operon are numbered relative to the site of lacZ transcription initiation. The translation initiation co(Ion of the trpA gene, the translation termination codons of lrpB and trpA, the -35 and - 10 consensus sequences of the lac promoter and the translation initiation codon of the lacZ gene are underlined. The 2 potential translation termination eodons in the lac regulatory region are also underlined. Translation readthrough from trp in fusion strains W21 l, W225 and W227 stops at a UGA codon positioned at base-pair +6. Translation readthrough from trpB in fusion strain W200 stops at a U-G-A co(Ion positioned at base-pair +83. Arrows in trp operon regions indicate that the nuc]eotides downstream ark deleted. Arrows in the lac operon region indicate that the nucleotides upstream are deleted. The trp and lac operon sequence is according to Nichols & Yanofsky (1979) and Dickson ~t al. (1975). Hyl)hcns have been omitted from the sequences for clarity. product does not totally inactivate the enzyme, although cells with these deletion mutations cannot grow under very stringent conditions (at 42~ with 5-methyltryI)tophan). In flzsion W225, the deletion removed two thirds of the trpA gene, and in W200 the entire trpA gene was deleted. These strains had becn previously shown to l)e phenotyI)ically TrI)A- (Mitchell et at., 1975). The W200 deletion also removed the last five amino acids from the trpB gene and allowed the synthesis of a readthrouoh protein that contained 18 additional amino acids. Since previous studies have shown that the trpB protein in W200 is active (,Mitchell et al., 1975), it is evident that the five C-terminal amino acids are not required for, and the additional amino acids do not interfere with, the trpB protein activity. (c) The trp terminator Fusion strains F36a and W205 are characterized as phenotypieaily TrpA +, that is, they make perfectly normal trpA protein (tryptophan synthetase A) (Mitchell et at., 1976). Since the fusion of two operons requires the elimination of the transcriptional terminators between them, it was proposed that the trp end-points of deletions F36a and W205 were located in between the trpA gene and the transcription terminator of the trp operon. The deletion end-points of F36a and 35S YU XIAN-MING, L. 31. MUNSON ANI) W. S. REZNIKOFF Wt CAA CCG ATG AAA GCG GCG.e.s CC~ AGT TAA I/'IgA Gin Pro Met Lys AIa AIo Thr Arg Ser End W227 C,I~ CCT AGGCACOOC I~3GCTT TAC ACT TTA TGC TTC OCvGCTC GTA TGT TGT GTG GAA'I-fG TGA trpA Gin Pro ,~rq His Pro Arq Leu Tyr Thr Le~ Cys ~ Arq keu Val Cys Cys Vat Glu Leu End W211 C.AA CCG ATG TGA trpA Gin Pro Met End Wt TTG A~ CK~ GGA GGGG~ ATC TG~ IrpB Lea Lys Ala Arg Gly Glu lie E.nd T TG AAA A~C AC,C TAT C,AC CAT GAT TAC CC~ TTC ACT GGCC, GT C.,GTTTT ACA ACG TC,G TGA /rpB Leu Lys Ash Ser Tyr Asp His Asp Tyr Arg Rae Thr Gilt Arg Arg Phe Thr Thr Set End Fro.