DOCSLIB.ORG

Validation of Genes Sensitive to P23 Levels in a Different MCF-7 Cell Line Overexpressing P23 [Clone #8]

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Validation of Genes Sensitive to P23 Levels in a Different MCF-7 Cell Line Overexpressing P23 [Clone #8] Supplementary Figure 1 – Validation of genes sensitive to p23 levels in a different MCF-7 cell line overexpressing p23 [clone #8]. qRT-PCR experiments were performed to show the relative fold-change (RFC) in the expression of six genes from Figure 1c between MCF-7 control (white bars) and MCF-7+p23 (#8) cells (black bars). Data are means of three independent experiments, normalized to GAPDH, and presented as RFC from that of MCF-7 control cells, set to 1. Error bars represent standard deviation. Supplementary Figure 2 – Genes most upregulated or downregulated by p23 overexpression are also overexpressed or under- expressed in invasive breast cancers Differential analyses of microarray datasets from invasive breast cancer subgroups (listed in the Legend) were performed using the Oncomine database (www.oncomine.org) to determine if the ten genes most upregulated or the eighteen genes most downregulated ( > 5-fold, Tables S5-6) by p23 overexpression are also over- or under-expressed in invasive breast cancers. Shown are five of the 10 upregulated and 11 of the 18 downregulated genes that are significantly over- or under-expressed in at least one invasive breast cancer dataset (p-value < 0.05) (* designates those genes that are not considered significant using Oncomine differential analysis, but are associated with invasive cancers in referenced literature). Over-expressed genes ranked highest, based on significance, within a particular dataset are designated with red boxes (or dark blue boxes for under-expressed genes). Pink and light blue boxes indicate genes that are statistically significant, but with lower gene rank. White boxes designate genes that are not statistically significant within a given dataset. Grey boxes indicate that gene expression was not measured for a particular dataset. Supplementary Figure 3 – p23 mediated changes in gene expression upon inhibition of Hsp90 A) MCF-7+p23 cells were treated with either DMSO vehicle or 1μM GA for two hours prior to protein extraction. p23-Hsp90 co- immunoprecipitation experiments were performed following cell lysis [50mM Hepes, pH 7.6, 150mM NaCl, 1mM EDTA, 1mM EGTA, 1mM NaF, 1% Triton X-100, and 10% glycerol, 3mM DTT, 1mM PMSF, 5mM ATP, 20mM sodium molybdinate and protease inhibitor cocktail (Sigma)] and pre- cleared with protein-G agarose beads (Roche). Protein lysate (8mg) was incubated overnight at 4°C with 10μg HA.11 antibody (Covance) and 0.2% input and 1/5 of the IP reaction was immunoblotted with anti-Hsp90 (1:1000; Transduction Laboratories, H38220) or p23. B) MCF-7+p23 cells were hormone-starved for three days and treated for 48 hours with GA (left panel) or 24 hours with 17-AAG (right panel). RNA was extracted and qRT-PCR performed. Data are means, normalized to 28S (left panel) or GAPDH (right panel), and expressed as relative fold-change (RFC) in gene expression to vehicle treated MCF-7+p23 cells, set to 1. Error bars represent standard deviation. Supplementary Figure 4 – p23 levels can influence the estrogen sensitivity of some, but not all genes Venn diagrams show the distribution of estrogen sensitivity of 357 genes identified in control and MCF-7+p23 cells. 116 were sensitive to E2 in both cell types (green overlap; 47 induced, 69 repressed). There were 51 induced and 47 repressed genes in control cells (yellow circles) that were not induced in MCF-7+p23 cells, suggesting these genes were made unresponsive to E2 by p23 overexpression. Conversely, 65 genes were induced and 78 repressed by E2 only in MCF-7+p23 cells, suggesting that p23 overexpression makes these genes more responsive to E2 (blue circles). When examined closely, the majority of the 65 genes that were uniquely induced or downregulated by E2 in the MCF-7+p23 cells displayed between a 1.2 and 1.9-fold change in mRNA expression by E2 in control cells and greater than 2-fold change in MCF-7+p23 cells (data not shown). There were also a small number of genes (11) not regulated by E2 in control cells (fold change < 1.2), but induced (or repressed) 2-fold or more by E2 upon p23 overexpression. Therefore, these genes can be classified as being highly reactive to E2 by p23 overexpression and are listed in Supplementary Table 7. Supplementary Figure 5 – Semi-quantitative analysis of ER recruitment to PMP22 and ABCC3 EREs A schematic representation of the PMP22 and ABCC3 loci. Arrows represent transcriptional start sites (TSS), white boxes represent exons, the stripped boxes represent the ER binding elements (ERE) as determined by global ChIP-Chip analysis and black boxes represent the control upstream sequences (UPS). ChIP assays were preformed in MCF-7 control and MCF-7+p23 cells in the absence (ethanol vehicle treated) and presence of E2 using an antibody against ER or equivalent amount of non-specific rabbit IgG (Sigma). Relative levels of ER binding to 0.1% and 0.05% of the total input are shown by PCR and are representative of at least three independent experiments. Supplementary Figure 6 - p23 expression in human breast cancer A breast cancer tissue microarray containing 213 specimens was stained by immunohistochemistry with anti-p23 antibody and the intensity of p23 staining in the nucleus and cytoplasm was scored on a scale of 0 to 3+, with 3+ being the highest intensity staining. Example specimens scored as 2+ (left panel) and 3+ (right panel) for cytoplasmic p23 from biopsies are shown. Insets magnify a portion of each image. Supplementary Figure 7 – Subcellular distribution of p23 in MCF-7 control and MCF- 7+p23 cells as a function of ER agonist and antagonist treatment Nuclear and cytoplasmic fractions were prepared using Pierce Biotechnology’s NE-PER Nuclear and Cytoplasmic Extraction Reagents (78833, Pierce Biotechnology) according to manufacturer’s instructions, from 16h ethanol vehicle (-), 1nM 17--estradiol (E), 100nM 4-OH-tamoxifen (T), or 100nM ICI 182,780 (I) treated MCF-7 control and MCF-7+p23 cells. Levels of p23, TFII-I, and -tubulin were determined by immunoblotting using a TFII-I antibody (1:1000; Cell Signaling, 4562) or antibodies to p23 and tubulin as described previously in the Materials and Methods. Shown is a representative experiment that was repeated three times with similar results. Supplementary Figure 8 – Enhanced activation of AKT and increased cytoplasmic phosphoproteome in MCF-7+p23 cells A) The cytoplasmic and nucleoplasmic fractions from MCF-7 control and MCF-7+p23 cells were prepared as described in Narita et al. (Cell 2006 126:503-14) from cells pretreated for 30 min at 37°C with the phosphatase inhibitor Calyculin A (100ng/ml; Cell Signaling, 9902) to stabilize the phosphoproteome. Fractions were immunoblotted for phospho-AKT S473 (1:1000; Cell Signaling, 9271), total AKT (1:1000; Cell Signaling, 9272), and tubulin as described in the Materials and Methods section. B) Cytoplasmic and nucleoplasmic fractions from MCF-7 control and MCF-7+p23 cells were also probed for phosphoproteins using phospho-AKT substrate antibody (1:1000, Cell Signaling, 9614). Arrowheads (black and white) indicate phosphoproteins in greater abundance in the p23 overexpressing cells relative to controls. The immunoreactivity was visualized using the Odyssey Infrared Imaging System. Figure S1 MCF-7 MCF-7+p23 (clone #8) 140 25 10 120 20 8 100 80 15 6 RFC 60 10 4 40 5 2 20 0 0 0 PMP22 ABCC3 AGR2 1.4 1.4 1.2 1.2 1.2 1 1 1 0.8 0.8 0.8 0.6 RFC 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 0 0 0 P8 TM4SF1 Sox3 Figure S2 * * * Figure S3 A input IP:HA (p23) 1μM GA - + - + Hsp90 WB:Hsp90 HA-p23 WB:p23 p23 B 2 2 MCF-7+p23_DMSO 4 MCF-7+p23_DMSO 25 MCF-7+p23_GA MCF-7+p23_17-AAG 20 1.5 3 1.5 15 1 2 1 RFC RFC 10 0.5 1 0.5 5 0 0 0 0 pS2 cmyc PMP22 ABCC3 AGR2 pS2 cmyc PMP22 ABCC3 AGR2 Figure S4 E2 Induced Genes E2 Repressed Genes MCF7-WT MCF7-p23 MCF7-WT MCF7-p23 51 47 65 47 69 78 98 112 # of genes 116 147 differentially regulated by E2 Figure S5 PMP22 ABCC3 ERE UPS P2 UPS P ERE -395kb -6kb +1bp -3 kb +1bp +16kb MCF-7 MCF-7 + p23 10nM E2 - + - + input input input input IgG ER IgG ER IgG ER IgG ER PMP22 ERE PMP22 UPS ABCC3 ERE ABCC3 UPS 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Figure S6 cytoplasmic p23 2+ cytoplasmic p23 3+ Figure S7 cytoplasmic nuclear MCF-7 MCF-7+p23 MCF-7 MCF-7+p23 E T I E T I E T I E T I HA-p23 p23 TFII-I Tubulin Figure S8 A B cytoplasmic nuclear MW MCF-7+p23 MCF-7 MCF-7 MCF-7+p23 170 130 MCF-7 MCF-7+p23 100 P-AKT 70 55 AKT 40 35 Tubulin 25 15 10 Phospho Akt Substrate Antibody Table S1 qRT-PCR Gene Expression Primers GAPDH_F 5' - CCTCAACGACCACTTTGTCA - 3' GAPDH_R 5' - CCCTGTTGCTGTAGCCAAAT -3' 28S_F 5' - AAACTCTGGTGGAGGTCCGT -3' 28S_R 5' - CTTACCAAAAGTGGCCCACTA -3' pS2_F 5' - GAACAAGGTGATCTGCG -3' pS2_R 5' - TGGTATTAGGATAGAAGCACCA -3' PMP22_F 5' - GTGCTGCTGTTCGTCTCCAC -3' PMP22_R 5' - ATCAGTTGCGTGTCCATTGC -3' ABCC3_F 5' - TTGTCGTGGCTACATCATCC -3' ABCC3_R 5' - AAAAGGTCCGCCCAGGAG -3' AGR2_F 5' - ACTTGGATGAGTGCCCACACAG -3' AGR2_R 5' - CAGATTGAGGAGGACAAACTGCTC -3' Sox3_F 5’ - ACTCATCAGGTGCGAGAAGC – 3’ Sox3_R 5’ - GGGAAGGGTAGGCTTATCAA – 3’ p8_F 5’ - GAGGAAACTGGTGACCAAGC – 3’ p8_R 5’ - CCGTCTCTATTGCTGGGTGT -3’ TM4SF1_F 5’ - TTTGCTGCTCTCACCAACAG – 3’ TM4SF1_R 5’ - GTAGACTGTGGGGAGTATGTTACAC – 3’ Table S2 ChIP primers PMP22(ERE)F 5'- GCCGCATAAAATGTCACGCC -3' PMP22(ERE)R 5'- AAACCTACTTGGGGGAGTCTGC -3' PMP22(UPS)F 5'- TCCGTGGAACCTAAGTCTTGGAG-3' PMP22(UPS)R 5'- GCAACTGTGTCTTGGGAATCGC - 3' PMP22(P2)F 5'- GAGCCAGTTTCTCGGTCAAC -3' PMP22(P2)R 5'- GCGGCGACTTTTACTCGAA -3' ABCC3(ERE)F 5'- GCTGCCACAGCACTAAACTGT -3' ABCC3(ERE)R 5'- GAGTGAGGTCCGGGTTTTCT -3' ABCC3(UPS)F 5'- GCAAGGGGCTAAAAGGAATC -3' ABCC3(UPS)R 5'- AATGCTCCGAAGGGAGAGAG
Load more

Recommended publications
  • Supplementary Data
    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
    [Show full text]
  • METABOLIC EVOLUTION in GALDIERIA SULPHURARIA By
    METABOLIC EVOLUTION IN GALDIERIA SULPHURARIA By CHAD M. TERNES Bachelor of Science in Botany Oklahoma State University Stillwater, Oklahoma 2009 Submitted to the Faculty of the Graduate College of the Oklahoma State University in partial fulfillment of the requirements for the Degree of DOCTOR OF PHILOSOPHY May, 2015 METABOLIC EVOLUTION IN GALDIERIA SUPHURARIA Dissertation Approved: Dr. Gerald Schoenknecht Dissertation Adviser Dr. David Meinke Dr. Andrew Doust Dr. Patricia Canaan ii Name: CHAD M. TERNES Date of Degree: MAY, 2015 Title of Study: METABOLIC EVOLUTION IN GALDIERIA SULPHURARIA Major Field: PLANT SCIENCE Abstract: The thermoacidophilic, unicellular, red alga Galdieria sulphuraria possesses characteristics, including salt and heavy metal tolerance, unsurpassed by any other alga. Like most plastid bearing eukaryotes, G. sulphuraria can grow photoautotrophically. Additionally, it can also grow solely as a heterotroph, which results in the cessation of photosynthetic pigment biosynthesis. The ability to grow heterotrophically is likely correlated with G. sulphuraria ’s broad capacity for carbon metabolism, which rivals that of fungi. Annotation of the metabolic pathways encoded by the genome of G. sulphuraria revealed several pathways that are uncharacteristic for plants and algae, even red algae. Phylogenetic analyses of the enzymes underlying the metabolic pathways suggest multiple instances of horizontal gene transfer, in addition to endosymbiotic gene transfer and conservation through ancestry. Although some metabolic pathways as a whole appear to be retained through ancestry, genes encoding individual enzymes within a pathway were substituted by genes that were acquired horizontally from other domains of life. Thus, metabolic pathways in G. sulphuraria appear to be composed of a ‘metabolic patchwork’, underscored by a mosaic of genes resulting from multiple evolutionary processes.
    [Show full text]
  • Table 2. Significant
    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Direction of Cross Affects Obesity After Puberty in Male but Not Female
    Kärst et al. BMC Genomics (2015) 16:904 DOI 10.1186/s12864-015-2164-2 RESEARCH ARTICLE Open Access The direction of cross affects obesity after puberty in male but not female offspring Stefan Kärst1†, Danny Arends1†, Sebastian Heise1†, Jan Trost1, Marie-Laure Yaspo2, Vyacheslav Amstislavskiy2, Thomas Risch2, Hans Lehrach2 and Gudrun A. Brockmann1* Abstract Background: We investigated parent-of-origin and allele-specific expression effects on obesity and hepatic gene expression in reciprocal crosses between the Berlin Fat Mouse Inbred line (BFMI) and C57Bl/6NCrl (B6N). Results: We found that F1-males with a BFMI mother developed 1.8 times more fat mass on a high fat diet at 10 weeks than F1-males of a BFMI father. The phenotype was detectable from six weeks on and was preserved after cross-fostering. RNA-seq data of liver provided evidence for higher biosynthesis and elongation of fatty acids (p = 0.00635) in obese male offspring of a BFMI mother versus lean offspring of a BFMI father. Furthermore, fatty acid degradation (p = 0.00198) and the peroxisome pathway were impaired (p = 0.00094). The circadian rhythm was affected as well (p = 0.00087). Among the highest up-regulated protein coding genes in obese males were Acot4 (1.82 fold, p = 0.022), Cyp4a10 (1.35 fold, p = 0.026) and Cyp4a14 (1.32 fold, p = 0.012), which hydroxylize fatty acids and which are known to be increased in liver steatosis. Obese males showed lower expression of the genetically imprinted and paternally expressed 3 (Peg3) gene (0.31 fold, p = 0.046) and higher expression of the androgen receptor (Ar) gene (2.38 fold, p = 0.068).
    [Show full text]
  • Upregulated Kynurenine Pathway Enzymes in Aortic Atherosclerotic Aneurysm: Macrophage Kynureninase Downregulates Inflammation
    The official journal of the Japan Atherosclerosis Society and the Asian Pacific Society of Atherosclerosis and Vascular Diseases Original Article J Atheroscler Thromb, 2021; 28: 000-000. http://doi.org/10.5551/jat.58248 Upregulated Kynurenine Pathway Enzymes in Aortic Atherosclerotic Aneurysm: Macrophage Kynureninase Downregulates Inflammation Masanori Nishimura1, 2, Atsushi Yamashita2, Yunosuke Matsuura3, Junichi Okutsu4, Aiko Fukahori4, Tsuyoshi Hirata4, Tomohiro Nishizawa5, Hirohito Ishii1, Kazunari Maekawa2, Eriko Nakamura2, Kazuo Kitamura3, Kunihide Nakamura1 and Yujiro Asada2 1Division of Cardiovascular Surgery, Department of Surgery, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan 2Department of Pathology, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan 3Department of Internal Medicine, Faculty of Medicine, University of Miyazaki, Miyazaki, Japan 4Translational Research Department, Daiichi Sankyo RD Novare Co., Ltd., Tokyo, Japan 5Specialty Medicine Research Laboratories I, Daiichi Sankyo Co., Ltd., Tokyo, Japan Aims: Inflammation and hypertension contribute to the progression of atherosclerotic aneurysm in the aorta. Vascular cell metabolism is regarded to modulate atherogenesis, but the metabolic alterations that occur in ath- erosclerotic aneurysm remain unknown. The present study aimed to identify metabolic pathways and metabo- lites in aneurysmal walls and examine their roles in atherogenesis. Methods: Gene expression using microarray and metabolite levels in the early atherosclerotic lesions and aneu- rysmal walls obtained from 42 patients undergoing aortic surgery were investigated (early lesion n=11, aneu- rysm n=35) and capillary electrophoresis–time-of-flight mass spectrometry (early lesion n=14, aneurysm n=38). Using immunohistochemistry, the protein expression and localization of the identified factors were examined (early lesion n=11, non-aneurysmal advanced lesion n=8, aneurysm n=11).
    [Show full text]
  • Long Noncoding RNA UPK1A-AS1 Indicates Poor Prognosis of Hepatocellular Carcinoma and Promotes Cell Proliferation Through Interacting with EZH2
    Long noncoding RNA UPK1A-AS1 indicates poor prognosis of hepatocellular carcinoma and promotes cell proliferation through interacting with EZH2 Dong-Yan Zhang ( [email protected] ) Southern Medical University Nanfang Hospital Qing-Can Sun Southern Medical University Nanfang Hospital Xue-Jing Zou Southern Medical University Nanfang Hospital Yang Song Southern Medical University Nanfang Hospital Wen-Wen Li Southern Medical University Nanfang Hospital Ze-Qin Guo Southern Medical University Nanfang Hospital Shan-Shan Liu Southern Medical University Nanfang Hospital Li Liu Southern Medical University Nanfang Hospital De-Hua Wu Southern Medical University Nanfang Hospital Research Keywords: UPK1A antisense RNA 1, EZH2, long non-coding RNA, miR-138-5p, proliferation, Hepatocellular carcinoma Posted Date: October 1st, 2020 DOI: https://doi.org/10.21203/rs.3.rs-40876/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/29 Version of Record: A version of this preprint was published on October 29th, 2020. See the published version at https://doi.org/10.1186/s13046-020-01748-y. Page 2/29 Abstract Background: Dysregulations of lncRNA are responsible for cancer initiation and development, positioning lncRNAs as not only biomarkers but also promising therapeutic targets for cancer treatment. Growing number of lncRNAs have been reported in HCC but their functional and mechanistic roles remain unclear. Methods: Gene Set Enrichment Analysis was used to investigate the molecular mechanism of lncRNA UPK1A antisense RNA 1 (UPK1A-AS1). CCK-8 assay, EdU assay, ow cytometry, western blot, and xenograft assay were used to conrm the role of UPK1A-AS1 in the proliferation of HCC cells both in vitro and in vivo.
    [Show full text]
  • Investigation of Candidate Genes and Mechanisms Underlying Obesity
    Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between
    [Show full text]
  • HIV-1 Envelope Mimicry of Host Enzyme Kynureninase Does Not Disrupt Tryptophan Metabolism
    HIV-1 Envelope Mimicry of Host Enzyme Kynureninase Does Not Disrupt Tryptophan Metabolism This information is current as Todd Bradley, Guang Yang, Olga Ilkayeva, T. Matt Holl, of September 29, 2021. Ruijun Zhang, Jinsong Zhang, Sampa Santra, Christopher B. Fox, Steve G. Reed, Robert Parks, Cindy M. Bowman, Hilary Bouton-Verville, Laura L. Sutherland, Richard M. Scearce, Nathan Vandergrift, Thomas B. Kepler, M. Anthony Moody, Hua-Xin Liao, S. Munir Alam, Roger McLendon, Jeffrey I. Everitt, Christopher B. Newgard, Downloaded from Laurent Verkoczy, Garnett Kelsoe and Barton F. Haynes J Immunol 2016; 197:4663-4673; Prepublished online 14 November 2016; doi: 10.4049/jimmunol.1601484 http://www.jimmunol.org/content/197/12/4663 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2016/11/12/jimmunol.160148 Material 4.DCSupplemental References This article cites 67 articles, 31 of which you can access for free at: http://www.jimmunol.org/content/197/12/4663.full#ref-list-1 by guest on September 29, 2021 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc.
    [Show full text]
  • Supplementary Materials
    Supplementary Materials COMPARATIVE ANALYSIS OF THE TRANSCRIPTOME, PROTEOME AND miRNA PROFILE OF KUPFFER CELLS AND MONOCYTES Andrey Elchaninov1,3*, Anastasiya Lokhonina1,3, Maria Nikitina2, Polina Vishnyakova1,3, Andrey Makarov1, Irina Arutyunyan1, Anastasiya Poltavets1, Evgeniya Kananykhina2, Sergey Kovalchuk4, Evgeny Karpulevich5,6, Galina Bolshakova2, Gennady Sukhikh1, Timur Fatkhudinov2,3 1 Laboratory of Regenerative Medicine, National Medical Research Center for Obstetrics, Gynecology and Perinatology Named after Academician V.I. Kulakov of Ministry of Healthcare of Russian Federation, Moscow, Russia 2 Laboratory of Growth and Development, Scientific Research Institute of Human Morphology, Moscow, Russia 3 Histology Department, Medical Institute, Peoples' Friendship University of Russia, Moscow, Russia 4 Laboratory of Bioinformatic methods for Combinatorial Chemistry and Biology, Shemyakin-Ovchinnikov Institute of Bioorganic Chemistry of the Russian Academy of Sciences, Moscow, Russia 5 Information Systems Department, Ivannikov Institute for System Programming of the Russian Academy of Sciences, Moscow, Russia 6 Genome Engineering Laboratory, Moscow Institute of Physics and Technology, Dolgoprudny, Moscow Region, Russia Figure S1. Flow cytometry analysis of unsorted blood sample. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S2. Flow cytometry analysis of unsorted liver stromal cells. Representative forward, side scattering and histogram are shown. The proportions of negative cells were determined in relation to the isotype controls. The percentages of positive cells are indicated. The blue curve corresponds to the isotype control. Figure S3. MiRNAs expression analysis in monocytes and Kupffer cells. Full-length of heatmaps are presented.
    [Show full text]
  • BIOCHEMISTRY of TRYPTOPHAN in HEALTH and DISEASE Contents
    Molec. Aspects Med. Vol. 6, pp. 101-197, 1982 0098-2997/82/020101-97548.50/0 Printed in Great Britain. All rights reserved. Copyright © Pergamon Press Ltd. BIOCHEMISTRY OF TRYPTOPHAN IN HEALTH AND DISEASE David A. Bender Courtauld Institute of Biochemistry, The Middlesex Hospital Medical School, London WIP 7PN, U.K. Contents Chapter 1 THE DISCOVERY OF TRYPTOPHAN, ITS PHYSIOLOGICAL SIGNIFICANCE AND METABOLIC FATES 103 Tryptophan and glucose metabolism 105 Xanthurenic acid and insulin 105 The glucose tolerance factor 106 Inhibition of gluconeogenesis by tryptophan metabolites i07 Metabolic fates of tryptophan 108 Protein synthesis 108 Oxidative metabolism Ii0 5-Hydroxyindole synthesis 111 Intestinal bacterial metabolism iii Chapter 2 THE 5-HYDROXYINDOLE PATHWAY OF TRYPTOPHAN METABOLISM; SEROTONIN AND OTHER CENTRALLY ACTIVE TRYPTOPHAN METABOLITES 112 Tryptophan 5-hydroxylase 112 Inhibition of tryptophan hydroxylase and the carcinoid syndrome 116 Aromatic amino acid decarboxylase 118 The specificity of aromatic amino acid decarboxylase 120 Tryptophan metabolism in the pineal gland 121 Monoamine oxidase 124 The uptake of tryptophan into the brain 124 The binding of tryptophan to serum albumin 127 Competition for uptake by other neutral amino acids 129 Changes in tryptophan metabolism in response to food intake 129 Tryptophan uptake into the brain in liver failure 131 Sleep and tryptophan metabolism 134 101 102 D.A. Bender Tryptophan and serotonin in psychiatric disorders 135 Affective disorders 136 Evidence for a deficit of serotonin or tryptophan
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]