Single-Cell Transcriptome Profiling of the Kidney Glomerulus Identifies Key Cell Types and Reactions to Injury

Total Page:16

File Type:pdf, Size:1020Kb

Load more

BASIC RESEARCH www.jasn.org Single-Cell Transcriptome Profiling of the Kidney Glomerulus Identifies Key Cell Types and Reactions to Injury Jun-Jae Chung ,1 Leonard Goldstein ,2 Ying-Jiun J. Chen,2 Jiyeon Lee ,1 Joshua D. Webster,3 Merone Roose-Girma,2 Sharad C. Paudyal,4 Zora Modrusan,2 Anwesha Dey,5 and Andrey S. Shaw1 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background The glomerulus is a specialized capillary bed that is involved in urine production and BP control. Glomerular injury is a major cause of CKD, which is epidemic and without therapeutic options. Single-cell transcriptomics has radically improved our ability to characterize complex organs, such as the kidney. Cells of the glomerulus, however, have been largely underrepresented in previous single-cell kidney studies due to their paucity and intractability. Methods Single-cell RNA sequencing comprehensively characterized the types of cells in the glomerulus from healthy mice and from four different disease models (nephrotoxic serum nephritis, diabetes, doxo- rubicin toxicity, and CD2AP deficiency). Results Allcelltypesintheglomeruluswereidentified using unsupervised clustering analysis. Novel marker genes and gene signatures of mesangial cells, vascular smooth muscle cells of the afferent and efferent arteri- oles, parietal epithelial cells, and three types of endothelial cells were identified. Analysis of the disease models revealed cell type–specific and injury type–specific responses in the glomerulus, including acute activation of the Hippo pathway in podocytes after nephrotoxic immune injury. Conditional deletion of YAP or TAZ resulted in more severe and prolonged proteinuria in response to injury, as well as worse glomerulosclerosis. Conclusions Generation of comprehensive high-resolution, single-cell transcriptomic profiles of the glo- merulus from healthy and injured mice provides resources to identify novel disease-related genes and pathways. JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2020020220 The glomerulus, the site of filtration in the kidney, mechanisms are used to restore function after injury is a capillary bed composed of endothelial cells, po- or how acute glomerular injury progresses to chronic docytes, and mesangial cells, as well as less abun- dant cell types, such as the parietal epithelial cells (PECs) and vascular smooth muscle cells (SMCs) Received March 13, 2020. Accepted June 7, 2020. (Supplemental Figure 1). Loss of glomerular func- Published online ahead of print. Publication date available at tion is the most common cause of CKD, a major www.jasn.org. health care problem affecting approximately 15% Present address: Dr. Sharad C. Paudyal, Department of Radiation 1 of the population. Glomerular injury is caused by Oncology, Dana-Farber Cancer Institute, Brigham and Women’s factors such as diabetes and hypertension, as well as Hospital, Harvard Medical School, Boston, Massachusetts. by immune injury. Glomeruli are particularly sus- Correspondence: Dr. Andrey S. Shaw, Department of Research ceptible to injury because podocytes are largely un- Biology, Genentech, 1 DNA Way, MS93b, South San Francisco, able to regenerate and, therefore, tissue damage is CA 94080. Email: [email protected] considered irreversible. It is not known what reparative Copyright © 2020 by the American Society of Nephrology JASN 31: ccc–ccc, 2020 ISSN : 1046-6673/3110-ccc 1 BASIC RESEARCH www.jasn.org fibrosis. Despite their critical roles in kidney function and disease, Significance Statement cells of the glomerulus have largely been underrepresented in pre- vious kidney single-cell RNA sequencing (scRNA-seq) studies due Single-cell transcriptomics techniques have revolutionized the to their paucity and difficulty of isolation. ability to characterize cells from heterogeneous organs like the Here, we performed scRNA-seq using purified glomeruli to kidney. Although glomerular disorders are an important cause of CKD, a thorough characterization of the cells in the glomerulus has characterize all of the cell types and we analyzed their reaction remained challenging due to the technical difficulties of isolating to four common types of kidney injury: immune, metabolic, undamaged cells, especially from glomeruli of diseased animals. toxic, and genetic injury. Our work, which includes sequenc- This study provides a comprehensive single-cell atlas, based on ing of approximately 75,000 glomerular cells, provides a com- approximately 75,000 cells, from glomeruli of healthy mice and prehensive transcriptional signature of all cell types in the mice injured in four ways, including all cell types present. The data set will be a valuable resource for generating precise tools to in- glomerulus, including those that have not been well charac- terrogate specific glomerular cell types and in identifying genes terized previously, such as mesangial cells, PECs, juxtaglomer- involved in the pathogenesis of glomerular diseases. ular (JG) cells, and arteriolar SMCs. Results from four disease models provide new insights into the glomerular response to acute injury and its progression to CKD. C57BL/6J mice were given a single intraperitoneal injection of 20 mg/kg doxorubicin hydrochloride (Pfizer). All animal proce- dures were conducted under protocols approved by the Institu- METHODS tional Animal Care and Use Committee at Genentech, and were performed in accordance with the Guide for the Care and Use of Reagents Laboratory Animals. The reagents used were as follows: Dynabeads M-450 Tosylac- Wwtr1 Yap1 tivated (Thermo Fisher Scientific), Liberase TM (Sigma-Al- Generation of and CKO Mice drich), DNase I (Sigma-Aldrich), trypsin (Thermo Fisher Homologous recombination and mouse embryonic stem (ES) 3–5 fi Scientific), Dispase II (Roche Applied Science), Collagenase cell technology was used to generate genetically modi ed D (Roche Applied Science), paraformaldehlyde (Electron Mi- mouse strains with a Wwtr1 or Yap1 CKO. For Wwtr1,agene 9 croscopy Sciences), and OCT (Sakura Finetek). targeting vector was constructed with a 1415-bp arm of 5 homology corresponding to GRCm38/mm10 chromosome 3 – 9 Antibodies (chr3): 57,577,558 57,576,144 and a 2066-bp arm of 3 ho- – Anti-FHL2, anti-SERPINE2, anti-RGS2, anti-ADAMTS5, mology corresponding to chr3: 57,574,633 57,572,568. The fl 1 anti–calponin 1, and anti–a smooth muscle actin antibodies 1510-bp region anked by loxP sites (exon 1 2) corresponds – were purchased from Abcam. Anti-PKCa antibody was pur- to chr3: 57,576,143 57,574,634. For Yap1, a gene-targeting 9 chased from Thermo Fisher Scientific. Anti-PDGFRb (APB5) vector was constructed with a 1990-bp arm of 5 homology – antibody was purchased from eBioscience. Anti-YAP/TAZ corresponding to GRCm38/mm10 chr9: 8,003,842 8,001,853 (D24E4) antibody was purchased from Cell Signaling. Anti– and a 2045-bp arm of 39 homology corresponding to chr9: b-actin (AC-15) and anti-vinculin (hVIN-1) antibodies were 8,001,304–7,999,260. The 548-bp region flanked by loxP sites purchased from Sigma-Aldrich. Phycoerythrin-conjugated (exon 2) corresponding to chr9: 8,001,852–8,001,305. anti-CCL2 (2H5) and phycoerythrin/Cy7-conjugated The final vector was confirmed by DNA sequencing, line- anti–TNF-a (MP6_XT22) antibodies were purchased from arized, and used to target C2 (C57BL/6N) ES cells using stan- Biolegend. Alexa Fluor–conjugated secondary antibodies dard methods (G418-positive and ganciclovir-negative selec- were purchased from Thermo Fisher Scientific. tion).6 C57BL/6N C2 ES cells7 were electroporated with 20 mg of linearized targeting vector DNA and cultured under Mice drug selection essentially as described. Positive clones were C57BL/6J and BTBR ob/ob (BTBR.Cg-Lepob/WiscJ) mice were identified using long-range PCR followed by sequence purchased from Jackson Laboratory. CD2AP-deficient mice confirmation. have been described previously.2 Generation of Wwtr1 Correctly targeted ES cells were subjected to karyotyping. (TAZ) and Yap1 (YAP) conditional knockout (CKO) strains Euploid gene-targeted ES cell clones were treated with Adeno- and CCL2-YPet reporter strain is described below. All animals FLP to remove PGK neomycin, ES cell clones were tested to were bred and housed at Genentech under specificpathogen- identify clones with no copies of the PGK neomycin cassette, free conditions with free access to chow and water and a and the correct sequence of the targeted allele was verified. The 12-hour day/night cycle. Only male mice were used. For the neph- presence of the Y chromosome was verified before microin- rotoxic serum nephritis model, age-matched C57BL/6J mice were jection into albino C57BL/6N embryos. Germline transmis- injected intravenously with 100 ml (for scRNA-seq analysis) or sion was obtained after crossing resulting chimeras with 2.3 ml/kg body wt (approximately 60 ml, for YAP/TAZ experi- C57BL/6N females. Genomic DNA from born pups was ments) of sheep anti-rat glomeruli serum (Probetex). For the screened by long-range PCR to verify the desired gene- doxorubicin nephropathy model, age- and weight-matched targeted structure before mouse colony expansion. Genotyping 2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH primers used to identify germline transmission were the follow- glomeruli and washed four to five times with HBSS until ing: Wwtr1.CKO primers were (1) TGGTCACAAGCGTTA samples were .98% pure by visual inspection under a AGC, (2) TGGTTCAAGCCTGTTAAATCA, and (3)CCTACT- microscope. CACCTGGCTGT; expected amplicon sizes were 255 bp for wild For preparation of single-cell suspensions, the purified glo- type, 289 bp for floxed, 440 bp for knockout. The Yap1.CKO meruli were resuspended in 1.25 ml of digestion buffer (0.5% primers were (1) TTGAGTTATGTAGGATGAGCATTA, (2) trypsin, 2.0 U/ml Dispase II, 2 U/ml Collagenase D, 10 U/ml GTATGTCACGGCAACCAA, and (3) TGACCAACCCTAAAG DNase I in prewarmed PBS without calcium and magnesium AGAGA; expected amplicon sizes were 246 bp for wild type, ions) and incubated at 37°C for 40–60 minutes with constant 280 bp for floxed, 320 bp for knockout.
Recommended publications
  • ENSG Gene Encodes Effector TCR Pathway Costimulation Inhibitory/Exhaustion Synapse/Adhesion Chemokines/Receptors

    ENSG Gene Encodes Effector TCR Pathway Costimulation Inhibitory/Exhaustion Synapse/Adhesion Chemokines/Receptors

    ENSG Gene Encodes Effector TCR pathway Costimulation Inhibitory/exhaustion Synapse/adhesion Chemokines/receptors ENSG00000111537 IFNG IFNg x ENSG00000109471 IL2 IL-2 x ENSG00000232810 TNF TNFa x ENSG00000271503 CCL5 CCL5 x x ENSG00000139187 KLRG1 Klrg1 x ENSG00000117560 FASLG Fas ligand x ENSG00000121858 TNFSF10 TRAIL x ENSG00000134545 KLRC1 Klrc1 / NKG2A x ENSG00000213809 KLRK1 Klrk1 / NKG2D x ENSG00000188389 PDCD1 PD-1 x x ENSG00000117281 CD160 CD160 x x ENSG00000134460 IL2RA IL-2 receptor x subunit alpha ENSG00000110324 IL10RA IL-10 receptor x subunit alpha ENSG00000115604 IL18R1 IL-18 receptor 1 x ENSG00000115607 IL18RAP IL-18 receptor x accessory protein ENSG00000081985 IL12RB2 IL-12 receptor x beta 2 ENSG00000186810 CXCR3 CXCR3 x x ENSG00000005844 ITGAL CD11a x ENSG00000160255 ITGB2 CD18; Integrin x x beta-2 ENSG00000156886 ITGAD CD11d x ENSG00000140678 ITGAX; CD11c x x Integrin alpha-X ENSG00000115232 ITGA4 CD49d; Integrin x x alpha-4 ENSG00000169896 ITGAM CD11b; Integrin x x alpha-M ENSG00000138378 STAT4 Stat4 x ENSG00000115415 STAT1 Stat1 x ENSG00000170581 STAT2 Stat2 x ENSG00000126561 STAT5a Stat5a x ENSG00000162434 JAK1 Jak1 x ENSG00000100453 GZMB Granzyme B x ENSG00000145649 GZMA Granzyme A x ENSG00000180644 PRF1 Perforin 1 x ENSG00000115523 GNLY Granulysin x ENSG00000100450 GZMH Granzyme H x ENSG00000113088 GZMK Granzyme K x ENSG00000057657 PRDM1 Blimp-1 x ENSG00000073861 TBX21 T-bet x ENSG00000115738 ID2 ID2 x ENSG00000176083 ZNF683 Hobit x ENSG00000137265 IRF4 Interferon x regulatory factor 4 ENSG00000140968 IRF8 Interferon
  • Te2, Part Iii

    Te2, Part Iii

    TERMINOLOGIA EMBRYOLOGICA Second Edition International Embryological Terminology FIPAT The Federative International Programme for Anatomical Terminology A programme of the International Federation of Associations of Anatomists (IFAA) TE2, PART III Contents Caput V: Organogenesis Chapter 5: Organogenesis (continued) Systema respiratorium Respiratory system Systema urinarium Urinary system Systemata genitalia Genital systems Coeloma Coelom Glandulae endocrinae Endocrine glands Systema cardiovasculare Cardiovascular system Systema lymphoideum Lymphoid system Bibliographic Reference Citation: FIPAT. Terminologia Embryologica. 2nd ed. FIPAT.library.dal.ca. Federative International Programme for Anatomical Terminology, February 2017 Published pending approval by the General Assembly at the next Congress of IFAA (2019) Creative Commons License: The publication of Terminologia Embryologica is under a Creative Commons Attribution-NoDerivatives 4.0 International (CC BY-ND 4.0) license The individual terms in this terminology are within the public domain. Statements about terms being part of this international standard terminology should use the above bibliographic reference to cite this terminology. The unaltered PDF files of this terminology may be freely copied and distributed by users. IFAA member societies are authorized to publish translations of this terminology. Authors of other works that might be considered derivative should write to the Chair of FIPAT for permission to publish a derivative work. Caput V: ORGANOGENESIS Chapter 5: ORGANOGENESIS
  • Genetic Associations Between Voltage-Gated Calcium Channels (Vgccs) and Autism Spectrum Disorder (ASD)

    Genetic Associations Between Voltage-Gated Calcium Channels (Vgccs) and Autism Spectrum Disorder (ASD)

    Liao and Li Molecular Brain (2020) 13:96 https://doi.org/10.1186/s13041-020-00634-0 REVIEW Open Access Genetic associations between voltage- gated calcium channels and autism spectrum disorder: a systematic review Xiaoli Liao1,2 and Yamin Li2* Abstract Objectives: The present review systematically summarized existing publications regarding the genetic associations between voltage-gated calcium channels (VGCCs) and autism spectrum disorder (ASD). Methods: A comprehensive literature search was conducted to gather pertinent studies in three online databases. Two authors independently screened the included records based on the selection criteria. Discrepancies in each step were settled through discussions. Results: From 1163 resulting searched articles, 28 were identified for inclusion. The most prominent among the VGCCs variants found in ASD were those falling within loci encoding the α subunits, CACNA1A, CACNA1B, CACN A1C, CACNA1D, CACNA1E, CACNA1F, CACNA1G, CACNA1H, and CACNA1I as well as those of their accessory subunits CACNB2, CACNA2D3, and CACNA2D4. Two signaling pathways, the IP3-Ca2+ pathway and the MAPK pathway, were identified as scaffolds that united genetic lesions into a consensus etiology of ASD. Conclusions: Evidence generated from this review supports the role of VGCC genetic variants in the pathogenesis of ASD, making it a promising therapeutic target. Future research should focus on the specific mechanism that connects VGCC genetic variants to the complex ASD phenotype. Keywords: Autism spectrum disorder, Voltage-gated calcium
  • Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse

    Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only.
  • 3034.Full.Pdf

    3034.Full.Pdf

    Characterization of the CD200 Receptor Family in Mice and Humans and Their Interactions with CD200 This information is current as Gavin J. Wright, Holly Cherwinski, Mildred Foster-Cuevas, of September 28, 2021. Gary Brooke, Michael J. Puklavec, Mike Bigler, Yaoli Song, Maria Jenmalm, Dan Gorman, Terri McClanahan, Man-Ru Liu, Marion H. Brown, Jonathon D. Sedgwick, Joseph H. Phillips and A. Neil Barclay J Immunol 2003; 171:3034-3046; ; Downloaded from doi: 10.4049/jimmunol.171.6.3034 http://www.jimmunol.org/content/171/6/3034 References This article cites 39 articles, 20 of which you can access for free at: http://www.jimmunol.org/ http://www.jimmunol.org/content/171/6/3034.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on September 28, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Characterization of the CD200 Receptor Family in Mice and Humans and Their Interactions with CD2001 Gavin J.
  • Age-Dependent Myocardial Transcriptomic Changes in the Rat

    Age-Dependent Myocardial Transcriptomic Changes in the Rat

    Revista Română de Medicină de Laborator Vol. 22, Nr. 1, Martie, 2014 9 Research article DOI: 10.2478/rrlm-2014-0001 Age-dependent myocardial transcriptomic changes in the rat. Novel insights into atrial and ventricular arrhythmias pathogenesis Modificări transcriptomice dependente de vârstă în miocardul de șobolan. Noi aspecte referitoare la patogeneza aritmiilor atriale și ventriculare Alina Scridon1,2, Emmanuelle Fouilloux-Meugnier3, Emmanuelle Loizon3, Marcel Perian1, Sophie Rome3, Claude Julien2, Christian Barrès2, Philippe Chevalier2,4 1.Physiology Department, University of Medicine and Pharmacy of Tîrgu Mureș, 540139, Tîrgu Mureș, Romania 2. Unité de Neurocardiologie, EA4612, Université Lyon 1, F-69008, Lyon, France 3. Unité 1060 INSERM CarMen, Université Lyon 1, F-69008, Lyon, France 4. Hospices Civils de Lyon, Hôpital Louis Pradel, Service de Rythmologie, 69500, Bron, France Abstract Background: Aging is associated with significantly increased prevalence of cardiac arrhythmias, but tran- scriptional events that underlie this process remain to be established. To gain deeper insight into molecular mech- anisms of aging-related cardiac arrhythmias, we performed mRNA expression analysis comparing atrial and ven- tricular myocardium from Wistar-Kyoto (WKY) rats of different ages. Methods: Atrial and ventricular sampling was performed in 3 groups (n=4 each) of young (14-week-old), adult (25-week-old), and aging (47-week-old) WKY rats. mRNA expressions of 89 genes involved in cardiac arrhythmogenicity were investigated using TaqMan Low Density Array analysis. Results: Of the 89 studied genes, 40 and 64 genes presented steady atrial and ventricu- lar expressions, respectively. All genes differentially expressed within the atria of WKY rats were up-regulated with advancing age, mainly the genes encoding for various K+, Ca2+, Na+ channels, and type 6 collagen.
  • The Mineralocorticoid Receptor Leads to Increased Expression of EGFR

    The Mineralocorticoid Receptor Leads to Increased Expression of EGFR

    www.nature.com/scientificreports OPEN The mineralocorticoid receptor leads to increased expression of EGFR and T‑type calcium channels that support HL‑1 cell hypertrophy Katharina Stroedecke1,2, Sandra Meinel1,2, Fritz Markwardt1, Udo Kloeckner1, Nicole Straetz1, Katja Quarch1, Barbara Schreier1, Michael Kopf1, Michael Gekle1 & Claudia Grossmann1* The EGF receptor (EGFR) has been extensively studied in tumor biology and recently a role in cardiovascular pathophysiology was suggested. The mineralocorticoid receptor (MR) is an important efector of the renin–angiotensin–aldosterone‑system and elicits pathophysiological efects in the cardiovascular system; however, the underlying molecular mechanisms are unclear. Our aim was to investigate the importance of EGFR for MR‑mediated cardiovascular pathophysiology because MR is known to induce EGFR expression. We identifed a SNP within the EGFR promoter that modulates MR‑induced EGFR expression. In RNA‑sequencing and qPCR experiments in heart tissue of EGFR KO and WT mice, changes in EGFR abundance led to diferential expression of cardiac ion channels, especially of the T‑type calcium channel CACNA1H. Accordingly, CACNA1H expression was increased in WT mice after in vivo MR activation by aldosterone but not in respective EGFR KO mice. Aldosterone‑ and EGF‑responsiveness of CACNA1H expression was confrmed in HL‑1 cells by Western blot and by measuring peak current density of T‑type calcium channels. Aldosterone‑induced CACNA1H protein expression could be abrogated by the EGFR inhibitor AG1478. Furthermore, inhibition of T‑type calcium channels with mibefradil or ML218 reduced diameter, volume and BNP levels in HL‑1 cells. In conclusion the MR regulates EGFR and CACNA1H expression, which has an efect on HL‑1 cell diameter, and the extent of this regulation seems to depend on the SNP‑216 (G/T) genotype.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Examination of the Transcription Factors Acting in Bone Marrow

    Examination of the Transcription Factors Acting in Bone Marrow

    THESIS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY (PHD) Examination of the transcription factors acting in bone marrow derived macrophages by Gergely Nagy Supervisor: Dr. Endre Barta UNIVERSITY OF DEBRECEN DOCTORAL SCHOOL OF MOLECULAR CELL AND IMMUNE BIOLOGY DEBRECEN, 2016 Table of contents Table of contents ........................................................................................................................ 2 1. Introduction ............................................................................................................................ 5 1.1. Transcriptional regulation ................................................................................................... 5 1.1.1. Transcriptional initiation .................................................................................................. 5 1.1.2. Co-regulators and histone modifications .......................................................................... 8 1.2. Promoter and enhancer sequences guiding transcription factors ...................................... 11 1.2.1. General transcription factors .......................................................................................... 11 1.2.2. The ETS superfamily ..................................................................................................... 17 1.2.3. The AP-1 and CREB proteins ........................................................................................ 20 1.2.4. Other promoter specific transcription factor families ...................................................
  • Genomic Profiling of Adult Acute Lymphoblastic Leukemia by Single

    Genomic Profiling of Adult Acute Lymphoblastic Leukemia by Single

    SUPPLEMENTARY APPENDIX Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonucleotide microarray and comparison to pediatric acute lymphoblastic leukemia Ryoko Okamoto,1 Seishi Ogawa,2 Daniel Nowak,1 Norihiko Kawamata,1 Tadayuki Akagi,1,3 Motohiro Kato,2 Masashi Sanada,2 Tamara Weiss,4 Claudia Haferlach,4 Martin Dugas,5 Christian Ruckert,5 Torsten Haferlach,4 and H. Phillip Koeffler1,6 1Division of Hematology and Oncology, Cedars-Sinai Medical Center, UCLA School of Medicine, Los Angeles, CA, USA; 2Cancer Genomics Project, Graduate School of Medicine, University of Tokyo, Tokyo, Japan; 3Department of Stem Cell Biology, Graduate School of Medical Science, Kanazawa University 4MLL Munich Leukemia Laboratory, Munich, Germany; 5Department of Medical Informatics and Biomathematics, University of Münster, Münster, Germany; 6Cancer Science Institute of Singapore, National University of Singapore, Singapore Citation: Okamoto R, Ogawa S, Nowak D, Kawamata N, Akagi T, Kato M, Sanada M, Weiss T, Haferlach C, Dugas M, Ruckert C, Haferlach T, and Koeffler HP. Genomic profiling of adult acute lymphoblastic leukemia by single nucleotide polymorphism oligonu- cleotide microarray and comparison to pediatric acute lymphoblastic leukemia. Haematologica 2010;95(9):1481-1488. doi:10.3324/haematol.2009.011114 Online Supplementary Data ed by PCR of genomic DNA and subsequent direct sequencing of SNP in a region of CNN-LOH in an ALL sample versus the corresponding Design and Methods matched normal sample (Online Supplementary
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Genome-Wide Analysis of Pax8 Binding Provides New Insights Into

    Genome-Wide Analysis of Pax8 Binding Provides New Insights Into

    Ruiz-Llorente et al. BMC Genomics 2012, 13:147 http://www.biomedcentral.com/1471-2164/13/147 RESEARCH ARTICLE Open Access Genome-wide analysis of Pax8 binding provides new insights into thyroid functions Sergio Ruiz-Llorente1,2, Enrique Carrillo SantadePau1,3,4, Ana Sastre-Perona1, Cristina Montero-Conde1,2, Gonzalo Gómez-López3, James A Fagin2, Alfonso Valencia3, David G Pisano3 and Pilar Santisteban1* Abstract Background: The transcription factor Pax8 is essential for the differentiation of thyroid cells. However, there are few data on genes transcriptionally regulated by Pax8 other than thyroid-related genes. To better understand the role of Pax8 in the biology of thyroid cells, we obtained transcriptional profiles of Pax8-silenced PCCl3 thyroid cells using whole genome expression arrays and integrated these signals with global cis-regulatory sequencing studies performed by ChIP-Seq analysis Results: Exhaustive analysis of Pax8 immunoprecipitated peaks demonstrated preferential binding to intragenic regions and CpG-enriched islands, which suggests a role of Pax8 in transcriptional regulation of orphan CpG regions. In addition, ChIP-Seq allowed us to identify Pax8 partners, including proteins involved in tertiary DNA structure (CTCF) and chromatin remodeling (Sp1), and these direct transcriptional interactions were confirmed in vivo. Moreover, both factors modulate Pax8-dependent transcriptional activation of the sodium iodide symporter (Nis) gene promoter. We ultimately combined putative and novel Pax8 binding sites with actual target gene expression regulation to define Pax8-dependent genes. Functional classification suggests that Pax8-regulated genes may be directly involved in important processes of thyroid cell function such as cell proliferation and differentiation, apoptosis, cell polarity, motion and adhesion, and a plethora of DNA/protein-related processes.