Single-Cell Transcriptome Profiling of the Kidney Glomerulus Identifies Key Cell Types and Reactions to Injury
Total Page：16
File Type：pdf, Size：1020Kb
BASIC RESEARCH www.jasn.org Single-Cell Transcriptome Profiling of the Kidney Glomerulus Identifies Key Cell Types and Reactions to Injury Jun-Jae Chung ,1 Leonard Goldstein ,2 Ying-Jiun J. Chen,2 Jiyeon Lee ,1 Joshua D. Webster,3 Merone Roose-Girma,2 Sharad C. Paudyal,4 Zora Modrusan,2 Anwesha Dey,5 and Andrey S. Shaw1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background The glomerulus is a specialized capillary bed that is involved in urine production and BP control. Glomerular injury is a major cause of CKD, which is epidemic and without therapeutic options. Single-cell transcriptomics has radically improved our ability to characterize complex organs, such as the kidney. Cells of the glomerulus, however, have been largely underrepresented in previous single-cell kidney studies due to their paucity and intractability. Methods Single-cell RNA sequencing comprehensively characterized the types of cells in the glomerulus from healthy mice and from four different disease models (nephrotoxic serum nephritis, diabetes, doxo- rubicin toxicity, and CD2AP deficiency). Results Allcelltypesintheglomeruluswereidentified using unsupervised clustering analysis. Novel marker genes and gene signatures of mesangial cells, vascular smooth muscle cells of the afferent and efferent arteri- oles, parietal epithelial cells, and three types of endothelial cells were identified. Analysis of the disease models revealed cell type–specific and injury type–specific responses in the glomerulus, including acute activation of the Hippo pathway in podocytes after nephrotoxic immune injury. Conditional deletion of YAP or TAZ resulted in more severe and prolonged proteinuria in response to injury, as well as worse glomerulosclerosis. Conclusions Generation of comprehensive high-resolution, single-cell transcriptomic profiles of the glo- merulus from healthy and injured mice provides resources to identify novel disease-related genes and pathways. JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2020020220 The glomerulus, the site of filtration in the kidney, mechanisms are used to restore function after injury is a capillary bed composed of endothelial cells, po- or how acute glomerular injury progresses to chronic docytes, and mesangial cells, as well as less abun- dant cell types, such as the parietal epithelial cells (PECs) and vascular smooth muscle cells (SMCs) Received March 13, 2020. Accepted June 7, 2020. (Supplemental Figure 1). Loss of glomerular func- Published online ahead of print. Publication date available at tion is the most common cause of CKD, a major www.jasn.org. health care problem affecting approximately 15% Present address: Dr. Sharad C. Paudyal, Department of Radiation 1 of the population. Glomerular injury is caused by Oncology, Dana-Farber Cancer Institute, Brigham and Women’s factors such as diabetes and hypertension, as well as Hospital, Harvard Medical School, Boston, Massachusetts. by immune injury. Glomeruli are particularly sus- Correspondence: Dr. Andrey S. Shaw, Department of Research ceptible to injury because podocytes are largely un- Biology, Genentech, 1 DNA Way, MS93b, South San Francisco, able to regenerate and, therefore, tissue damage is CA 94080. Email: [email protected] considered irreversible. It is not known what reparative Copyright © 2020 by the American Society of Nephrology JASN 31: ccc–ccc, 2020 ISSN : 1046-6673/3110-ccc 1 BASIC RESEARCH www.jasn.org fibrosis. Despite their critical roles in kidney function and disease, Significance Statement cells of the glomerulus have largely been underrepresented in pre- vious kidney single-cell RNA sequencing (scRNA-seq) studies due Single-cell transcriptomics techniques have revolutionized the to their paucity and difficulty of isolation. ability to characterize cells from heterogeneous organs like the Here, we performed scRNA-seq using purified glomeruli to kidney. Although glomerular disorders are an important cause of CKD, a thorough characterization of the cells in the glomerulus has characterize all of the cell types and we analyzed their reaction remained challenging due to the technical difficulties of isolating to four common types of kidney injury: immune, metabolic, undamaged cells, especially from glomeruli of diseased animals. toxic, and genetic injury. Our work, which includes sequenc- This study provides a comprehensive single-cell atlas, based on ing of approximately 75,000 glomerular cells, provides a com- approximately 75,000 cells, from glomeruli of healthy mice and prehensive transcriptional signature of all cell types in the mice injured in four ways, including all cell types present. The data set will be a valuable resource for generating precise tools to in- glomerulus, including those that have not been well charac- terrogate specific glomerular cell types and in identifying genes terized previously, such as mesangial cells, PECs, juxtaglomer- involved in the pathogenesis of glomerular diseases. ular (JG) cells, and arteriolar SMCs. Results from four disease models provide new insights into the glomerular response to acute injury and its progression to CKD. C57BL/6J mice were given a single intraperitoneal injection of 20 mg/kg doxorubicin hydrochloride (Pfizer). All animal proce- dures were conducted under protocols approved by the Institu- METHODS tional Animal Care and Use Committee at Genentech, and were performed in accordance with the Guide for the Care and Use of Reagents Laboratory Animals. The reagents used were as follows: Dynabeads M-450 Tosylac- Wwtr1 Yap1 tivated (Thermo Fisher Scientific), Liberase TM (Sigma-Al- Generation of and CKO Mice drich), DNase I (Sigma-Aldrich), trypsin (Thermo Fisher Homologous recombination and mouse embryonic stem (ES) 3–5 fi Scientific), Dispase II (Roche Applied Science), Collagenase cell technology was used to generate genetically modi ed D (Roche Applied Science), paraformaldehlyde (Electron Mi- mouse strains with a Wwtr1 or Yap1 CKO. For Wwtr1,agene 9 croscopy Sciences), and OCT (Sakura Finetek). targeting vector was constructed with a 1415-bp arm of 5 homology corresponding to GRCm38/mm10 chromosome 3 – 9 Antibodies (chr3): 57,577,558 57,576,144 and a 2066-bp arm of 3 ho- – Anti-FHL2, anti-SERPINE2, anti-RGS2, anti-ADAMTS5, mology corresponding to chr3: 57,574,633 57,572,568. The fl 1 anti–calponin 1, and anti–a smooth muscle actin antibodies 1510-bp region anked by loxP sites (exon 1 2) corresponds – were purchased from Abcam. Anti-PKCa antibody was pur- to chr3: 57,576,143 57,574,634. For Yap1, a gene-targeting 9 chased from Thermo Fisher Scientific. Anti-PDGFRb (APB5) vector was constructed with a 1990-bp arm of 5 homology – antibody was purchased from eBioscience. Anti-YAP/TAZ corresponding to GRCm38/mm10 chr9: 8,003,842 8,001,853 (D24E4) antibody was purchased from Cell Signaling. Anti– and a 2045-bp arm of 39 homology corresponding to chr9: b-actin (AC-15) and anti-vinculin (hVIN-1) antibodies were 8,001,304–7,999,260. The 548-bp region flanked by loxP sites purchased from Sigma-Aldrich. Phycoerythrin-conjugated (exon 2) corresponding to chr9: 8,001,852–8,001,305. anti-CCL2 (2H5) and phycoerythrin/Cy7-conjugated The final vector was confirmed by DNA sequencing, line- anti–TNF-a (MP6_XT22) antibodies were purchased from arized, and used to target C2 (C57BL/6N) ES cells using stan- Biolegend. Alexa Fluor–conjugated secondary antibodies dard methods (G418-positive and ganciclovir-negative selec- were purchased from Thermo Fisher Scientific. tion).6 C57BL/6N C2 ES cells7 were electroporated with 20 mg of linearized targeting vector DNA and cultured under Mice drug selection essentially as described. Positive clones were C57BL/6J and BTBR ob/ob (BTBR.Cg-Lepob/WiscJ) mice were identified using long-range PCR followed by sequence purchased from Jackson Laboratory. CD2AP-deficient mice confirmation. have been described previously.2 Generation of Wwtr1 Correctly targeted ES cells were subjected to karyotyping. (TAZ) and Yap1 (YAP) conditional knockout (CKO) strains Euploid gene-targeted ES cell clones were treated with Adeno- and CCL2-YPet reporter strain is described below. All animals FLP to remove PGK neomycin, ES cell clones were tested to were bred and housed at Genentech under specificpathogen- identify clones with no copies of the PGK neomycin cassette, free conditions with free access to chow and water and a and the correct sequence of the targeted allele was verified. The 12-hour day/night cycle. Only male mice were used. For the neph- presence of the Y chromosome was verified before microin- rotoxic serum nephritis model, age-matched C57BL/6J mice were jection into albino C57BL/6N embryos. Germline transmis- injected intravenously with 100 ml (for scRNA-seq analysis) or sion was obtained after crossing resulting chimeras with 2.3 ml/kg body wt (approximately 60 ml, for YAP/TAZ experi- C57BL/6N females. Genomic DNA from born pups was ments) of sheep anti-rat glomeruli serum (Probetex). For the screened by long-range PCR to verify the desired gene- doxorubicin nephropathy model, age- and weight-matched targeted structure before mouse colony expansion. Genotyping 2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH primers used to identify germline transmission were the follow- glomeruli and washed four to five times with HBSS until ing: Wwtr1.CKO primers were (1) TGGTCACAAGCGTTA samples were .98% pure by visual inspection under a AGC, (2) TGGTTCAAGCCTGTTAAATCA, and (3)CCTACT- microscope. CACCTGGCTGT; expected amplicon sizes were 255 bp for wild For preparation of single-cell suspensions, the purified glo- type, 289 bp for floxed, 440 bp for knockout. The Yap1.CKO meruli were resuspended in 1.25 ml of digestion buffer (0.5% primers were (1) TTGAGTTATGTAGGATGAGCATTA, (2) trypsin, 2.0 U/ml Dispase II, 2 U/ml Collagenase D, 10 U/ml GTATGTCACGGCAACCAA, and (3) TGACCAACCCTAAAG DNase I in prewarmed PBS without calcium and magnesium AGAGA; expected amplicon sizes were 246 bp for wild type, ions) and incubated at 37°C for 40–60 minutes with constant 280 bp for floxed, 320 bp for knockout.