DOCSLIB.ORG

Regulation of S100A10 Gene Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Regulation of S100A10 Gene Expression biomolecules Communication Regulation of S100A10 Gene Expression Aleksandra Głowacka 1, Paweł Bieganowski 2 , Ewelina Jurewicz 1 , Wiesława Le´sniak 1 , Tomasz Wilanowski 3,* and Anna Filipek 1,* 1 Nencki Institute of Experimental Biology, Polish Academy of Sciences, 3 Pasteur Str., 02-093 Warsaw, Poland; [email protected] (A.G.); [email protected] (E.J.); [email protected] (W.L.) 2 Mossakowski Medical Research Institute, Polish Academy of Sciences, 5 Pawi´nskiegoStr., 02-106 Warsaw, Poland; [email protected] 3 Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, 1 Miecznikowa Str., 02-096 Warsaw, Poland * Correspondence: [email protected] (T.W.); a.fi[email protected] (A.F.); Tel.: +48-22-589-23-32 (A.F.); Fax: +48-22-822-53-42 (A.F.) Abstract: S100A10, a member of the S100 family of Ca2+-binding proteins, is a widely distributed protein involved in many cellular and extracellular processes. The best recognized role of S100A10 is the regulation, via interaction with annexin A2, of plasminogen conversion to plasmin. Plasmin, together with other proteases, induces degradation of the extracellular matrix (ECM), which is an important step in tumor progression. Additionally, S100A10 interacts with 5-hydroxytryptamine 1B (5-HT1B) receptor, which influences neurotransmitter binding and, through that, depressive symptoms. Taking this into account, it is evident that S100A10 expression in the cell should be under strict control. In this work, we summarize available literature data concerning the physiological stimuli and transcription factors that influence S100A10 expression. We also present our original results showing for the first time regulation of S100A10 expression by grainyhead-like 2 transcription Citation: Głowacka, A.; factor (GRHL2). By applying in silico analysis, we have found two highly conserved GRHL2 binding Bieganowski, P.; Jurewicz, E.; Le´sniak, sites in the 1st intron of the gene encoding S100A10 protein. Using chromatin immunoprecipitation W.; Wilanowski, T.; Filipek, A. (ChIP) and luciferase assays, we have shown that GRHL2 directly binds to these sites and that this Regulation of S100A10 Gene DNA region can affect transcription of S100A10. Expression. Biomolecules 2021, 11, 974. https://doi.org/10.3390/ Keywords: cancer; gene expression; grainyhead-like 2; S100A10 biom11070974 Academic Editor: Donald Cameron 1. Introduction Received: 18 May 2021 The S100 protein family consists of over 20 low molecular weight (10–12 kDa), Ca2+- Accepted: 28 June 2021 Published: 2 July 2021 binding proteins expressed only in vertebrates [1]. In the human genome, genes encoding 17 members of the S100 family are clustered on chromosome 1 (1q21) [2]. Despite their Publisher’s Note: MDPI stays neutral shared localization, expression of S100 genes is not spatiotemporally synchronized and 2+ with regard to jurisdictional claims in each gene has its own expression pattern [3,4]. S100 proteins bind Ca through two 2+ published maps and institutional affil- “EF-hand” motifs. In a Ca -bound form, they interact with a variety of protein ligands iations. which, in consequence, leads to regulation of numerous processes inside and outside the cell [5,6]. S100A10 is a unique member of the S100 protein family in that it does not bind Ca2+ and is insensitive to changes in Ca2+ concentration. Both “EF hand” motifs in S100A10 have amino acid substitutions that allow them to maintain a conformation, which resembles Copyright: © 2021 by the authors. 2+ Licensee MDPI, Basel, Switzerland. that of other S100 proteins in a Ca -bound form. This means that S100A10 is permanently This article is an open access article locked in an active state [7]. Inside the cell, S100A10 forms a heterotetrameric complex with 2+ distributed under the terms and annexin A2, a protein that binds Ca and phospholipids [8]. The annexin A2-S100A10 conditions of the Creative Commons complex is involved in many membrane-associated processes, e.g., trafficking, fusion, Attribution (CC BY) license (https:// microdomain or lipid raft organization and cytoskeleton-membrane binding. Additionally, creativecommons.org/licenses/by/ this complex binds F-actin, which suggests that it is involved in cytoskeletal reorganization 4.0/). and regulation. Moreover, the annexin A2-S100A10 complex interacts with plasminogen Biomolecules 2021, 11, 974. https://doi.org/10.3390/biom11070974 https://www.mdpi.com/journal/biomolecules Biomolecules 2021, 11, x 2 of 10 Biomolecules 2021, 11, 974 2 of 9 cytoskeletal reorganization and regulation. Moreover, the annexin A2-S100A10 complex interacts with plasminogen and facilitates its conversion into plasmin, a serine protease andthat facilitates is responsible its conversion for fibrinolysis into plasmin, but can also a serine activate protease metalloproteinases that is responsible and degrade for fibri- nolysisextracellular but can matrix also activate (ECM) metalloproteinasesproteins [9]. Dysregulation and degrade of plas extracellularminogen conversion matrix (ECM) to proteinsplasmin [9 plays]. Dysregulation an important of role plasminogen in the etiolo conversiongy of many to cancer plasmin and plays non-cancer an important diseases. role inIt the is well etiology known of many that degradation cancer and non-cancerof extracellular diseases. matrix It proteins, is well known together that with degradation inflam- ofmation, extracellular promotes matrix tumor proteins, growth, together invasiveness, with inflammation,and metastasis promotes(Figure 1). tumor It is thus growth, not invasiveness,surprising that and an metastasis elevated level (Figure of S100A101). It is thus is a notcommon surprising feature that of anmany elevated cancers, level such of S100A10as squamous is a common cell carcinoma, feature colon, of many lung, cancers, breast, such or pancreatic as squamous cancer cell [10–12]. carcinoma, The role colon, of lung,S100A10 breast, in orother pancreatic processes cancer such [as10 modulation–12]. The role of ofserotonin S100A10 and in other other receptors, processes regula- such as modulationtion of ion ofchannel serotonin level and and other activity, receptors, or involvement regulation in of macrophage ion channel levelmigration andactivity, has been or involvementextensively inreviewed macrophage [13,14]. migration It is only has natural been extensivelythat expression reviewed of S100A10 [13,14 ].must It is be only flexi- nat- uralble thatenough expression to meet of theseS100A10 functionalmust be demands. flexible enough In this towork, meet we these present functional literature demands. data Inconcerning this work, wevarious present factors literature that influence data concerning S100A10 various expression factors and that our influence originalS100A10 results expressionthat show andthat ourthe originalgene is regulated results that by showGRHL2. that the gene is regulated by GRHL2. FigureFigure 1. 1.Role Role of of S100A10 S100A10 in in tumor tumor progression.progression. 2.2. Regulation Regulation of ofS100A10 S100A10Expression—Literature Expression—Literature Data TheThe gene gene encoding encoding S100A10 S100A10 isis highly highly inducibleinducible andand itsits expressionexpression seemsseems to bebe regu-reg- latedulated by numerousby numerous external external and and internal internal factors. factors. Studies Studies performed performed by different by different research re- groupssearch identifiedgroups identified many physiological many physiological stimuli thatstimuli promoted that promoted S100A10 S100A10 expression, expression, among themamong transforming them transforming growth factor- growthβ (TGF- factor-β), gonadotrophinβ (TGF-β), gonadotrophin (GD), epidermal (GD), growth epidermal factor (EGF),growth basic factor fibroblast (EGF), basic growth fibroblast factor (bFGF),growth interleukinfactor (bFGF), 1β interleukin(IL-1β)[13 ],1β brain-derived (IL-1β) [13], neurotrophicbrain-derived factor neurotrophic (BDNF) [factor15], fibroblast (BDNF) growth[15], fibroblast factor 2 growth (FGF2) fa [16ctor], and 2 (FGF2) nitric oxide[16], (NO)and [nitric17]. Theoreticaloxide (NO) analysis[17]. Theoretical of the S100A10 analysis promoterof the S100A10 identified promoter many identified potential many regu- latorypotential sites, regulatory among them sites,γIRE, among GAS, them and γ GRE,IRE, andGAS, consensus and GRE, binding and consensus sequences binding for the followingsequences transcription for the following factors: transcription AP-1, Sp1, Sp2,factors: NF κAP-1,B, HIF1, Sp1, ATF, Sp2, and NFκ CTF-NF1B, HIF1, ATF, [13]. Overand time,CTF-NF1 the binding [13]. Over of these time, andthe otherbinding transcription of these and factors other totranscription their cognate factors binding to their sites withincognate the binding regulatory sites regions within ofthe S100A10 regulatory has regions been verified of S100A10 experimentally, has been verified providing exper- rele- vantimentally, information providing on the relevant regulation information of S100A10 on expression.the regulation It was of S100A10 proposed, expression. for example, It basedwas proposed, on the effects for example, of siRNA-induced based on the knockdown effects of siRNA-induced of several transcription knockdown factors, of sever- that c-Fosal transcription and c-Jun may factors, act asthat activators, c-Fos and while c-Jun CREM, may act Fosl2, as activators, STAT3, Sp1, while and CREM, SRF may Fosl2, act asSTAT3, inhibitors, Sp1, ofand S100A10 SRF may expression act as inhibitors,
Load more

Recommended publications
  • Mapping the Physiological and Molecular Markers of Stress and SSRI Antidepressant Treatment in S100a10 Corticostriatal Neurons
    Molecular Psychiatry (2020) 25:1112–1129 https://doi.org/10.1038/s41380-019-0473-6 ARTICLE Mapping the physiological and molecular markers of stress and SSRI antidepressant treatment in S100a10 corticostriatal neurons 1 2 1 3,4 1 Derya Sargin ● Revathy U. Chottekalapanda ● Kristina E. Perit ● Victoria Yao ● Duong Chu ● 1 2 1 3,4,5 6 2 Daniel W. Sparks ● Salina Kalik ● Saige K. Power ● Olga G. Troyanskaya ● Eric F. Schmidt ● Paul Greengard ● Evelyn K. Lambe 1,7,8 Received: 30 October 2018 / Revised: 8 April 2019 / Accepted: 17 May 2019 / Published online: 20 August 2019 © The Author(s) 2019. This article is published with open access Abstract In mood disorders, psychomotor and sensory abnormalities are prevalent, disabling, and intertwined with emotional and cognitive symptoms. Corticostriatal neurons in motor and somatosensory cortex are implicated in these symptoms, yet mechanisms of their vulnerability are unknown. Here, we demonstrate that S100a10 corticostriatal neurons exhibit distinct serotonin responses and have increased excitability, compared with S100a10-negative neurons. We reveal that prolonged social isolation disrupts the specific serotonin response which gets restored by chronic antidepressant treatment. We identify fi 1234567890();,: 1234567890();,: cell-type-speci c transcriptional signatures in S100a10 neurons that contribute to serotonin responses and strongly associate with psychomotor and somatosensory function. Our studies provide a strong framework to understand the pathogenesis and create new avenues for the treatment of mood disorders. Introduction Our understanding of mood and anxiety disorders is limited These authors contributed equally: Derya Sargin, Revathy U. Chottekalapanda due to the complexity of the circuitry involved and the diverse symptoms manifested in these diseases.
    [Show full text]
  • The S100A10 Subunit of the Annexin A2 Heterotetramer Facilitates L2-Mediated Human Papillomavirus Infection
    The S100A10 Subunit of the Annexin A2 Heterotetramer Facilitates L2-Mediated Human Papillomavirus Infection Andrew W. Woodham1, Diane M. Da Silva2,3, Joseph G. Skeate1, Adam B. Raff1, Mark R. Ambroso4, Heike E. Brand3, J. Mario Isas4, Ralf Langen4, W. Martin Kast1,2,3* 1 Departments of Molecular Microbiology & Immunology, University of Southern California, Los Angeles, California, United States of America, 2 Department of Obstetrics & Gynecology, University of Southern California, Los Angeles, California, United States of America, 3 Norris Comprehensive Cancer Center, University of Southern California, Los Angeles, California, United States of America, 4 Department of Biochemistry & Molecular Biology, University of Southern California, Los Angeles, California, United States of America Abstract Mucosotropic, high-risk human papillomaviruses (HPV) are sexually transmitted viruses that are causally associated with the development of cervical cancer. The most common high-risk genotype, HPV16, is an obligatory intracellular virus that must gain entry into host epithelial cells and deliver its double stranded DNA to the nucleus. HPV capsid proteins play a vital role in these steps. Despite the critical nature of these capsid protein-host cell interactions, the precise cellular components necessary for HPV16 infection of epithelial cells remains unknown. Several neutralizing epitopes have been identified for the HPV16 L2 minor capsid protein that can inhibit infection after initial attachment of the virus to the cell surface, which suggests an L2-specific secondary receptor or cofactor is required for infection, but so far no specific L2-receptor has been identified. Here, we demonstrate that the annexin A2 heterotetramer (A2t) contributes to HPV16 infection and co- immunoprecipitates with HPV16 particles on the surface of epithelial cells in an L2-dependent manner.
    [Show full text]
  • Core Transcriptional Regulatory Circuitries in Cancer
    Oncogene (2020) 39:6633–6646 https://doi.org/10.1038/s41388-020-01459-w REVIEW ARTICLE Core transcriptional regulatory circuitries in cancer 1 1,2,3 1 2 1,4,5 Ye Chen ● Liang Xu ● Ruby Yu-Tong Lin ● Markus Müschen ● H. Phillip Koeffler Received: 14 June 2020 / Revised: 30 August 2020 / Accepted: 4 September 2020 / Published online: 17 September 2020 © The Author(s) 2020. This article is published with open access Abstract Transcription factors (TFs) coordinate the on-and-off states of gene expression typically in a combinatorial fashion. Studies from embryonic stem cells and other cell types have revealed that a clique of self-regulated core TFs control cell identity and cell state. These core TFs form interconnected feed-forward transcriptional loops to establish and reinforce the cell-type- specific gene-expression program; the ensemble of core TFs and their regulatory loops constitutes core transcriptional regulatory circuitry (CRC). Here, we summarize recent progress in computational reconstitution and biologic exploration of CRCs across various human malignancies, and consolidate the strategy and methodology for CRC discovery. We also discuss the genetic basis and therapeutic vulnerability of CRC, and highlight new frontiers and future efforts for the study of CRC in cancer. Knowledge of CRC in cancer is fundamental to understanding cancer-specific transcriptional addiction, and should provide important insight to both pathobiology and therapeutics. 1234567890();,: 1234567890();,: Introduction genes. Till now, one critical goal in biology remains to understand the composition and hierarchy of transcriptional Transcriptional regulation is one of the fundamental mole- regulatory network in each specified cell type/lineage.
    [Show full text]
  • 2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
    REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins .............................................................................................................
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Cacybp (NM 009786) Mouse Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202748 Cacybp (NM_009786) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cacybp (NM_009786) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cacybp Synonyms: SIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202748 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCCGTTTTGGAAGAGTTGCAGAAAGACCTAGAAGAGGTCAAAGTATTGCTGGAAAAGTCCACTA GGAAAAGACTACGTGATACTCTTACAAGTGAAAAGTCCAAGATTGAGACGGAACTCAAGAACAAGATGCA ACAGAAGTCGCAGAAGAAACCAGAACTTGATAATGAAAAGCCAGCTGCTGTGGTTGCTCCTCTTACAACA GGATACACCGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTACATTACCT TGACTGGCGTCCATCAGGTGCCCACTGAGAACGTGCAGGTGCACTTCACAGAGAGGTCATTTGATCTTCT GGTAAAAAACCTCAATGGCAAGAATTACTCCATGATTGTGAACAATCTTTTGAAACCTATCTCTGTGGAA AGCAGTTCAAAAAAAGTCAAGACTGATACAGTAATTATTCTATGTAGAAAGAAAGCAGAAAACACAAGAT GGGACTACTTAACACAGGTGGAAAAGGAATGCAAAGAGAAAGAAAAGCCTTCCTACGACACGGAGGCAGA CCCTAGTGAGGGATTAATGAATGTTCTAAAGAAAATTTATGAAGACGGAGACGATGATATGAAGCGAACC ATTAATAAAGCGTGGGTGGAATCCAGAGAGAAGCAAGCCAGAGAAGACACGGAATTT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online
    [Show full text]
  • Rage (Receptor for Advanced Glycation End Products) in Melanoma
    RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION A Dissertation Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science By Varsha Meghnani In Partial Fulfillment for the Degree of DOCTOR OF PHILOSOPHY Major Department: Pharmaceutical Sciences May 2014 Fargo, North Dakota North Dakota State University Graduate School Title RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION By VARSHA MEGHNANI The Supervisory Committee certifies that this disquisition complies with North Dakota State University’s regulations and meets the accepted standards for the degree of DOCTOR OF PHILOSOPHY SUPERVISORY COMMITTEE: ESTELLE LECLERC Chair BIN GUO STEPHEN O’ROURKE JANE SCHUH Approved: 5/22/2014 JAGDISH SINGH Date Department Chair ABSTRACT The Receptor for Advanced Glycation End Products (RAGE) and its ligands are expressed in multiple cancer types and are implicated in cancer progression. Our lab has previously reported higher transcript levels of RAGE and S100B in advanced staged melanoma patients. The contribution of RAGE in the pathophysiology of melanoma has not been well studied. Based on previous reports, we hypothesized that RAGE, when over-expressed in melanoma cells, promotes melanoma progression. To study the pathogenic role of RAGE in melanoma, a primary melanoma cell line, WM115, was selected and stably transfected with full length RAGE (FL_RAGE) to generate a model cell line over-expressing RAGE (WM115_RAGE). WM266, a sister cell line of WM115, originated from a metastatic tumor of the same patient was used as a metastatic control cell line in the study. After assessing the expression levels of RAGE in the transfected cells, the influence of RAGE on their cellular properties was examined.
    [Show full text]
  • S100A10 Antibody
    Product Datasheet S100A10 Antibody Catalog No: #49352 Package Size: #49352-1 50ul #49352-2 100ul Orders: [email protected] Support: [email protected] Description Product Name S100A10 Antibody Host Species Rabbit Clonality Monoclonal Clone No. JF0987 Purification ProA affinity purified Applications WB, IHC Species Reactivity Hu, Ms Immunogen Description recombinant protein Other Names 42C antibody AA409961 antibody AL024248 antibody Annexin II ligand antibody Annexin II ligand, calpactin I, light polypeptide antibody Annexin II tetramer (AIIt) p11 subunit antibody Annexin II, light chain antibody ANX2L antibody ANX2LG antibody Ca[1] antibody CAL12 antibody CAL1L antibody Calpactin I light chain antibody Calpactin I, p11 subunit antibody Calpactin-1 light chain antibody Cellular ligand of annexin II antibody CLP11 antibody GP11 antibody MGC111133 antibody Nerve growth factor-induced protein 42C antibody OTTHUMP00000015269 antibody OTTHUMP00000015270 antibody p10 antibody p10 protein antibody p11 antibody Protein S100 A10 antibody Protein S100-A10 antibody S100 calcium binding protein A10 (annexin II ligand, calpactin I, light polypeptide (p11)) antibody S100 calcium binding protein A10 (calpactin) antibody S100 calcium binding protein A10 antibody S100 calcium-binding protein A10 antibody S100a10 antibody S10AA_HUMAN antibody Accession No. Swiss-Prot#:P60903 Calculated MW 11 kDa Formulation 1*TBS (pH7.4), 1%BSA, 40%Glycerol. Preservative: 0.05% Sodium Azide. Storage Store at -20°C Application Details WB: 1:1,000-1:2,000 IHC: 1:50-1:200 Images Western blot analysis of S100A10 on human lung lysates using anti-S100A10 antibody at 1/1,000 dilution. Address: 8400 Baltimore Ave. Suite 302 College Park MD 20740 USA http://www.sabbiotech.com 1 Immunohistochemical analysis of paraffin-embedded human colon cancer tissue using anti-S100A10 antibody.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • Role of P11 in Cellular and Behavioral Effects of 5-HT4 Receptor Stimulation
    The Journal of Neuroscience, February 11, 2009 • 29(6):1937–1946 • 1937 Behavioral/Systems/Cognitive Role of p11 in Cellular and Behavioral Effects of 5-HT4 Receptor Stimulation Jennifer L. Warner-Schmidt,1 Marc Flajolet,1 Abigail Maller,1 Emily Y. Chen,1 Hongshi Qi,2 Per Svenningsson,1,2 and Paul Greengard1 1Laboratory of Molecular and Cellular Neuroscience, The Rockefeller University, New York, New York 10065, and 2Center for Molecular Medicine, Department of Physiology and Pharmacology, Karolinska Institute, SE-171 77 Stockholm, Sweden p11 (S100A10), a member of a large family of S100 proteins, interacts with serotonin receptor 1B (5-HTR1B), modulates 5-HT1B receptor signal transduction, and is required for antidepressant responses to activation of this receptor. In the current study, we investigated the specificity of the interaction between 5-HTR1B and p11 by screening brain-expressed S100 proteins against serotonin and noradrenergic receptors. The data indicate that p11 is unique among its family members for its interactions with defined serotonin receptors. We identify a novel p11-interacting receptor (5-HTR4) and characterize the interaction between p11 and 5-HTR4, demonstrating that (1) p11 and 5-HTR4 mRNA and protein are coexpressed in brain regions that are relevant for major depression, (2) p11 increases 5-HTR4 surface expression and facilitates 5-HTR4 signaling, and (3) p11 is required for the behavioral antidepressant responses to 5-HTR4 stimulation in vivo. The essential role played by p11 in modulating signaling through 5-HT4 as well as 5-HT1B receptors supports the concept that this protein may be a key determinant of vulnerability to depression.
    [Show full text]
  • Identification of Differentially Expressed Genes in Human Bladder Cancer Through Genome-Wide Gene Expression Profiling
    521-531 24/7/06 18:28 Page 521 ONCOLOGY REPORTS 16: 521-531, 2006 521 Identification of differentially expressed genes in human bladder cancer through genome-wide gene expression profiling KAZUMORI KAWAKAMI1,3, HIDEKI ENOKIDA1, TOKUSHI TACHIWADA1, TAKENARI GOTANDA1, KENGO TSUNEYOSHI1, HIROYUKI KUBO1, KENRYU NISHIYAMA1, MASAKI TAKIGUCHI2, MASAYUKI NAKAGAWA1 and NAOHIKO SEKI3 1Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520; Departments of 2Biochemistry and Genetics, and 3Functional Genomics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Received February 15, 2006; Accepted April 27, 2006 Abstract. Large-scale gene expression profiling is an effective CKS2 gene not only as a potential biomarker for diagnosing, strategy for understanding the progression of bladder cancer but also for staging human BC. This is the first report (BC). The aim of this study was to identify genes that are demonstrating that CKS2 expression is strongly correlated expressed differently in the course of BC progression and to with the progression of human BC. establish new biomarkers for BC. Specimens from 21 patients with pathologically confirmed superficial (n=10) or Introduction invasive (n=11) BC and 4 normal bladder samples were studied; samples from 14 of the 21 BC samples were subjected Bladder cancer (BC) is among the 5 most common to microarray analysis. The validity of the microarray results malignancies worldwide, and the 2nd most common tumor of was verified by real-time RT-PCR. Of the 136 up-regulated the genitourinary tract and the 2nd most common cause of genes we detected, 21 were present in all 14 BCs examined death in patients with cancer of the urinary tract (1-7).
    [Show full text]