Validation of Genes Sensitive to P23 Levels in a Different MCF-7 Cell Line Overexpressing P23 [Clone #8]

Home , Kynureninase, RAD1 homolog, Shroom family member 2, UPK1A

Supplementary Figure 1 – Validation of genes sensitive to p23 levels in a different MCF-7 cell line overexpressing p23 [clone #8]. qRT-PCR experiments were performed to show the relative fold-change (RFC) in the expression of six genes from Figure 1c between

MCF-7 control (white bars) and MCF-7+p23 (#8) cells (black bars). Data are means of three independent experiments, normalized to

GAPDH, and presented as RFC from that of MCF-7 control cells, set to 1. Error bars represent standard deviation.

Supplementary Figure 2 – Genes most upregulated or downregulated by p23 overexpression are also overexpressed or under- expressed in invasive breast cancers

Differential analyses of microarray datasets from invasive breast cancer subgroups (listed in the Legend) were performed using the

Oncomine database (www.oncomine.org) to determine if the ten genes most upregulated or the eighteen genes most downregulated ( >

5-fold, Tables S5-6) by p23 overexpression are also over- or under-expressed in invasive breast cancers. Shown are five of the 10 upregulated and 11 of the 18 downregulated genes that are significantly over- or under-expressed in at least one invasive breast cancer dataset (p-value < 0.05) (* designates those genes that are not considered significant using Oncomine differential analysis, but are associated with invasive cancers in referenced literature). Over-expressed genes ranked highest, based on significance, within a particular dataset are designated with red boxes (or dark blue boxes for under-expressed genes). Pink and light blue boxes indicate genes that are statistically significant, but with lower gene rank. White boxes designate genes that are not statistically significant within a given dataset. Grey boxes indicate that gene expression was not measured for a particular dataset. Supplementary Figure 3 – p23 mediated changes in gene expression upon inhibition of Hsp90

A) MCF-7+p23 cells were treated with either DMSO vehicle or 1μM GA for two hours prior to protein extraction. p23-Hsp90 co- immunoprecipitation experiments were performed following cell lysis [50mM Hepes, pH 7.6, 150mM NaCl, 1mM EDTA, 1mM

EGTA, 1mM NaF, 1% Triton X-100, and 10% glycerol, 3mM DTT, 1mM PMSF, 5mM ATP, 20mM sodium molybdinate and protease inhibitor cocktail (Sigma)] and pre- cleared with protein-G agarose beads (Roche). Protein lysate (8mg) was incubated overnight at 4°C with 10μg HA.11 antibody (Covance) and 0.2% input and 1/5 of the IP reaction was immunoblotted with anti-Hsp90

(1:1000; Transduction Laboratories, H38220) or p23. B) MCF-7+p23 cells were hormone-starved for three days and treated for 48 hours with GA (left panel) or 24 hours with 17-AAG (right panel). RNA was extracted and qRT-PCR performed. Data are means, normalized to 28S (left panel) or GAPDH (right panel), and expressed as relative fold-change (RFC) in gene expression to vehicle treated MCF-7+p23 cells, set to 1. Error bars represent standard deviation.

Supplementary Figure 4 – p23 levels can influence the estrogen sensitivity of some, but not all genes

Venn diagrams show the distribution of estrogen sensitivity of 357 genes identified in control and MCF-7+p23 cells. 116 were sensitive to E2 in both cell types (green overlap; 47 induced, 69 repressed). There were 51 induced and 47 repressed genes in control cells (yellow circles) that were not induced in MCF-7+p23 cells, suggesting these genes were made unresponsive to E2 by p23 overexpression. Conversely, 65 genes were induced and 78 repressed by E2 only in MCF-7+p23 cells, suggesting that p23 overexpression makes these genes more responsive to E2 (blue circles). When examined closely, the majority of the 65 genes that were uniquely induced or downregulated by E2 in the MCF-7+p23 cells displayed between a 1.2 and 1.9-fold change in mRNA expression by E2 in control cells and greater than 2-fold change in MCF-7+p23 cells (data not shown). There were also a small number of genes (11) not regulated by E2 in control cells (fold change < 1.2), but induced (or repressed) 2-fold or more by E2 upon p23 overexpression. Therefore, these genes can be classified as being highly reactive to E2 by p23 overexpression and are listed in

Supplementary Table 7.

Supplementary Figure 5 – Semi-quantitative analysis of ER recruitment to PMP22 and ABCC3 EREs

A schematic representation of the PMP22 and ABCC3 loci. Arrows represent transcriptional start sites (TSS), white boxes represent exons, the stripped boxes represent the ER binding elements (ERE) as determined by global ChIP-Chip analysis and black boxes represent the control upstream sequences (UPS). ChIP assays were preformed in MCF-7 control and MCF-7+p23 cells in the absence

(ethanol vehicle treated) and presence of E2 using an antibody against ER or equivalent amount of non-specific rabbit IgG (Sigma).

Relative levels of ER binding to 0.1% and 0.05% of the total input are shown by PCR and are representative of at least three independent experiments.

Supplementary Figure 6 - p23 expression in human breast cancer

A breast cancer tissue microarray containing 213 specimens was stained by immunohistochemistry with anti-p23 antibody and the intensity of p23 staining in the nucleus and cytoplasm was scored on a scale of 0 to 3+, with 3+ being the highest intensity staining.

Example specimens scored as 2+ (left panel) and 3+ (right panel) for cytoplasmic p23 from biopsies are shown. Insets magnify a portion of each image.

Supplementary Figure 7 – Subcellular distribution of p23 in MCF-7 control and MCF- 7+p23 cells as a function of ER agonist and antagonist treatment

Nuclear and cytoplasmic fractions were prepared using Pierce Biotechnology’s NE-PER Nuclear and Cytoplasmic Extraction

Reagents (78833, Pierce Biotechnology) according to manufacturer’s instructions, from 16h ethanol vehicle (-), 1nM 17--estradiol

(E), 100nM 4-OH-tamoxifen (T), or 100nM ICI 182,780 (I) treated MCF-7 control and MCF-7+p23 cells. Levels of p23, TFII-I, and

-tubulin were determined by immunoblotting using a TFII-I antibody (1:1000; Cell Signaling, 4562) or antibodies to p23 and tubulin as described previously in the Materials and Methods. Shown is a representative experiment that was repeated three times with similar results.

Supplementary Figure 8 – Enhanced activation of AKT and increased cytoplasmic phosphoproteome in MCF-7+p23 cells

A) The cytoplasmic and nucleoplasmic fractions from MCF-7 control and MCF-7+p23 cells were prepared as described in Narita et al. (Cell 2006 126:503-14) from cells pretreated for 30 min at 37°C with the phosphatase inhibitor Calyculin A (100ng/ml; Cell

Signaling, 9902) to stabilize the phosphoproteome. Fractions were immunoblotted for phospho-AKT S473 (1:1000; Cell Signaling,

9271), total AKT (1:1000; Cell Signaling, 9272), and tubulin as described in the Materials and Methods section. B) Cytoplasmic and nucleoplasmic fractions from MCF-7 control and MCF-7+p23 cells were also probed for phosphoproteins using phospho-AKT substrate antibody (1:1000, Cell Signaling, 9614). Arrowheads (black and white) indicate phosphoproteins in greater abundance in the p23 overexpressing cells relative to controls. The immunoreactivity was visualized using the Odyssey Infrared Imaging System.

Figure S1 MCF-7 MCF-7+p23 (clone #8) 140 25 10 120 20 8 100 80 15 6

RFC 60 10 4 40 5 2 20 0 0 0 PMP22 ABCC3 AGR2

1.4 1.4 1.2 1.2 1.2 1 1 1 0.8 0.8 0.8 0.6

RFC 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0 0 0 P8 TM4SF1 Sox3 Figure S2

* * Figure S3 A input IP:HA (p23)

1μM GA - + - +

Hsp90 WB:Hsp90

HA-p23 WB:p23 p23

2 2 MCF-7+p23_DMSO 4 MCF-7+p23_DMSO 25 MCF-7+p23_GA MCF-7+p23_17-AAG 20 1.5 3 1.5

15 1 2 1 RFC RFC 10

0.5 1 0.5 5

0 0 0 0 pS2 cmyc PMP22 ABCC3 AGR2 pS2 cmyc PMP22 ABCC3 AGR2 Figure S4

E2 Induced Genes E2 Repressed Genes

MCF7-WT MCF7-p23 MCF7-WT MCF7-p23

51 47 65 47 69 78

98 112 # of genes 116 147 differentially regulated by E2 Figure S5

PMP22 ABCC3

ERE UPS P2 UPS P ERE -395kb -6kb +1bp -3 kb +1bp +16kb

MCF-7 MCF-7 + p23

10nM E2 - + - + input input input input IgG ER IgG ER IgG ER IgG ER PMP22 ERE

PMP22 UPS

ABCC3 ERE ABCC3 UPS

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Figure S6

cytoplasmic p23 2+ cytoplasmic p23 3+ Figure S7

cytoplasmic nuclear MCF-7 MCF-7+p23 MCF-7 MCF-7+p23

E T I E T I E T I E T I HA-p23 p23

TFII-I

Tubulin Figure S8

A B cytoplasmic nuclear

MW MCF-7+p23 MCF-7 MCF-7 MCF-7+p23 170 130 MCF-7 MCF-7+p23 100 P-AKT 70 55 AKT 40 35 Tubulin 25

Phospho Akt Substrate Antibody Table S1 qRT-PCR Gene Expression Primers

GAPDH_F 5' - CCTCAACGACCACTTTGTCA - 3' GAPDH_R 5' - CCCTGTTGCTGTAGCCAAAT -3' 28S_F 5' - AAACTCTGGTGGAGGTCCGT -3' 28S_R 5' - CTTACCAAAAGTGGCCCACTA -3' pS2_F 5' - GAACAAGGTGATCTGCG -3' pS2_R 5' - TGGTATTAGGATAGAAGCACCA -3' PMP22_F 5' - GTGCTGCTGTTCGTCTCCAC -3' PMP22_R 5' - ATCAGTTGCGTGTCCATTGC -3' ABCC3_F 5' - TTGTCGTGGCTACATCATCC -3' ABCC3_R 5' - AAAAGGTCCGCCCAGGAG -3' AGR2_F 5' - ACTTGGATGAGTGCCCACACAG -3' AGR2_R 5' - CAGATTGAGGAGGACAAACTGCTC -3' Sox3_F 5’ - ACTCATCAGGTGCGAGAAGC – 3’ Sox3_R 5’ - GGGAAGGGTAGGCTTATCAA – 3’ p8_F 5’ - GAGGAAACTGGTGACCAAGC – 3’ p8_R 5’ - CCGTCTCTATTGCTGGGTGT -3’ TM4SF1_F 5’ - TTTGCTGCTCTCACCAACAG – 3’ TM4SF1_R 5’ - GTAGACTGTGGGGAGTATGTTACAC – 3’

Table S2 ChIP primers PMP22(ERE)F 5'- GCCGCATAAAATGTCACGCC -3' PMP22(ERE)R 5'- AAACCTACTTGGGGGAGTCTGC -3' PMP22(UPS)F 5'- TCCGTGGAACCTAAGTCTTGGAG-3' PMP22(UPS)R 5'- GCAACTGTGTCTTGGGAATCGC - 3' PMP22(P2)F 5'- GAGCCAGTTTCTCGGTCAAC -3' PMP22(P2)R 5'- GCGGCGACTTTTACTCGAA -3' ABCC3(ERE)F 5'- GCTGCCACAGCACTAAACTGT -3' ABCC3(ERE)R 5'- GAGTGAGGTCCGGGTTTTCT -3' ABCC3(UPS)F 5'- GCAAGGGGCTAAAAGGAATC -3' ABCC3(UPS)R 5'- AATGCTCCGAAGGGAGAGAG -3' ABCC3(P)F 5'- TCAGGTTAGGACTCGGTTGC -3' ABCC3(P)R 5'- CTAAGAAGGGTGGGACACTGC -3' Table S3 Summary of Gene Ontology (GO) categories for the p23 induced genes Biological Total Binomial Fold Process Probes Expected Matches p-value Enrichment

tryptophan metabolic process 6 0.07 3 3.64E-05 40.58 NAD biosynthetic and metabolic processes 7 0.09 3 6.31E-05 34.78 aromatic compound catabolic process 20 0.25 6 1.17E-07 24.35 fatty acid catabolic process 10 0.12 3 2.10E-04 24.35 prophase 7 0.09 2 3.06E-03 23.19 indole and derivative metabolic processes 11 0.14 3 2.87E-04 22.13 amino acid derivative catabolic process 27 0.33 7 3.09E-08 21.04 neurotransmitter catabolic process 16 0.2 4 3.73E-05 20.29 androgen metabolic process 12 0.15 3 3.79E-04 20.29 pyridine nucleotide biosynthetic process 13 0.16 3 4.88E-04 18.73 aromatic amino acid family catabolic process 14 0.17 3 6.15E-04 17.39 L-amino acid catabolic process 15 0.18 3 7.62E-04 16.23 carboxylic and organic acid catabolic process 15 0.18 3 7.62E-04 16.23 biogenic amine catabolic process 22 0.27 4 1.41E-04 14.75 neutral amino acid transport 17 0.21 3 1.12E-03 14.32 water-soluble vitamin biosynthetic process 18 0.22 3 1.33E-03 13.53 vitamin biosynthetic process 20 0.25 3 1.82E-03 12.17 sex determination 23 0.28 3 2.76E-03 10.58 Table S4 Associations Between p23 Expression and Breast Tumor Stage, Tumor Size (T), Node Status (N) and Metastasis (M)

#$ ! "$$&"! "!&% 23 &)! #56 ! ' "$ $&$%&% 1' 2"$ &%& " $! $" 43 ' $ " !%$(&"!% 2!3 0&"#% '$ & % #56 #56 0&"#% #56) '$ #56 & %

Table S5 Genes induced > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

Probesets Gene Symbol Induced by p23 Gene Title 210139_s_at PMP22 23.66 peripheral myelin protein 22 209493_at PDZD2 8.79 PDZ domain containing 2 206165_s_at CLCA2 8.40 chloride channel regulator 2 218820_at C14orf132 6.84 chromosome 14 open reading frame 132 213258_at TFPI 6.42 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 202391_at BASP1 5.28 brain abundant, membrane attached signal protein 1 204284_at PPP1R3C 5.20 protein phosphatase 1, regulatory (inhibitor) subunit 3C 209173_at AGR2 5.17 anterior gradient homolog 2 (Xenopus laevis) 210664_s_at TFPI 5.11 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 208161_s_at ABCC3 5.10 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 219789_at NPR3 5.09 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) 209676_at TFPI 5.08 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 212094_at PEG10 4.81 paternally expressed 10 207147_at DLX2 4.44 distal-less homeobox 2 209209_s_at FERMT2 4.35 fermitin family homolog 2 (Drosophila) 212509_s_at MXRA7 4.18 matrix-remodelling associated 7 209040_s_at PSMB8 4.16 proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7) 203335_at PHYH 4.14 phytanoyl-CoA 2-hydroxylase 202291_s_at MGP 3.82 matrix Gla protein 212092_at PEG10 3.80 paternally expressed 10 209210_s_at FERMT2 3.76 fermitin family homolog 2 (Drosophila) 204256_at ELOVL6 3.72 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 222001_x_at LOC728855 3.64 hypothetical LOC728855 204279_at PSMB9 3.58 proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional peptidase 2) 206166_s_at CLCA2 3.57 chloride channel regulator 2 215806_x_at TARP /// TRGC 3.54 TCR gamma alternate reading frame protein /// T cell receptor gamma constant 2 212945_s_at MGA 3.52 MAX gene associated 201818_at LPCAT1 3.51 lysophosphatidylcholine acyltransferase 1 217771_at GOLM1 3.48 golgi membrane protein 1 216920_s_at TARP /// TRGC 3.38 TCR gamma alternate reading frame protein /// T cell receptor gamma constant 2 214079_at DHRS2 3.35 dehydrogenase/reductase (SDR family) member 2 216092_s_at SLC7A8 3.29 solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 209641_s_at ABCC3 3.27 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 211144_x_at TARP /// TRGC 3.26 TCR gamma alternate reading frame protein /// T cell receptor gamma constant 2 214858_at PP14571 3.23 similar to hCG1777210 209522_s_at CRAT 3.22 carnitine acetyltransferase 201649_at UBE2L6 3.19 ubiquitin-conjugating enzyme E2L 6 209813_x_at TARP 3.17 TCR gamma alternate reading frame protein 202752_x_at SLC7A8 3.12 solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 204688_at SGCE 3.09 sarcoglycan, epsilon 204542_at ST6GALNAC2 3.08 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 209504_s_at PLEKHB1 2.98 pleckstrin homology domain containing, family B (evectins) member 1 Table S5 Genes induced > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

201963_at ACSL1 2.94 acyl-CoA synthetase long-chain family member 1 221024_s_at SLC2A10 2.92 solute carrier family 2 (facilitated glucose transporter), member 10 218313_s_at GALNT7 2.90 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7) 204351_at S100P 2.90 S100 calcium binding protein P 209684_at RIN2 2.89 Ras and Rab interactor 2 220987_s_at C11orf17 /// N 2.87 chromosome 11 open reading frame 17 /// NUAK family, SNF1-like kinase, 2 201976_s_at MYO10 2.87 myosin X 203874_s_at SMARCA1 2.83 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 210665_at TFPI 2.83 tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 206463_s_at DHRS2 2.81 dehydrogenase/reductase (SDR family) member 2 211712_s_at ANXA9 2.80 annexin A9 218574_s_at LMCD1 2.78 LIM and cysteine-rich domains 1 208083_s_at ITGB6 2.77 integrin, beta 6 202310_s_at COL1A1 2.76 collagen, type I, alpha 1 207275_s_at ACSL1 2.75 acyl-CoA synthetase long-chain family member 1 213397_x_at RNASE4 2.73 ribonuclease, RNase A family, 4 217248_s_at SLC7A8 2.70 solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 205083_at AOX1 2.69 aldehyde oxidase 1 201348_at GPX3 2.68 glutathione peroxidase 3 (plasma) 212314_at KIAA0746 /// S 2.67 KIAA0746 protein /// serine incorporator 2 214212_x_at FERMT2 2.67 fermitin family homolog 2 (Drosophila) 219911_s_at LOC10013429 2.67 similar to Solute carrier organic anion transporter family, member 4A1 217528_at CLCA2 2.64 chloride channel regulator 2 210868_s_at ELOVL6 2.61 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) 210085_s_at ANXA9 2.61 annexin A9 211371_at MAP2K5 2.59 mitogen-activated protein kinase kinase 5 207392_x_at UGT2B15 2.58 UDP glucuronosyltransferase 2 family, polypeptide B15 209460_at ABAT 2.54 4-aminobutyrate aminotransferase 221698_s_at CLEC7A 2.53 C-type lectin domain family 7, member A 218298_s_at C14orf159 2.52 chromosome 14 open reading frame 159 204967_at SHROOM2 2.52 shroom family member 2 221727_at SUB1 2.51 SUB1 homolog (S. cerevisiae) 210592_s_at SAT1 2.51 spermidine/spermine N1-acetyltransferase 1 206527_at ABAT 2.50 4-aminobutyrate aminotransferase 212311_at KIAA0746 /// S 2.49 KIAA0746 protein /// serine incorporator 2 219054_at C5orf23 2.49 chromosome 5 open reading frame 23 219872_at C4orf18 2.48 chromosome 4 open reading frame 18 209189_at FOS 2.47 v-fos FBJ murine osteosarcoma viral oncogene homolog 221933_at NLGN4X 2.47 neuroligin 4, X-linked 205845_at CACNA1H 2.44 calcium channel, voltage-dependent, T type, alpha 1H subunit 203567_s_at TRIM38 2.44 tripartite motif-containing 38 216252_x_at FAS 2.43 Fas (TNF receptor superfamily, member 6) 221577_x_at GDF15 2.43 growth differentiation factor 15 218325_s_at DIDO1 2.42 death inducer-obliterator 1 Table S5 Genes induced > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

202052_s_at RAI14 2.41 retinoic acid induced 14 214046_at FUT9 2.40 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) 202917_s_at S100A8 2.39 S100 calcium binding protein A8 206115_at EGR3 2.39 early growth response 3 206164_at CLCA2 2.38 chloride channel regulator 2 202784_s_at NNT 2.38 nicotinamide nucleotide transhydrogenase 203964_at NMI 2.37 N-myc (and STAT) interactor 203303_at DYNLT3 2.34 dynein, light chain, Tctex-type 3 212820_at DMXL2 2.34 Dmx-like 2 206685_at HCG4 2.32 HLA complex group 4 220467_at FLJ21272 2.32 hypothetical protein FLJ21272 211704_s_at SPIN2A /// SP 2.31 spindlin family, member 2A /// spindlin family, member 2B 213283_s_at SALL2 2.30 sal-like 2 (Drosophila) 221485_at B4GALT5 2.29 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 217388_s_at KYNU 2.28 kynureninase (L-kynurenine hydrolase) 211421_s_at RET 2.27 ret proto-oncogene 212739_s_at NME4 2.27 non-metastatic cells 4, protein expressed in 217867_x_at BACE2 2.25 beta-site APP-cleaving enzyme 2 203455_s_at SAT1 2.24 spermidine/spermine N1-acetyltransferase 1 202975_s_at RHOBTB3 2.24 Rho-related BTB domain containing 3 204844_at ENPEP 2.23 glutamyl aminopeptidase (aminopeptidase A) 214091_s_at GPX3 2.23 glutathione peroxidase 3 (plasma) 219327_s_at GPRC5C 2.22 G protein-coupled receptor, family C, group 5, member C 204780_s_at FAS 2.22 Fas (TNF receptor superfamily, member 6) 212503_s_at DIP2C 2.22 DIP2 disco-interacting protein 2 homolog C (Drosophila) 218269_at RNASEN 2.21 ribonuclease type III, nuclear 53720_at C19orf66 2.20 chromosome 19 open reading frame 66 209312_x_at HLA-DRB1 /// 2.20 major histocompatibility complex, class II, DR beta 1 219268_at ETNK2 2.19 ethanolamine kinase 2 219763_at DENND1A 2.19 DENN/MADD domain containing 1A 211056_s_at SRD5A1 2.19 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) 219572_at CADPS2 2.19 Ca++-dependent secretion activator 2 203200_s_at MTRR 2.19 5-methyltetrahydrofolate-homocysteine methyltransferase reductase 212504_at DIP2C 2.19 DIP2 disco-interacting protein 2 homolog C (Drosophila) 204675_at SRD5A1 2.18 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) 204385_at KYNU 2.17 kynureninase (L-kynurenine hydrolase) 208812_x_at HLA-C 2.17 major histocompatibility complex, class I, C 211518_s_at BMP4 2.15 bone morphogenetic protein 4 209101_at CTGF 2.14 connective tissue growth factor 209426_s_at AMACR 2.13 alpha-methylacyl-CoA racemase 204460_s_at RAD1 2.12 RAD1 homolog (S. pombe) 202883_s_at PPP2R1B 2.12 protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform 216687_x_at UGT2B15 2.12 UDP glucuronosyltransferase 2 family, polypeptide B15 210216_x_at RAD1 2.11 RAD1 homolog (S. pombe) Table S5 Genes induced > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

217889_s_at CYBRD1 2.10 cytochrome b reductase 1 200923_at LGALS3BP 2.10 lectin, galactoside-binding, soluble, 3 binding protein 221372_s_at P2RX2 2.10 purinergic receptor P2X, ligand-gated ion channel, 2 215719_x_at FAS 2.10 Fas (TNF receptor superfamily, member 6) 214624_at UPK1A 2.10 uroplakin 1A 218312_s_at ZSCAN18 2.10 zinc finger and SCAN domain containing 18 213618_at ARAP2 2.09 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 212543_at AIM1 2.08 absent in melanoma 1 205803_s_at TRPC1 2.08 transient receptor potential cation channel, subfamily C, member 1 209459_s_at ABAT 2.08 4-aminobutyrate aminotransferase 206022_at NDP 2.07 Norrie disease (pseudoglioma) 215193_x_at HLA-DRB1 /// 2.06 major histocompatibility complex, class II, DR beta 1 205120_s_at SGCB 2.06 sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) 219032_x_at OPN3 2.06 opsin 3 205316_at --- 2.06 --- 211689_s_at TMPRSS2 2.05 transmembrane protease, serine 2 202073_at OPTN 2.05 optineurin 204838_s_at MLH3 2.05 mutL homolog 3 (E. coli) 207038_at SLC16A6 2.05 solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 205082_s_at AOX1 2.05 aldehyde oxidase 1 214647_s_at HFE 2.04 hemochromatosis 203799_at CD302 2.04 CD302 molecule 201108_s_at THBS1 2.04 thrombospondin 1 202886_s_at PPP2R1B 2.03 protein phosphatase 2 (formerly 2A), regulatory subunit A, beta isoform 218429_s_at C19orf66 2.03 chromosome 19 open reading frame 66 220937_s_at ST6GALNAC4 2.03 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4 210663_s_at KYNU 2.03 kynureninase (L-kynurenine hydrolase) 212741_at MAOA 2.02 monoamine oxidase A 204527_at MYO5A 2.01 myosin VA (heavy chain 12, myoxin) 211113_s_at ABCG1 2.01 ATP-binding cassette, sub-family G (WHITE), member 1 219298_at ECHDC3 2.01 enoyl Coenzyme A hydratase domain containing 3 209747_at TGFB3 2.01 transforming growth factor, beta 3 208986_at TCF12 2.00 transcription factor 12 Table S6 Genes repressed > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

Probesets Gene Symbol Repressed by p23 Gene Title 209230_s_at NUPR1 14.15 nuclear protein 1 219795_at SLC6A14 9.47 solute carrier family 6 (amino acid transporter), member 14 209387_s_at TM4SF1 9.21 transmembrane 4 L six family member 1 209560_s_at DLK1 9.04 delta-like 1 homolog (Drosophila) 215034_s_at TM4SF1 8.32 transmembrane 4 L six family member 1 214633_at SOX3 7.88 SRY (sex determining region Y)-box 3 209386_at TM4SF1 7.76 transmembrane 4 L six family member 1 205347_s_at MGC39900 /// 7.45 thymosin beta15b /// thymosin beta 15a 203413_at NELL2 7.30 NEL-like 2 (chicken) 207739_s_at GAGE1 /// GAG 6.67 G antigen 1 /// G antigen 12F /// G antigen 12G 220793_at SAGE1 6.62 sarcoma antigen 1 213712_at ELOVL2 6.33 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 219753_at STAG3 6.16 stromal antigen 3 202345_s_at FABP5 /// FAB 6.03 fatty acid binding protein 5 (psoriasis-associated) 201669_s_at MARCKS 5.97 myristoylated alanine-rich protein kinase C substrate 206632_s_at APOBEC3B 5.83 apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B 219932_at SLC27A6 5.83 solute carrier family 27 (fatty acid transporter), member 6 206640_x_at GAGE12B /// G 5.75 G antigen 12B /// G antigen 12C 204913_s_at SOX11 5.28 SRY (sex determining region Y)-box 11 208235_x_at GAGE12F /// G 5.23 G antigen 12F /// G antigen 12G 201141_at GPNMB 4.92 glycoprotein (transmembrane) nmb 215116_s_at DNM1 4.87 dynamin 1 201670_s_at MARCKS 4.76 myristoylated alanine-rich protein kinase C substrate 206698_at XK 4.55 X-linked Kx blood group (McLeod syndrome) 220922_s_at SPANXA1 /// S 4.52 sperm protein associated with the nucleus, X-linked, family member A1 203355_s_at PSD3 4.27 pleckstrin and Sec7 domain containing 3 203710_at ITPR1 4.26 inositol 1,4,5-triphosphate receptor, type 1 204597_x_at STC1 4.20 stanniocalcin 1 204602_at DKK1 4.19 dickkopf homolog 1 (Xenopus laevis) 219631_at LRP12 4.18 low density lipoprotein-related protein 12 205357_s_at AGTR1 4.13 angiotensin II receptor, type 1 220253_s_at LRP12 4.03 low density lipoprotein-related protein 12 207302_at SGCG 3.95 sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein) 220029_at ELOVL2 3.93 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 205097_at SLC26A2 3.90 solute carrier family 26 (sulfate transporter), member 2 216944_s_at ITPR1 3.80 inositol 1,4,5-triphosphate receptor, type 1 204041_at MAOB 3.69 monoamine oxidase B Table S6 Genes repressed > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

209687_at CXCL12 3.67 chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) 207086_x_at GAGE1 /// GAG 3.62 G antigen 1 /// G antigen 12B 214414_x_at HBA1 /// HBA2 3.62 hemoglobin, alpha 1 /// hemoglobin, alpha 2 206935_at PCDH8 3.61 protocadherin 8 210400_at GRIN2C 3.57 glutamate receptor, ionotropic, N-methyl D-aspartate 2C 208155_x_at GAGE1 /// GAG 3.56 G antigen 1 /// G antigen 12F 211745_x_at HBA1 /// HBA2 3.56 hemoglobin, alpha 1 /// hemoglobin, alpha 2 218613_at PSD3 3.52 pleckstrin and Sec7 domain containing 3 212192_at KCTD12 3.48 potassium channel tetramerisation domain containing 12 209458_x_at HBA1 /// HBA2 3.41 hemoglobin, alpha 1 /// hemoglobin, alpha 2 217414_x_at HBA1 /// HBA2 3.40 hemoglobin, alpha 1 /// hemoglobin, alpha 2 202124_s_at TRAK2 3.39 trafficking protein, kinesin binding 2 215189_at KRT86 /// LOC 3.34 keratin 86 /// hypothetical protein LOC100134394 203232_s_at ATXN1 3.34 ataxin 1 209120_at NR2F2 3.32 nuclear receptor subfamily 2, group F, member 2 214612_x_at MAGEA2 /// MA 3.30 melanoma antigen family A, 2 218692_at GOLSYN 3.29 Golgi-localized protein 205691_at SYNGR3 3.28 synaptogyrin 3 203231_s_at ATXN1 3.24 ataxin 1 210652_s_at TTC39A 3.24 tetratricopeptide repeat domain 39A 209942_x_at MAGEA3 3.18 melanoma antigen family A, 3 218501_at ARHGEF3 3.17 Rho guanine nucleotide exchange factor (GEF) 3 202125_s_at TRAK2 3.15 trafficking protein, kinesin binding 2 204472_at GEM 3.15 GTP binding protein overexpressed in skeletal muscle 204915_s_at SOX11 3.10 SRY (sex determining region Y)-box 11 214472_at HIST1H2AD /// 3.09 histone cluster 1, H2ad /// histone cluster 1, H3a 203037_s_at MTSS1 3.08 metastasis suppressor 1 202350_s_at MATN2 3.08 matrilin 2 211699_x_at HBA1 /// HBA2 3.08 hemoglobin, alpha 1 /// hemoglobin, alpha 2 204018_x_at HBA1 /// HBA2 3.05 hemoglobin, alpha 1 /// hemoglobin, alpha 2 207802_at CRISP3 3.04 cysteine-rich secretory protein 3 215465_at ABCA12 3.04 ATP-binding cassette, sub-family A (ABC1), member 12 212063_at CD44 3.01 CD44 molecule (Indian blood group) 204914_s_at SOX11 2.91 SRY (sex determining region Y)-box 11 203184_at FBN2 2.90 fibrillin 2 219578_s_at CPEB1 2.86 cytoplasmic polyadenylation element binding protein 1 210387_at HIST1H2BC /// 2.86 histone cluster 1, H2bc /// histone cluster 1, H2be 202149_at NEDD9 2.85 neural precursor cell expressed, developmentally down-regulated 9 205548_s_at BTG3 2.82 BTG family, member 3 Table S6 Genes repressed > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

203153_at IFIT1 2.82 interferon-induced protein with tetratricopeptide repeats 1 201505_at LAMB1 2.80 laminin, beta 1 203324_s_at CAV2 2.79 caveolin 2 203373_at SOCS2 2.78 suppressor of cytokine signaling 2 222154_s_at LOC26010 2.78 viral DNA polymerase-transactivated protein 6 212599_at AUTS2 2.75 autism susceptibility candidate 2 218559_s_at MAFB 2.74 v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 221606_s_at NSBP1 2.74 nucleosomal binding protein 1 201034_at ADD3 2.72 adducin 3 (gamma) 205239_at AREG /// AREG 2.72 amphiregulin /// amphiregulin B 203425_s_at IGFBP5 2.71 insulin-like growth factor binding protein 5 219615_s_at KCNK5 2.69 potassium channel, subfamily K, member 5 204595_s_at STC1 2.68 stanniocalcin 1 204086_at PRAME 2.67 preferentially expressed antigen in melanoma 219335_at ARMCX5 2.65 armadillo repeat containing, X-linked 5 215073_s_at NR2F2 2.64 nuclear receptor subfamily 2, group F, member 2 204528_s_at NAP1L1 2.63 nucleosome assembly protein 1-like 1 208181_at HIST1H4A /// 2.60 histone cluster 1, H4a 203426_s_at IGFBP5 2.59 insulin-like growth factor binding protein 5 203354_s_at PSD3 2.57 pleckstrin and Sec7 domain containing 3 211417_x_at GGT1 2.55 gamma-glutamyltransferase 1 211323_s_at ITPR1 2.53 inositol 1,4,5-triphosphate receptor, type 1 215779_s_at HIST1H2BC /// 2.53 histone cluster 1, H2bc 208284_x_at GGT1 2.52 gamma-glutamyltransferase 1 220217_x_at SPANXC 2.51 SPANX family, member C 207131_x_at GGT1 2.50 gamma-glutamyltransferase 1 213110_s_at COL4A5 2.49 collagen, type IV, alpha 5 207663_x_at GAGE3 2.46 G antigen 3 203566_s_at AGL 2.45 amylo-1, 6-glucosidase, 4-alpha-glucanotransferase 205531_s_at GLS2 2.45 glutaminase 2 (liver, mitochondrial) 204596_s_at STC1 2.45 stanniocalcin 1 218922_s_at LASS4 2.44 LAG1 homolog, ceramide synthase 4 218561_s_at LYRM4 2.43 LYR motif containing 4 222028_at ZNF45 2.41 zinc finger protein 45 214440_at NAT1 2.41 N-acetyltransferase 1 (arylamine N-acetyltransferase) 212977_at CXCR7 2.41 chemokine (C-X-C motif) receptor 7 209919_x_at GGT1 2.41 gamma-glutamyltransferase 1 200907_s_at PALLD 2.40 palladin, cytoskeletal associated protein 213134_x_at BTG3 2.40 BTG family, member 3 Table S6 Genes repressed > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

209015_s_at DNAJB6 2.39 DnaJ (Hsp40) homolog, subfamily B, member 6 200897_s_at PALLD 2.39 palladin, cytoskeletal associated protein 203758_at CTSO 2.38 cathepsin O 204285_s_at PMAIP1 2.37 phorbol-12-myristate-13-acetate-induced protein 1 202088_at SLC39A6 2.37 solute carrier family 39 (zinc transporter), member 6 203424_s_at IGFBP5 2.36 insulin-like growth factor binding protein 5 217437_s_at TACC1 2.36 transforming, acidic coiled-coil containing protein 1 207304_at ZNF45 2.33 zinc finger protein 45 214455_at HIST1H2BC /// 2.33 histone cluster 1, H2bc 208762_at SUMO1 2.32 SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) 201753_s_at ADD3 2.31 adducin 3 (gamma) 215603_x_at GGT1 /// GGT2 2.31 gamma-glutamyltransferase 1 205509_at CPB1 2.30 carboxypeptidase B1 (tissue) 203438_at STC2 2.29 stanniocalcin 2 219312_s_at ZBTB10 2.28 zinc finger and BTB domain containing 10 201327_s_at CCT6A 2.28 chaperonin containing TCP1, subunit 6A (zeta 1) 202003_s_at ACAA2 2.28 acetyl-Coenzyme A acyltransferase 2 216568_x_at --- 2.27 --- 212158_at SDC2 2.27 syndecan 2 221986_s_at KLHL24 2.26 kelch-like 24 (Drosophila) 203372_s_at SOCS2 2.25 suppressor of cytokine signaling 2 210762_s_at DLC1 2.24 deleted in liver cancer 1 214481_at HIST1H2AM 2.24 Histone cluster 1, H2am (HIST1H2AM), mRNA 220254_at LRP12 2.23 low density lipoprotein-related protein 12 217989_at HSD17B11 2.22 hydroxysteroid (17-beta) dehydrogenase 11 212792_at DPY19L1 2.22 dpy-19-like 1 (C. elegans) 221261_x_at MAGED4 /// M 2.21 melanoma antigen family D, 4 /// melanoma antigen family D, 4B 200962_at RPL31 2.21 ribosomal protein L31 212989_at SGMS1 2.21 sphingomyelin synthase 1 205133_s_at HSPE1 2.20 heat shock 10kDa protein 1 (chaperonin 10) 210612_s_at SYNJ2 2.20 synaptojanin 2 209681_at SLC19A2 2.20 solute carrier family 19 (thiamine transporter), member 2 211416_x_at GGTLC1 2.20 gamma-glutamyltransferase light chain 1 203108_at GPRC5A 2.18 G protein-coupled receptor, family C, group 5, member A 201691_s_at TPD52 2.17 tumor protein D52 219850_s_at EHF 2.16 ets homologous factor 214827_at PARD6B 2.16 par-6 partitioning defective 6 homolog beta (C. elegans) 200662_s_at TOMM20 2.16 translocase of outer mitochondrial membrane 20 homolog (yeast) 214957_at ACTL8 2.15 actin-like 8 Table S6 Genes repressed > 2-fold in MCF7+p23 cells compared to control MCF-7 cells

208343_s_at NR5A2 2.15 nuclear receptor subfamily 5, group A, member 2 211958_at IGFBP5 2.15 insulin-like growth factor binding protein 5 204507_s_at PPP3R1 /// WD 2.15 protein phosphatase 3 (formerly 2B), regulatory subunit B, alpha isoform 206898_at CDH19 2.14 cadherin 19, type 2 204286_s_at PMAIP1 2.14 phorbol-12-myristate-13-acetate-induced protein 1 209369_at ANXA3 2.13 annexin A3 212828_at SYNJ2 2.13 synaptojanin 2 213572_s_at SERPINB1 2.11 serpin peptidase inhibitor, clade B (ovalbumin), member 1 211317_s_at CFLAR 2.11 CASP8 and FADD-like apoptosis regulator 212716_s_at EIF3K 2.11 eukaryotic translation initiation factor 3, subunit K 207325_x_at MAGEA1 2.11 melanoma antigen family A, 1 (directs expression of antigen MZ2-E) 202478_at TRIB2 2.10 tribbles homolog 2 (Drosophila) 201843_s_at EFEMP1 2.09 EGF-containing fibulin-like extracellular matrix protein 1 219061_s_at LAGE3 2.09 L antigen family, member 3 203011_at IMPA1 2.09 inositol(myo)-1(or 4)-monophosphatase 1 201487_at CTSC 2.08 cathepsin C 217403_s_at ZNF227 2.07 zinc finger protein 227 214522_x_at HIST1H2AD /// 2.07 histone cluster 1, H2ad /// histone cluster 1, H3d 205110_s_at FGF13 2.07 fibroblast growth factor 13 206272_at RAB4A /// SPH 2.07 RAB4A, member RAS oncogene family /// S-phase response (cyclin-related) 203582_s_at RAB4A 2.06 RAB4A, member RAS oncogene family 206850_at RASL10A 2.06 RAS-like, family 10, member A 209031_at CADM1 2.06 cell adhesion molecule 1 219765_at ZNF329 2.06 zinc finger protein 329 211363_s_at MTAP 2.06 methylthioadenosine phosphorylase 204415_at IFI6 2.05 interferon, alpha-inducible protein 6 212131_at LSM14A 2.04 LSM14A, SCD6 homolog A (S. cerevisiae) 209258_s_at SMC3 2.03 structural maintenance of chromosomes 3 219266_at ZNF350 2.03 zinc finger protein 350 212867_at --- 2.03 --- 209006_s_at C1orf63 2.03 chromosome 1 open reading frame 63 203347_s_at MTF2 2.02 metal response element binding transcription factor 2 213526_s_at LIN37 2.01 lin-37 homolog (C. elegans) 212773_s_at TOMM20 2.01 translocase of outer mitochondrial membrane 20 homolog (yeast) 205194_at PSPH 2.01 phosphoserine phosphatase 218421_at CERK 2.00 ceramide kinase Table S7 Genes increasingly responsive to E2 in context of p23 overexpression

Fold change Fold change Probe Set ID Gene Symbol Gene Title MCF7-control MCF7+p23 200766_at CTSD cathepsin D 1.31 2.15 200875_s_at NOP56 NOP56 ribonucleoprotein homolog (yeast) 1.53 2.04 200894_s_at FKBP4 FK506 binding protein 4, 59kDa 1.66 2.58 201034_at ADD3 adducin 3 (gamma) 1.60 2.15 201490_s_at PPIF peptidylprolyl isomerase F 1.71 2.00 201669_s_at MARCKS myristoylated alanine-rich protein kinase C substrate 0.86 2.31 201670_s_at MARCKS myristoylated alanine-rich protein kinase C substrate 1.20 2.34 201739_at SGK1 serum/glucocorticoid regulated kinase 1 1.40 2.71 202022_at ALDOC aldolase C, fructose-bisphosphate 1.59 2.52 202146_at IFRD1 interferon-related developmental regulator 1 1.33 2.31 202147_s_at IFRD1 interferon-related developmental regulator 1 1.29 2.27 202291_s_at MGP matrix Gla protein 1.19 3.00 202393_s_at KLF10 Kruppel-like factor 10 1.54 2.09 202599_s_at NRIP1 nuclear receptor interacting protein 1 1.91 2.56 202600_s_at NRIP1 nuclear receptor interacting protein 1 1.84 3.02 202613_at CTPS CTP synthase 1.95 2.23 202641_at ARL3 ADP-ribosylation factor-like 3 1.22 2.04 202833_s_at SERPINA1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 1.03 4.28 202908_at WFS1 Wolfram syndrome 1 (wolframin) 1.57 2.12 202949_s_at FHL2 four and a half LIM domains 2 1.22 3.11 203706_s_at FZD7 frizzled homolog 7 (Drosophila) 1.63 2.61 204029_at CELSR2 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila 1.79 2.27 204286_s_at PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 1.86 2.10 204379_s_at FGFR3 fibroblast growth factor receptor 3 1.34 2.13 204479_at OSTF1 osteoclast stimulating factor 1 1.10 2.01 204686_at IRS1 insulin receptor substrate 1 1.32 2.47 204688_at SGCE sarcoglycan, epsilon 1.25 2.09 204797_s_at EML1 echinoderm microtubule associated protein like 1 1.44 2.11 204995_at CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 1.62 2.01 205282_at LRP8 low density lipoprotein receptor-related protein 8, apolipoprotein e receptor 1.53 2.01 205364_at ACOX2 acyl-Coenzyme A oxidase 2, branched chain 1.31 4.63 205380_at PDZK1 PDZ domain containing 1 1.17 8.83 205493_s_at DPYSL4 dihydropyrimidinase-like 4 1.29 2.33

Probe sets, which map to 11 known genes, are highlighed in yellow and are classified as genes unresponsive to E2 that are made responsive to E2 in the context of p23 overexpression Table S7 Genes increasingly responsive to E2 in context of p23 overexpression

205769_at SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 1.88 2.23 205842_s_at JAK2 Janus kinase 2 1.55 2.10 205879_x_at RET ret proto-oncogene 1.84 2.04 205920_at SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1.45 2.39 205921_s_at SLC6A6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1.17 2.88 206401_s_at MAPT microtubule-associated protein tau 1.56 2.21 207178_s_at FRK fyn-related kinase 1.19 2.10 207214_at SPINK4 serine peptidase inhibitor, Kazal type 4 1.59 3.01 207388_s_at PTGES prostaglandin E synthase 1.11 2.30 207392_x_at UGT2B15 UDP glucuronosyltransferase 2 family, polypeptide B15 1.19 2.42 207430_s_at MSMB microseminoprotein, beta- 1.99 2.27 207626_s_at SLC7A2 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 1.74 3.04 208291_s_at TH tyrosine hydroxylase 1.38 2.33 208337_s_at NR5A2 nuclear receptor subfamily 5, group A, member 2 0.96 3.28 208343_s_at NR5A2 nuclear receptor subfamily 5, group A, member 2 0.74 3.42 209267_s_at SLC39A8 solute carrier family 39 (zinc transporter), member 8 1.97 2.36 209418_s_at THOC5 THO complex 5 1.68 2.33 209656_s_at TMEM47 transmembrane protein 47 1.96 2.15 209681_at SLC19A2 solute carrier family 19 (thiamine transporter), member 2 1.46 2.19 210174_at NR5A2 nuclear receptor subfamily 5, group A, member 2 1.06 2.77 210286_s_at SLC4A7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 1.29 2.10 210367_s_at PTGES prostaglandin E synthase 1.61 2.73 210868_s_at ELOVL6 ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/E 1.98 2.14 211429_s_at SERPINA1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1 1.14 2.79 211712_s_at ANXA9 annexin A9 1.11 2.07 212092_at PEG10 paternally expressed 10 1.65 2.92 212094_at PEG10 paternally expressed 10 1.74 2.67 212473_s_at MICAL2 microtubule associated monoxygenase, calponin and LIM domain containing 2 1.48 2.05 212909_at LYPD1 LY6/PLAUR domain containing 1 1.63 2.69 215343_at CCDC88C coiled-coil domain containing 88C 1.66 2.62 216262_s_at TGIF2 TGFB-induced factor homeobox 2 1.40 2.19 216687_x_at UGT2B15 UDP glucuronosyltransferase 2 family, polypeptide B15 1.15 2.29 218073_s_at TMEM48 transmembrane protein 48 1.61 2.02 218705_s_at SNX24 sorting nexin 24 1.73 3.00 218724_s_at TGIF2 TGFB-induced factor homeobox 2 1.73 3.05

218856_at TNFRSF21 tumor necrosis factor receptor superfamily, member 21 1.64 2.19 219054_at C5orf23 chromosome 5 open reading frame 23 1.50 2.53 219147_s_at C9orf95 chromosome 9 open reading frame 95 0.97 2.18 219522_at FJX1 four jointed box 1 (Drosophila) 1.74 2.19 219790_s_at NPR3 natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide recepto 1.42 2.21 221667_s_at HSPB8 heat shock 22kDa protein 8 1.87 3.27 222062_at IL27RA interleukin 27 receptor, alpha 1.86 2.34 222154_s_at LOC26010 viral DNA polymerase-transactivated protein 6 1.72 2.62 36499_at CELSR2 cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila 1.34 2.25

Probe sets, which map to 11 known genes, are highlighed in yellow and are classified as genes unresponsive to E2 that are made responsive to E2 in the context of p23 overexpression