3rd Multi/Interdisciplinary Research Conference 3rd Multi/Interdisciplinary : “The Africa we want: Wealth creation for Sustainable Growth and Social Transformation”

PROCEEDINGS OF

THE 3RD MULTI /INTERDISCIPLINARY RESEARCH CONFERENCE

VOLUME I

3rd Multi/Interdisciplinary Research Conference “The Africa we want: Wealth creation for Sustainable Growth and Social Transformation”

Date: 23 - 24 July 2019 Venue: NIPAM - Windhoek TABLE OF CONTENTS

Table of Contents ...... 1

Foreword ...... 2

Acknowledgements ...... 3

Recent advances in nanotechnology for waste water treatment ...... 4

Antiplasmodial activity, phytochemical profile, active principles and cytotoxicity ofPechuel-loeschea leubnitziae O. Hoffm. (Asteraceae): An endemic shrub used to manage malaria in Namibia ...... 19

Sustainable indigenous gastronomy and culinary identity: Developing culturally modified foods. 30

Inclusion of the cultural practice of dry sex in HIV and AIDS behavioural change programmes: Case study of Zambezi region, Namibia ...... 45

A critical analysis of drama as an effective teaching tool in early childhood education: A case study of Mogoditshane Child Development Centre ...... 60

Mushroom polysaccharides from Kalaharituber pfeilii and Termitomyces schimperi reveal antioxidant and prebiotic functions ...... 69

Ethnobotanical survey and in vitro evaluation of antimicrobial activity of selected traditional herbs and spices from Kabbe constituencies in Zambezi region ...... 78

Physico-chemical properties and microbial communities of fermented olives in Namibia using culture dependent method ...... 96

Proximate content and functional properties of putative pearl millet (pennisetum glaucum) mutants derived through gamma irradiation in Namibia ...... 106

Assessing the effectiveness of abortion as a sexual and reproductive health tool in reducing the prevalence of child motherhood in Zimbabwe ...... 123

~ 1 ~ FOREWORD

This conference proceeding is based on the 3rd Multi/Interdisciplinary Research Conference which was hosted by the University of Namibia (UNAM) through the Multidisciplinary Research Centre (MRC) from 23 - 24 July 2019 at NIPAM in Windhoek. The theme of the conference was “The Africa we want: Wealth creation for Sustainable Growth and Social Transformation”. The main objectives of the Conference were to provide a platform for academics, practitioners and postgraduate students to share their research findings within the above mentioned theme, to provide recommendations for policy and programme interventions and evoke innovation for continental socio-economic transformation. The conference papers in these proceedings represent international experiences on global issues from academics beyond Namibia and as far as South Africa, Zimbabwe, Botswana and Germany. All conference papers were subjected to two stages of peer-review from which two volumes were prepared for conference proceeding publication by 2020.

Volume one and volume two present papers across disciplines and focusses, amongst others, on issues of technological advances, sexual reproductive health, culture and behavioural changes, drama and education, climate change, etc.

MRC wishes to express gratitude to all peer reviewers of the articles under this proceedings for their tireless efforts in reviewing manuscripts and ensuring that all articles conform to the standard requirements of a conference proceeding. Special thanks goes to the contributors or authors of the various articles for their trust, patience and timely revisions to the papers before publication in this conference proceeding. The authors or contributors realized the importance of ensuring that their research output are presented and published for the wider audience so that their academic outputs have an expanded network for potential impact on the wider international community readership. We at MRC therefore wish all our readers a pleasant reading of this conference proceedings issue.

Dr Kletus Likuwa

~ 2 ~ ACKNOWLEDGEMENTS

The Conference Proceedings Committee would like to acknowledge the excellent work of our conference organizing committee which comprised of the following:

Conference Chair: Dr Elizabeth Ngololo Kamara and Ms. Nguza Siyambango

Exco Committee: Prof Nelago Indongo Dr Klefus Likuwa Prof Ahmad Cheikhyoussef Dr Napandulwe Shiweda Dr Selma Mekondjo Wardine Lendelvo Dr Nailoke Pauline Kadhila

Proceedings Committee: Prof Ahmad Cheikhyoussef Dr Napandulwe Shiweda Dr Selma Mekondjo Wardine Lendelvo Prof Davis Mumbengegwi

Language Editor: Dr Nelson Mlambo

Internal and External Reviewers

Prof Davis Mumbengegwi Prof Mohamed Fawzy Ramadan Hassanien Prof Ahmad Cheikhyoussef Dr Collen Musara Dr Iwanette Du Preez Dr Mack Moyo Dr Martha Shikongo-Nambabi Prof Benjamin Campbell Mr. Werner Embashu Prof Oluwatosin A. Ijabadeniyi Dr Lydia Horn Prof Ahmed Mohammed Hussein Dr Natascha Cheikhyoussef Dr Ljiljana Fruk

Further gratitude is extended to all of our distinguished plenary speakers and to our session directors. We would also like to acknowledge the important contributions of all of our conference participants and postgraduate students for sharing with us their personal insights and aspirations.

Finally, we wish to thank the GIZ Namibia for its financial support towards our conference, we are extremely grateful.

~ 3 ~ RECENT ADVANCES IN NANOTECHNOLOGY FOR WASTE WATER TREATMENT

Ateeq Rahman*, Kapa Tuhafeni, Paulas Kapolo, Daniel Likius and Veikko Uahengo Faculty of Science, Department of Chemistry and Biochemistry, University of Namibia, Mandumefayo, Pionierspark, Windhoek, Namibia

Email: [email protected]/ [email protected]

ABSTRACT Namibia is a very dry country with an average rainfall of 250 mm per year. The concern over increasing needs for drinking water and awareness for the development of systems to improve water quality both for drinking purposes and for effluents from wastewater treatment and industrial facilities have provided incentives to develop new technologies and to improve the performance of existing technologies. In recent decades, water treatment using nano technological based expertise has gained significant attention. Against this background, the adaptation of highly advanced nanotechnology to traditional process engineering offers new opportunities in technological developments for advanced water and wastewater technology processes. Recent nanotechnology technique extends from the fabrication of membranes from nanomaterials to the use of catalysts for the decomposition of noxious compounds in water. Research advances in nanotechnologies for water and wastewater treatment processes is provided, including nano based materials such as nano adsorbents, nanometals, nanomembranes, and photocatalysts. The beneficial properties of these materials as well as technical barriers when compared with conventional processes are reported. Hence, the waste water treatment can be executed with various materials such as Layered Double Hydroxides (LDHS), metal oxides, and Ag NPs, depending upon their preparation conditions, are applicable for various wastewater treatment processes. The use of nanotechnology to remove contaminants in water is widespread and many advances have already been achieved. The application of nanotechnology in the clean-up of contaminated water could be summarised by nanoscale filtration techniques, the adsorption of pollutants on nanoparticles and the breakdown of contaminants in wastewater by nanoparticle, Nano sheets, and Carbon Nanotubes as catalysts.

Keywords: Nanotechnology, nanoparticle, Waste water treatment.

INTRODUCTION Water is the most essential substance for all life on earth and it is a precious resource for global civilisation. Reliable access to clean and affordable water is considered one of the most basic humanitarian goals and it still remains a major global challenge for the 21st century (Gehrke et al., 2015). Outside of the laboratory there is no such thing as “pure” water. Even the naturally occurring water contains impurities and other contaminants that may make it dangerous for human consumption and for the environment. Water contamination not only affects the environment and human health, but it has impacts on the economic and social spheres. The adaptation of highly advanced nanotechnology

~ 4 ~ to traditional process engineering offers new opportunities in technological developments for advanced water and wastewater technology processes (Gehrke et al., 2015). This is due to the fact that the traditional process has been difficult to meet people’s continuous improvement of wastewater treatment requirements in many ways due to rapid increases in wastewater discharges. Most of the remediation technologies available today, while effective, very often are costly and time consuming, particularly the pump-and-treat methods. A plethora of techniques are classified in conventional methods, as established recovery processes and emerging removal methods are used. Since there are many disadvantages such as chemical consumption (lime, oxidants, H2S), the physicochemical monitoring of the effluent (pH) is ineffective in the removal of the metal ions at low concentration which requires an oxidation step if the metals are complexed high sludge production, as well as handling and disposal problems (treatment, cost). This requires an adjunction of non-reusable chemicals (coagulants, flocculants, aid chemicals). Physicochemical monitoring of the effluent (pH) increases sludge volumes generation that is disposed far off and this increases treatment costs (Ateeq et al., 2019). The low removal of arsenic high initial capital cost, energy costs for maintenance and operational costs. Recently Ateeq et al. (2019) reported activated carbon prepared from acacia pods for waste water treatment. Activated carbon exhibited positive results for waste water treatment. Recent advances in nanotechnology for waste water treatment offer to develop advanced next generation water supply systems (Gehrke et al., 2015). For the purposes of improving the water treatment processes, the use of nanomaterials is being researched to fabricate the separation and reactive media which is of high quality in terms of reactivity and performance that can enhance and make the wastewater treatment process more efficient (Qu et al., 2013). Nanomaterials typically have high reactivity and a high degree of functionalisation, a large specific surface area, size-dependent properties, etc., which makes them suitable for applications in wastewater treatment and for water purification (Diallo et al., 2005). This review article provides an overview on the recent advances on nanotechnology for wastewater treatment, and a number of new procedures for producing nanomaterials that are ultimately used for wastewater treatment are highlighted.

Figure 1: Schematic of a composite nanomaterial packed bed reactor for the purification of water contaminated by mixtures of (i) metal ions, (ii) Organic solutes, and (iii) bacteria (Chaturvedi, 2019).

~ 5 ~ HISTORY OF NANOPARTICLES “Nano” is derived from the Greek word for dwarf. A nanometre is one billionth of a meter (10-9) and it might be represented by the length of ten hydrogen atoms lined up in a row (Chaturvedi et al., 2019). At this scale, materials often possess novel size-dependent properties that are different from their large counterparts, many of which have been explored for application in water and waste water treatment. In 1867, James Clerk Maxwell was the first to mention some of the nano concepts in nanotechnology through a proposed experiment on a tiny entity known as Maxwell’s Demon which was able to handle individual molecules. Michael Faraday and his gold nanoparticles were made in the mid-19th century. The first observations and size measurements of nano-particles using an ultra- microscope were made possible in a study of gold sols and other nanomaterials with sizes down to 10 nm and less (Zsigmondy, 1914). Zsigmondy (1914) reported that they were the first to characterise particle sizes using the term nanometre and he developed the first system of classification based on particle size in the nanometre range. Several advances in the field of nanomaterial characterisation were made possible by Langmuir and Blodgett in the 1920s, who introduced the monolayer concept, and Derjaguin et al. (1954) who conducted the first measurement of surface forces (Derjaguin, 1954). Since then, several advances were made in the study of nanoscale structures, but the term nanotechnology was first defined by Taniguchi (1974) as nano-technology mainly consists of the processing of, separation, consolidation, and deformation of materials by one atom or one molecule. The tools and methods for nanotechnology involve imaging, measuring, modelling, and manipulating matter at the nanoscale.

USE OF NANOMATERIALS FOR WASTE WATER TREATMENT Nano-objects are often categorised as the number of dimensions they fall in the nanoscale. And a nanoparticle is a nano-object with all three external dimensions in the nanoscale. And a nanofiber has two external dimensions in the nanoscale, with nanotubes being hollow nanofibers, andnanorods are solid nanofibers. Hence, a nanoplate has one external dimension in the nanoscale (Taniguchi, 1974).

Due to a large number of studies, nanomaterials show potent promise for applications in water and wastewater treatment. Recently greater emphasis has been extensively studied with regards to nanomaterials for water and wastewater treatment mostly including zero-valent metal nanoparticles, metal oxides nanoparticles, carbon nanotubes (CNTs), and nanocomposites.

Zero valent nano particles Silver Nanoparticles: Due to the development of nanotechnology, Ag NPs have been successfully applied in water and wastewater disinfection in recent years. However, the direct application of Ag NPs may cause some problems due to their tendency to aggregate in aqueous media that gradually reduces their efficiency during long-term use (Li, 2013). Hence, Ag NPs attached to filter materials have been considered a novel process for water disinfection due to their high antibacterial activity and cost-effectiveness (Quang 2013). In the past two decades, Ag NPs on ceramic materials/membranes have created more attention due to their disinfection and biofouling reduction for household (point- of-use) water treatment (Ren, 2013). Hence for example, the addition of Ag NPs to ceramic filters

~ 6 ~ constructed with clay and sawdust has turned out to be able to improve the removal efficiency of Escherichia coli. It has been found that filters with higher porosity achieved higher bacteria removal than those with lower porosity (Kallman, 2011). Apart from other Ag NPs colloidal, Ag NPs have been combined with cylindrical ceramic filters, which are made up of clay-rich soil with water, grog, and flour in different quantities and ways (dipping and painting). It was proven that colloidal Ag NPs improved the filter performance and the filters can remove Escherichia coli in the rate between 97.8% and 100% (Kallman, 2011).

Iron nanoparticles: Since a few years ago, various zero-valent metal nanoparticles such as Fe, Zn, Al, and Ni, in water pollution treatment have drawn wide research interest. However, due to the extremely high reductive ability, nano-zero-valent Al is thermodynamically unstable in the presence of water, which favours the formation of oxides/hydroxides on the surface, impeding (completely) the transfer of electrons from the metal surface to the contaminants (Rivero-Huguet, 2009). Compared with Fe, Ni has a less negative standard reduction potential, indicating a lower reducing ability. With a moderate standard reduction potential, nano-zero-valent Fe or Zn holds good potential to act as reducing agents relative to many redox-labile contaminants. Despite a weaker reduction ability, Fe possesses many prominent advantages over Zn for applications in water pollution treatment, including excellent adsorption properties, precipitation and oxidation (in the presence of dissolved oxygen), and very low cost. Hence, zero-valent iron nanoparticles have been widely studied zero-valent metal nanoparticles. And as a result of the extremely small size and thus large specific surface area, nZVI possesses good adsorption properties and strong reducing ability.

Zn nanoparticles: Whereas much research has focussed on contaminant degradation in water and wastewater treatment by zero-valent metal nanoparticles, these have focused on iron, and Zn has also been considered as an alternative (Bokare, 2013). And with a more negative standard reduction potential, Zn is a stronger reductant compared with Fe. Therefore, the contaminant degradation rate of zinc nanoparticles may be faster than that of nZVI. Several studies have demonstrated that contaminant reduction by nZVZ can be a successful; the application of nZVZ is mainly limited in the degradation of halogenated organic compounds, exclusively CCl4. The treatment of other varieties of contaminants by nZVZ has seldom been reported till to date.

METAL OXIDES NANOPARTICLES

TiO2 Nanoparticles: Since a few years ago, the photocatalytic degradation process has been successfully applied in the contaminant degradation in water and wastewater. In the presence of light and a catalyst, contaminants can be gradually oxidised into low molecular weight intermediate products and eventually transformed into CO2, H2O, and anions. The bulk of common photo-catalysts are metal oxide or sulfide semiconductors, among which TiO2 has been most widely investigated in the past years. Owing to its high photocatalytic activity, very economical price, photostability, and chemical and biological stability (Guesh, 2016), and due to its large band gap energy (3.2 eV) of TiO2, it requires ultraviolet (UV) excitation to induce charge separation within the particles. Therefore besides, TiO2 NPs show little selectivity and thus they are highly versatile for the degradation of all

~ 7 ~ kinds of contaminants such as chlorinated organic compounds (Oshaka, 2008), polycyclic aromatic hydrocarbons (Guo, 2015), dyes (Lei, 2014), phenols, pesticides (Alalm, 2015), arsenic, cyanide, and heavy metals (Guo, 2015).

IRON OXIDES NANOPARTICLES: Since the past few years, there has been enormous interest in the use of iron oxides nanoparticles for the removal of heavy metals, and contaminants due to their simplicity and availability. Magnetic magnetite (Fe3O4) and magnetic maghemite (γ-Fe2O4) and nonmagnetic hematite (α-Fe2O3) are often used as nanoadsorbents. In general, due to the small size of nanosorbent materials, their separation and recovery from contaminated water are great challenges for water treatment. However, magnetic magnetite (Fe3O4) and magnetic maghemite (γ-Fe2O4) can be easily separated and recovered from the system with the assistance of an external magnetic field hence they have been successfully widely accepted as sorbent materials in the removal of various heavy metals from water systems (Lei, 2014).

CARBON NANOTUBES Carbon nanomaterials (CNMs) are a class of beautiful materials due to their outstanding structures and electronic properties which make them attractive for fundamental studies as well as various applications, exclusively in adsorption processes. Their advantages for wastewater treatment are mainly due to, (a) Greater capacity to adsorb a wide range of contaminants, (b) Fast kinetics, (c) Large specific surface area, and (d) Selectivity towards aromatics (Lei, 2014). There are numerous forms of CNMs, such as carbon nanotubes (CNTs), carbon beads, carbon fibres, and Nano porous carbon (Lei, 2014). Among them, CNTs have attracted the maximum attention and progressed quickly in recent years.

NANOCOMPOSITES Since the past couple of years, the synthesis of various nanocomposites has attracted the field of nanomaterials. Due to some numerous studies that have been conducted, much development has been made, for example, via chemical deposition of nZVI on CNTs, a novel nanoscale adsorbent was prepared. The adsorbent has the good potential for quick and effective removal of contaminants from water. Due to its unique magnetic property, the adsorbent can be easily separated from the solution by the magnet (Azhari 2014). Moreover, thin film nanocomposite (TFN) nanofiltration membranes have been prepared via in situ interfacial incorporation of TiO2 NPs along with fabrication of co- polyamide network on a polyimide support. To improve the compatibility of TiO2 NPs inside the polymer matrix, both amine and chloride compounds were utilised to functionalise TiO2 NPs. In theory, ideal composites for real applications should be continuous and bulk immobile materials of which the nano-reactivity is obtained by anchoring or impregnating a parent material structure with nanomaterials (Azhari, 2014). The treatment of wastewater demands for nontoxic, long-term stable and low-cost materials for nanocomposites.

~ 8 ~ Table 1: Comparison of different p-type NiO nanostructures (Ruiyang et al., 2016).

Operating Response time/ Materials Ethanol (ppm) Rg/Ra Temperature oC Recovery time (s) Flake-flower NiO 400 300 23.7 10/5 NiOnanorod 500 300 1.4 4/5 NiOnanoblock 500 300 1.1 5/5 NiO nanowire 500 300 3.4 5/6 Needle-Flower NiO 500 300 4.0 4/6 NiO sphere 500 200 1.1 67/47 NiO octahedron 500 200 1.7 32/28 NiOnanosheet 500 200 4.3 64/93 UltralongNiO nanowire 400 350 2.4 15/18

Wenzhong et al. (2002) reported the synthesis of Needle shaped NiO nano sheets by the hydrothermal process as presented in figure 2.

Figure 2: Synthesis of Needle like NiO nano sheets (Shengkai, 2015; Wenzhong et al., 2002).

The needle-like NiC2O4 2H2O structures with length and diameter of 5μm and 80nm were synthesised by using 0.061g sodium oxalate individually. Furthermore, it can be seen that the dispersions of the needles was relatively tremendous and when the amount of sodium oxalate was reduced to 0.022g, the NiC2O4. H2O nano-flowers self-assembled by needles with length and diameter of 6 μm and100nm was obtained as shown in Fig. 2 (Shengkai, 2015).

ZnO NANO SHEETS PREPARATION AND MORPHOLOGY STUDY BY SEM AND TEM NPs of different shape and sizes are synthesized by different methods that include Sol Gel, Co- precipitation, hydrothermal, Chemical Vapour Disposition, Laser ablation, deposition, impregnation, thermal, and electrolytic methods (Taniguchi, 1974). Iijun et al. (2014) reported the synthesis of ZnO nanostructures using a surfactant-free hydrothermal method. They reported the fabrication of flower- like ZnO architectures; they are made of thin nano-sheets by using a surfactant-free hydrothermal process. The morphology of the as-grown flower-like ZnO architectures were investigated by field- emission scan electron microscopy (FESEM), high-resolution transmission electron microscopy (HRTEM), and spectroscopy. Iijun et al. (2014) reported that the FESEM images of the ZnO sample were obtained after preheating for 12 hours.

~ 9 ~ Figure 3: No to change. (a) and (b) SEM images of NiO samples obtained at 160◦C for 6 h. (c) and (d) SEM images of NiO samples obtained at 160◦C for 9 h (Ruiyang, 2016).

It can be seen from the low magnification top view FESEM image shown in figure 3 (a) that high density flower-like ZnO architectures uniformly grow and extremely disperse in the substrates without any aggregation, specifying high yields and good uniformity accomplished with this fabrication condition. The middle magnification FESEM image in figure 3(b) confirms that individual flowers have a diameter of about 40–50 m and consist of hundreds of thin curved nanosheets, which are spoke-wise, projected from a common central zone. As presented in figures 3(c) and 3(d), the high 휇 magnification FESEM image reveals that these ZnO nanosheets are about 10–15 m in length, 3–6 m in width, and about 50n min thickness, which are decorated to form the shape of flower-like 휇 architectures (Ruiyang, 2016). Moreover, low density ZnO nanorods, as shown in figure 3(e), can be 휇 observed on the space without flower-like ZnO architectures indicated by the white square in figure 3(b). Iijun et al. (2014) reported that scheme 1 shows a characteristic of low resolution TEM image of an individual flower-like ZnO architecture scraped off from the substrate, which clearly demonstrates that it is made up of projected thin nanosheets (Iijun et al., 2014). The flower-like ZnO growth process is summarised in scheme 1. Iijun et al. (2014) reported that Zn2+ and OH− are provided by hydration of

Zn(NO3)2 and HMT respectively. Therefore, the key chemical reactions can be formulated as follows:

~ 10 ~ Scheme1: Schematic growth diagram of the ZnO nanostructures fabricated by preheating hydrothermal method (Iijun et al., 2014; Kook et al., 2014).

SIGNIFICANCE OF NANOPARTICLES FOR WASTEWATER TREATMENT Modern advances in nanotechnology imply that several issues relating to water quality could be determined or this significantly increased the usage of nanomaterials which resulted in the growth of nanotechnology. Novel routes in the development of new nanomaterials to desalinate water are among the most thrilling and gifted technologies (Kanchi, 2014). Specific nanomaterials targeting the analyte and making the entire system effective, economical and rapid for the treatment of waste waters are being exploited by different science research teams in the world. On the other hand, the treatment of industrial wastewater with newly synthesized nanomaterials is another potentially useful application. The capability to remove toxic compounds from surface and sub-surface and other environments are very difficult to access in situ, and doing so rapidly, efficiently and within reasonable costs is the ultimate goal. Hence, nanotechnology based wastewater treatment effectively eliminates the contaminants and helps in the recycling process to get purified water, which leads to a reduction in labour, time and expenditure to industry and solves the various environmental issues.

Nanomaterials are mainly categorised into various groups based on their physical and surface properties. Nanomaterials include nano-adsorbents such as carbon nanotubes (CNTs), metal oxide nanomaterials

(Al2O3 NPs, ZnO NPs, TiO2 NPs and CeO2 NPs), metallic nanoparticles (Au & Ag NPs), mixed oxide nanoparticles (Fe-Ti NPs) and polymer nanostructures, nanofibers, and nano clays. Additionally, it also utilises the existence of nanosomic pores in zeolite filtration membranes, as well as nanocatalysts. Metallic/metal oxide nanoparticles such as titanium oxide nanoparticles and palladium nanoparticles are used as nano sensors for the analysis of organic and inorganic pollutants in the water systems. Gehrke (2015) states that nanomaterials have unique size-dependent properties related to their high specific surface area (fast dissolution, high reactivity, strong sorption) and discontinuous properties (such as superparamagnetic, localised surface plasmon resonance, and quantum confinement effect). These specific Nano based characteristics allow the development of novel high-tech materials for more efficient water and wastewater treatment processes, namely membranes, adsorption materials,

~ 11 ~ nanocatalysts, functionalised surfaces, coatings, and reagents (Ateeq, 2015). The most promising materials and applications are highlighted in Table 2.

Table 2: Overview of types of nanomaterials applied for water and wastewater technology (Cheturvedi et al., 2019). Nanomaterial Properties Application High specific surface area, high adsorp- Point of use, removal of organics, Nano adsorbents tion rates, small footprint. High production heavy metals and bacteria. costs. Short intraparticle diffusion distance, com- Removal of heavy metals, (arsenic) Nanometals and nano metal ox- pressible, abrasion resistant, magnetic Radionuclides, media filters, slurry re- ides actors, powders, pellets

Photo catalytic (WO3, TiO2) Less reusable Membranes and membrane pro- Reliable, largely automated process - rela- All field of water and wastewater treat- cesses tive high energy demand ment processes

One of the most sustainable ways of making suitable amounts of nanomaterials for water treatment is the use of waste materials that could be converted into suitable nanostructures. This can be achieved either using food waste or plastic waste, egg shells or waste paper as summarised microstructures. i) Obtaining carbon based nanomaterials from food waste Food waste materials are generated in tonnes worldwide, which amounts to enormous pollution emitting out of it. In order to minimise pollution these materials have high content of carbonaceous material; therefore, these materials can be converted to useful materials which have valuable applications for waste water treatment. Betzy (2015) reported the chemical activation performed by a single step impregnation of precursors with activating agents (such as KOH and ZnCl2), followed up with a heat treatment process at moderate temperature ranging from 700 to 900 K. Chemically ACs usually exhibit high specific surface areas and well-defined micropore size distribution. Various ∼ biomass precursors such as cherry stone, fish scale, waste paper, water bamboo, Cherry stones, sugar cane waste, Camellia oleifera Shell, Foxnut (Euryale ferox) Shell, waste tea, Holm Oak (Quercus ilex) Acorns, Paulownia Flower, Pineapple Waste, flour, yeast cells, fallen leaves, pine-cone, pig bone, willow catkins, lettuce leaves, waste tea-leaves, sunflower seed shell, ginkgo shells, cow dung, silk, human hair and sewage sludge, have been chemically converted into ACs for waste water treatment. For example, a honeycomb like carbon foam has been successfully derived from natural flour via KOH activation, which exhibited a large specific surface area of 1313 2m g. To date, all kinds of biomass precursors such as date seeds, coconut shell, ark of plants, walnut shell, pista shell, almond shell, coffee seeds, orange peel, pomegranate peel, banana peel, a pig bone, fish scales, shrimp shell, litchi shells, olive stones, cotton, silk cocoon, bamboo, wheat straw, mango stone, pomelo peels, banana peels, gelatin, cassava, bark of plane trees, and starch have been widely explored to prepare hierarchical porous carbons by well-deigned carbonization processes (Betzy, 2015).

~ 12 ~ Table 3: Peformance of activated carbon derived from agricultural waste materials (Pavan, 2017). Carbonisation Activating Surface area Total Pore Source temperature Application agent (BET) m2/g volume cm2/g (oC) For the adsorption of Camella H PO 450 oC 1608 1.17 methylene blue and oleifera Shell 3 4 iodine As an adsorbent for Bamboo Chips H PO & K CO 700-850 oC 2237 1.23 3 4 2 3 ciprofloxacin Adsorption of NOx and H2S from a gas steam Kernels of Steam of CO 2 500 & 800 361 to 1173 0.21 to 0.74 and for the removal cherry stones and KOH of methylene blue and iodine Removing hazardous Foxnut (Euryale waste compounds ZnCl Solution 500-700 2869 1.96 forex) 2 industrial gases and waste water KOH, ZnCl , Removal of dye from Holm Oak 2 750 1305 0.621 H3PO4, H2SO4 waste water High performance Paulownia KOH 800 1471 electrode material for flower supercapacitors Solid Pineapple Removal of dye from Waste Biomass ZnCl solution 500 914.67 0.56 2 waste water (SPWB) Low cost adsorption of Sugar Cane KOH with 800 806 0.678 heavy metals with great biogases (SCB) HNO 3 adsorption capacity An electrode materials in Waste tea H PO /K CO 450/800 1327/1125 0.865/0.050 3 4 2 3 supercapacitor ii) Waste plastic: Waste plastics account for huge domestic waste globally which is accounting for millions of waste dumped as waste garbage; which can be utilised for preparing activated carbon, and carbon nanotubes and a study of its applications for waste water treatment, and for supercapacitors. Waste plastics are also known as High Density Polyethylene (HDPE). Usually it is prepared by cutting into small pieces and then adding Cobalt acetate catalysts then mounting in the furnace under argon atmosphere for an hour at 700-900oC for an hour. Then it is cooled to room temperature and the sample is collected and ready for analysis and studying its application for waste water treatment, supercapacitors, Li ion batteries and many more applications (Pavan et al., 2017). iii) Egg shell: Egg has good protein and it is consumed daily as valuable food worldwide which gives good energy for all ages of people and the egg shells are wasted are they are daily thrown into the garbage quite a lot. These egg shells have calcium carbonate which accounts to 93%. Calcium carbonate can be easily converted to calcium oxide, nano calcium oxide, and calcium hydroxy apatite by simple pyrolysis or calcination process at high temperatures in the furnace. Then a white powder is obtained and used as catalysts in organic synthesis, and different metal oxides can be impregnated on calcium oxide for waste water treatment (Elaheh, 2014). iv) Waste paper: Approximately one-fifth of the contents of household dustbins, waste papers from office dustbins, of which half is newspaper, magazines and office papers. This is equivalent to over 4

~ 13 ~ kg of wastepaper per household for each week. Present statistics suggest that 80% of the waste stream is disposed as landfill, 10% is incinerated, and the other 10% is recycled (Kalpana, 2009). Recycling or reuse is the best current solution for reducing the disposal problem. There is therefore an urgent need to develop alternate methods for developing waste water purification processes to overcome the shortage of water in Namibia and worldwide. Waste paper can be converted nano activated carbon and applied for waste water treatment. Any waste material can be converted into useful material and it can be utilised for the title project it will be eco-friendly and economic process (Kalpana, 2009).

VARIOUS METAL AND METAL OXIDE NANOPARTICLES USED FOR WASTE WATER TREATMENT Nanoscale metal oxides are promising alternatives to activated carbon and effective adsorbents to remove heavy metals and radionuclides from wastewater (Chorawala, 2015). Stoimenov et al. (2002) reported that the MgO nanoparticles and Magnesium nanoparticles are very effective biocides against Gram-positive and Gram-negative bacteria (Escherichia coli and Bacillus megaterium) and bacterial spores (Bacillus subtillus). Silver nanoparticles (Ag NPs) are highly toxic to microorganisms and thus they have strong antibacterial effects against a wide range of microorganisms. Silver nanoparticles have been widely used for the disinfection of water as a good antimicrobial agent although the mechanism of the antimicrobial effect of Ag NPs is still not clearly known (Sondi et al., 2004). In recent years, Ag NPs have been reported to be able to adhere to the bacterial cell wall and subsequently penetrate it, resulting in structural changes of the cell membrane of the bacterial cell and thus increasing its permeability (Sondi et al., 2004). Another important nano metal, nano-titanium dioxide (TiO2) is among the promising nanocatalysts which are tested for their antimicrobial activity. TiO2 is utilised in the disinfection and decontamination processes of wastewater (Sondi et al., 2004).

NANOFILTRATION MEMBRANE FOR WASTE WATER TREATMENT Nanofiltration is one of the membrane filtration techniques and it can be defined as a pressure-driven process wherein molecules and particles less than 0.5 nm to 1 nm are rejected by the membrane (Gehrke et al., 2015). Nanofiltration membranes are widely used in water treatment for drinking water or wastewater treatment (Saha et al., 2013). Nanofiltration membranes are characterised by a unique charge-based repulsion mechanism allowing the separation of various ions (Sharma, 2012). They are mostly applied for the reduction of hardness, colour, odour, and heavy metal ions from groundwater. The conversion of sea water into potable water (desalination) is another prosperous field of application since comparable desalination technologies are very cost-intensive. According to (Saha et al., 2013), nanofiltration membranes are pressure-driven membranes with properties between those of reverse osmosis and ultra-filtration membranes and they have pore sizes between 0.2 and 4 nm. Nanofiltration membranes have been shown to remove turbidity, microorganisms and inorganic ions such as Ca and Na.

VARIOUS NANOMATERIALS USED FOR WASTE WATER TREATMENT AT UNAM The project is ongoing for the synthesis of various nano materials such as Activated carbon from acacia pods, and banana peels using impregnating reagents H2SO4, H3PO4. CoFe LDHs nano sheets, and Ag

~ 14 ~ Nano nanoparticles were applied for waste water contaminated with algae. Water was treated from treatment ex: Gammams water, sea water, methylene blue, methyl orange, and algae contaminated water. All the obtained results were good compared with standard results reported in literature. The treated water samples were analysed by a UV spectrophotometer. Activated carbon from acacia pods, banana peels, CoFe LDHs Ag NPs physical properties and further samples were analysed by XRD, SEM, TEM, IR, and BET surface area instruments in South Africa. Adsorption and desorption studies were conducted and all the samples showed positive results comparing the standard literature values and the analysis is still in progress.

CONCLUSIONS This article highlights the importance of nanotechnology and argues that it can play a pivotal role for waste water treatment in Namibia, and the rest of Africa. Since it is well-known that Namibia is a dry country, there is an overwhelming need for improvement of the quality of water in Namibia and the sub-Saharan African region. An awareness of the development of innovative systems has to be developed for the improvement of water quality both for drinking purposes and for using in industries and treating the effluents from wastewater treatment and industrial facilities. Therefore, new technology has to be developed for maintaining water quality in the form of nanotechnology. Over the last few decades nanotechnology has emerged as the most advanced technology in all branches of science and engineering. From these intriguing features it is evident that in the coming era nanotechnology will play an important role in waste water treatment. In recent decades water treatment using nanotechnology based expertise has gained significant attention. Against this background, the adoption of highly advanced nanotechnology to traditional process engineering offers new opportunities in technological developments for advanced wastewater technology processes. Recent nanotechnology techniques extend from the fabrication of membranes from nanomaterials to the use of catalysts for the decomposition of noxious compounds that are present in water. The article highlighted the shapes of nano particles, CoFe LDHs nano sheets, Ag nano particles, and activated carbon prepared from banana peels and acacia pods have been applied for waste water treatment and the results are encouraging even though the research is progressing with some possibilities for improvements of the process. This is quite significant for Namibia and Africa for water quality and research advances in nanotechnologies for wastewater treatment processes. Finally, it is concluded that the future of water management and quality of water is depended on improving the technology of waste water treatment on the lines of nanotechnology.

ACKNOWLEDGEMENTS The authors acknowledge the Multidisciplinary Research Centre conference organisers and the Research and Publications Department of the University of Namibia for giving opportunity to present this research paper.

~ 15 ~ REFERENCES Ateeq R. Heita J H, Likius D, Uahengo V, Sirunda. S, Bhaskurani V. H. C, Jonnalagadda S. B. (2019).

Chemical preparation of activated carbon from Acacia erioloba seed pods using H2SO4 as impregnating agent for water treatment: An environmentally benevolent approach. Journal of Cleaner Production 237, 117689, 1-9, doi.org/10.1016/j.jclepro.2019.117689. Ateeq R, Mathew M, Courtie M, et al (2015). A mini review on new emerging trends for the synthesis of adipic acid from metal-nano heterogeneous catalysts. Catalysis Letters, 146(1), 788-799. doi 10.1007/s10562-015-1682-5.

Alalm M. G., Tawfik A., & Ookawara, S. (2015). Comparison of solar TiO2 photocatalysis and solar photo-Fenton for treatment of pesticides industry wastewater: operational conditions, kinetics, and costs. Journal of Water Process Engineering 8, 55–63. doi:10.1016/j.jwpe.2015.09.007. Azari A., Babaei A.-A., Kalantary R. R., Esrafili A., Moazzen M., & Kakavandi B. (2014). Nitrate removal from aqueous solution using carbon nanotubes magnetized by nano zero-valent iron. Journal of Mazandaran University of Medical Sciences, 23, 14–27. ISSN:1735-9260E- ISSN:1735-9279. Betzy N. T, Soney C. G. (2015). Production of activated carbon from natural sources. Trends in Green Chemistry, 1, 1-5. doi:10.21767/2471-9889.100007. Bokare, V., Jung, J.-L. Chang, Y.-Y., & Chang Y.-S (2013). Reductive dechlorination of octachlorodibenzo-p-dioxin by nanosized zero-valent zinc: Modeling of rate kinetics and congener profile. Journal of Hazardous Materials, 250, 397–402. doi 10.1016/J. JHAZMAT.2013.02.020. Chaturvedi, S., & Dave, P. N., (2019). Water purification using nanotechnology: Emerging opportunities. Chemical Methodologies 3, 115-144. doi 10.22034/CHEMM.2018.143461.1069. Chorawala.K. K., & Mehta M. J., (2015). Applications of nanotechnology in wastewater treatment international. Journal of Innovative and Emerging Research in Engineering, 2, 21-26. ISSN: 2394 – 5394. Derjaguin. B. V, Titijevskaia A. S, Abricossova I. I., & Malkina A. D. (1954). Investigations of the forces of interaction of surfaces in different media and their application to the problem of colloid stability. Discussion of the Faraday Society, 18, 24-41. doi 10.1039/DF9541800024. Diallo M. S., & Savage. N. (2005) Nanoparticles and water quality. Journal of Nanoparticle Research,7, 325-330. doi 10.1007/s11051-005-8543-x. Elaheh M., & Asadollah, H. (2014). Preparation and characterization of nano CaO based on eggshell waste: Novel and green catalytic approach to highly efficient synthesis of pyrano [4,3-b] pyrans. Chinese Journal of Catalysis 35, 351-356. doi: 10.1016/S1872-2067(12)60755-4. Gehrke, I., Andreas G., & Somborn-schulz, A. (2015). Innovations in nanotechnology for water treatment. Nanotechnology Appled Sciences, 8, 1-17. doi: 10.2147/NSA.S43773. Guo M., Song, W., Wang, T., Li, Y., Wang, X., & Du X. (2015). Phenyl-functionalization of titanium dioxide-nanosheets coating fabri-cated on a titanium wire for selective solid-phase microextraction of polycyclic aromatic hydrocarbons from environment water samples. Talanta, 144, 998–1006. doi: 10.1016/j.talanta.2015.07.064.

~ 16 ~ Guesh K., Mayoral A., ´Alvarez, C. M., Chebude, Y., & D´ıaz, I. (2016). Enhanced photocatalytic

activity of TiO2 supported on zeolites tested in real wastewaters from the textile industry of Ethiopia. Microporous and Mesoporous Materials, 225, 88–97. doi.org/10.1016/j. micromeso.2015.12.001. Ijun, Q., Binbin, W., Lihua, Z., Caleb, C., Zhisheng, S., Xiaomin, L., Hyung-Kook, K., & Yoon- Hwae, H. (2014). Synthesis and characterization of flower-like bundles of ZnO nanosheets by a surfactant-free hydrothermal process. Journal of Nanomaterials, 281461, 1-11. doi. org/10.1155/2014/281461. Kalpana, D., Cho, S. H., Lee, S. B., Lee, Y.S., & Rohit, R. (2009). Recycled waste paper: A new source of raw material for electric double-layer capacitors. Journal of Power Sources 190, 587-591. doi:10.1016/j.jpowsour.2009.01.058. Kanchi, S (2014). Nanotechnology for water treatment. Journal Environmental Analytical Chemistry, 1, 1-3. doi:10.4172/2380-2391.1000e102. Kook, K., & Yoon-Hwae H. (2014). Synthesis and characterization of flower-like bundles of ZnO nanosheets by a surfactant-free hydrothermal process. Journal of Nanomaterials, 1-13 doi. org/1.2017/j.memsci.2014.13.021 . Kallman, E. N., Oyanedel-Craver, V. A., & Smith, J. A. (2011). Ceramic filters impregnated with silver nanoparticles for point-of-use water treatment in rural Guatemala. Journal of Environmental Engineering, 137(6), 407–415. doi.org/10.1061/(ASCE)EE.1943-7870.0000330. Li, X., Lenhart, J. J., & Walker, H. W. (2013). Aggregation kinetics and dissolution of coated silver nanoparticles. Langmuir, 28, 1095–1104. doi.org/10.1021/la202328n. Lei, Y., Chen F., Luo, Y., & Zhang, L. (2014). Three-dimensional magnetic graphene oxide foam/ Fe3O4 nanocomposite as an efficient absorbent for Cr(VI) removal. Journal of Materials Science, 49, 4236–4245. doi:10.1007/s10853-014-8118-2. Ohsaka, T., Shinozaki, K., Tsuruta, K., & Hirano, K. (2008). Photoelectrochemical degradation of some chlorinated organic compounds on n-TiO2 electrode. Chemosphere, 73,1279–1283. doi. org/10.1016/j.chemosphere.2008.07.016. Pavan, K. T., Shane, D., & Neil, J. C. (2017). Synthesis of multi-walled carbon nanotubes from plastic waste using a stainless-steel CVD reactor as catalyst. Nanomaterials 284, 1-17. doi:10.3390/ nano7100284. Qu, X., Alvarez, P. J., & Li, Q. (2013). Applications of nanotechnology in water and wastewater treatment. Water Research, 47, 3931-3946. doi: 10.1016/j.watres.2012.09.058. Quang, D. V., Sarawade, P. B., Jeon, S. J., Sang, S. H., Jong-Kil, K., Young, G. C., & Hee, T. K. (2013). Effective water disinfection using silver nanoparticle containing silica beads. Applied Surface Science, 266, 280–287. doi.org/10.1016/j.apsusc.2012.11.168. Ruiyang, M., Wen, Z., & Qi, G. (2016). SDS-assisted hydrothermal synthesis of NiO flake-flower architectures with enhanced gas-sensing properties. Applied Surface Science 384, 304-310. doi.org/10.1016/j.apsusc.2016.05.070. Ren, D. & Smith, J. A. (2013) Retention and transport of silver nanoparticles in a ceramic porous medium used for point-of- use water treatment. Environmental Science and Technology, 47, 3825–3832. doi.org/10.1021/es4000752.

~ 17 ~ Rivero-Huguet, M., & Marshall, W. D. (2009). Reduction of hexavalent chromium mediated by micron- and nano-scale zerovalent metallic particles. Journal of Environmental Monitoring, 11, 1072–1079. doi:10.1039/b819279k. Saha, B., Indranil, S., Mukhopadhyay, A., Chattopadhyay, D., Uday, C. G., & Debashis, C. (2013). Role of nanotechnology in water treatment and purification : Potential applications and implications. International Journal of Chemical Science and Technology 3, 59-64. Shon, H. K., Phuntsho, S., Vigneswaran, S., & Kandasamy, J (2013). Physical, chemical and biological characterization of membrane fouling. Membrane Technology and Environmental Applications, Chapter 16, American Society of Civil Engineers, 457-475. doi/abs/10.1061/9780784412275. ch16. Sharma, V., & Sharma, A. (2012). Nanotechnology: an emerging future trend in wastewater treatment with its innovative products and processes. International Journal of Enhanced Research in Science Technology and Engineering, 1, 1-8. Sondi, I., & Salopek-Sondi, B. (2004). Silver nanoparticles as antimicrobial agent: a case study on E. coli as a model for Gram negative bacteria. Journal of Colloid and Interface Science, 275, 177-182. doi:10.1016/j.jcis.2004.02.012. Stoimenov, P. K., Klinger, R. L., Marchin, G. L., & Klabunde, K. J. (2002). Metal oxide nanoparticles as bactericidal agents. Langmuir 18, 6679-6686. doi.org/10.1021/la0202374. Shengkai, C., Wen, Z., Huiwu, L., & He, Z. (2015). Hydrothermal synthesis of novel flower-needle NiO architectures: Structure, growth and gas response. Materials Letters,159, 385- 388. doi:10.1016/j.matlet.2015.07.045. Taniguchi, N. (1974). On the basic Concept of Nanotechnology. Proceedings of the International Conference on Production Engineering, Tokyo, 18-23. Wenzhong, W., Yingkai, L., Congkang, X., Changlin, Z., & Guang, W. (2002). Synthesis of NiO nanorods by a novel simple precursor thermal decomposition approach Chemical Physics Letters, 362, 119-122. doi.org/10.1016/S0009-2614 (02)00996-X. Zsigmondy, R. (1914). Colloidal and the ultramicroscopic. New York, NY: John Wiley and Sons.

~ 18 ~ ANTIPLASMODIAL ACTIVITY, PHYTOCHEMICAL PROFILE, ACTIVE COMPOUNDS AND CYTOTOXICITY OF PECHUEL-LOESCHEA LEUBNITZIAE O. HOFFM. (ASTERACEAE): AN ENDEMIC SHRUB USED TO MANAGE MALARIA IN NAMIBIA

Kadhila, N. P.1*, M. Sekhoacha, M.2, Tselanyane, M.3, Chinsembu, K.C.4 1Multidisciplinary Research Centre: Zero Emission Research Initiative, University of Namibia, P/ Bag 13301, Windhoek, Namibia 2Department of Pharmacology, Indigenous Knowledge Systems Lead Programme, University of the Free State, P.O. Box 339, Bloemfontein 9300, South Africa 3Council for Scientific and Industrial Research (CSIR), Pretoria, South Africa 4Department of Biological Sciences, Faculty of Science, University of Namibia, P/Bag 13301, Windhoek, Namibia

*Corresponding author: Email address: [email protected] (N.P. Kadhila)

ABSTRACT Previous studies done in Namibia on Pechuel-loeschea leubnitziae, a putative antimalarial endemic plant, have not evaluated the antiplasmodial activity and cytotoxicity. In this study, parasite lactate dehydrogenase assay showed that P. leubnitziae collected from northern regions of Namibia exert marginal antiplasmodial activity; IC50 = 7.24 µg/mL against a Plasmodium falciparum 3D7 strain. Phytochemical screening of P. leubnitziae DCM extracts showed the presence of anthraquinones, saponins, terpenoids, coumarins, alkaloids, and flavonoids. Two antiplasmodial fractions, namely

Npk1 F70 (IC50 = 2.63 µg/mL) and NPk1 F78 (IC50 = 2.64 µg/mL), were isolated from DCM extracts.

Both fractions were toxic to Chinese hamster ovary mammalian cells; IC50 = 2.747 µg/mL and 2.224 µg/ mL for NPk1 F78 and Npk1 F70, respectively. Analysis with gas chromatography-mass spectrometry (GC-MS), Fourier transform infrared (FTIR) and nuclear magnetic resonance spectroscopy (NMR) revealed that the two antiplasmodial fractions of P. leubnitziae namely NPk1 F78 and Npk1 F70 contain the same active compound xerantholide with molecular weight of 246 g/mol. Data from this study may contribute to the discovery of new antimalarial drugs from indigenous Namibian plants.

Keywords: Pechuel-loeschea leubnitziae, antiplasmodial activity, phytochemicals, xerantholide, cytotoxicity

INTRODUCTION Pechuel-loeschea leubnitziae, commonly known as wild sage, bitterbush and stinkbush in English; bitterbos in Afrikaans; and Oshizimba in the Oshiwambo language of Namibia, is a multi-stemmed and aromatic shrub indigenous to southern Africa (Tedder et al., 2012). The vernacular names connote the very bitter taste of the plant extracts. The only species in the genus, P. leubnitziae occurs in southern Angola, Namibia, Botswana, Swaziland, Zimbabwe and the northern regions of South Africa (Tedder et al., 2012). The plant has a chamaephyte growth form with silver-grey felt-like pubescence on

~ 19 ~ stems and leaves (Von Koenen, 2001). Since it is a woody species with perennating buds close to the ground, P. leubnitziae is fairly resistant to burning and resprouts from the base after the above-ground biomass is burnt. P.leubnitziae colonises disturbed regions on sandy and alkaline soils. It produces a large number of small and wind-dispersed seeds that dominate the soil seed bank particularly in regions with extensive above-ground plant cover. P.leubnitziae is an indicator of overgrazing and areas dominated by this shrub are often characterised by grazing-tolerant species with low forage quality (Tedder et al., 2012).

In Namibia, P. leubnitziae is found throughout the country except in the far north-eastern region (Mannheimer & Curtis, 2009). It is the most dominant shrub near the Olushandja Dam of north-central Namibia (Burke, 2000). A notable population of P. leubnitziae occurs on the flood plains between the Klipneus area and Rooibank (Theron et al., 1980). Namibian traditional healers use preparations of P. leubnitziae to treat various diseases. Archival collections (Van Damme et al., 1922) and recent reports (Chinsembu et al., 2015; Mumbengegwi et al., 2015) show that leaf extracts are orally administered to treat gonorrhoea, fever, and chest and stomach pains. Fresh or dried leaves are topically applied to treat measles and to disinfect wounds (Mumbengegwi et al., 2015). Patients inhale the vapour to cure colds and coughs (Ndongo, 2017; Mumbengegwi et al., 2015). Warmed leaves are used as a poultice to relieve painful feet and headaches. An extract of the root is also drunk as a tuberculosis remedy (Van Damme et al., 1922; Von Koenen, 2001).

The Herero people of Namibia use P. leubnitziae leaf decoctions as a steam bath to delay menstruation (Von Koenen, 2001). Ovahimba people of the Kunene region in Namibia and neighbouring Angola use finely ground roots mixed with fat as a cosmetic (Curtis & Mannheimer, 2005). In Ohangwena and Kavango East regions of Namibia, crushed leaves are boiled and persons suffering from fever and headaches are steamed (Curtis & Mannheimer, 2005; Kadhila, 2018). The Owambo people of Namibia drink leaves decoction as remedy for malaria (Kadhila, 2018). P.leubnitziae is also an effective mosquito repellent (Ndongo, 2017). Malaria is prevalent in nine regions and 22 districts of Namibia where 1.2 million people out of the country’s total population of 2.5 million are at risk of the disease (Alegana et al., 2016).

Despite the putative importance of P. leubnitziae in the management of malaria in Namibia, no studies have evaluated the antiplasmodial functions of this plant. Therefore, the aims of the current study were to test the in vitro activity of P. leubnitziae extracts against Plasmodium falciparum 3D7 strain, to determine the phytochemical, elucidate the antiplasmodial active fractions and compounds, and to determine the cytotoxicity.

METHODOLOGY Extract preparation and in vitro screening for antiplasmodial activity The plant (Fig. 1) was collected on 25 March 2016 by Dr Kadhila near Rundu town (geographical coordinates 17.64940 S, 015.95758 E) in the Kavango East region of Namibia. The plant’s voucher number is NPK13 and its documentation, identification, and authentication was done by the curator,

~ 20 ~ Mr Leevi Nanyeni of the National Herbarium at the National Botanical Research Institute of Namibia. The crushed boiled leaves are used to steam persons suffering from malaria and its related symptoms are steamed in crushed and boiling leaves of P. leubnitziae. Plant material (20 grams) was dried, ground to fine powder, and added to 200 mL of solvent. The samples were placed on a shaker for 48 hours, filtered and extracted again with the same solvent for another 48 hours. The extraction process was repeated sequentially with organic solvents in their increasing order of polarity. The solvents used were hexane, dichloromethane, ethyl acetate and methanol. The extracts were filtered through Whatman no.4 filter paper and subsequently evaporated using a rotary evaporator (Heidolph GI, Germany) at 60 oC. The extracts were dried in the fume hood, weighed and placed in sterile sample bottles and stored in a refrigerator until use.

Figure 1: Pechuel-loeschea leubnitiziae

CULTIVATION OF MALARIA PARASITES Plasmodium falciparum parasites (chloroquine-sensitive strain 3D7) were cultured as described by Trager and Jesen (1976), with minor modifications. The parasites were maintained in Roswell Park Memorial Institute (RPMI) 1640 (BioWhittaker) culture medium supplemented with phenol red, albumax II (bovine serum albumin) (Gibco) (25 g/L), HEPES (N-[2-hydroxyethyl]-piperazine-N’-[2- ethansulphonic acid]) (6 g/L), 4.25% of sodium bicarbonate and gentamycin (50 mg/L). The parasites were cultured in sealed flat bottom flasks and maintained in washed O+ human red blood cells (RBCs) o at 37 C in an atmosphere of 93% N2, 4% CO2, and 3% O2. The haematocrit and parasitaemia were kept between 2-4% by the addition of RBCs. Parasites were synchronised at the ring stage regularly by treatment with 5% D-sorbitol. The parasitaemia was determined microscopically using a Giemsa stained thin blood smear of culture on the slide.

Stock solutions of 20 mg/mL were made in 100% dimethyl sulfoxide (DMSO) and the samples were screened at 100 µg/mL - 5.13 x 10-3 µg/mL for dose-response (3- fold dilution). The solvent control, DMSO was also screened at corresponding concentrations of the test samples with the starting concentration of 1% DMSO at 100 µg/mL. The extracts were screened for in vitro antimalarial activity at full dose concentrations against 3D7 of P. falciparum. The 50% inhibitory activity (IC50 values) was determined using the parasite lactate dehydrogenase (pLDH) assay. Two-fold dilutions of the stock solution of 2 mg/mL to 200 µg/mL were prepared in complete RPMI 1640 culture medium, introduced to the parasite at trophozite stage, and incubated for 48 hrs at 37 oC in an atmosphere of

~ 21 ~ 93% N2, 4% CO2, and 3% O2. After incubation, parasite viability relative to the untreated controls was measured in the pLDH assay wherein the density of the parasite was indicated by production of quantifiable purple crystals of formazan salt. Dose-response curves were obtained by plotting percentage parasite survival against the logarithm of the concentration using GraphPad Prism software package (GraphPad software, Inc., California, USA). The 50% inhibitory activities (IC50 values) were derived from dose-response curves.

BIO FRACTIONS OF ANTIPLASMODIAL ACTIVE EXTRACTS BY COLUMN CHROMATOGRAPHY Fractionation of antiplasmodial active extracts by column chromatography was as described by Harborne (1973). Extracts that exhibited highest antiplasmodial activity were fractionated using column chromatography. Silica (0.063-0.200mm) was mixed with hexane to make slurry which was poured into a glass column (60 × 4 cm) and left to settle. The active fraction (20 mg/mL) was dissolved in 5 mL DCM:Hexane (9:1) and added onto the column, then washed with 50 mL hexane to wash out the DCM. The wash was collected in 20 mL in the first 2 glass tubes. The wash was followed by a slow and constant drop by drop flow of 200 mL of mobile phase: DCM:Hexane (60:40) at flow rate of ~65 drops per minute. The polarity of the mobile phase was then increased to DCM:MeOH (9:1). A total of 117 fractions of 10 mL each were collected.

Thin layer chromatography (TLC) was performed on Whatman aluminium sheets coated with a 0.2 mm layer of silica (Si gel 60). TLC was used to determine the profiles of the eluted fractions generated from column chromatography. The fractions 1 to 15 were reconstituted in DCM:Hexane (9:1) solvent system, while fractions 16-40 were reconstituted in 100% DCM. Fractions 41-52 were reconstituted in DCM:MeOH (9:1). Fractions were spotted on the TLC sheets using 10 μl capillary tubes. TLC plates were developed in TLC tanks in the mobile phase DCM:Hexane:EtOAC (6:3:1). The polarity of the mobile phase was increased to a DCM:Hexane:MeOH (6:2:2) solvent system for the more non-polar fractions. TLC plates were viewed under 254 nm and 365 nm UV light. Fractions with similar TLC profiles were pooled together which then yielded a total of 19 fractions including the wash, which was the last fraction.

PHYTOCHEMICAL SCREENING OF THE ANTIPLASMODIAL ACTIVE FRACTIONS For the detection of the compounds, universal reagents were used to react with many classes of natural products (Shikongo, 2012). The following classes of compounds were detected using freshly prepared universal reagents. For the detection of terpenoids and saponins, freshly prepared Liebermann Burchard Reagent (LBr) reagent was used. The reagent was prepared by carefully adding

5 mL of concentrated H2SO4 to 50 mL of absolute ethanol on ice. The TLC plates were sprayed with 5 to10 mL of LBr reagent, warmed at 100 °C for 5 to 10 minutes and evaluated under visible or UV (365 nm) light. The presence of brown zones in UV365nm, dark brown in visible light, grey zones in UV365nm and weak grey in visible light denote the presence of terpenoids and saponins. Freshly prepared KOH solution was used for the detection of anthraquinones and coumarins. The TLC plates were sprayed with 10 mL of a 10% (w/v) of 96% ethanolic KOH solution, dried and then observed

~ 22 ~ under UV (365 nm) or visible light without warming. The presence of yellow zones was an indication of anthraquinones and coumarins compounds.

Flavonoids were detected using aluminium chloride. Each TLC plate was sprayed with 5 to 10 mL of a 1% (w/v) 95% ethanolic AlCl3 solution and evaluated under UV (365 nm) light. The presence of blue, green and purple zones were indicative of flavonoids. The Dragendorrf reagent was prepared and used for the detection of alkaloids. The reagent was prepared by dissolving 8.00 g of KI in 20 mL of distilled water. This solution was then added to a second solution containing 0.85 g of basic bismuth nitrate in 40 mL of distilled H2O and 10 mL of glacial acetic acid. Each TLC plate was sprayed with 10 mL and observed under UV light at the wavelength of 365 nm. The presence of orange to red color and yellow zones was an indication of alkaloids.

CYTOTOXICITY ASSAYS Determination of cytotoxicity for antiplasmodial fractions was done using Chinese hamster ovary (CHO) cells that were cultivated in Dulbecco’s Modified Eagle Medium (DMEM) and F-12 HAMS Medium (1:1), supplemented with 10% fetal bovine serum and 0.6% streptomycin. CHO cells were plated at a concentration of 1×1^5 cells/mL and incubated in a 5% CO2 incubator for 24 hours in order to adhere. Medium was aspirated and cells were incubated with 10-fold serial dilutions (0.001-100 µg/mL) of test samples for further 48 hours. After the incubation, cell viability relative to untreated controls was determined using a colorimetric MTT (3-[4, 5-dimethylthiazol-2-yl]-2, 5 diphenyl tetrazolium bromide) assay and the IC50 (50% inhibition of cell viability) value was derived from dose-response curves. Emetine was used as a positive control.

STRUCTURE ELUCIDATION OF ACTIVE COMPOUND Structure elucidation of the antiplasmodial active compound was done at Protechnik Laboratories (Pretoria, South Africa) using standard procedures for gas chromatography-mass spectrometry (GC- MS), Fourier transform infrared (FTIR) and nuclear magnetic resonance spectroscopy (NMR).

RESULTS When screened for in vitro antimalarial activity against the chloroquine-sensitive strain 3D7 of P. falciparum, P. leubnitiziae DCM extract showed marginal activity of IC50 7.24 µg/mL (Fig. 2).

Figure 2: Log solvent percentage vs. % parasite survival data used to plot test samples (Npk-1D (P. leubnitiziae), Chloroquine and the solvent control (DMSO) dose-response curves.

~ 23 ~ DMSO had no effect on the parasites but chloroquine showed IC50 of 8.09 ng/mL. Phytochemical screening of the plant extracts showed the presence of anthraquinones, saponins, terpenoids, coumarins, alkaloids, and flavonoids. The active crude of dichloromethane extract for Npk-1D was fractionated and compounds were isolated and subjected to purification. Two compounds were isolated (Fig. 3), namely, Npk1 F70 and Npk1 F78, and they showed increased in vitro antimalarial activity against 3D7 strain, Npk1 F70 (2.63 ± 0.48 µg/mL) and Npk1 F78 (2.64 ± 0.32 µg/mL).

Figure 3: TLC profiles for the active fractions of Npk1 F70 to F78 (A) and purified square crystals compounds of fraction Npk1 F78 (B).

Cytotoxicity assay revealed that the antiplasmodial fractions are toxic to mammalian CHO cells, with

IC50 values of 2.42 µg/mL for Npk1 F70-77 and IC50 2.29 µg/mL for Npk1 F78-90 (Fig. 4).

Figure 4: Log concentration vs. % parasite survival data used to plot compounds Npk1 F70-77 and Npk1 F78-90 dose-response curves.

The chemical structure elucidation revealed that the two fractionates contained the same compound which was identified as xerantholide (Fig. 5) with a molecular weight of 246.3042 g/mol. Due to the chiral centres at position 1, 7, 8 and 10, this means the compound has diasteromers. There is however a mixture of similar compounds with different conformation or orientations of the groups attached. The functional groups within the chemical structure are defined as Vmax (KBr)/cm-1 2967(C-15 and

C-14 2 X CH3) 2892(C-13 C=CH2), 1755(C-12 O-C=O), 1688(C-3 C=O), 1632(C-5 C=C).

~ 24 ~ Figure 5: Chemical structure of the isolated active compound Xerantholide from NPK1 F70.

Figure 6: Percentage inhibition on CHO cells by the standard drug emetine with IC50 of

0.02411µg/mL, Npk1 F70 with IC50 2.524µg/mL and Npk1 F78 with IC50 2.747 µg/mL.

Table 1: IC50 and Z’-factors of test Npk-1D fractionated samples and two compounds against 3D7 strain of P. falciparum.

Test sample IC50 (µg/mL) Activity Z’-factor pk1 F70-77 2.63 ± 0.48 High 0.84 Npk1 F78-90 2.64 ± 0.32 High 0.84

The Z’-factor is used to quantify how well the assay works. A Z’-factor between 0.5 and 1.0 is an excellent assay while the one between 0 and 0.5 is a marginal assay. Therefore, a prerequisite for all experiments is to have a Z’-factor > 0.5.

DISCUSSION To the best of our knowledge, this is the first report on xerantholidein vitro antiplasmodial activity. It is the first study to show direct empirical evidence that P. leubnitziae exerts antiplasmodial efficacy in vitro. Our study also attributes P. leubnitziae antiplasmodial function to its active compound Xerantholide.

~ 25 ~ In Namibia, P. leubnitziae has been studied for its in vitro antibacterial and antioxidant activities. It was found to have an antioxidant function and antibacterial activity against five laboratory bacterial strains and it is also used as a mosquito repellent (Ndongo, 2017). The use of P. leubnitziae to repel mosquitoes is warranted because Nawrot et al. (1986) also showed that Xerantholide isolated from Xeranthemum cylindraceum acts as a good deterrent and an antifeedant to beetles that infest stored grain. Sesquiterpene lactones including Xerantholide are known to have cytotoxic and anti- inflammatory activities (Ríos et al., 2014). This is consistent with our findings that Xerantholide is cytotoxic as well as the traditional applications of P. leubnitziae to treat inflammatory diseases in Namibia.

The chemical compound Xerantholide which has been isolated from Npk1-D fraction of P. leibnitziae in this study with a molecular formula of C15H18O3 and a molecular weight of 246.306 g/mol is a sesquiterpenic lactone known guaianolide that have been isolated from the aerial of P. leibnitziae (Bohlmann & Borthakur, 1982). This study’s ‘H NMR spectral data of compounds is similar to the 1H NMR and 13C NMR Data of Xerantholide (400 MHz, CDCl3) by Bohlmann and Borthakur (1982), suggesting that it is the same compound.

The compound NPK1 F70 has a mixture of similar compounds with different conformation or orientations of the groups attached to it; this might have to do with what is stated by Bohlmann and Borthakur (1982), when they referred to their compound as Xerantholide and its probable precursor. They further stated that the compound could not be separated completely. This study found out that the isolated compound has diasteromers which are molecules that are not mirror images of each other, which might be the same scenario as in Bohlmann and Borthakur (1982). The compound Xerantholide has also been isolated from the aerial parts of the Xeranthemum cylindraceum (Samek et al., 1977; Dekić et al., 2015). The identified compound is listed among the 96 natural product fragments that have different chemotypes and are different from the known antimalarial aminoquinolines, quinolones, or diamidines. Xerantholide is listed as one of the sesquiterpene lactones which share the same backbone carbon structure as the current most effective antimalarial drug artemisinin which is a structural class known to kill P. falciparum parasites at submicromolar concentration (Vu et al., 2018). Although Xerantholide is reported as a biologically active sesquiterpene lactones from the Asteraceae family (Ivanescu et al., 2015), it’s in vitro antimalarial activity is not reported as in the findings of this study. The guaianolide Xerantholide identified in this study is toxic to the CHO cells. Gasymova et al. (2018) stated that Xerantholide exhibited cytostatic activity against HeLa and KB tumor cells; this has also been reported by Dekić et al., (2015). Many sesquiterpene lactones isolated from Asteraceae have already been described as anti-plasmodial and cytotoxic (Ivanescu et al., 2015), but Xerantholide has not been reported before, except in this study. This is the first study to report on the in vitro antiplasmodial activity of Xerantholide compound found in Pechuel-loeschea leubnitiziae plant from the family Asteraceae in Namibia.

In conclusion, this study’s positive outcome supports the traditional use of P. leubnitziae in Kavango East and Ohangwena regions in Northern Namibia. However, the plant’s lack of selectivity would urge

~ 26 ~ caution in its consumption. Thus further studies on its genotoxicity and chronic toxicity are needed to balance its safety when used. Therefore, it is recommended that a pharmacomodulation study must be carried out on Xerantholide in order to decrease the compound’s toxicity, while maintaining or improving its activity. There might as well be a need for modification of the compound’s chemical structure for it to be used for possible anti-cancer therapy.

ACKNOWLEDGEMENTS We thank South Africa’s National Research Foundation (NRF), the Council for Scientific and Industrial Research (CSIR), Namibia’s National Commission on Research Science and Technology (NCRST), Ministry of Higher Education, Training and Technology, the Namibia Government Scholarship and Training Program (NGSTP) and the University of Namibia (UNAM) for supporting the study. Dr Duduzile Molefe-Khamanga, chief scientist at the Protechnik Laboratories (a Division of Armscor SOC Ltd, Pretoria, South Africa) is acknowledged for her contribution on the analysis. Funding for this study was made available through the third bilateral call research collaboration programme under the project “Screening of indigenous Namibian mushrooms for their antimalarial activities against sensitive and resistant strains of the malaria parasites” for which Dr M. Sekhoacha and Prof. K.C. Chinsembu were co-principal investigators.

REFERENCES Alegana, V.A., Atkinson, P.M., Lourenço, C., Ruktanonchai, N.W., Bosco, C., zu Erbach-Schoenberg, E., Didier, B., Pindolia, D., Le Menach, A., Katokele, S.P., Uusiku, X.Y. and Tatem, A.J. (2016). Advances in mapping malaria for elimination: fine resolution modelling of Plasmodium falciparum incidence. Scientific Reports, 6(29628). doi: 10.1038/srep29628. Bohlmann, F., & Borthakur, N. (1982). Sesquiterpenes and norsesquiterpenes from Pechuel-Loeschea leibnitziae. Phytochemistry, 21(5), 1160-1162. Burke, A. (2000). Plant diversity of a man-made wetland–the Olushandja dam in north central Namibia. Dinteria, 26, 25-44. Chinsembu, K. C. (2015). Plants as antimalarial agents in Sub-Saharan Africa. Acta Tropica, 152, 32-48. Curtis, B.A., & Mannheimer, C. A. (2005). Tree Atlas of Namibia. Windhoek, Namibia: National Botanical Research Institute. Dekić, M.S., Radulović, N.S., Ranđelović, V.N., Stojanović-Radić, Z.Z., & Veljković, B.P. (2015). Essential oils and diethyl ether extracts of Serbian Xeranthemum cylindraceumand X. annum: Chemical composition, antimicrobial activity, and chemotaxonomic implications. Chemistry and Biodiversity, 12(9), 1378–1397. doi:10.1002/cbdv.201400316. Gasymova, S.A., Novruzov, E.N., & Mekhtieva, N.P. (2018). Chemical composition of fatty oil from Xeranthemum cylindraceum SEEDS. Chemistry of Natural Compounds, 54(4), 760. https:// doi.org/10.1007/s10600-018-2465-1. Gumbricht, T., McCarthy, J., & McCarthy, T.S. (2004). Channels, wetlands and islands in the Okavango Delta, Botswana, and their relation to hydrological and sedimentological processes. Earth Surface Processes and Landforms: The Journal of the British Geomorphological Research Group 29(1), 15-29.

~ 27 ~ Harborne, J.B. (1973). Phytochemical methods: A guide to modern techniques of plant analysis. Norfolk, UK: Fakenham Press Limited Fakenham. DOl: 10.1007/978-94-009-5921-7. Heinl, M., Sliva, J., Murray-Hudson, M., & Tacheba, B. (2007). Post-fire succession on savanna habitats in the Okavango delta wetland, Botswana. Journal of Tropical Ecology, 23(6), 705- 713. Heinl, M., Sliva, J., Tacheba, B., & Bredenkamp, G.J. (2004). Vegetation changes after single fire- events in the Okavango delta wetland, Botswana. South African Journal of Botany, 70(5), 695-704. Ivanescu, B., Miron, A., Corciova, A. (2015). Sesquiterpene lactones from Artemisia genus: Biological activities and methods of analysis. Journal of Analytical Methods in Chemistry, 247685, 21 http://dx.doi.org/10.1155/2015/247685. Jacobson, P.J., Jacobson, K.M., Angermeier, P.L., & Cherry, D.S. (1999). Transport, retention, and ecological significance of woody debris within a large ephemeral river. Journal of the North American Benthological Society, 18(4), 429-444. Kadhila, N.P. (2018). Evaluation of indigenous Namibian mushrooms and plants for antimalarial properties (Doctoral dissertation, University of Namibia, Windhoek, Namibia). Retrieved from http://repository.unam.edu.na/bitstream/handle/11070/2539/kadhila2019. pdf?sequence=1&isAllowed=y Mannheimer, C., & Curtis, B. (2009). Le Roux and Müller’s field guide to the trees and shrubs of Namibia. Retrieved from http://www.nbri.org.na/le-roux-and-m%C3%BCllers-fieldguide- trees-and-shrubs-of-namibia Mumbengegwi, D.R., Du Preez, I.C., Dushimemaria, F., Auala, J.R., Nafuka, S. (2015). The use of traditional medicinal plants as antimicrobial treatments. In: Kazhila C Chinsembu, Ahmad Cheikhyoussef, Davis Mumbengegwi, Lawrence N Kazembe and Kasanda, C.D. (Eds.) Indigenous Knowledge of Namibia (pp. 89-114). Windhoek, Namibia: University of Namibia Press. Murray-Hudson, M., Combs, F., Wolski, P., & Brown, M.T. (2011). A vegetation-based hierarchical classification for seasonally pulsed floodplains in the Okavango delta, Botswana. African Journal of Aquatic Science, 36(3), 223-234. Nawrot, J., Bloszyk, E., Harmatha, J.U.R.A., Novotny, L., & Drozdz, B. (1986). Action of antifeedants of plant origin on beetles infesting stored products. Acta Entomol. Bohemoslov, 83, 327-335. Ndongo, D. (2017). Antibacterial, antioxidant and phytochemical investigation of Acacia arenaria, Aloe esculenta and Pechuel-loeschea leubnitziae. (Master’s thesis, University of Namibia, Windhoek, Namibia). Retrieved from http://repository.unam.edu.na/bitstream/ handle/11070/2250/ndongo2017.pdf?sequence=1&isAllowed=y Ríos, E., León, A., Chávez, M. I., Torres, Y., Ramírez-Apan, M. T., Toscano, R. A., & Delgado, G. (2014). Sesquiterpene lactones from Mikania micrantha and Mikania cordifolia and their cytotoxic and anti-inflammatory evaluation.Fitoterapia , 94, 155-163. Samek, Z., Holub, M., Drożdż, B., Grabarczyk, H., & Hładoń, B. (1977). Xerantholide-A new cytotoxically active sesquiterpenic lactone from Xeranthemum cylindraceum SIBTH. et SMITH. Collection of Czechoslovak Chemical Communications, 42(8), 2441-2447.

~ 28 ~ Shikongo, L. (2012). Analysis of the mycochemical components of the indigenous Namibian Ganoderma mushrooms. (Master’s thesis, University of Namibia, Windhoek, Namibia). Retrieved from http://repository.unam.edu.na/bitstream/handle/11070/548/shikongo2012. pdf?sequence=1&isAllowed=y Strohbach, B.J. (2000). Vegetation degradation trends in the northern Oshikoto Region: II. The Colophospermum mopane shrublands. Dinteria 26, 63-75. Tedder, M.J., Kirkman, K.P., Morris, C.D., Trollope, W.S.W., & Bonyongo, M.C. (2012). The influence of Pechuel-Loeschea leubnitziae (wild sage) on grass sward and soil seed bank composition. African Journal of Range and Forage Science, 29(3), 101-107. Theron, M.W., van Rooyen, N., & van Rooyen, M.W. (1980). Vegetation of the lower Kuiseb River. Madoqua, 11(4), 327-345. Trager, W., & Jensen, J.B. (1976). Human malaria parasites in continuous culture. Science, 193(4254), 673-675. Van Damme, P., Van Den Eynden, V., & Vernemmen, P. (1922). Plant uses by the Topnaar of the Kuiseb Valley Namib desert. Afrika Focus, 8(3-4), 223-252. Van Damme, P., Van Den Eynden, V., & Vernemmen, P. (1922). Plant uses by the Topnaar of the Kuiseb Valley Namib desert. Afrika Focus, 8(3-4), 223-252. Von Koenen, E. (2001). Medicinal, Poisonous, and Edible PLants in Namibia. Windhoek, Namibia: Klaus Hess Publishers. Vu, H., Pedro, L., Mak, T., McCormick, B., Rowley, J., Liu, M., Di Capua, A., Williams-Noonan, B., Pham, N.B., Pouwer, R., Nguyen, B., Andrews, K.T., Skinner-Adams, T., Kim, J., Hol, W.G.J, Hui, R., Crowther, G.J, Van Voorhis, W.C, & Quinn, R.J. (2018). Fragment-based screening of a natural product library against 62 potential malaria drug targets employing native mass spectrometry. American Chemical Society Infectious Diseases, 4(4), 431-444.

~ 29 ~ SUSTAINABLE INDIGENOUS GASTRONOMY AND CULINARY IDENTITY: DEVELOPING CULTURALLY MODIFIED FOODS

*Patricia Mumbengegwi1, Clotildah Kazembe2 and Magaret Nyarota3 1Chinhoyi University of Technology, School of Hospitality & Tourism, Department of Travel & Recreation, Zimbabwe. 2Chinhoyi University of Technology, School of Hospitality & Tourism, Department of Hospitality &Tourism, Zimbabwe. 3Chinhoyi University of Technology, School of Hospitality & Tourism, Department of Hospitality &Tourism, Zimbabwe

*Corresponding author: Patricia Mumbengegwi, Tel: +263732330395; Email address: [email protected]

ABSTRACT Due to a colonial legacy in Zimbabwe, culinary identity has been diminished. However, in recent years it has become important due to food security issues, the healthy eating wave and the cultural awakening emanating from UNESCO’s 2003 recognition of Intangible Cultural Heritage (ICH) for communities to look to their indigenous resources and maintaining their identity. To date Zimbabweans have a weak ‘culinary identity’. Some local gastronomy practices such as insect consumption are viewed with repugnance and regarded as primitive, while traditional vegetables are now considered wild plants or weeds. This conceptual paper argues for the case of marginalised indigenous food resources such as edible insects and wild plants which were a part of our cultural identity. The study responds to Sustainable Development Goal (SDG) Number two, which advocates for zero hunger, food security and the promotion of sustainable agriculture. It also addresses Agenda 2063, Aspiration 5 which calls for cultural preservation. The paper seeks to address ‘culinary identicide’ through the introduction of ‘cultural modification of food’. The concept involves a culinary reconstruction process and product innovation of cultural dishes, as well as the translation of the formerly highly sought after western cuisine, into hybrid dishes containing major cultural food components (Culturally Modified Foods, CMF). This may help to promote indigenous foods, improve culinary identity and lead to new product development. It may also go a long way in using indigenous resources as a panacea to economic challenges.

Keywords: Indigenous gastronomy, Colonial Cuisine, Culinary-identity, Culinary-identicide, Culturally Modified Foods, Deconstruction.

INTRODUCTION Gastronomy has become an indispensable element in order to get to know the cultural identity and lifestyle of a territory. Because food is also one of the methods of interpreting cultural heritage (Hjalager & Richards, 2002; Wang, 2002; Kaya & Yurtseven, 2011) it should be studied and interpreted by local communities in a way that benefits them. Hermansen (2012) notes that there is a strong link

~ 30 ~ between cuisine and the construction of identity. However, this identity construction can be hindered by various aspects. Foremost among hindrances in third world countries is ‘colonisation’. According to Alvarez (2018) in an article written for the Food Empowerment Project,

Historians have elaborated on the devastating effects colonisation had on Indigenous societies, cultures, and mortality. While the study of the conquest has generally focused on the social, political, and economic changes forced upon Indigenous populations, the matter of food—the very source of survival—is rarely considered. Yet, food was a principal tool of colonization. Arguably, one cannot properly understand colonization without taking into account the issue of food and eating.

Several studies have been carried out on colonial cuisine and its repercussions in the Americas, Netherlands and Nigeria. However, there is dearth of information surrounding colonial cuisine or how to counteract its effects on identity construction in Zimbabwe. As a result, the nation struggles to get out from under its colonial past and re-embrace their food identity and perpetuate cultural cuisine. Hence the present research sought to introduce the concept of deconstruction of colonial/ western cuisine through Culturally Modified Foods (CMF) as a means to an end. This would allow Zimbabweans to sustain and perpetuate their culinary identity.

In the early post-colonial era of Zimbabwe, urban migration took place (Ngulube, Dube, & Mhlongo, 2015). Urban life was revered as it was a mould of western culture inherited from the colonial period. It represented modernity and was embraced by the newly emancipated society. In this socio-cultural setting, Zimbabweans were still under the impression that western cuisine was preferable to the indigenous cuisine. The older generation failed to pass on knowledge of indigenous resources or recipes for preparing cultural dishes. ‘Culinary identicide’ therefore took place (Moyo, Ngulube, & Kazembe, 2016). Western indoctrination led to local foods being regarded as ‘unclean, unhealthy, rebellious, sacrilegious, and for the marginalized communities’ (Moyo, Ngulube, & Kazembe, 2016). This has also been by fuelled by phenomena such as Ghettoization, Mcdonaldisation, and Globalisation (Presenza & Chiappa, 2013), which further pushed local culinary identity into obscurity.

In recent years this move has become important due to food security issues, the healthy eating wave (Canizares & Guzman, 2012) and the cultural awakening emanating from UNESCO 2003’s recognition of the Intangible Cultural Heritage (ICH) Domain 3, 4 and 5 for communities to look to their indigenous resources and maintaining their identity.

~ 31 ~ Table 1: UNESCO 2013 Domains 3, 4, 5 application to CMF Category Description Application Domain 3 Social practices, rituals and Social practices include ingredient harvesting, the preparation festivals and cooking methods that are unique to a particular culture. For example steeping of small grains in water or cooking vessels. Domain 4 Knowledge and practices Culinary knowledge concerning nature and the universe such as concerning nature and the what is edible and what can be made edible, as well as benefits universe of consumption of certain elements found in nature. For example how to eat lizards or insects. Domain 5 Traditional craftsmanship Craftsmanship can include certain techniques used in presenting food. For example the sculpting of sadza on a plate or the carving of meat for smoking.

Furthermore, it is important to acknowledge the aspect of Intercultural Competences (UNESCO, 2003) in a bid to accept and embrace other cultures. Intercultural Competences allow for the deciphering of other cultures in fair and meaningful ways. When a culture is critically aware of its own strengths and limitations, it allows for the extension of horizons and enrichment of resources by learning from alternative ideas. These may involve those belonging to one or more cultural systems, particularly if they are not valued or recognised in a given socio-political context (Holmes, 2009). In this light to enhance culinary identity, other cuisines must be embraced, even that of cuisine inherited from colonial masters. To date, Zimbabweans have a weak culinary identity. Some local gastronomy practices such as insect consumption are viewed with repugnance and regarded as primitive (Costa Neto, 2014), while traditional vegetables are now considered by some as wild plants or weeds. This study argues for the case of marginalised indigenous food resources which were a part of our cultural identity. The study also responds to Sustainable Development Goal (SDG) Number two, which advocates for zero hunger, food security and the promotion of sustainable agriculture. The acceptance of available cultural resources that were formerly marginalised will lead to better satiety, improved nutrition and ultimately zero-hunger. Sustainable agriculture would include the production and perpetuation of resources that are indigenous to Zimbabwe. Indigenous vegetables that grow easily in the wild may be cultivated while insects can be farmed and harvested. This could lead to improved food security. The African Union’s (AU) Agenda 2063 Aspiration 5 also calls for the promotion of all forms of cultural heritage, of which food is a major cultural factor (Hermansen, 2012). When local traditional foods are accepted and produced, the aspect of ‘culinary identicide’ may be addressed. The proposed concept involves a culinary deconstruction/reconstruction process and product innovation of cultural dishes, as well as the translation of the formerly highly sought after western cuisine, into hybrid dishes containing major cultural food components (Culturally Modified Foods CMF).

CONCEPTUAL CONTEXT The aspect of Culturally Modified Foods (CMF) is hinged on socio cultural, geographic, demographic and historical grounds. Before CMF are explored, it is important to conceptualise some key issues that will further the understanding of the concept. This section attempts to explain these variables.

~ 32 ~ INDIGENOUS GASTRONOMY The term indigenous has been explained as that which is connected to a region, of which within it are rights, protection, development of cultural heritage, traditional knowledge and traditional cultural usual practices (Burke, 2016). With reference to the politics of the stomach, indigenous gastronomy has become the link between culture and food, the cooking skills involving selected food as well as the art of eating that is specific to a region or group of people (Batinic, 2017; Drpic & Vukman, 2014; Salvin, 2015). Globally different foods and cuisines are naturally intertwined with the cultures, traditions, passions and religions of individuals living in different countries and continents (WTO, 2012). Although there is an intertwinement and a decrease in the consumption of traditional local cuisines and dishes, there are still known cuisines of different countries today (Petersen, 2017). They have been important to the livelihoods of the communities and some still are. The local gastronomy practices according to Hermansen (2012), give a culinary identity to these people. Relying on available foods is more sustainable than using what is borrowed. Communities have lived healthy lives by consuming their natural indigenous cuisines which were naturally obtained and with minimum if any processing done to them. Many developing countries including Zimbabwe are losing their indigenous gastronomy culinary identity which have been regarded as of a low status, low value and of the poor and uneducated. Modernisation and colonisation have contributed significantly to the erosion of the local gastronomy practices. Traditional cuisines are creative responses to a wider complex of colonial forces and suppression of traditional knowledge (Grey & Patel, 2015).

CULINARY IDENTITY As mentioned earlier in this paper, food is one of the aspects tied to an individual or societal groupings’ sense of identity. ‘Culinary Identity’ is a term contrived from that of Cultural Identity, but zeroing in on aspects surrounding the consumption of food. According to Hecht (1993 p, 76):

Cultural Identity refers to those aspects of identity shared by members of a culture that, taken as a set, mark them as distinct from members of other cultures. Like most forms of identity, cultural identity is socially constructed, that is, people do something to create and then claim it, whether that be speaking a particular language, eating particular foods, or following particular religious practices. Individuals have multiple identities, and these change over time.

Eating together is the foundation of the cultural identity and continuity of communities throughout history. It is a moment of social exchange and communication, an affirmation and renewal of family, group or community identity (UNESCO, 2003a).

Thus said, Culinary Identity refers to the culinary habits that distinguish one societal grouping from another. Zimbabwe having sixteen ethnic groupings will exhibit multiple culinary identities. Furthermore, due to the introduction of colonial cuisine and other factors, these identities have changed over time.

~ 33 ~ CULINARY IDENTICIDE ‘Culinary Identicide’ is a new term / concept borrowed from that of Merhags’ Cultural identicide. It is described as the destruction of any or all forms of qualities related to the way of life of a people, customs, rituals and social practices that lead to the intentional destruction of identity (Meharg, 2006). This intentional destruction was noted in Zimbabwe, after the pre-colonial era and it has since laid claim to their once constructed habitual practices. In terms of ‘Culinary Identicide’ it has since transcended to the plate, where Zimbabwe’s culinary cuisine now lacks identity. Both the young and old generations have no claim to what is original Zimbabwean culture or what culinary identity is all about. Hence the National Archives of Zimbabwe since 2007 began documenting Zimbabwean cultural practices, norms, values, beliefs, rituals, ceremonies and types of food under the banner, “lest we forget.”

COLONIAL CUISINE Colonisation is a violent process that fundamentally alters the ways of life of the colonised (Alvarez, 2019). Through food, social and cultural norms are conveyed and also violated, thus it has always been a fundamental tool in the process of colonisation (Durmelat, 2015; Earle, 2012). Colonial cuisine can be described as the resultant food legacy which leads to a modified Culinary Identity. Colonial cuisine was perpetuated primarily through; 1. Reward: Europeanisation led to an elevated status. 2. The role of women in society: Women became employed as wet nurses and house help, exposing them to new foods and preparation methods and; 3. Availability of food for consumption: The colonisers changed agricultural production and introduced new foods (Durmelat, 2015, Earle 2012; Trigg, 2004).

Although colonisation is generally viewed negatively, in the context of cuisine we must also acknowledge the positive contributions to Zimbabwean diet. Several eating habits that have been adopted locally and flouted as indigenous such as the consumption of maize are in fact traceable to colonisation. In that way, colonial cuisine has distorted the culinary identity of Zimbabwe.

FOOD DECONSTRUCTION THEORY The term ‘deconstruction’ was coined by a Philosopher Jacques Derrida, in the 1960s, focusing on literature, music and art as the opposite of ‘construction’. The deconstruction theory refers to one being able to build from separate materials or ideas which are then meaningfully put together to come up with something. The same materials/ideas can be put together in a different way to come up with a different product, which may even be more interesting (Grey & Patel, 2015). Therefore, food deconstruction refers to the idea of breaking apart elements to make a dish and serving the items separately in a unique way. An example is beef stew where beef, liquid, vegetables and potatoes are isolated and served in an unconventional presentation. The culinary culture is the uniqueness of the cuisine. Through local gastronomy practices, a culture is known, identified and shared. The deconstruction theory is being borrowed in this paper as a concept for coming up with indigenous gastronomy which can be used suitable for use today by everyone. Our traditional indigenous

~ 34 ~ gastronomy can be used together with what we have today to come up with these culturally modified foods. The culinary identity is seen from the ingredients used, which come from the local food (Food and Culture Project, 2015).

On the other hand the opposite is true for ‘construct’, as one can starts with the beef, liquid and vegetables, the ingredients. To construct, one should be knowledgeable enough to know how to combine these foods well enough to come up with a tasty dish. Professional chefs have come to appreciate the value of scientific approaches to their craft, unlike mastering the tried and tested techniques for coming up with cuisines. While it is important to source new information about food, the diversity of ingredients as well as the understanding of culinary excellence, it is vital to maintain indigenous gastronomy. This knowledge enables food characteristics to be manipulated so that they can comply with the expected product (Plato, Brilliant, & Savarin, 2016). Quality products can be produced using local foods and ingredients (Mc Gee, 2007). In the context of CMF, food is being modified through a deconstruction process. Certain acceptable foods are taken apart and put together using cultural components.

GENETICALLY MODIFIED FOODS Genetically modified foods are created by deliberate insertion of specific material by the application of recombinant DNA technology or genetic engineering, a technique used for altering a living organism’s or plant’s genetic material (Massachusetts Medical Society, 2015; The Royal Society, 2002, p. 4; Wu & Butz, 2004). Genetically modified food offers beneficial changes in the composition of food relative to dietary intake. The global north has come up with many GMO foods such as poultry, poultry products, cereals and meat products. These mature earlier and are cheaper hence they have flooded the African markets. Despite the furore surrounding GMO foods on their pros and cons, developing countries have embraced some of these to alleviate poverty, malnutrition, improve food security and human nutrition (Elliott & Madan, 2016).

The concept used in creating modified plant and animal varieties is similar to the modification concept with indigenous ingredients to create product diversity (Wu & Butz, 2004). However, in this case the concentrates of dominant nutrients in the indigenous ingredients are extracted and used as crunchy, powdered or whole to develop new food product varieties for consumption. Thus, propelled by this genetic engineering process, indigenous food is transformed to allow previously unheard-of combinations to achieve pre-specified objectives. CMF thus becomes ‘the deliberate insertion of specific cultural ingredients to alter various recipe compositions by the application of a combination of both cultural and new technological processes.

PROBLEM STATEMENT Food has always been a fundamental tool in the process of colonisation, through which socio-cultural norms are conveyed, and also violated (Earle, 2012). Zimbabwe has a weak culinary identity due to the strong legacy of colonial cuisine. Alvarez (2018) postulates that “food is history, it is culturally transmitted and it is identity.” Trigg (2004) further argues that food choices are influenced and

~ 35 ~ constrained by cultural values and they are an important part of the construction and maintenance of social identity. Because of the weak culinary identity, Zimbabwean indigenous gastronomy is not visible or competitive. Paresecoli (2016) notes that “African cuisines are striving to achieve the visibility and popularity among consumers in the Global North that other culinary traditions from the Global South have been enjoying”. Countries like India, China and Jamaica (also former British colonies) have managed to hang on or reconstruct their culinary identities; while other countries like Malaysia and New Zealand have gone through a deconstruction process to liberate or fuse their cuisines in order to strengthen their culinary identity. If the issue of culinary identity is not addressed, colonial cuisine will continue to dominate, and vital culinary skills, unique flavours, as well as norms and values that are subsumed in gastronomy will be lost. Ultimately, cultural heritage will disappear (Moyo et al., 2017). This study is premised on the promotion of sustainable gastronomy and the strengthening of culinary identity. Thus, the objectives of the study are as follows; to promote ‘Culinary Identity’ through the deconstruction of western gastronomy and the development of Culturally Modified Foods. The specific objectives are: to establish the diversity of indigenous ingredients in Zimbabwe; to establish a platform for the deconstruction of western gastronomy, and, to explore the tactical procedures for the development of Culturally Modified Food.

METHODOLOGY This paper put into context a longitudinal study that was initiated in 2014 and is still ongoing. The mixed method approach (Creswell & Plano-Clark, 2011; Shorten & Smith, 2017,) was followed, using both the exploratory and experimental designs (Shields & Rangarjan, 2013; Centre for Innovation in Teaching & Research, Arizona, 2019). The study makes use of both Controlled Experiments and Field Experiments. Secondary and primary data was collected through content analysis (both literature and film), observation, experimentation, sensory panels (Watts, Ylimaki, Jeffery & Elias, 1989) and surveys. Sampling was done using convenience, purposive and snowballing methods (Creswell &Plano-Clark, 2011). Instruments used include observation sheets, questionnaires and interview guides. Experiments used different ingredients, heat sources, cooking vessels and service styles. Sensory evaluations tested the acceptance and preference, using the hedonic scale.

FINDINGS AND DISCUSSION

1. Diversity of indigenous ingredients Local gastronomy practices are possible through the use of the diversity of local ingredients available. It is therefore prudent to bring to the table ingredients that are locally sourced and community driven (Global Culinary Annual Report, 2018). The methods and techniques may be the same, but the difference in ingredients brings the authenticity of a local gastronomy. At the same time, the same methods and techniques and different ingredients bring uniqueness to food and cuisine. It is key to note that ingredients are key to culinary identity as they differ from one geographic area to another as well as the production methods used (Wright, 2018). That has a lot of significance on the taste and quality of product and its end use. The findings indicate that apart from the popular indigenous ingredients such as sour milk, maize, wild rice, cow’s feet, goat offals, pumpkin leaves, etc., there

~ 36 ~ are a plethora of indigenous ingredients that are marginalised. These range from plants such as small grains and vegetables, meat products in the form of insects, rodents, lizards and birds. The recurring marginalised ingredients identified in the study are discussed below.

SMALL GRAINS Globally people are going for ethnic cuisine which uses clean, real, and healthy plant based foods. Grains played a major role in indigenous gastronomy since men lived where grass seeds were gathered. There are now varieties of these grains which are being easily cultivated in most regions of Zimbabwe and they have become food for many cultures (Chiweshe et al., 2012). They have long shelf lives and locals have many ways of processing them. Despite their much publicised health benefits, traditional small grains are marginalised. Cereals are important for human diet asthey provide dietary fibre such as starch and carbohydrates, thus providing the demand for energy and nutrient intake for humans (Verma & Patel, 2013). Most of them are staple foods of many nations. For example in Zimbabwe and the Sub-Sahara, maize is the staple diet. Cereals are cheaper sources of food (UNWTO, 2019). The diet which is generally made up by the use of cheaper food sources like grains affects poor communities, as malnutrition is caused by adequate amounts of food and the poor quality of available food (UNWTO, 2019). Indigenous methods of processing food which include soaking and germination improve the bioavailability of nutrients by lowering anti-nutritional factors like phytates and also lower the viscosity of gruel through reduction of bulk density (Serere et al., 2016). Small grains like millet, rapoko, wheat, and sorghum when used together can boost the diet by complimenting each other in the essential amino acids which may be lacking in one and available in another. For example, millet is a good source of methionine but it is limited in threonine and lysine. These small grains should be considered because they are drought tolerant and they help to solve the problem of food insecurity and malnutrition by improving dietary quality. They are also good sources of phytochemical and micronutrients such as calcium and they add to the nutrition of populations. Micronutrients help to alleviate hidden hunger and they minimize the onset of chronic diseases (Chiweshe et al., 2012). Small grains are also gluten free and they are an important source of food for millions who are gluten intolerant including diabetic patients in both developing and developed countries. Zimbabwe’s weather is suitable for these small grains, but their production has since reduced greatly. Due to climate change, the country is experiencing many drought seasons, of which the small grains become suitable for their draught tolerance and have high yields. Every region of Zimbabwe is able to produce a small grain which is suitable for its soil type and climate (Chiweshe et al., 2012). Failure to utilise these grains as an indigenous resource will be a missing element for culinary identity, while providing food security.

VEGETABLES AND HERBS Indigenous vegetables, sometimes termed traditional vegetables, are species that are locally important for the sustainability of economies, human nutrition, health and social systems (Keatinge, Wang, Dinssa, Ebert, Hughes, & Stoilova, 2015). Traditional vegetables are of great significance in Africa, not only as a source of food and nutritional security but also as income generating high value crops (Dinssa, Stoilova, Nenguwo, Aloyce, Tenkouano, Hanson, Hughes & Keatinge, 2015). Most local

~ 37 ~ vegetable markets in Africa are characterised by women selling indigenous vegetables processed the traditional way. However, these have yet to attain global recognition to the same extent as major vegetable commodities such as tomatoes or cabbages, that is, they are marginalised for one reason or the other. These vegetables are often considered weeds and they are not given the value they deserve. Keatinge et al. (2014) further note that given the multitude of indigenous vegetables consumed worldwide, the accrued value for mankind is considerable. Therefore, it is important to consider them in local cuisine because they have been consumed for centuries. The harvesting, processing and preparation methods have been mastered by both rural and urban communities, hence they are tied to the identity of people. They can be used in CMF to improve nutrition, flavour, colour and texture. Examples of marginalised vegetables in Zimbabwe are mutsine (black jack), mhowa (amaranthus), nyevhe/runi (Cleome gynandra), munyemba (chick pea leaves) and nyenje/gusha (corchorusolitorus) are eaten in all regions of Zimbabwe, subject to availability.

INSECTS Edible insects both flying and crawling have been noted as a traditional food all over the world. It is highly nutritious with high fat, protein and mineral contents depending on the species and thus they represent a noteworthy alternative food source and a potential substitute from the western type of food (Rumpold & Schluter, 2013). Thus, according to Musundire, Zvidzai, Macheka, Ngadze, Manditsera, Mubaiwa, Chemura and Samende (2016), there are more than thirty–two (32) edible insect species found in Zimbabwe that can be consumed. Only thirteen (13) are currently being harvested and consumed by the local communities. The majority of edible insects found in Zimbabwe and developing countries are mostly gathered from wild populations found in nature, in farmlands or in forests (Van Huis, 2015). Edible insects are a sustainable food source and a nutritious resource (Berry, Dernini, Burlingame, Meybeck, & Conforti, 2015). Some of these edible insects are listed below according to their percentage of consumption. Almost all the edible insect groups are eaten such as beetles (31%), caterpillars (18%), wasps, bees and ants (15%), crickets, grasshoppers and locusts (13 %), true bugs (11%), and termites, dragonflies, flies and others (12%) (Dube et al., 2013). Edible insects are vast in Zimbabwe and they are already being consumed by the communities. Therefore, increasing the production and variety by incorporating modern recipes and cooking would increase consumption and acceptance.

RODENTS AND AMPHIBIANS Local gastronomy practices have utilised meat through hunting and gathering, which included game meat, rodents, frogs and lizards. Today there is very little use of these as opposed to the use of domesticated animals (Fieldhouse, 2013). Through stories, myths and beliefs about indigenous foods generated from colonisation and modern religion, they are no longer taken as food by many Zimbabweans. Many have been colonised to think that these are not forms of food. Many either no longer possess the hunting skills and the hunting is prohibited in most areas. Species that were used for food in most cases are now protected (Fieldhouse, 2013).

~ 38 ~ In Zimbabwe the Toko people of Mutoko consume specific types of lizards and the Tsonga/ Tshangani people of Chiredzi eat a particular species of bullfrogs (Chibememe et al., 2014). According to Hoffman (2008), the current knowledge of the yield and nutritional (proximate and fatty acid) composition of meat derived from African ungulates, camelidae, rodents, ratites and reptiles is reviewed. They found out that the fatty acids from these various species have low saturated fatty acids and high polyunsaturated fatty acids which are favourable to those of polyunsaturated fatty acid ratios. Although most of the species of lizard and rodents give low cholesterol levels consistent with their low meat lipid contents, the lizard gives a very low level (18.2 mg/100 g tissue). The fatty acid profiles of the various species have low saturated fatty acids and high polyunsaturated fatty acids resulting in favourable saturated to polyunsaturated fatty acid ratios (Hoffman, 2016). Although the springbok, camel, ostrich and crocodile are marketed and exported to sophisticated markets, the rodents species show most promise in becoming large commercial commodities. Not only is their meat desirable and nutritional, but they are also highly adaptable to extensive and intensive production systems.

Today’s tabooes against consumption have functionalist, symbolic and psychological grounding. The main objectives of this paper are to firstly demystify then deconstruct these foods to come up with uniquely acceptable indigenous cuisines. The lizard is actually a delicacy just like chicken as the Toko call it ‘hukurutombo’ meaning ‘rockchicken’ (Nyakupfuka, 2013). Indigenous delicacies using special cuts like the tail from the crocodile can also be developed for the lizard’s tail.

BIRDS The current situation that the world is faced with regarding food security not only calls for critical evaluation of ways to approach this problem, but effective action in order to improve food security (Little & Crowe, 2011). The bird species found in Zimbabwe have become one of the many solutions that can be used to eradicate malnutrition and at the same time be a sustainable source of food for Zimbabwe. In Zimbabwe, the main groups of birds that are exploited for food are those already with domesticated relatives, i.e. ducks, geese, francolin, quails, guinea fowl, pigeons and doves. There are also some smaller birds such as the larks, sparrows, weavers and queleas that are commonly eaten by communities together with various wild pigeon breeds (Msimanga, 2000). Birds are a good and cheap source of protein that can play a key role in food security for Zimbabwe and other sub-Saharan countries.

2. DECONSTRUCTION PLATFORM Western foods have become common in the Zimbabwean society. Some of the staples (bread, tea, rice, maize pap/sadza) and popular foods (pizza, pasta, ice-cream and sausages) are testimony to colonial legacy and globalisation. The study sought to provide a basis for identifying and dissecting these foods. Once this is done, suitable indigenous ingredients were deliberately inserted, that is the modification process and like Derrida’s deconstruction theory, meaningful end products were created. Likewise, indigenous dishes that were associated with Zimbabwean identity, and unique to particular cultures were also dissected to explore the ingredients and processing before modification took place.

~ 39 ~ DECONSTRUCTION EXPERIMENTS IN THE RESEARCH LABORATORY Several experiments in the kitchen laboratory were carried out in order to identify both favourable qualities in popular non-indigenous foods, as well as the favourable/unfavourable qualities in indigenous foods. What made certain foods more appealing, acceptable and favourable than others? Qualities like flavour, aroma, texture, presentation and temperature were isolated. These experiments that were carried out by the researchers also identified cooking vessels and preparation and cooking methods that improved nutrient quality and food aesthetics. Some of the experiments carried out by the researchers include culturally modified chocolate, baked goods (cakes, biscuits, pizza and pies), tea blends, ice-cream, chicken relish, pasta and dairy beverages (smoothies, protein shakes). Both western and indigenous preparation methods were used. The modification processes should however leave the final product with a culinary identity that can still be linked to Zimbabwe.

TASTING PANELS Once the CMF were completed, their palatability was put to the test. Sensory evaluation tested acceptance and preference of CMF in terms of flavour, appearance, aroma and texture. Both expert tasting panels (chefs, food scientists, academics, traditional leaders and seasoned diners) and random panellists were used. Panels were held at events such as conferences, annual exhibitions and festivals held in Zimbabwe from the period August 2014 to May 2019 as follows; Zimbabwe International Trade Fair, Sanganayi/ Hlanganani Travel Expo, Harare Agricultural Show, Chinhoyi Agricultural Show, Chirorodziva Festival, GAZA Greater Limpopo Trade Fair, and Mashonaland West Traditional Food Festival. This ensured a wide demography of panellists, provided anonymity and prevented predisposition. The majority of the tasting indicated acceptability and a preference for CMF.

Surveys Surveys in communities and at the afore-mentioned sites were carried out using questionnaires and in some instances one on one interview. These sought and provided valuable information on the state of culinary identity, marginalised indigenous ingredients and ingredients qualities for the cultural modification process.

3. TACTICAL PROCEDURES The term ‘tactical procedures’ is derived from two words, ‘tactical’ meaning premeditated strategies and ‘procedures’ which refers to the practices, techniques or methods used in a process. Several tactical procedures which relate to the modification process were identified and used in the experiments. Some of them are listed below.

PREPARATION METHODS Cultural preparation methods explored detoxing (insects), smoking (meats) fermentation (grains), sun drying (vegetables), and pounding (all ingredients).

~ 40 ~ Masking Masking is a term that is used to hide unfavourable characteristics through various means, for example, the addition of flavour enhancers, and the use of herbs and spices. In this instance, some fermented products had a strong smell that deterred people from consuming them, like the stink bug.

Cultural fusion Some ingredients and methods from different cultures can be combined seamlessly to come up with new products.

Culinary transfusions This is borrowed from blood transfusion, where a specific blood group is transfused into a person to help them survive. This is when a particular ingredient component is extracted from western foods and inoculated into an indigenous food or vice versa to make it more appealing and culturally inclined, that is, its culinary identity can be linked to that of Zimbabwe.

Culinary transformation Some foods require alteration to make them more visually appealing. This is done by changing or through physical manipulation of ingredients, cooking methods or presentation. For example, termites, crickets, stink bugs and lizards.

Ingredient enhancement Some ingredients actually need to be enhanced through further processing such as fortification, colouring, sweetening, whitening, drying, steeping, etc. For example pearl millet, sorghum, monkey apple.

Decolonisation As mentioned earlier in the study, colonial cuisine was perpetuated through reward, the role of women, and the availability of food. Decolonisation can restore identity (Grey & Patel, 2015), that is, colonial food dominance tactics can be reversed. The same techniques can be applied to promote indigenous gastronomy and improve culinary identity. Reward: Indigenous food leading to an elevated status (both health-wise and socially).The role of women in society: Women can be exposed to new food and preparation methods through clubs, events or even in the work place (outreach programmes); Availability of food for consumption: Agricultural production to include indigenous food both at household and commercial levels.

CONCLUSION The main objective of the study was to promote ‘Culinary Identity’ through the deconstruction of western gastronomy and the development of Culturally Modified Food. While it is important to note that this concept is part of ongoing research, the results collected to date indicate that inroads have been made to promote culinary identity. However, there’s still a lot of ground to be covered. The study was also indicative of the fact that some sectors of the society had been embracing food that

~ 41 ~ had already been modified as part of their culinary identity. Positive feedback has indicated that the deconstruction process has been thus far successful. CMF is widely accepted across the demographic divide because it makes some of the indigenous foods that were previously marginalised more palatable and easier to embrace. CMF camouflages and improves unfavourable food characteristics such as odours, flavours, and textures, as well as (food aesthetics) presentation. Furthermore, CMF can also enhance the nutritional value of food and because of ingredients that are indigenous, this may also go a long way to improving food security. All these benefits culminate to the popularising of indigenous gastronomy, thus promoting Zimbabwean Culinary identity. If CMF is successful it could lead to vibrant food tourism products.

REFERENCES Alvarez, L. (2018). Food is power: Food empowerment project. Retrieved from https://foodispower. org/our-food-choices/colonization-food-and-the-practice-of-eating extracted 12/05/19 Berry, E. M., Dernini, S., Burlingame, B., Meybeck, A., & Conforti, P. (2015). Food security and sustainability: can one exist without the other? Public Health Nutrition, 18(13), 2293- 2302. Burke, R., This, H., & Kelly, A.L. (2016). Molecular gastronomy. doi:10.1016/B978-0-08-100596- 5.03302-3 Chibememe, G., Muboko, N., Gandiwa, E., Kupika, O. L., Muposhi, V. K., & Pwiti, G. (2014). Embracing indigenous knowledge systems in the management of dryland ecosystems in the great Limpopo transfrontier conservation area: The case of Chibememe and Tshovani communities, Chiredzi, Zimbabwe. Biodiversity, 15(2-3), 192-202. Chiweshe, M., Edziwa, M., & Chikoore, R. (2012). Developing a high protein-energy cereal blend using locally produced small grain cereals and legumes. International Journal of Development and Sustainability, 1(20), 280-285. Costa Neto, E. (2014). Insects as human food. Anthropology Review, Amazôn, 5(3), 562-582. Creswell, J., & Plano-Clark, V. L. (2011). Designing and conducting mixed methods research. Thousand Oaks, California: BMJ Publishing Group. Dinssa, F.F., Stoilova, T., Nenguwo, N., Aloyce, A., Tenkouano, A., Hanson, P., Hughes, J. D A. & Keatinge, J.D.H. (2015). Traditional vegetables: improvement and development in sub- Saharan Africa at AVRDC – The World Vegetable Center. ActaHortic. 1102, 21-28 Drpić, K., & Vukman, M. (2014). Gastronomijakaovažandioturističkeponude u Hrvatskoj, Praktičnimenadžment, Virovitica, Visokaškolazamenadžment u turizmuiinformatici. Dube, S., Dlamini, N., Mafunga, A., Mukai, M., & Dhlamini, Z. (2013). A survey on entomology prevalence in Zimbabwe. African Journal of Food, Agriculture, Nutrition Development, 13(1), 7242-7253 Durmelat, S. (2015). Colonial culinary encounters and imperial leftovers. Journal of French Cultural Studies, 26(2), 115-129. Earle, R. (2012). The body of the conquistador: Food, race and the colonial experience in Spanish America, 1492-1700. Cambridge, UK: Cambridge University Press Elliott, K. & Madan, J. (2016). Can GMOs deliver for Africa? CGD Policy Paper 080.Washington, DC: Center for Global Development.

~ 42 ~ FAO, (2015). An international crop research institute for semi-arid tropics, (ICRISAT). Food and nutrition: customs and culture. Springer. Grey, S. & Patel, R. (2015). Food sovereignty as decolonization: some contributions from Indigenous movements to food system and development politics. Journal of Agriculture and Human Values. 32(3), 431-444. Hermansen, M. E. (2012). Creating terroir - An anthropological perspective on New Nordic Cuisine as an expression of Nordic identity. Anthropology of Food. Retrieved from http://aof.revues. org/7249 (http://http://aof.revues.org/7249) Hecht, M.L. (1993). 2002 – A research odyssey: Toward the development of a communication theory of identity. Communication Monographs, 60, 76-82. Hjalager, A., & Richards, G. (2002). Tourism and gastronomy. London, UK: Routledge. Hoffman, C. (2016) Controversial cuisine: A global account of the demand, supply and acceptance of “unconventional” and “exotic” meats. Retrieved from https://doi.org/10.1016/j. meatsci.2016.04.017 Hoffman, C. (2008). The yield and nutritional value of meat from African ungulates, camelidae, rodents, ratites and reptiles. Retrieved from https://doi.org/10.1016/j.meatsci.2008.05.018. Holmes, P. (2009). Intercultural competence: Asia-Pacific region: Concepts, methods, and tools for intercultural competence and mediation. Report for the State of the Arts and Perspectives on Intercultural Competences and Skills, UNESCO. Kaya, O. & Yurtseven, R. (2011). Local food in local menus: The case of Gokceada. International Multidisciplinary Journal of Tourism, 6(2), pp. 263-275. Keatinge, J.D.H., Wang, J.-F., Dinssa, F.F., Ebert, A.W., Hughes, J.D.A., & Stoilova, T. (2015). Genetically modified foods, risks and benefits. Retrieved from www.massmed.org/gmo McGee, H. (2007). On food and cooking: The science and lore of the kitchen: Simon and Schuster. McGee, H. (2013). Q & A: Harold McGee, the curious cook. Flavour, 2(1), 13. https://doi. org/10.1186/2044-7248-2-13 Meharg, S. (2006). Identicide: Precursor to genocide: Working Papers - Centre For Security and Defence Studies (CSDS). Retrieved from https://www3.carleton.ca/csds/docs/working_ papers/MehargWP05.pdf Moyo, C., Ngulube, P. & Kazembe, C., (2016). Preserving knowledge about Indigenous cuisine for posterity in Zimbabwe. Indilinga African Journal of Knowledge Systems, 15(1), 136-152 Msimanga, A. (2000).The role of birds in the culture of the Ndebele people of Zimbabwe. Journal of African Ornithology, 71(1/2), 22-24. Mukuruwambwa, P. (2009). Potential of sorghum and millet enrich household security in Zimbabwe’s semi-arid regions. A case of communal areas in Masvingo province. (Msc in Agricultural Economics, University of Fort Hare, Town, South Africa). Retrieved from http://scholar.ufs. ac.za:8080/xmlui/bitstream/11660/1371/1/MakuvaroV.pdf Musundire, R., Zvidzai, C. J., Chidewe, C., Samende, B. K., & Chemura, A. (2016). Habitat and nutritional composition of selected edible insects in Zimbabwe. Journal of Insects as Food and Feed, 2(3), 189-198.

~ 43 ~ Nenguwo, N., Dhillon, N.P.S., Easdown, W.J., Mavlyanova, R., Tenkouano, A., Afari-Sefa, V., Ngulube, P., Dube, L., & Mhlongo, M. (2015). Towards a cartography of indigenous knowledge systems in library and information science training and education in Anglophone Eastern and Southern Africa. Pretoria, South Africa: UNISA. Nyakupfuka, A. (2013). Global delicacies: Diversity, exotic, strange, weird, Relativism. Balboa Press. Paresecoli, F. (2016). African cuisine: From colonial past to cosmopolitan future. Retrieved from https://www.huffpost.com/entry/african-cuisines-from-col_b_9606458 Rumpold, B. & Schluter, O. (2013). Nutritional composition and safety aspects of edible insects, Molecular Nutrition & Food Research, 57(5):802-23. DOI: 10.1002/mnfr.201200735 Sánchez-Cañizares, S.M., & López-Guzmán, T. (2012). Gastronomy as a tourism resource: profile of the culinary tourist. Current Issues in Tourism, 15(3), 229-245. DOI: 10.1080/13683500.2011.589895 Schreinemachers, P., Iramu, E., Tikai, P., Dakuidreketi-Hickes, A., & Ravishankar, M. (2015). Indigenous vegetables worldwide: Their importance and future development. ActaHortic. 1102, 1-20 Serere, H. J., Bangamusewe, B., Matiringe, I., & Chinofunga, D. (2016). Development of fermented corn and rapoko blend instant porridge. International Journal of Nutrition and Food Sciences, 5(4), 246-254. Shields, P., & Rangarjan, N. (2013). A playbook for research methods: Integrating conceptual frameworks and project management. Stillwater, OK: New Forums Press. Shorten, A., & Smith, J. (2017). Mixed methods research: Expanding the evidence base.Evidence Based Nursing, 20(3):74-75. Trigg, H. (2004). Food choice and social identity in early colonial New Mexico. Journal of Southwest, 46(2), 223-252. UNESCO. (2003a). Convention for the safeguarding of the intangible cultural heritage. Paris, France: UNESCO Publishing. UNESCO. (2003b). Intercultural competences: Conceptual and operational framework. Paris, France: UNESCO Publishing. Van Huis, A. (2015). Edible insects contributing to food security? Agriculture & Food Security, 4(1), 20 doi:10.1186/s40066-015-0041-5 Van Huis, A., Van Itterbeek, J., Klunder, H., Mertens, E., Halloran, A., Muir, G., & Vantomme, P. (2013). Edible insects: Future prospects for food and feed security. FAO Forestry paper171, Rome. Retrieved from http://www.fao.org/3/i3253e/i3253e.pdf Verma, V., & Patel, S. (2013). Value added products from nutri-cereals: Finger millet (Eleusinecoracana). Emirates Journal of Food and Agriculture, 25(3), 169-176. Watts, B., Ylimaki, G., Jeffery, L., & Elias, L. (1989). Basic sensory methods for food evaluation. Ottawa, Ontario, Canada: International Development Research Centre. Wu, F. & Butz, W. (2004). The future of genetically modified crops: Lessons from the Green Revolution. Retrieved from https://www.rand.org/content/dam/rand/pubs/monographs/2004/ RAND_MG161.pdf

~ 44 ~ INCLUSION OF THE CULTURAL PRACTICE OF DRY COITUS IN HIV AND AIDS BEHAVIOURAL CHANGE PROGRAMMES: A CASE STUDY OF ZAMBEZI REGION, NAMIBIA

Immaculate Mogotsi Senior Researcher, Multidisciplinary Research Centre, University of Namibia, Namibia. [email protected]

ABSTRACT Research participants in the Zambezi region mentioned that women insert herbs to dry the female genitalia during coitus, as it serves the purpose of tightening the vaginal walls. This study used a focused ethnographic approach. Purposive sampling was used to select 33 research participants from Windhoek, Kabbe and Katima Mulilo. The research participants were from the Ministry of Health and Social Services, six NGO representatives working in HIV and AIDS behaviour change programmes as well as the Zambezi region Aids Coordinating Committee members. The research participants represented different segments of society such as traditional healers, life skills teachers, traditional leaders and community members from various age groups. The youngest participant was 15 years of age and the oldest was 96 years old. The methods of data collection were semi-structured in-depth face-to-face interviews, supplemented with focused participant observations, photographs of herbs and reflective field notes. ATLAS.ti 8 was used for data analysis. Women indicated various types of herbs that they insert into the female genitalia in dry form. Some of the herbs are used in hot water bath for vaginal douche or they are drunk in hot tea or as hot porridge. The rough texture of the herbs contributes to the tearing of the vaginal walls and also alters the natural vaginal PH. It thus undermines the natural defence against microbes which thereby increases the chances of vaginal infections. Both men and women reported discomfort and pain during coitus and they also indicated that condom use is infective as the process of dry coitus excludes any lubrication in female genitalia. Despite these known facts about the use of dry coitus, HIV and AIDS behaviour change programmes have not incorporated this practice into HIV and AIDS awareness training programmes. The practice of dry coitus is associated with increased HIV risk factors; it is thus important to create awareness through HIV and AIDS behaviour change programmes.

Keywords: HIV and AIDS, dry coitus, cultural practices, sexual and reproductive health, behavioural change programme, Zambezi region.

INTRODUCTION HIV and AIDS still remains a major concern in the Zambezi region. However, throughout Namibia, the prevalence of HIV and AIDS is showing a slight stabilisation, and nationally this stands at 17.2% (Ministry of Health and Social Services-MoHSS, 2016). However, in the Zambezi region, the HIV and AIDS prevalence rate still remains high at 32.9% (Ministry of Health and Social Services-MoHSS, 2016). Therefore it is evident that despite a massive action to inform the public about HIV and AIDS risks, HIV prevalence is not declining as expected in the Zambezi region. It is, therefore, important

~ 45 ~ to interrogate all HIV risk factors that contribute to the spread of HIV and AIDS within the Zambezi region. The present study explored dry coitus as a cultural practice that may promote the spread of HIV and AIDS. It also explored whether HIV and AIDS behaviour change programmes have adopted culturally appropriate prevention strategies that contextually respond to dealing with dry coitus. Cultural practices such as dry coitus have been implicated in the high HIV and AIDS prevalence in the region (/Khaxas & Frank, 2010; Loosli, 2004). In addition to the increased risk accompanying STDs, the practice of dry coitus (inserting a variety of substances, including antiseptics, detergents, and herbs into the female genitalia prior to intercourse) may produce extensive local irritation and inflammation which enhances the transmission of HIV (Baleta, 1998).

VAGINAL PRACTICES FOR DRYING, TIGHTENING AND CLEANSING Studies show that women have been inserting products into the female genitalia for various reasons, and these products range from cotton wool, cloths, powders, roots, disinfectants, vicks, toothpaste and saltwater (Brown, Ayowa, & Brown, 1993; Civic & Wilson, 1996; Dallabetta, Miotti, Chiphangwi, Liomba, Canner, & Saah, 1995; Halperin, 1999; Sandala, Lurie, Sunkutu, Chani, Hudes, & Hearst, 1995; Sharma, Bukusi, Posner, Feldman, Ngugi, & Cohen, 2006; Runganga, Pitts, & McMaster, 1992). Women also use commercial products such as vaginal douching solutions, soaps, detergents, and vaginal creams (Martin, Hilber, Hull, Preston-Whyte et al., 2010). The practice of women inserting products into their vaginas is a worldwide phenomenon. This practice is aimed at cleansing, tightening and drying the female genitalia. These practices are particularly used for hygiene purposes, during menstruation, or during pregnancy or prior to or following coitus (Halperin, 1999; Turner, Morrison, Munjoma et al., 2010). Other studies show that these products are used for disease and pregnancy prevention or to meet the sexual preference of a sexual partner. In some instances these products are used as part of abiding to notions of womanhood which women and girls are expected to follow as dictated by mothers and grandmothers (Martin et al., 2010; Scorgie, Kunene, Smit, Manzini, Chersich, & Preston-Whyte, 2009).

A study by Turner et al. (2010) identified factors that are likely to result in women using products to dry, cleanse and tighten the female genitalia. Women with a higher absolute number of unprotected coitus acts had higher odds of engaging in vaginal cleansing. In addition, those with recent STI symptoms had higher odds of both cleansing and drying. Moreover, women with the highest sexual frequency may feel more pressure to be “clean” for themselves and their partners, and the presence of seminal fluid following coitus may lead them to cleanse more than women who have coitus less often. If they believe that cleansing provides protection from disease acquisition, they may also cleanse as a pre-emptive prevention measure or “cure”. Additionally, women with STI symptoms (including bleeding, discharge, itching, and pain) may be more likely to engage in more frequent vaginal cleansing and drying to relieve discomfort.

VAGINAL PRACTICES LINKED TO HIV AND AIDS Practices that entail cleansing, drying and tightening the female genitalia have been identified to perpetuate HIV and AIDS (Braunstein & van de Wijgert, 2005; Kilmarx, Limpakarnjanarat,

~ 46 ~ Supawitkul et al. 1998; Myer, Denny, De Souza, Barone, Wright Jr. & Kuhn, 2004; Van De Wijgert, Mason, Gwanzura et al., 2000). The composition of the products used to cleanse, dry and tighten the female genitalia may cause abrasion in the vaginal epithelium or mucosal inflammation that may lead to the recruitment of HIV target cells (Kilmarx et al., 1998; Van De Wijgert et al. 2000). These products might be coarse, acidic, harsh or bitter and thus disrupt the vaginal flora, which may cause bacterial vaginosis. Bacterial vaginosis is an established risk factor for HIV acquisition (Atashili, Poole, Ndumbe, Adimora, & Smith, 2008; Turner, Morrison, Munjoma et al., 2010).

INCLUSION OF CULTURAL PRACTICES IN THE NATIONAL HIV AND AIDS POLICY FRAMEWORK Progress has been made in recognising the effects of cultural practices that perpetuate HIV and AIDS among the various social groupings in Namibia. Both the HIV and AIDS Policy of 2007 and the National Strategic Framework for HIV and AIDS Response in Namibia 2017/18 to 2021/22, state that some cultural practices can potentially perpetuate the spread of HIV and AIDS. The policy frameworks further stipulate that culture and religion shape human behaviour and thus they dictate people’s choices and lifestyles which can influence their sexual risk-taking. Integrating cultural practices in HIV and AIDS behaviour change programmes is a critical component in the prevention of HIV and AIDS.

These policy frameworks further state that the state must protect its citizens against violence, including sexual violence, forms of coerced coitus as well as traditional and religious practices that negatively affect people’s health. Despite the policy’s position on cultural practices, the policy does not stipulate the cultural practices that can potentially perpetuate HIV and AIDS in the context of Namibia. Given that the term cultural practices can mean diverse aspects of people’s lives, in this context, however, dry coitus as a cultural practice was interrogated and also the risk it poses to individuals’ susceptibility to HIV and AIDS.

The study assessed the extent to which HIV and AIDS behaviour change programmes have adopted culturally appropriate and context-specific HIV and AIDS prevention strategies in the Zambezi region by incorporating the practice of dry coitus in HIV and AIDS behaviour change programmes. Behaviour change programmes are important in shaping both individual and community behaviours. To change behaviour, individuals may be educated about HIV avoidance, accept and adopt key attitudes and need to be given appropriate products and services. The environment plays a supportive role in behaviour change.

SOCIAL CONSTRUCTIVIST THEORY: THE RELATION BETWEEN HIV AND AIDS AND THE CULTURAL PRACTICE OF DRY COITUS This study employed the social constructivist theory to locate this research project. According to this theory, most aspects of human behaviour and experience are constructed by the culture in which they exist. This idea is meant to oppose the biological essentialist view that portrays various human phenomena as being biologically essential or natural to the human condition, rather than being a

~ 47 ~ product of culture (Giles, 2006). The constructivist theory was used in the context of human sexuality and it helps to explain individual sexuality as mediated by social factors (Dworkin & O’Sullivan, 2005). Berger and Luckmann (1966) emphasise the extent to which human sexuality is influenced by societal factors in which the individual lives. Berger and Luckmann (1966 acknowledge that sexuality is grounded in biological drives, but biology does not dictate where, when, how and with whom a person engages in sexual behaviour. Although the sexual desire may be biologically driven, its expression is socially constructed. The constructivist theory suggests that the constructs and ideas associated with traditional sexual scripts remain unchanged and they are rooted in traditional gender roles that were established decades earlier. It therefore argues that as much as sexual decision-making is personal, it is equally influenced by cultural factors that are common in a particular community; hence, sexual relations are governed by society.

Gagnon and Simon (1973) presented a theory on sexuality, that is, the social constructionist theory. Gagnon and Simon (1973) also rejected an essentialist view that sexuality is not universal and argued it is not the same in all historical times and cultural spaces. Gagnon (1990) further alludes that sexuality is created by culture, by defining some behaviours and some relationships as sexual and the learning of these definitions or scripts by members of the society. Foucalt (1978) also applied social construction to human sexuality. Foucalt (1978) argues that human sexuality cannot be fully explained by theories on biological essentialism. Sexuality is not a biological quality or natural inner drive whose character is the same across time and space. Sexuality, therefore, is a cultural construct. Its meaning is derived from language or discourse; each institution in society has a discourse about coitus; as well as a way of thinking and talking about the broad array of sexual expressions.

For example, practices such as dry coitus have social significance in the society where they are practised (Malungo, 2001; Loosli, 2004). However, with the advent of HIV and AIDS, a new challenge is looming as a result of the strong correlation between individual sexuality and the influence of society in shaping that sexuality, thus HIV and AIDS prevention programmes have to include the impact of society and how it shapes the sexual behaviour that is potentially a risk factor to contracting HIV and AIDS (Olutayo, 2015).

METHODOLOGY

QUALITATIVE RESEARCH The study used a qualitative research approach. This approach allows for exploring complex phenomena such as the linkages between HIV and AIDS and cultural practices, as well as analysing the extent to which HIV and AIDS culturally appropriate prevention strategies are adopted. Mohajan (2018) states that qualitative research aims to explore, understand and describe research participants’ experiences through an inductive approach by generating new knowledge and theory that is grounded in human experience (Bryman, 2008). Bazeley (2013, p. 4) also elaborates that “researchers engage in qualitative studies by describing, observing, interpreting and analysing people’s experiences, their actions and the way they think about themselves and the world around them”.

~ 48 ~ FOCUSED ETHNOGRAPHY This study used an ethnographic approach known as focused ethnography. Focused ethnography can be applied to any discipline where there is a desire to explore specific cultural perspectives held by sub-groups of people within a context-specific and problem-focused framework (Higginbottom et al., 2013). Focused ethnography is appropriate for investigating societal problems in specific contexts (Wall, 2015), as well as research questions that are related to the experiences of groups or subgroups within specific cultural contexts (Higginbottom et al., 2013).

Focused ethnography was useful for this study because of its key characteristics which include: focusing on discrete communities or organisations, unstructured and semi-structured interviews; selecting episodes of participant observation and limited numbers of research participants who have been selected for their knowledge and experience of the phenomenon (Muecke, 1994). Intensive data collection using audio-visual recording techniques are common and they compensate for short-term field visits by producing a large amount of data for analysis (Knoblauch, 2005).

Selecting the focused ethnography method allowed the researcher to gain further insight into drawing the interrelationship between the practice of dry coitus and HIV and AIDS as well the extent to which HIV and AIDS behaviour change programmes are culturally appropriate. It was important for the researcher to establish rapport and become familiar with the setting, including the practices and language used (Elliott, & Martin, 2013; Guillemin, & Heggen, 2009). Focused ethnography also sheds light on community members’ perspectives pertaining to the cultural practice of dry coitus that can potentially pose a risk to the spread of HIV and AIDS.

PURPOSE SAMPLING Purposive sampling was utilised to select the research participants (Gentles et al., 2015). A total of 33 research participants were included in the study. Of the 33 participants, 3 were from Windhoek, while 30 were from the Zambezi region. Thus, a total of 30 participants were knowledgeable about the social context of the region, similarly, they were also aware of the practice of dry coitus.

Research participants were from Katima Mulilo, Kabbe and Windhoek. The researcher purposefully included a variety of participants from different age groups, of which 18 were females and 15 were males. The roles and responsibilities of the participants also varied; there were some participants from the Division of Special Programmes (DSP) at the Ministry of Health and Social Services (MoHSS), a Regional AIDS Coordination Coordinator at the Zambezi Regional Council, and others were from Non-Governmental Organisations operating in the Zambezi region. The six NGOs working in HIV and AIDS behaviour change programmes, namely the Catholic AIDS Action, Society for Family Health, Total Control of the Epidemic (TCE)/Development AID from People to People (DAPP), and Red Cross are based in Katima Mulilo, while Namibia Network of AIDS Service Organisations (NANASO) and Women Leadership Centre (WLC) are in Windhoek and they only conduct outreach programmes in the Zambezi region.

~ 49 ~ Participants also represented different segments of society such as traditional leaders, traditional healers, and life skills teachers. The study also included community members from various age groups, with the youngest being 15 years old and school going and the eldest was a 96 year old pensioner. Each of the participants was given a pseudonym. The participants from the Zambezi region were from various parts of the region. The study included participants that identified with home languages such as Silozi, Sifwe, Sisubia, Mbalangwe, Yeyi, Shikwe and Nyanga. All the participants signed a consent form and participants younger than 18 years signed assent forms and their parents and/or guardians consented on their behalf. The study received ethical approval from the University of Namibia’s Research and Ethics Committee.

METHODS OF DATA COLLECTION In this study, the researcher used different methods to collect rich quality data, which can facilitate reaching data saturation (Fusch & Ness, 2015). The combination of using in-depth face-to-face semi- structured interviews, supplemented with focused participant observations, photographs of herbs and reflective field notes contributed to the quantity and quality of data.

DATA ANALYSIS Tessier (2012) refers to the process of transcribing qualitative data from interviews as one of the initial steps in preparing the data for analysis. The researcher and two transcribers were responsible for transcribing all the recordings. Through transcription, the researcher began to immerse herself in the data, developing an intimate knowledge of the data and the researcher became sensitive to important issues that arose (Bazeley, 2013). In order to retain rich and full data, transcription was done verbatim (Halcomb, & Davidson, 2006). Moreover, to ensure that rich data was retained, the decision was made to include all content from the interviews in the transcript to be able to explore in detail the perspectives of the participants.

The interviews were conducted in four languages, namely English, Silozi, Sifwe and Sisubia. The researcher made use of research assistants for translations. It was important to the researcher to retain the participants’ voices by ensuring that the meaning of what had been said by the participants should not be lost through translations. The researcher, therefore, took more of a naturalised approach to transcribing, and this applied even in instances where translation retained the pauses, as well nonverbal communication, stutters and involuntary vocalisations. Each completed interview transcript was imported into AtlasTi. Friese (2014), states that qualitative data analysis with AtlasTi can assist with managing data, visualising data, querying ideas and reporting from the data.

RESULTS AND DISCUSSIONS This section discusses the cultural practice of dry coitus and its potential for perpetuating the spread of HIV and AIDS. The extent to which this cultural practice still occurs is elaborated on. In addition, this section also assesses the degree to which cultural transformation is occurring within this practice. The role that has been placed by various social structures in preserving or altering the cultural practice is also highlighted.

~ 50 ~ The practise of using herbs and other agents to dry the female genitalia for purposes of coitus is not unique to the Zambezi region of Namibia. Kuhn (1998), reflected on the practice and indicated that the practice is common in various parts of the world. The use of vaginal drying agents has been reported in other countries such as Costa Rica, Haiti, Cameroon, South Africa, Senegal, Malawi, Zambia, Kenya, Saudi Arabia, Zaire and Zimbabwe (Halperin, 1999; Kuhn, 1998). Despite the knowledge of this practice, the international health community knows little about the prevalence of this practice, or how to implement culturally appropriate and context-specific HIV and AIDS behaviour change programmes.

PERCEIVED JUSTIFICATION FOR DRY COITUS Female participants in this study indicated that using drying agents on the female genitalia has many benefits varying from treating vaginal infections or symptoms, to increasing friction (warmth), tightening of the vaginal walls and improving general blood circulation to enhance sexual performance. This corresponds with studies in Senegal where community members believed that it is necessary for hygiene reasons, to remove vaginal fluids, and to create a clean environment for procreation (Halperin, 1999; Loosli, 2004); as well as also to rule out the negative cultural perceptions of wet female genitalia which is associated with unfaithfulness, abnormality, disease, dirtiness, and lack of sexual pleasure.

Vaginal drying agents are used when there is a preference for dry rather than lubricated female genitalia. Reasons for this preference vary. In South Africa, some men have reported that vaginal wetness during coitus is an indicator of a woman’s infidelity, and some of the men also associated vaginal lubrication with sexually transmitted diseases (STDs) and the use of contraceptives (Baleta, 1998; Karim et al., 1994). In Zaire, as well as in Zimbabwe, it was found that both men and women expressed preferences for vaginal dryness and tightness during intercourse as it was reported to increase sexual satisfaction and pleasure for men (Brown, Ayowa, & Brown, 1993).

Similarly, in the current study, the same sentiments about vaginal fluids were raised. The female and male participants spoke about vaginal fluid as if it is something detestable and abnormal in women. For example, the male traditional healer stated that it is very nice for a man to have coitus with a woman whose female genitalia is dry. However, if a woman’s female genitalia is found to be wet, the man might think that the woman had coitus with another man. In his opinion, the woman’s female genitalia ought to be dry because the man is the one who should ejaculate sperm into the female genitalia for it to be wet. The female genitalia is thus perceived not to have the capacity to excrete its own vaginal fluids. Pitts, Magunje and McMaster (1994) confirmed in their studies that vaginal lubrication is not considered an essential element in pleasurable coitus, hence participants indicated that vaginal drying agents made them feel “like a virgin” and als that this enhanced their partner’s sexual pleasure.

The practice of dry coitus highlights on the conflict of knowledge systems among communities that practice it and the biomedical practice. Zemouri, Wi, Kiarie, Seuc, Mogasale, Latif, and Broutet

~ 51 ~ (2016) state that the vaginal discharge serves an important housekeeping function in the female reproductive system. Fluids made by glands inside the female genitalia and cervix carry away dead cells and bacteria. This keeps the female genitalia clean and helps to prevent infection. Most of the time, vaginal discharges are thus perfectly normal.

In order to effectively address the factors that perpetuate HIV and AIDS embedded in the practice of dry coitus, it is important that the gap between the two conflicting medical knowledge systems about the vaginal lubrication is bridged. In doing so, the biomedical practice through HIV and AIDS behaviour change programmes should educate community members on the consequences of dry coitus to allow them to alter this practice and thus reduce the factors that perpetuate HIV and AIDS. The continued practice of dry coitus further raises the need for community based education on the anatomy of male and female reproductive systems. This also raises the question of whether the notion of sexual pleasure is a result of socialisation, and also the rights of women in deriving sexual pleasure?

MEN DEMAND DRY COITUS Despite the pain that man endure as a result of dry coitus, the 86 year old man from Kabbe confirmed that the majority of men prefer dry coitus. He also stated that when a man has coitus with a woman with dry female genitalia, he will not leave her, implying that if the female genitalia is lubricated, she might be divorced by her husband. Patrice from RACOC also indicated that when a man marries a woman, he expects her to use herbs to dry her female genitalia. A woman who does not meet these societal standards is considered abnormal and the husband will report her to the elders and the elders will advise him to leave her as she is “abnormal”.

Sibolile from the Red Cross also confirmed that men advise their women to use herbs to dry the female genitalia if they find the wetness “abnormal”. He said that, “us men we advise women… you sleep with your girlfriend or your wife, you can see how abnormally wet she is then you start talking to her that this is not good. Men also do not want that wetness … at least a person should be wet but in a normal way”, he argued.

The participant from the Red Cross elaborated on the extent to which men prefer dry coitus by mentioning that there is a level of vaginal fluids/moisture that is acceptable to men, and there is a level that is considered too much and unacceptable. Too much vaginal fluids are said to be culturally a condition of women’s disease. Women who find themselves with this condition would be worried and would consult on how to remedy the situation. On the other hand, men prefer dry female genitalia because they need to feel tightness and friction during coitus. That is when men feel that they are strong and that they can do it, which is coitus. The possibility of these practices declining is rare, mentioned the participant from the Red Cross, because women have accepted that it is their responsibility to satisfy their men by using these herbs that dry their female genitalia. Furthermore, the lack of behavioural change intervention into this practice will lead to its persistence.

~ 52 ~ HOW TO USE THE HERBS FOR DRY COITUS The participants indicated various ways of how the herbs are used to dry the female genitalia. One method is to insert finely powdered herbs in the female genitalia. In order to avoid inserting the granules of herbs as they sometimes are too coarse and can cause tearing on the vaginal walls, women put the herbs in a stocking before inserting them in the female genitalia. In some instances, women can dissolve the herbs in warm water and then douche the female genitalia. The participants stated that the various methods serve the same purpose of reducing vaginal fluids during coitus. The researcher, however, observed that of the two types of herbs, using the herbs in dry form has a more drying effect on the female genitalia. Inserting the herbs by using a stocking is most effective if the herbs are inserted longer than approximately two to three hours in the female genitalia for the drying effect to be felt. The researcher did not notice a major difference when dissolving the herbs in water before douching the female genitalia. The researcher suspected that increasing the quantity of the dissolved herbs can create the drying effect.

Research participants alluded to different forms of herbs that can be used by both men and women to enhance sexual pleasure. Some herbs that are consumed orally are also believed to “heat up the body”, causing heat and friction during intercourse and heightened male sexual stimulation (Pitts, Magunje, & McMaster, 1994). Namasiku from DSP elaborated that there are herbs that are put in hot water and drank like tea or the herbs are put in thin porridge. Namasiku indicated that this method warms up the body and also reduces the excretion of vaginal fluids during coitus. Some participants could however not agree whether the herbs that are consumed like tea and in thin porridge have the same effect of drying the female genitalia and therefore heighten the risk of HIV and AIDS.

The researcher saw at least two types of herbs that can be inserted in the female genitalia and two different types of herbs that can be consumed as a form of tea or in thin porridge. The herbs have a fine rough texture when you touch them on your fingertips. One of the herbs used for drying the female genitalia is deep reddish-brown in colour and when you mix it with water it gives a glue-like sticky texture. The TCE/ DAPP Field Supervisor confirmed the variety of the herbs that are used. The majority of female research participants had either the herbs that can dry the female genitalia or they had the herb that can be drunk as tea or that can be put in thin porridge. For those who did not have them, they knew where to acquire the herbs. There was no secret or shame around acquiring these herbs. On the contrary, women spoke as if they are useful herbs for every woman to have as they can save relations and marriages.

Figure 1: Samples herbs for dry coitus

~ 53 ~ Figure 2: Herbs that are consumed as tea or are eaten in porridge

These herbs are sold by traditional healers and they can also be bought at open markets. The researcher got herbs from one of the research participant who was willing to share hers. She also bought some herbs from a junior secondary school teacher after the female life skills teacher who was a research participant alerted her about the lady who usually comes to the school to sell them. During the time when the researcher was at the school to buy the herbs, teachers and cleaners and mainly women were lining up to buy the herbs. A tablespoon was measured at N$10.00 of both herbs that can be inserted in the female genitalia and those that are used for warming the body. Some female learners from the junior secondary school met with the lady who sold the herbs after school and bought some of the herbs. The researcher also bought some herbs from the female traditional healer at the cost of N$10.00 for three tablespoons. The male traditional healer had indicated that he also sells the herbs for drying the female genitalia and warming up the body at a price of N$150.00. These herbs are easily available at street markets, they can be purchased from female elders in the community and they can also be bought from traditional healers. Both urban and rural participants knew where to find herbs. It is interesting to note how the awareness of the relationship between dry coitus cancer risk and HIV and AIDS leads to behaviour change that does not reduce the risks. On the contrary, what is happening is that community members are devising different strategies of using the herbs by putting them in a cloth before inserting them in the female genitalia, or putting the herbs in hot water in bathing bowls and douching the female genitalia.

DRY COITUS INHIBITS CONDOM USE Loosli (2004) states that the consequences of dry coitus include preventing condom use. Condoms are ineffective in dry coitus conditions as the process excludes any lubricant in the female genitalia. If a condom is used it would likely break. Participants indicated the difficulty to use condoms effectively when practising dry coitus.

Traditional leader Sinvula posited that dry coitus can potentially injure the male genitalia, particularly, if the man is forcing himself on the women. He was also sceptical about the use of a condom when women are using herbs that dry the female genitalia. The possibility of the condom bursting if the female genitalia are not lubricated was highly plausible, he warned. Scorgie et al. (2009), Baleta (1998), and Myer, Denny, De Souza, Wright Jr. and Kuhn (2006) also indicated that condom use was problematic during dry coitus in a study that was conducted in South Africa. The participant

~ 54 ~ from the Red Cross also cautioned against the cuts of the glans of the penis among men who are not circumcised, because of its tenderness. Instances where the female genitalia is dry, small and tight lead to penetration that results in the development of sores on the glans of the penis. The perspectives of men getting hurt during dry coitus were also mentioned in a study by Halperin (1999), who reported on the opinion of one participant who said that, “It’s natural for all guys to go crazy for a woman who is dry, but you have to make love carefully. If you want to be rough, you can get hurt. A man can get cuts and wounds and catch diseases”. Leo, who is 28 years alluded to his preference for dry coitus and said that he finds it enjoyable. He however also mentioned the possibility of the male genitalia getting cuts and as a result, getting exposed to different diseases including HIV and AIDS.

DRY COITUS AND THE LINK TO HIV AND AIDS The rough texture of the herbs also contributes to the tearing of the vaginal walls. The tearing of the vaginal walls contributes to painful coitus experiences for women. In addition to friction during intercourse, lesions occur in the vagina’s mucous membrane causing vagina epithelium trauma and micro-lacerations during intercourse. HIV transmission is known to be enhanced in the presence of genital lesions and ulcerations (Loosli, 2004). Since vaginal drying agents have been documented as producing lesions that disrupt membrane integrity, the practice may also increase the risk of HIV acquisition. In addition, intravaginal substances may alter the vaginal pH, which normally serves as a protective factor against HIV acquisition (Kun, 1998). Drying agents are also identified to change the natural vaginal pH (acidity and alkalinity) and thus they undermine the natural defence against microbes, making the infection more likely. Loosli (2004) further alluded to the pain and discomfort that is associated with dry coitus whereby men and women have reported tearing and bleeding during dry coitus in the Caribbean as well as in some parts of Africa. The Ministry of Health and Social Services and NGOs working on HIV and AIDS behaviour change programmes raised the fact that the practice of dry coitus is commonly mentioned by community members as a driver of HIV and AIDS. Patrice from the Regional AIDS Coordinating Committee (RACOC) in the Zambezi region confirmed that community members during the HIV and AIDS Community outreach highlighted dry coitus as one of the drivers of HIV and AIDS. However, studies show that there is no scientific consensus as to whether the practice of dry coitus perpetuates the risk of HIV and AIDS. For example Van De Wijgert et al. (2000), Kilmarx et al. (1998), Mbizvo, Musya, Stray-Pedersen, Chirenje, and Hussain, (2004), and McClelland, Lavreys, HassanMandaliya, Ndinya-Achola, and Baeten, (2006), indicated that there is a direct association with increased prevalence and incidence of HIV and AIDS. Whilst Myer, Denny, De Souza, Wright Jr. and Kuhn, (2006) and Van De Wijgert et al. (2008) state that there is no significant effect on dry coitus and HIV risk. It is the hope of this researcher that such practices are further investigated in order to conclusively establish the relationship between dry coitus and HIV risk. Findings from such studies ultimately inform HIV and AIDS behaviour change programmes. Vaginal wall tearing was identified as a major vehicle for spreading the virus. The pain associated with dry coitus among women was also confirmed by Loosli (2004) where a high percentage of women confided that they experience pain rather than pleasure and resent this. It is therefore evident that most women perform dry coitus to satisfy their partner or husband. The men believe that friction enhances their sexual stimulation and pleasure. Research participants argued that the female genitalia

~ 55 ~ that has less moisture holds the male genitalia during coitus and this provides more friction and sexual pleasure to the male. The continued expectations from women to have tight female genitalia as they mature and have children is not only unrealistic but it is unnatural. The prevailing culture of dry coitus feeds into the beliefs around virginity and men’s sexual attraction to young girls. It was believed that coitus with a virgin could cure HIV and AIDS (Meel, 2003). Despite the awareness about dry coitus in the community and the possible risk it poses to HIV and AIDS, this cultural practice has not been integrated into HIV and AIDS behaviour change programmes.

CONCLUSION The overall objective was to explore the cultural practice of dry coitus that may perpetuate HIV and AIDS in the Zambezi region. This practice was commonly reported among the research participants. Furthermore, the herbs that are used to either insert into the female genitalia are easily accessible in open markets and from traditional healers. Community members from all age groups, including staff members from the Ministry of Health and Social Services and representatives from NGOs, are aware of the HIV risk posed by the practice of dry coitus. The National HIV and AIDS policy frameworks are cognisant of the cultural practices that might perpetuate the spread of HIV and AIDS. Despite the awareness of the HIV risk posed by the practice of dry coitus, behaviour change programmes have not incorporated it into their HIV and AIDS prevention programme. It is thus important to create awareness of the HIV risk posed by cultural practices such as dry coitus. As for dry coitus, there is no targeted intervention for this cultural practice; furthermore, there is a need for further studies on the pharmacology of herbs used by women to dry their female genitalia and the herbs that are consumed in tea or thin porridge. Even within the context of the Zambezi region, the locale where such practices are concentrated need to be identified. For example, it is not known how widespread the practice of dry coitus is within the Zambezi region. There is, therefore, a need for more qualitative and quantitative studies to be conducted to inform HIV and AIDS behaviour change programmes. The perspectives of community members that practice these cultures need to be sought and together with HIV and AIDS behaviour change programmes, appropriate interventions need to be devised. Further studies should also address male and female sexual and reproductive health and should interrogate the notion of female sexual pleasure.

REFERENCES Atashili, J., Poole, C., Ndumbe, P. M., Adimora, A. A., & Smith, J. S. (2008). Bacterial vaginosis and HIV acquisition: A meta-analysis of published studies. AIDS, 22(12), 1493–1501. Baleta, A. (1998). Concerns voiced over “dry sex” practices in South Africa. Lancet, 352, 12-92. Bazeley, P. (2013). Qualitative data analysis: Practical strategies. London, UK: Sage. Berger, P., & Luckmann, T. (1966). The social construction of reality: A treatise in the sociology of knowledge. Garden City, NY: Doubleday. Braunstein S. & van de Wijgert, J. (2005). Preferences and practices related to vaginal lubrication: Implications for microbicide acceptability and clinical testing. Journal of Women’s Health, 14(5), 424-433. Bryman, A. (2008). Social research methods. (3rd ed). Oxford, UK: Oxford University Press.

~ 56 ~ Brown, J. E., Ayowa, O. B., & Brown, R. C. (1993). Dry and tight: Sexual practices and potential AIDS risk in Zaire. Social Science and Medicine, 37(8), 989-994. Civic D. &Wilson, D. (1996). Dry sex in Zimbabwe and implications for condom use. Social Science and Medicine, 42(1), 91-98. Dallabetta, G. A., Miotti, P. G., Chiphangwi, J. D., Liomba, G., Canner, J. K., & Saah, A. J. (1995). Traditional vaginal agents: Yse and association with HIV infection in Malawian women. AIDS, 9(3), 293-297. Dworkin, S., & O’Sullivan, L. (2005). Actual versus desired initiation patterns among a sample of college men: Tapping disjuncture within traditional male sexual scripts. Journal of Sex Research, 42(2), 150-158. Elliott, C. M. A., & Martin, J. M. A. (2013). Developing and establishing a good rapport. Information Outlook, 17(2), 32-53. Foucault, M. (1978). The history of sexuality: An introduction. New York, NY: Pantheon. Fusch, P. I., & Ness, L. R. (2005). Are we there yet? Data saturation in qualitative research. The Qualitative Report, 20(9), 1408-1416. Retrieved from http://www.nova.edu/ssss/QR/QR20/9/ fusch1.pdf Friese, S. (2014). Qualitative data analysis with ATLAS.ti (2nd ed.). London, UK: SAGE. Gagnon, J. H., & Simon, W. (1973). Sexual conduct. Chicago, CH Aldine. Gagnon, J. H. (1990). The explicit and implicit use of the scripting perspective in sex research. Annual Review of Sex Research, 1, 1-43. Gentles, S. J., Charles, C., Ploeg, J., & McKibbon, K. (2015). Sampling in qualitative research: Insights from an overview of the methods literature. The Qualitative Report, 20(11), 1772- 1789. Giles, J. (2006). Social constructionism and sexual desire. Journal for the Theory of Social Behaviour, 36: 225-238. doi:10.1111/j.1468-5914.2006.00305.x Guillemin, M., & Heggen, K. (2009). Rapport and respect: Negotiating ethical relations between researcher and participant. Medicine, Health Care, and Philosophy, 12(3), 291-299. doi: http://dx.doi.org/10.1007/s11019-008-9165-8. Halcomb, E., & Davidson, P. M. (2006). Is verbatim transcription of interview data always necessary? Applied Nursing Research, 19(1), 38-42. Halperin, D. T. (1999). Dry sex practices and HIV infection in the Dominican Republic and Hait. Sexually Transmitted Infections, 75(6), 445-446. Higginbottom, G. M., Pillay, J. J., & Boadu, N. Y. (2013). Guidance on performing focused ethnographies with an emphasis on healthcare research. The Qualitative Report, 18(9), 1 - 6. Retrieved from http://nsuworks.nova/tqr/vol18/iss9/1. Karim, Q. A., Khasany, A, B. M., Frohlich, J. A., Werner, L., Mlotshwa, M., Madlala. B., & Kari, M. S. S. A. (2012). AIDS and Behaviour, 16(7), 1870-1876. doi: 10.1007/s10461-012-0209-y. /Khaxas, E & Frank, E. (2010). Violence is not our culture: Women claiming their rights in the Caprivi region. Windhoek, Namibia: Women Leadership Centre. Kilmarx, P. H., Limpakarnjanarat, K., Supawitkul. S. Korattana, S., Young, N. L., Parekh, B. S., Respess, R. A., Mastro, T. D and St Louis M. E., (1998). Mucosal disruption due to use of a widely-distributed commercial vaginal product: Potential to facilitate HIV transmission. AIDS, 12(7), 767-773.

~ 57 ~ Knoblauch, H. (2005). Focused ethnography. Forum: Qualitative Social Research, 6(3), 44. Retrieved from http://nbn-resolving.de/urn:nbn:de:0114-fqs0503440. Kun, K. (1998). Vaginal drying agents and HIV transmission. International Perspective on Sexual and Reproductive Health, 24(2), 93-94 Loosli, B. C. (2004). Traditional practices and HIV prevention in Sub-Saharan Africa. Geneva, Switzerland. Malungo, J. R. S. (2001). Sexual cleansing (Kusalazya) and levirate marriage (Kunjilila mung’anda) in the era of AIDS: Changes in perceptions and practices in Zambia. Social Science and Medicine, 53(3), 71-82. Martin Hilber, A., Hull, T. H., Preston-Whyte, E. Bagnol, B., Smit, J., Wacharasin, C., Widyantoro, Nand WHO GSVP Study Group. (2010). A cross-cultural study of vaginal practices and sexuality: implications for sexual health. Social Science and Medicine, 70(3), 392-400. Mbizvo, M. E., Musya, S. E., Stray-Pedersen, B., Chirenje, Z. & Hussain, A. (2004). Bacterial vaginosis and intravaginal practices: Association with HIV. The Central African Journal of Medicine, 50(5-6), 41-46. McClelland, R. S., Lavreys, L., Hassan, W. M., Mandaliya, K., Ndinya-Achola, J. O. & Baeten, J. M. (2006). Vaginal washing and increased risk of HIV-1 acquisition among African women: a 10-year prospective study. AIDS, 20(2), 269-273. Meel, B, L., (2003). The myth of child rape as a cure for HIV/AIDS in Transkei. Medicine, Science and the Law, 43(1), 85-88. Mills, E., Cooper, C., Seely, D., & Kanfer, I. (2005). African herbal medicines in the treatment of HIV: Hypoxis and Sutherlandia: An overview of evidence and pharmacology. Nutrition Journal, 4;19, doi:10.1186/1475-2891-4-19 Ministry of Health and Social Services. (2016). Surveillance Report of the 2016 National HIV Sentinel Survey. Windhoek, Namibia: Directorate of Special Program. Ministry of Health and Social Services. (2017). National Strategic Framework for HIV and AIDS Response in Namibia 2017/18 to 2021/22. Windhoek, Namibia: Directorate of Special Programs. Mohajan, H. (2018). Qualitative research methodology in social sciences and related subjects. Journal of Economic Development, Environment and People, 7(1), 23-48. Muecke, M. A. (1994). On the evaluation of ethnographies. In J. M. Morse, (Ed.), Critical issues in qualitative research methods. Thousand Oaks, CA: SAGE Publications. Myer, L., Denny, L., De Souza, M., Barone, M. A., Wright Jr., T. C. & Kuhn. L. (2004). Intravaginal practices, HIV and other sexually transmitted diseases among South African women. Sexually Transmitted Diseases, 31(3), 174-179. Myer, L., Denny, L., De Souza, M., Wright Jr., T. C. & Kuhn, L. (2006). Distinguishing the temporal association between women’s intravaginal practices and risk of human immunodeficiency virus infection: A prospective study of South African women. American Journal of Epidemiology, 163(6), 552-560. Olutayo, A. M. (2015). Trado-cultural practices, situation, analysis and epidemiological factors in the spread of HIV/AIDS in Nigeria. Journal of Education and Practice, 6(21), 65-70. Pitts, M., Magunje, N. & McMaster, J. (1994). Students’ knowledge of the use of herbs and other agents as preparation for sexual intercourse. Health Care for Women International, 15(2), 91-99.

~ 58 ~ Runganga, A., Pitts, M., & McMaster, J. (1992). The use of herbal and other agents to enhance a sexual experience. Social Science and Medicine, 35(8), 1037-1042. Sandala, L., Lurie, P., Sunkutu, M. R., Chani, E. M., Hudes, E. S., & Hearst, N. (1995). Dry sex and HIV infection among women attending a sexually transmitted diseases clinic in Lusaka, Zambia. AIDS, 9(S1), S61–S68. Sharma, A., Bukusi, E., Posner, S., Feldman, D., Ngugi, E., & Cohen. C. R. (2006). Sex preparation and diaphragm acceptability in sex work in Nairobi, Kenya. Sexual Health, 3(4), 261-268. Scorgie, F., Kunene, B., Smit, J. A., Manzini, N. F., Chersich, M. & Preston-Whyte, E. M. (2009). In search of sexual pleasure and fidelity: vaginal practices in KwaZulu-Natal, South Africa. Culture, Health and Sexuality, 11(3), 267-283. Tessier, S. (2012). From field notes to transcripts, to tape recordings: Evolution or combination? International Journal of Qualitative Methods, 11(4), 446-460. Turner, A. N., Morrison, C.S., Munjoma, M. W., Moyo, P., Tsungai C., & van de Wijgert, J. H. (2010). Vaginal Practices of HIV-Negative Zimbabwean Women. Infectious Diseases in Obstetrics and Gynecology,2010, 387671. http://dx.doi.org/10.1155/2010/387671. Van De Wijgert, J. H. H. M., Mason, P. R., Gwanzura, L. Mbizvo, M. T., Chirenje Z. M., Iliff, V., Shiboski, S and Padian, N.S. (2000). Intravaginal practices, vaginal flora disturbances, and acquisition of sexually transmitted diseases in Zimbabwean women. Journal of Infectious Diseases, 181(2), 587-594. Van De Wijgert, J. H. H. M., Chirenje, Z. M., Iliff., Mbizvo, M. T., Mason, P. R., Gwanzura, L., Shiboski, S and Padian, N.S. (2000). Effect of intravaginal practices on the vaginal and cervical mucosa of Zimbabwean women. Journal of Acquired Immune Deficiency Syndromes, 24(1), 62-67. Van De Wijgert, J. H. H. M., Morrison, C. S., Cornelisse, P. G. A., Munjoma, M., Moncada, J., Awio, P., Wang, J., Van der Pol, B., Chipato, T., Salata, R. A and Padian, N. S. (2008). Bacterial vaginosis and vaginal yeast, but not vaginal cleansing, increase HIV-1 acquisition in African women. Journal of Acquired Immune Deficiency Syndromes, 48(2), 203-210. Wall, S. S. (2015). Focused ethnography: A methodological adaptation for social research in emerging contexts. Forum: Qualitative Social Research, 16(1), Art1. Retrieved from http:// nbn-resolving.de/urn:nbn:de:0114-fqs150111. Zemouri, C., Wi, T, E., Kiarie, J., Seuc A., Mogasale, V., Latif, A., & Broutet, N. (2016). The performance of the vaginal discharge syndromic management in treating vaginal and cervical infection: A systematic review and meta-analysis. PLOS One, 11(10):e0163365. doi: 10.1371/ journal.pone.0163365.

~ 59 ~ A CRITICAL ANALYSIS OF DRAMA AS AN EFFECTIVE TEACHING TOOL IN EARLY CHILDHOOD EDUCATION: A CASE STUDY OF MOGODITSHANE CHILD DEVELOPMENT CENTRE

Isaac Chidaura Post Graduate School, Afda Botswana Campus

Email Addresses: [email protected] / [email protected]

ABSTRACT This research was a critical analysis of drama in education as an effective teaching tool in early childhood education in Botswana. The target group for this study was a group of 20 pre-school students from Mogoditshane Child Development Centre in 2016. The theoretical framework of this study was underpinned by Drama in Education (Dorothy Heathcote), Theatre for Development (Augusto Boal) and Theatre of the Oppressed (Paulo Freire) theories. These theories consider the use of theatre elements as essential in achieving both its ‘pedagogical objective’ and its ‘artistic objective’ (Bolton, 1993). The study used a participatory case study approach within the qualitative action research paradigm. Data was gathered through focus group discussion and participant observation. Research instruments included in-depth open-ended interviews, questionnaires and an observation checklist, and data was also digitally recorded. The literature survey included books, journals, newspapers and organisational records on internet reports. Mantle of the expert and teacher-in-role were the overarching drama in education teaching techniques essential for pre-school learners to be able to understand concepts in class. This research showed how the safety of drama through the creation of “dramatic elsewhere”, distancing, framing and role playing, work towards a deeper understanding by pre-schoolers in school. The research noted that if toddlers are told something, they tend to forget. If they are shown something, they remember, but if they are involved practically they understand. Findings call for efforts to conduct lessons in early childhood education experientially through drama as a teaching tool. This research recommends early childhood schools and education authorities in Botswana to explicitly consider drama as an effective early childhood teaching methodology in the 21st century. The study concludes with a strong plea for the inclusion of accredited drama and theatre pedagogical courses in pre-school teachers’ training colleges.

Keywords: Early childhood education, drama in education, effective teaching tool, English medium pre-schools, critical analysis

INTRODUCTION This research report is a critical analysis of drama as an effective teaching tool in pre-schools at Mogoditshane Child Development Centre in Gaborone, Botswana. Mogoditshane Child Development Centre is a privately owned pre-school situated along the road that demarcates Mogoditshane from Block 7 in Gaborone. The research project was conducted with a group of 20 early childhood development children in 2016. Early childhood development is defined as the period from pregnancy

~ 60 ~ and birth to the age of eight (Thomas & Thomas, 2009). On the other hand, Bogin (1998) asserts that early childhood is the period between infancy and middle childhood (from 3-6 years). This means that early childhood education or childhood development is the care of children from birth through to the age of 8, and including their families (Chikutuma, 2013). For this study, dramatic play in ECD involved role playing, song, dance, and rhymes among others.

According to Freire (1972), education worldwide is suffering from narration sickness. A careful analysis of teacher-student relationship even at early childhood level involves a narrator (teacher), patient, and listening objects (students). “In this banking concept of education, knowledge is a gift bestowed by those who consider themselves knowledgeable upon those whom they consider to know nothing” (Freire, 1972, p. 31). Corroborating Freire’s (1972) ideas, Rooth (1995) posits that knowledge is never a concrete thing presented by an expert to the unknowing. Rather, true knowledge comes from experiential learning where learners are responsible for and are active in the production of their knowledge and the power of learning lies in them.

According to Miranda (2004), the teaching methods and techniques have functional qualities that help children to be more attentive, to develop memory capacity and to engage in the learning process. Play / drama allows pre-schoolers to assimilate the information they get from the outside environment into their minds, and this assists them to make sense of it (Ailwood, 2003). Thus, during play, children practice the skills that they acquire during non-play situations. Thus, this study critically explored how drama could be used as a teaching tool in early childhood education in Botswana so as to avert the narration sickness in the education system and enhance pre-school learners’ level of understanding. Excell and Linington (2011), assert that children who actively participate in drama during preschool will have advanced intellectual development and the ability to think inventively. During role playing, young children create safe spaces in which they practice skills that they acquire during non-play situations. This is corroborated by Ailwood (2003) who argues that play allows pre-schoolers to assimilate the information they are gathering from their environment into their minds and this helps them to make sense of it. Songs also foster children’s learning and development (Chikutuma, 2013). In the same vein, Miranda (2004) asserts that from birth, music is an intuitive form of communication between mother and child. The use of songs facilitates the development of literacy skills in young children (Berk, 2009). Zembat and Zulfikar (2006), postulate that stories and tales have important effects in Mathematical concept development, such as geometry, measurement and graphics abilities. Thus, without dramatising, children’s skills and knowledge would be lost. In view of the above, this research project sought to critically explore how drama could be used as an effective teaching methodology in early childhood care and education in Botswana.

RESEARCH OBJECTIVES  To critically examine how drama in education can be used as an effective teaching tool to enhance pre-school learners’ level of understanding in early childhood education.  To analyse the effects of integrating drama in education pedagogy in early childhood education in Botswana.

~ 61 ~ THEORETICAL FRAMEWORK The theoretical framework of this study is underpinned by Dorothy Heathcote’s drama in education principles. According to Bolton (1998), drama in education should aim for internal actions that have significance in order to bring about a change in understanding. The overriding objective of drama in education is to encourage learners’ participation in their learning. The drama teacher must build the play using what children already know and select dramatic elements that suit the learners’ needs. A fundamental characteristic feature of drama in education is the symbolic or make believe play.

Leading drama educators, O’Neill (1995) and O’Toole (1992) assert that role play is a central element in drama in education. The philosophy behind drama in education encourages learners to have a practical engagement with knowledge. It emphasises the importance of a change in understanding through make believe. In order for this to happen, role play becomes central to drama education. This study is informed by drama in education both as theory and practice. Cameron (2003) notes that drama in education is a framed activity where role creation allows learners to behave “as if” they are in a different context and to respond “as if” they are involved in a different set of interpersonal relationships. This pedagogy relies on imaginative creation to develop fictional lived experiences. The development of a fictional world allows learners to explore ideas in a safe space of their creation. In this case, a state of belonging actively to both the real and the fictional world becomes make belief. Augusto Boal in his “Theatre of the Oppressed” theory defines this as “metaxis”. As early childhood children play some dramatic roles in class, they put themselves in other people’s shoes which therefore, enhances their understanding of themselves, others and the concepts that are learnt in a classroom set-up. This study is informed by drama in education theory to establish how role playing enhances the level of understanding by preschool learners in Botswana’s English Medium preschools.

LITERATURE REVIEW Bolton (1998) asserts that Dorothy Heathcote’s pioneering work in drama in education in England was developed to stimulate student participation in the classroom. Heathcote’s (1995) teacher-in- role is used as a way to empower learners through active participation in their learning when they create roles for themselves. Bowell and Heap (2001) corroborate this when they note that process drama, particularly with teacher-in-role as a central strategy, is a powerful means by which teachers can empower learners. The possibility that teacher-in-role could be one of the most effective ways of managing the power shift between teachers and pupils in the context of a fictional world is shared by this research project. However, for this study, teacher-in-role was used as child/student initiated, teacher-directed and student-directed play as a way of empowering preschool learners to raise their level of understanding about topics explored in class (Miranda, 2004). O’Neill (1995) posits that drama in education gives access to “dramatic elsewhere” in which students become empowered when they experience new roles and fresh relationships. This research focused on how the safety of drama in education through the creation of “dramatic elsewhere”, distancing, framing and role playing, works towards deeper grasping of concepts taught to pre-school learners in class.

~ 62 ~ Kramer (2014) carried out research with children and adults at early childhood education institutions in Rio de Janeiro, Brazil to identify interactions between adults and children to rethink the teaching practice in pre-school. Kramer’s (2014) research in Rio de Janeiro is related to Chikutuma’s (2013) study on the quality of early childhood development programmes in Harare primary schools in Zimbabwe. Both studies recommended training of all stakeholders on early childhood development management and organisation. Chikutuma (2013) argues that parents must be invited as resource persons when teaching certain concepts in order to improve the quality of ECD programmes. This study critically analysed drama as an effective teaching tool in early childhood development education in Botswana in order to improve the quality of ECD teaching methodologies. The University of North Carolina’s Abecedarian early childhood intervention programme showed that children who received an enriched drama-oriented early childhood programme had higher IQs at the age of 5 than the comparable group of children who did not get a play oriented programme (Johansson & Samuelsson, 2006). In the same vein, Rotumi and Too (2012) assert that play is an activity that leads to development in children. This is also echoed by Ailwood (2003), who highlight that children learn best when they act upon their environment and construct knowledge for themselves. During the course of this research project, children used to perform with real objects which were symbols for something they would have experienced directly or indirectly as part of their short dramatic skits in class to enhance their level of understanding. Maundeni (2013) carried out a research on the accessibility of early childhood care and education by children from a disadvantaged background in Botswana. Until recently, early childhood care and education in Botswana was mostly offered by the private sector (Maundeni, 2013). This made early childhood care and education to be very expensive and inaccessible for less privileged children in Botswana. The research by Maundeni (2013) concludeds that early childhood care and education in Botswana is a necessity that is accessible to a few children. Whilst Maundeni (2013)’s study explored accessibility of early childhood care and education in Botswana, this study concentrated on the effectiveness of drama/play as an effective teaching methodology in early childhood care and education in Botswana.

METHODS

INTERVIEWS This study used hot seating as an interview technique to gather data. Pre-school students, teachers and the researcher assumed roles in the improvised performances and answered questions from others whilst in role. Roles were hot-seated individually, in pairs or in small groups. For this research, the hot seated character would take the centre stage in a chair in front of the class in a semi-circle. Questioning at this stage was crucial and the type of questions asked was not close-ended questions (Boal, 1982). These were questions which could not be answered by a ‘Yes’ or ‘No’ response. It was encouraged that the teacher takes on the role of a facilitator to guide the questioning in a constructive direction by posing open-ended questions which provoked the hot seated role player’s imagination in order to get more information. This was when participants (researchers/teachers) had to question or interrogate a role to find out information, ascertain why the role player behaved in a certain way, or to offer the role advice (O’Toole, 2012). This is also highlighted by Ahirirwe (2012) when he highlights

~ 63 ~ that under the technique of hot seating, a role is questioned by the group about his / her background behaviour and motivation. Ahirirwe (2012) goes on to assert that hot seating has its origins in the Theatre of the Oppressed, which is a brainchild of Augusto Boal. Much of the data for this research was gleaned from answers to hot seating questions. It was hoped that learners’ emotional engagement through this experience would enable learning. Participants/learners were regarded as knowledgeable role players while the researchers took different roles as facilitators, catalysts, observers, participants or both during the hot seating sessions.

PARTICIPANT OBSERVATION Participant observation refers to the gaining of understanding of participants through first hand observation of their activities while participating in the process as facilitator or while in role. The following structure of an action learning process was used during the course of this study: action, reflection, learning, and planning. Under action, the researcher-participant carries out a pre-planned interaction which encourages participation; during reflection s/he describes the events and looks for significant responses or activities of participants as well as choices made by the facilitator. During the course of the research project, the researcher was involved in a number of drama-based learning activities with pre-schoolers, such as drama, music/song, dance and rhymes. Thus, the researcher became a teacher-in-role, who encouraged pre-school learners to take part in role playing, whilst gaining an understanding of participants through first hand observation, of their activities in the process as facilitator or while in role.

RESEARCH JOURNAL The research journal was a very effective resource and research tool which helped the researcher to meet the above mentioned description. For this research project, the journal documented the researcher’s analytical individual responses and critiques to the work covered during workshops. The researcher also recorded observations, difficulties and individual developments in the classroom. The journal helped with the basic documentation to support future plans and actions in order to improve the processes of subsequent sessions. Based on reflections of previous workshops, drama in education theory was consulted to support alternatives for blunders encountered during the course of research. Description, analysis, theory and self-reflection were the major components of our journals. The researcher’s journal was of fundamental importance during the research period because it assisted with future referencing and data analysis after the classroom workshops.

RESEARCH FINDINGS This study noted that, at Mogoditshane Child Development Centre, different types of plays are introduced to pre-school children in relation to their age groups. In infancy and early years, functional play is introduced. This is the first stage of the play. It is a sensory and motor type of play focusing on exploring things like toys and materials (Zimbabwe Ministry of Education, Sport and Culture ECEC Teacher Training Manual, 1999, p. 21). At this stage, children like to play alone (solidarity play). In addition, it was also observed that at Mogoditshane Child Development Centre, toddlers, unlike infants, are introduced mostly to spontaneous play. Since toddlers like to play side by side,

~ 64 ~ (parallel play) but engage in their own activities, they are given an opportunity to choose activities and to freely express their individual interests and needs. For these first two categories of pre-school learners at Mogoditshane Child Development Centre, it was evident that children learn about and make sense of their environment through play. The target group for this study at Mogoditshane Child Development Centre was a group of 20 children aged between 3 and 6. The study established that this group was mainly involved in imaginative play, constructive play and games with rules (interactive play / co-operative play). At Mogoditshane Child Development Centre, interactive play / co-operative play involved older children who were willing to engage in play with their friends. This was part of imaginative play where children used various drama techniques such as dance and music/song, to explore real life issues in class through pure fantasy. This study also noted that dramatic play was the most effective type of play to elicit empathy and allow for the exploration of situations from different perspectives among the 20 children. Safety in the dramatic elsewhere during role playing in class had a major bearing on the enhancement of self-esteem and the development of healthy decision making skills by characters played by the children in their short skits at Mogoditshane Child Development Centre. The democratic and inclusive atmosphere created by drama play encouraged communication among the children who were taking part in the short plays such as mok weeding. The workshops at Mogoditsane Child Development Centre proved that dramatic play can enhance children’s ability to say things they could not verbalise, to express their feelings and emotions freely and to do things they would feel uncomfortable doing in other contexts. With the belief that action, as opposed to intellectual theorising is the way to effective early childhood education, this research showed how the safety of drama in education through the creation of “dramatic elsewhere”, distancing, framing, role playing, music and dance works towards raising the level of understanding by early childhood learners.

Metaphorical and symbolical roles were also used at Mogoditshane Child Development Centre to distance Mathematical and linguistic related aspects from early childhood learners both in time and space, but at the same time representing learners’ reality. This was part of constructive play where children were manipulating objects in order to create something meaningful. Metaphor served to increase pre-school learners’ involvement in the learning process at Mogoditshane Child Development Centre, especially when it was used as a process and not as an end product. In addition to being constructive, games with rules were another type of play that was used as teaching method at Mogoditshane Child Development Centre. In this case children were required to follow established rules during games like Skipping and Hide and Seek and other traditional children’s games.

Suspension of disbelief set early childhood learners free from their real life worries, hence learners were free to engage with the drama. Boal’s (1982) “metaxis”, a state of belonging completely and simultaneously to two different autonomous worlds enabled learners’ engagement with the process drama. Sustaining two different worlds simultaneously enabled learners to role play and watch themselves at the same time. Drama in education’s simple role taking was used to give pre-school learners ownership of the class room processes and a set of attitudes towards any given topic that they were able to understand at a distance. Ownership meant the shift of power structures within the

~ 65 ~ classroom so that infants were able to question and negotiate for answers without the fear of violating the teacher’s authority. This ownership was stimulated by drama in education techniques that worked towards engaging early childhood learners at an emotional level.

This research found that at Mogoditshane Child Development Centre, music, dance and teacher-in- role are the overarching drama in education techniques used for early childhood learners to be able to negotiate and make sense of what they learn in class. During one of the teacher-in-role workshops at Mogoditshane Child Development Centre, the teacher managed a class from within a drama by taking a role to deepen and extend students’ inquiry and learning. Using the above process drama techniques, the teacher managed to control what was happening in a crowd scene by finding a way that would make the drama tenser and exciting. Put simply, the teacher / facilitator assumed a role in the dramatic world and related to the pre-school pupils as that role in the drama rather than a teacher. The effectiveness of teacher-in-role during that workshop depended in the skill of the teacher and her ability to solicit participation from a class of pre-school learners. The teacher’s usual position of an authority with all the answers was subverted by becoming a fellow explorer involved in solving challenges posed in the fictional dramatic world created by the group. Rooth (1995) warns us that, facilitation / teaching is not merely a technique for running class room lessons, but a belief that knowledge is gained through participation in the class room rather than assuming that the teacher knows everything, while students know nothing. Moreover, the study showed that the more educators at Mogoditshane Child Development Centre included music, playing of instruments, storytelling and singing with other elements of drama, the more children became happier in class. It was evident that these activities gave young children an opportunity to socialise, to be creative and to release extra energy. At Mogoditshane Child Development Centre, the release of extra energy was shown when children who refused to have a sleeping rest after lunch ended up falling asleep after taking part in music or drama or dance. The paper concludes that the ability of the teacher to notice the mood and energy of the group and decide on the appropriate tasks calls for high levels of attention and flexibility during a drama in education lesson. As a result, this research noted that edutainment is essential in early childhood education, particularly in Botswana.

LIMITATIONS OF THE STUDY The pedagogy of process drama tends to assume that a change in understanding should happen within the learning context. This might not have happened with the 2016 group of early childhood learners at Mogoditshane Child Development Centre. This is because there is no applied drama and theatre framework for monitoring and evaluations as yet, like those in the social and physical sciences to gauge the effectiveness of drama in education as a teaching tool in early childhood education. The arts industry is ill-equipped when it comes to monitoring and evaluation. There were no indicators to point at tangible outcomes after the project, when the objective is dealing with the social transformation of a given group of pre-school learners. Knowledge acquiring is a complex process. There is a possibility that, perhaps early childhood learners at Mogoditshane Child Development Centre may have enjoyed a good time during the “edutainment” process rather than a serious and committed engagement with the learning of topics that were covered during the course of this research.

~ 66 ~ Moreover, generalising results from a case study of one private English Medium early childhood school might be misleading. The fact that this research was carried out with learners from one private English Medium early childhood centre does not mean that its findings may be generalised to the broader early childhood education system in Botswana. Early childhood education teaching methods in English Medium pre-schools in Gaborone, for example, may be different from those in Francistown and Setswana Medium pre-schools in Botswana. The qualitative drama in education analysis of the focus group has the potential weakness that misinterpretation (bias) may occur. Moreover, another limitation was that the study did not allow time for impact assessment and project follow-up workshops. There was also limited time within which this research had to be carried out with some workshop meeting times being re-scheduled owing to clashes of commitment with the school authorities. The research workshops which were of fundamental importance to this study were carried out in two months with 45 minutes per lesson / workshop. Since knowledge acquisition is a process and not an event, the classroom interaction needed ample time so that new insights could take effect among early childhood learners. However, even if there is need to take cognisance of the limitations of this study, such limitations were acceptable especially in terms of the overall aim of the research.

RECOMMENDATIONS FOR POLICY MAKING The major findings of this research have implications for the role of drama in education, not only as a teaching tool in the early childhood education classroom set up, but on a broader perspective about education in general, even outside the walls of the classroom in Botswana. The findings call for a shift in policy by early childhood education stakeholders and the education authorities in Botswana towards regulating the use of process drama as a teaching and learning tool in the formal education sector.

This study concludes that it is necessary to implement early childhood development teaching methodologies in Botswana that involve activities based on all the five senses of a child. Such teaching methods must be determined by the child’s level of conceptual understanding in class. This means that in preschool education, teaching methods and the choice of appropriate content can positively or negatively influence the quality of early childhood development education. This research recommends early childhood schools and education authorities in Botswana to explicitly consider drama as an effective early childhood teaching methodology in the 21st century. This study concludes with a strong plea for the inclusion of accredited drama and theatre pedagogical courses in early childhood teachers’ training colleges and universities that offer early childhood education programmes.

REFERENCES Ahirirwe, J. R. (2012). Using role play to build tolerance among adolescents with regard to homosexuality. A case study of Supreme Educational College, South Africa (Master’s dissertation, University of the Witwatersrand, Johannesburg, South Africa). Ailwood, J. (2003). Governing early childhood education through lay. Contemporary Issues in Early Childhood, 4(3), 286-299. Berk, L. E. (2009). Child development. New Delhi, India: Prentice Hall. Boal, A. (1982). Theatre of the oppressed. (2nd ed.). New York, NY: Routledge Press.

~ 67 ~ Bogin, B. (1998). Patterns of human growth. (2nd ed.). London, UK: Cambridge University Press. Bolton, G. (1998). Acting in classroom drama: A critical analysis. Calender Islands Publishers. Bowell, P. and Heap, B. S. (2001). Planning process drama. London, UK: David Fulton Publishers. Chikutuma, T. (2013). The quality of early childhood development programmes in Harare primary schools in Zimbabwe (PhD Thesis, University of South Africa, Pretoria, South Africa). Cameron, D. (2003). Real players? Drama, technology and education. Town, UK: Trentham Books. Chinyowa, K. C. (2012). Role play in process drama. [Lecture Notes]. University of the Witwatersrand. Excell, L., & Linington, H. (2011). Taking debate into action: Does the current Grade R practice in South Africa meet quality requirements? South Africa Educational Journal, 8(2), 3-12. Freire, P. (1972). Pedagogy of the oppressed. New York, NY: Routledge Press. Heathcote, D., & Bolton, G. (1995). Drama for learning: Dorothy Heathcote’s Mantle of the expert approach to education. Portsmouth, NH: Heinemann. Johansson, E., & Pramling-Samuelsson, J. (2006). Play and learning: Inseparable dimensions in preschool practice. Early Childhood Development and Care, 176(1), 47-65. Kramer, S. (2014). Early childhood education: Difficulties creating and changing daily practice. Creative Education, 5, 386-395. Retrieved from http://doi: 10.4236/ce.2014.56048. Maundeni, T. (2013). Early childhood care and education in Botswana: A necessity that is accessible to few children. Creative Education, 4(7A), 54-59. Retrieved from http://doi:10.4236/ ce.2013.47A 1008. Miranda, M. L. (2004). The implications of developmentally appropriate practice for kindergarten general music classroom. Journal Research in Music Education, 52(1), 43-63. O’Neill, C. (1995). Drama worlds: A framework for process drama. Portsmouths, NH: Heinemann. O’Toole, J., & Lepp, M. (2000). (Eds). Drama for life: Stories of adult learning and empowerment. Brisbane, Australia: Play lab Press. O’Toole, J. (2012). Process drama. [Visiting Notes]. University of the Witwatersrand. O’Toole, J., & Stinson, M. (2009). Drama and curriculum: A giant at the door. Brisbane, Australia: Spinger. O’Toole, J. (1992). Process drama: Negotiating art and meaning. London, UK: Routledge. Rooth, E. (1995). Life skills: A resource book for facilitators. Braamfontein, South Africa: Nolwazi Educational Publishers. Rotumi, J., & Too, J. K. (2012). Factors influencing the choice of approaches used by preschool teachers in Baringo country, Kenya. International Journal of Academic Research in Progressive Education and Development, 1(2), 1-15. Thomas, C. M., & Thomas, A. M. (2009). Current issues in comparative education: Early education in Zambia: An integrated part of educational provision. Early Childhood Education and Care - Worldwide Challenges and Progresses, 11, 6-14. Zembat, R., & Zulfikar, S. T. (2006).An investigation of conversation and storytelling activities used by preschool teachers. Educational Sciences: Theory and Practice, 6(2) 602-608. Zimbabwe Ministry of Education, Sport and Culture. (1999). Early childhood education and care (ECEC) teacher training manual. Harare, Zimbabwe: Zimbabwe Ministry of Education, Sport and Culture.

~ 68 ~ MUSHROOM POLYSACCHARIDES FROM KALAHARITUBER PFEILII AND TERMITOMYCES SCHIMPERI REVEAL ANTIOXIDANT AND PREBIOTIC FUNCTIONS

A. N. Amadhila1, N. P. Kadhila2, and A. Cheikhyoussef3* 1Department of Biological Sciences, Faculty of Science, University of Namibia, 2Zero Emission Research Initiative, Multidisciplinary Research Centre, University of Namibia, P/ Bag 13301, Windhoek, Namibia, 3Science and Technology Division, Multi-disciplinary Research Centre, University of Namibia

Email address: [email protected]

ABSTRACT Kalaharituber pfeilii and Termitomyces schimperi are delicious edible mushrooms that have been consumed as food owing to their nutritional value. We hypothesised that these mushrooms’ polysaccharides (PS) could contribute to health benefits, in part, by modulating gut microbiota and we also explored their antioxidant activities for use as natural antioxidants. Functional foods and novel prebiotic influencing beneficial bacteria are necessary for the maintenance and restoration of healthy gut flora and preventing gastrointestinal related diseases such a bowel syndrome and colorectal cancer. This study aimed to investigate the potential of polysaccharides from 2 Namibian wild-growing mushrooms to stimulate the growth of Lactobacillus plantarum ATCC 8014, Lactobacillus acidophilus ATCC 4356 and to determine their antioxidant activities against 2,2-diphenyl-1-picrylhydrazyl radicals (DPPH·) and Fe3+ reducing power assays [4]. Determination of growth promoting activity of polysaccharides was performed in U-shaped 96-well plates in an ELISA reader in relation to the reference strain of L. plantarum ATCC 8014, and L. acidophilus ATCC 4356. Both T. schimperi and K. pfeilii’s alkali and water PS showed good scavenging activities against DPPH· radical in a dose-dependent manner at all concentrations. The scavenging ratio of K. pfeilii alkali extracts (KPA) and K. pfeilii water extracts (KPW) were 48.1%, and 41.5% respectively. Whereas, of T. schimperi alkali extracts (TSA) and T. schimperi water extracts (TSW) were 52.1% and 56.3%, respectively. The polysaccharides extracts from TSW and KPA also showed significant reducing ability. Furthermore, TSA, KPW and TSW showed their ability to act as carbohydrate sources for the studied bacteria by lowering medium pH up to 4.14 in L. acidophilus and increasing biomass concentration. The results presented in this study strongly suggest that polysaccharides from K. pfeilii and T. schimperi display significant antioxidant and prebiotic activities and hence hold great potential as nutraceutical and functional agents.

Keywords: Lactobacillus plantarum, Lactobacillus acidophilus, Antioxidants, Mushrooms, Polysaccharides, Prebiotics

INTRODUCTION Nowadays, consumers have become increasingly aware of the necessity to maintain their health through nutrition, and of the role of the gut flora in health and disease. Changes in the composition of gut flora are often associated with disease and may in some cases be the cause of disease. In particular, there is an

~ 69 ~ increase in the incidence of illnesses that may be caused by deficient or compromised microflora such as gastrointestinal tract (GIT) infections, irritable bowel syndrome, inflammatory bowel disease, and certain cancers (e.g. colorectal cancer). Furthermore, oxidative stress caused by an imbalanced metabolism and an excess of reactive oxygen species (ROS) culminates into a range of disorders (Seifried et al., 2017), i.e. metabolic disease, heart disease, severe neural disorders such as Alzheimer’s and Parkinson’s (Barnham et al., 2004), premature aging (Finkel & Holbrook, 2000; Sadowska-Bartosz & Bartosz, 2014) and some cancers (Gorrini et al., 2013). According to Su et al. (2013), edible mushrooms have become an attractive option for functional foods or as a source for the development of pharmaceuticals and nutraceuticals. Mushroom polysaccharides are not only important as prebiotics but they have immense other biological properties such as antitumor, hepatoprotective, antimicrobial, antioxidant, immunomodulatory, antinociceptive, antiviral and hypoglycemic effects (Wasser, 2002; Singdevsachan et al., 2016; Su et al., 2013). The taste, attractiveness, high protein content, and medicinal value of K. pfeilii and T. schimperi make it very popular and highly consumed especially among the native people of Namibia. Despite their popularity, systematic studies on the extraction and purification of polysaccharides as well as the evaluation of their prebiotic and antioxidative activities are generally lacking. We theorise that K. pfeilii and T. schimperi may offer great potential for the use as functional ingredients enabling intestinal microbiota modulation and potentially benefiting colonic health. The main aims of this study were to first examine the antioxidant activities, and second, to employ strains of probiotic bacteria to measure the prebiotic activities of K. pfeilii and T. schimperi polysaccharides.

METHODOLOGY

SAMPLES OF MUSHROOM FRUIT BODIES The fruiting body of Termitomyces schimperi was bought from market vendors near Wilhelmstal farm in the Erongo region, Namibia. The fruiting body of Kalaharituber pfeilii was bought from hawker women in Okashana village near Omuthiya in Oshikoto region, Namibia.

SAMPLE PREPARATION, POLYSACCHARIDES EXTRACTION AND PURIFICATION Following sample collection, separately, each of the mushroom species was brush-cleaned, thrice washed with distilled water, cut into smaller slices and sun-dried until constant mass was attained. The mushroom samples were homogenised into fine powder using a sterilised mortar and pestle. In order to remove lipids, lipoprotein, phenols, and smaller molecules, the homogenates were washed thrice with 80% (w/w) ethanol, followed by three times washing with distilled water then extracted with boiling water for 4 h. The polysaccharides were separated from the residue by precipitation with 95% cold ethanol. Sevag reagent (chloroform/butanol 4:1, v/v) was applied to deproteinize, the procedure used is as depicted by Shi et al. (2013). The deproteinised supernatants were further dialysed to remove lower molecular weight compounds such as oligosaccharides and protein of lower molecular weight (dialysis tubing, high retention seamless cellulose tubing, MWCO 12400. Sigma Co. St. Louis, MO, USA) and finally concentrated by lyophilisation (Alpha 2-4 LSCplus. Martin Christ, Germany) to yield water-soluble fractions. The insoluble parts were extracted with 1 M solution of sodium hydroxide containing 0.05% of sodium borohydride. After filtration the supernatants were adjusted in the same way as the water extracts supernatants to yield alkali-soluble polysaccharides.

~ 70 ~ IN VITRO ANTIOXIDANT ACTIVITY ASSAYS DPPH· FREE RADICAL SCAVENGING ACTIVITY The scavenging of DPPH· radical was carried out according to Wang et al. (2013). Briefly, 2 mL polysaccharides aqueous solution (50-800 μg/mL) and 2 mL DPPH· solution (0.2 mmol/L, in anhydrous ethanol solution) were mixed and shaken vigorously. The mixture was incubated in the dark for 30 min. A UV-Vis spectrophotometer was used to measure the absorbance at 517 nm with water added to 2 mL anhydrous ethanol solution of DPPH· as the blank and L-ascorbic acid as a positive control. The DPPH· radical scavenging effect was calculated according to the following equation: Scavenging effect of DPPH· radical % = 1 × 100

REDUCING POWER ASSAY The reducing power of the polysaccharides extracts was measured according to Yen and Chen (1995) with slight modifications (Shi, 2016). Briefly, an aliquot of each sample (1 mL), with different concentrations was mixed with 1 mL of phosphate buffer (200 mM, pH 6.6) followed by 1 mL of 1% potassium ferricyanide [K3Fe(CN)6]. The mixture was incubated for 20 min in a water bath at 50°C. After this incubation, 1 mL of 1% trichloroacetic acid (TCA) was added, followed by centrifugation at 6000 g for 10 min. The supernatant (2 mL) was mixed with 2 mL of distilled water and 0.4 mL of 0.1% ferric chloride (FeCl3), then the absorbance was measured at 700 nm against a blank in the spectrophotometer. A higher spectrophotometric absorbance meant a higher reducing power activity.

MEASURING PREBIOTIC ACTIVITY IN VITRO The samples were treated according to Synytsya et al. (2009), with slight adjustments. The strains selected for tests were Lactobacillus plantarum ATCC 8014, Lactobacillus acidophilus ATCC 4356 and Enterobacter aerogenes (Microbiologics Inc.). Cultivation tests were performed at 37°C in the medium based on MRS (Oxoid) commonly used for lactic acid bacteria cultivation. The medium comprised of (g/L) peptone 10.0; meat extract 8.0; yeast extract 4.0; dipotassium hydrogen phosphate 2.0; sodium acetate trihydrate 5.0; triammonium citrate 2.0; magnesium sulfate heptahydrate 0.2; manganous sulfate tetrahydrate 0.05 (de Man, et al., 1960).The determination of the growth of test strains in the presence of crude mushroom polysaccharides was performed in U-shaped 96 well- plates. MRS broth media (200 μL) without glucose was supplemented with 1.5% polysaccharide inoculated with 20 μL of L. plantarum ATCC 8014, L. acidophilus ATCC 4356 and E. aerogenes. The plates were incubated for 72 h. The absorbance was measured after 0, 17, 24, 48 and 72 h of incubation using a reader at a wavelength of 550 nm. The pH value of all samples was measured using a pH meter (Schott AG, Mainz, Germany) in the beginning (0 h) and end (72 h) of the experiment. Two controls were used: a negative control containing MRS broth without glucose supplemented by polysaccharide, and a positive control containing MRS broth with glucose and the Lactobacillus strain. The absorbance readings for each sample were compared to that of the negative control (Nowak et al., 2017).

~ 71 ~ RESULTS AND DISCUSSION DPPH· FREE RADICAL SCAVENGING ACTIVITY The DPPH· radical scavenging activity results are shown in the figures below (Figure 1 and Figure 2). It has been found that all polysaccharide extracts have significant amounts of radical scavenging activity.

Figure 1: Antioxidant activities of TSA, TSW, and ascorbic acid (DPPH· radical scavenging activity)

Figure 2: Antioxidant activities of KPA, KPW, and ascorbic acid (DPPH· radical scavenging activity)

~ 72 ~ REDUCING POWER ASSAYS The reducing ability was measured by monitoring Fe3+→Fe2+ conversion by the mushroom polysaccharides. The formation of Fe2+ is determined from the absorbance values at 700 nm (Shi, 2016), at five different concentrations. A higher spectrophotometric absorbance meant a higher reducing power activity. It can be seen that T. schimperi water polysaccharides (TSW) exhibited good reducing power as demonstrated in Figure 3 below. Polysaccharides from alkali extracts of K. pfeilii (KPA) have also shown highly significant reducing ability. The reducing power of the polysaccharides from these mushrooms can be ranked as TSW ˃ KPA ˃ KPW ˃ TSA. The results of the Fe3+ reducing abilities of polysaccharides are presented in Figure 3 below.

Figure 3: Reducing power assay at 500 µg/mL of KPA, KPW, TSA, TSW EPS extracts and ascorbic acid

According to Beara et al. (2014), it is well established that bound polyphenolics contribute to the antioxidant activity of polysaccharides and their presence is highly beneficial. Therefore, the confirmation of these compounds in the examinedK. pfeilii and T. schimperi polysaccharide extracts could contribute to their numerous potential applications, apart from using them as food. The results of DPPH· scavenging experiments by spectrophotometric measurement indicated the possession of strong scavenging of DPPH· radicals by K. pfeilii and T. schimperi in a concentration-dependent manner. According to previous studies, glucans in the α-form have shown a strong correlation to the reducing power of polysaccharides from four well-known medicinal mushrooms including Ganoderma applanatum, G. lucidum, L. edodes, and T. versicolor (Kozarski et al., 2012). Our results suggested that polysaccharides extracts from T. schimperi and K. pfeilii possess antioxidant activity and could be explored as a potential antioxidant.

PREBIOTIC ASSAY The difference between the values of the analysed parameter (maximum biomass concentration) measured was compared for each specific bacteria strain (Figure 4). A positive value indicates the stimulating effect of extracts to related growth characteristics of the selected strain, whereas a

~ 73 ~ negative value portrays an inhibitory effect. From the results, it can be seen that TSA, KPW and TSW polysaccharides showed their ability to act as carbohydrate sources for these bacteria. These extracts support probiotic bacteria biomass growth and SCFA (short-chain fatty acids) production especially for Lactobacillus strains as indicated by decrease in pH value and increased optical density. Polysaccharide extracts from T. schimperi demonstrated the ability to act as better probiotics growth source than that from K. pfeilii. It should also be noted that alkali extracts exhibited better stimulating effects than water extracts for both K. pfeilii and T. schimperi.

Figure 4: The plot of difference between the values of maximum biomass concentration of different strains A) L. plantarum ATCC 8014, B) L. acidophilus ATCC 4356, and C) E. aerogenes measured as optical density (OD550) for the medium supplemented with different mushroom polysaccharides extracts at different times of incubation 0, 17, 24, 48 and 72 h.

~ 74 ~ Figure 5: Determination of pH after 0, 17, 24, 48 and 72 h of incubation of bacterial strains, L. acidophilus ATCC 4356 with different mushrooms polysaccharide extracts (TSA- T. schimperi alkali extracts; TSW- T. schimperi water extracts; KPA - K. pfeilii alkali extracts, and KPW- K. pfeilii water extracts).

Up till now, non-digestible carbohydrates isolated from mushrooms are universally acknowledged as prebiotics (Delgado-Fernandez et al., 2019). The end-products of prebiotics fermentation by probiotics, such as acetic, propionic and butyric acids, have been demonstrated to play important roles in immune-modulation, lipid metabolism regulation and integrity improvement of colon epithelial barrier, except serving as energy sources (Rastall & Gibson, 2015). This is the first such determination for these mushroom species. Data revealed that other mushrooms were able to promote the growth and viability of probiotic bacteria. Different extracts of Pleurotus ostreatus and Pleurotus eryngii were also studied, and their prebiotic potential was revealed by Synytsya et al. (2009). Pholiota nameko extracts were found to increase the growth of L. acidophilus (Rodrigues et al., 2017). Furthermore, the polysaccharide fraction from G. lucidum revealed the potential for the stimulation of the growth of both Lactobacillus sp., and Bifidobacterium sp. (Yamin et al., 2012).

CONCLUSION Our results suggest that T. schimperi mushroom polysaccharides are a very good source of naturally- derived antioxidants and they are a potential functional food ingredient. The scavenging ratio of KPA and KPW was 69.1% and 51.5%, whereas, the scavenging ratio of TSA and TSW were 72.1% and 57.3%, respectively. This work highlighted that these underutilised mushrooms have great scavenging activities in a concentration-dependent, mainly when dealing with lower polysaccharides concentrations. The antioxidative capacity demonstrated can be one of the major ways in which these polysaccharides can help maintain the oxidative equilibrium in the human body. The polysaccharides displayed good prebiotic activities, thus, are potential candidates as functional ingredients to improve human health and functional applications through regulating gut flora.

~ 75 ~ REFERENCES Ambalam, P., Raman, M., Purama, R. K., & Doble, M. (2016). Probiotics, prebiotics and colorectal cancer. Best Practice & Research Clinical Gastroenterology, 30, 119-131. Barnham, K. J., Masters, C. L. & Bush, A. I., 2004. Neurodegenerative diseases and oxidative stress. Nature Reviews Drug Discovery, 3, 205-214. Beara, I. N., Lesjak, M. M., Cetojević-Simin, D. D., Marjanović, Z. S., Ristić, J. D., Mrkonjić, Z. O and Mimica-Dukić N. M. (2014). Phenolic profile, antioxidant, anti-inflammatory and cytotoxic activities of black (Tuber aestivum Vittad.) and white (Tuber magnatum Pico) truffles. Food Chemistry, 165, 460-466. Carocho, M., Morales, P., & Ferreira, I. C. (2018). Antioxidants: Reviewing the chemistry, food applications, legislation and role as preservatives. Trends in Food Science & Technology, 71, 107-120. de Man, J., Rogosa, M. & Sharpe, E. M. (1960). A medium for the cultivation of lactobacilli. Journal of Applied Microbiology, 23, 130-135. Delgado-Fernandez, P., Corzo, N., Olano, A., Hernández-Hernández, O., and JavierMoreno, F. (2019). Effect of selected prebiotics on the growth of lactic acid bacteria and physicochemical properties of yoghurts. International Dairy Journal, 89, 77-85. Finkel, T., & Holbrook, N. J. (2000). Oxidants, oxidative stress and the biology of ageing. Nature, 408, 239-247. Gibson, G., & Roberfroid, M. (2005). Dietary modulation of the human colonic microbiota: introducing the concept of prebiotics. Journal of Nutrition, 125, 1401- 1412. Gorrini, C., Harris, I. S., & Mak, T. W. (2013). Modulation of oxidative stress as an anticancer strategy. Nature Reviews Drug Discovery, 12, 931-947. Gorrini, C., Harris, I. S. & Mak, T. W. (2013). Modulation of oxidative stress as an anticancer strategy. Nature Reviews Drug Discovery, 12, 931-947. Kozarski, M., Klaus, A., Nikšić, M., Vrvić, M. M., Todorović, N., Jakovljević, D and Van Griensvend, L. J. L. D. (2012). Antioxidative activities and chemical characterization of polysaccharide extrats from the widely used mushrooms Ganoderma applanatum, Ganoderma lucidum, Lentinus edodes and Trametes versicolor. Journal of Food Composition and Analysis, 26, 144-153. Liu, Y., Zhou, Y., Liu, M., Wang, Q., & Li, Y. (2018). Extraction optimisation, characterisation, antioxidant and immunomodulatory activities of a novel polysaccharide from the wild mushroom Paxillus involutus. International Journal of Biological Macromolecules, 112, 326- 332. Nowak, R., Nowacka-Jechalke, N., Juda, M., & Malm, A. (2017). The preliminary study of prebiotic potential of Polish wild mushroom polysaccharides: the stimulation effect on Lactobacillus strains growth. European Journal of Nutrition, 57, 1511-1521. Rastall, R. A. & Gibson, G. R. (2015). Recent developments in prebiotics to selectively impact beneficial microbes and promote intestinal health.Current Opinion in Biotechnology, 32, 42- 46.

~ 76 ~ Rodrigues, D., Freitas, A.C., Sousa, S., Amorim, M., Vasconcelos, M.W., da Costa, J.P,, Silva, A. M., Rocha-Santos, T. A., Duarte, A. C and Gomes, A. M. (2017). Chemical and structural characterization of Pholiota nameko extracts with biological properties. Food Chemistry, 216:176-185. Seifried, R. M., Harrison, E. & Seifried, H. E. (2017). Chapter 16: Antioxidants in Health and Disease. In: A. Coulston, C. Boushey, M. Ferruzzi & L. Delahanty, (Eds), Nutrition in the prevention and treatment of disease, pp. 321-346. London, UK: Academic Press. Sadowska-Bartosz, I., & Bartosz, G. (2014). Effect of antioxidants supplementation on aging and longevity. BioMed Research International, 2014, 1-17. Su, C. A., Xu, X. Y., Liu, D. Y., Wu, M., Zeng, F. Q., Zeng, M. Y., Wei, W., Jiang, N and Luo, X. (2013). Isolation and characterisation of exopolysaccharide with immunomodulatory activity from fermentation broth of Morchella conica. DARU Journal of Pharmaceutical Sciences, 21(1):5. doi: 10.1186/2008-2231-21-5. Shi, M., Zhang, Z. & Yang, Y. (2013). Antioxidant and immunoregulatory activity of Ganoderma lucidum polysaccharide (GLP). Carbohydrate Polymers, 95, 200-206. Shi, L. (2016). Bioactivities, isolation and purification methods of polysaccharides from natural products: A review. International Journal of Biological Macromolecules, 92, 37-48. Singdevsachan, S. K., Auroshree, P., Mishra, J., Baliyarsingh, B., Tayunga, K and Thato, H. (2016). Mushroom polysaccharides as potential prebiotics with their antitumor and immunomodulating properties: A review. Bioactive Carbohydrates and Dietary Fibre, 7, 1-14. Synytsya, A., Míčková, K., Synytsya, A., Jablonský, I., Spěváček, J., Erban, V. , Kováříková, E and Čopíkováa, J. (2009). Glucans from fruiting bodies of cultivated mushrooms Pleurotus ostreatus and Pleurotus eryngii: Structure and potential prebiotic activity. Carbohydrate Polymers, 76, 548-556. Wang, J., Wang, Y., Liu, X., Yuan, Y and Yue, T. (2013). Free radical scavenging and immunomodulatory activities of Ganoderma lucidum polysaccharide derivatives. Carbohydrate Polymers, 91, 33- 38. Wasser, S. (2002). Medicinal mushrooms as a source of antitumor and immunomodulating polysaccharides. Applied Microbiology and Biotechnology, 60, 258 - 274. Yamin, S., Shuhaimi, M, Arbakariya, A., Fatimah, A.B., Khalilah, A.K., Anas, O. and Yazid, A.M. (2012). Effect of Ganoderma lucidum polysaccharides on the growth of Bifidobacterium spp. as assessed using Real-time PCR. International Food Research Journal, 19(3), 1199-1205. Yen, G.C., & Chen, HY. (1995). Antioxidant activity of various tea extracts in relation to their antimutagenicity. Journal of Agricultural and Food Chemistry, 43, 27-32. Zeng, D., & Zhu, S. (2018). Purification, characterisation, antioxidant and anticancer activities of novel polysaccharides extracted from Bachu mushroom. International Journal of Biological Macromolecules, 107, 1086-1092.

~ 77 ~ ETHNOBOTANICAL SURVEY AND IN VITRO EVALUATION OF ANTIMICROBIAL ACTIVITY OF SELECTED TRADITIONAL HERBS AND SPICES FROM KABBE CONSTITUENCIES IN ZAMBEZI REGION, NAMIBIA

A. Tomas1, A. Cheikhyoussef2*, and K. C. Chinsembu1 1Department of Biological Sciences, Faculty of Science, University of Namibia, Namibia 2Science and Technology Division, Multidisciplinary Research Centre, University of Namibia, Namibia

*Author for correspondence: [email protected]

ABSTRACT Research on indigenous knowledge as an alternative key to unlock the power of health benefits has gained much interest recently. However, there is a lack of documented information about the usage of indigenous plants as traditional herbs and spices, and their contributions towards health benefits. The aims of this study were to conduct an ethnobotanical survey of indigenous knowledge of plants traditionally used as herbs and spices in Kabbe constituencies of the Zambezi region, and to evaluate the antimicrobial activity of plant extracts against selected food-borne pathogens. Using semi-structured interviews and closed-end questionnaires, ethnobotanical data were collected from 32 informants in three villages of Kabbe North and Kabbe South constituencies between the 10th and 21st December 2018 respectively. Eight plants traditionally used as herbs and/or spices were recorded in Kabbe constituencies. Dichloromethane:methanol and aqueous extracts of plant extracts were tested against the laboratory strains of food-borne pathogens using disc diffusion assay and minimum inhibitory concentration (MIC). Organic extracts of Eucalyptus sp. had the lowest MIC value at 6.25 mg/ml against S. typhimurium and S. sonnei, meanwhile the roots extracts of Baphia massaiensis aqueous extracts showed the lowest MIC value between 6.25-12.5 mg/ml against S. aureus, S. typhimurium, P. aeruginosa, C. albicans, and S. cerevisiae. Our preliminary results demonstrated the antimicrobial activity in traditional culinary herbs and spices in addition to their indigenous uses. Extraction, isolation and characterisation of bioactive compounds of these plant may be required. Toxicity studies are needed to support the safe usage of these plants as food additives and natural preservatives for food safety applications.

Keywords: Ethnobotanical survey, food-borne pathogens, culinary herbs, indigenous knowledge, antimicrobial activity, spices, disc diffusion assay, Zambezi region

INTRODUCTION Herbs and spices have a long history of traditional usage for both culinary and medicinal purposes (Embuscado, 2018). In general, traditional culinary herbs and spices such as Sindambi (Hibiscus fuscus), Delele (Corchorus tridens), Lisoto (Nymphaea lotus), Mubuyu (Adansonia digitata), Muchaba (Ficus exasperata), and Mulinga (Moringa oleifera) are common and preferred by most communities

~ 78 ~ of the northern parts of Namibia (Chinsembu & Hedimbi, 2010). This is because they are easily accessible, affordable, have no side-effects, non-narcotic and sometimes they are the only source of culinary herbs and spices available (Maroyi, 2013). The Zambezi region of Namibia has a longstanding tradition, culture, and plant diversity exhibiting a wide range of physiological and pharmacological properties (Chinsembu, Negumbo, Likando, & Mbangu, 2014). Although both culinary herbs and spices are used in small amounts during food preparation and provide flavour, colour, and fragrance to food dishes or drinks, they may still be difficult to differentiate (Asowata-Ayodele, Afolayan, & Otunola, 2016). However, a study by Spencer (2017) provided a definite distinction between herbs and spices. This study discussed herbs as plant parts, mostly the green and fresh leaves, flowers, or stems of plants with flavour, delicious, tasty or aromatic properties in contrast to spices which are aromatic seed, fruit, root parts, bark, or even the stigma of a flower consumed to enhance sensory quality of foods such as flavour, colour, and aroma. A single plant species can be both used as a culinary herb and spice (Raghavan, 2006). Herbs and spices contain phytochemicals which play important roles in the preservation and seasoning of food and beverage, as well as in traditional medicines (Tassou, Chorianopoulos, Skandamis, & Nychas, 2012). These phytochemicals are examples of secondary metabolites and are non-nutritive chemicals (Aniszewski, 2007). According to Srinivasan (2016), phytochemicals in herbs and spices can be categorised into several groups, which are phenolics (also known as polyphenols), terpenoids and essential oils, alkaloids, as well as lectins and polypeptides. Studies have indicated that these phytochemicals play crucial roles in the organoleptic profiles and chemical compositions of herbs and spices (Tajkarimi, Ibrahim, & Cliver, 2010; Raghavan, 2006). Interestingly, several edible parts of plants such as fresh leaves, flowers, stems, tubes, dried seeds, fruits, roots, and barks are of particular interest for their modulatory effects on atherosclerosis, cancer, diabetes, obesity, inflammation, arthritis, immune deficiency, free radicals, microbes, ageing and mental health due to these non-nutritive chemicals (Srinivasan, 2016). Antimicrobial activities and modulatory effects of traditional culinary herbs and spices have become an important research area in the 21st century. This is due to increasing primary concern of food safety, occurrence of disease outbreaks and microbial resistance on antibiotics in most parts of the world (Witkowska, Hickey, Alonso-Gomez, & Wilkinson, 2013). Because of these, traditional herbs and spices have become a new hope to serve as natural preservatives to control food-borne pathogens (Gottardi, Bukvicki, Prasad, & Tyagi, 2016). These in turn can be used as substrates in the formulation of new antimicrobial agents, functional foods or nutraceuticals. Therefore, the purpose of this study was to document the indigenous knowledge on traditional culinary herbs and spices in the Zambezi region, and to evaluate their extracts in vitro for antimicrobial activity against selected food-borne pathogens.

METHODOLOGY STUDY AREAS The Kabbe constituency (Figure 1), with a population of 14 979 people in 2010, was split into Kabbe North and Kabbe South in August 2013 (Namibia 2011 Population and Housing Census Atlas, 2013; Kabbe Constituency, 2018). The Kabbe North is located in the north-western part of Kabbe constituency, while the Kabbe South is in the eastern part. The Bukalo, Mukungu, and Saili villages in Kabbe North constituency and Kandiyana, Kabula, and Sinchembe villages in Kabbe South

~ 79 ~ constituency were used as study areas for the ethnobotanical data and plant collection. Most of these villages are situated in the flood area of the Zambezi River, and they are rich in animals and plants diversity. The people in these villages have strong dependency on traditional spices and medicinal plants (Chinsembu, Negumbo, Likando, & Mbangu, 2014).

Figure 1: The map of Namibia showing the location of the study areas in Zambezi Region.

ETHNOBOTANICAL DATA COLLECTION A method similar to that by Chinsembu, Negumbo, Likando, and Mbangu (2014), with few modifications, was used in this study. In brief, the ethnobotanical survey was conducted inthe aforementioned villages of Kabbe North and Kabbe South constituencies in December 2018 with a total of 32 informants. Simple random sampling was used to select the participants without following a specific order, with community members in these villages as the main informants. Face-to-face interview method and closed-ended questionnaires were used to collect the ethnobotanical data. Furthermore, all interviews were conducted in local languages, with the Silozi-English translator during the conversations between the participants and the research team.

After explaining the objectives of the research study and seeking consent, the informants were individually engaged in semi-structured interviews. The questionnaire intended to obtain information on the common names, uses, and preparation methods of traditional herb and spice remedies that are found and used in the Kabbe constituencies. Additionally, vernacular names of the plant species, parts, and dosage use were also recorded.

To compare the relative importance of each plant species, frequency index was calculated. According to Mahwasane, Middleton and Boaduo (2013), frequency index is defined as a numerical expression

~ 80 ~ of the percentage frequency of citation for a single plant species by informants. The following formula was used to calculate frequency index (FI) (Mahwasane, Middleton, & Boaduo, 2013):

FI = FC/N × 100

Where FC is the number of informants who mentioned the use of the plant species, and N is the total number of informants (32 informants) in Kabbe North and Kabbe South constituencies. The frequency index was high when a particular plant was mentioned by many informants and low when there were few reports.

PLANT COLLECTION AND IDENTIFICATION Parts of plants species used as herbs and/or spices mentioned by at least three (3) independent participants were collected, and photographs of putative herbs and spices were also taken in the field. Upon collection, the plant specimens were given voucher numbers and transported in plant presses to the University of Namibia (UNAM), before taken to the Namibian Botanical Research Institute (NBRI) for taxonomic identification.

PREPARATION OF CRUDE EXTRACTS In the Department of Biological Sciences laboratories at UNAM, the collected plant parts were rinsed in running tap water to remove unwanted particles, shade-dried at room temperature, milled to fine powder in a clean grinder, wrapped in aluminium foil, and stored in closed containers until extraction. Preparation of dichloromethane and methanol (DCM:MeOH) extracts were conducted according to the method described by Mostafa et al. (2018) with modifications. In summary, about 10 g fine powder of each plant part collected was macerated in a 250 ml of 1:1 ratio of DCM:MeOH followed by continuous shaking with an orbital shaker at a speed of 100 rpm in the dark for 36 hours at room temperature.

After 36 hours, the macerates of each plant were filtered in separate flasks using a qualitative filter paper (Whatman No 4 filter paper, Whatman, England). To ensure exhaustive extraction, the marc (residue) of each plant was re-soaked in fresh DCM:MeOH, as mentioned before, for about 36 hours. The residue after the second filtration process were discarded, and the filtrates of all portions were pooled for the respective plants before concentrated with a Rotary evaporator under reduced pressure at 40 °C. Percentage yields of the plant extracts were calculated. The resulting concentrated extracts of each plant material were transferred to 1.5 mL Eppendorf tubes, labelled with respective plant voucher numbers, and refrigerated at 4 °C until testing for antimicrobial activity.

Preparation of water extracts was done using the same procedure except that double distilled water

(dd-H2O) was used instead DCM:MeOH. In addition, the filtrates were concentrated with a Rotary evaporator under reduced pressure at 90 °C instead of 40 °C.

~ 81 ~ CULTURING OF TEST MICROORGANISMS Laboratory strains of food-borne fungi Candida albicans; food-borne Gram-positive bacteria Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes, Clostridium perfringens, and Enterococcus faecalis; food-borne Gram-negative bacteria Escherichia coli, Salmonella typhimurium, Shigella sonnei, Pseudomonas aeruginosa, Proteus vulgaris, and one yeast strain of Saccharomyces cerevisiae were obtained from the Department of Biological Sciences, University of Namibia.

Bacterial cultures were isolated, grown in Tryptic Soy Broth (TSB) medium and maintained following standard microbiological techniques described by Kong, Wang, and Xiong (2007) with modifications. In short, stock cultures were sub-cultured twice on Tryptone Soya Agar (TSA), followed by overnight incubation at 37 °C. Pure cultures of food-borne bacteria and food-borne fungi were prepared from subcultures and grown overnight in TSB and Nutrient Broth media. Enumeration of indicator strains using plate count method (Viable count) was performed from subcultures grown overnight on Plate Count Agar (PCA) and TSA at 37 °C. The working cultures were prepared from subcultures with population between 6 to 8 x 108 CFU/ml after 18 to 24 hours of incubation and grown overnight in TSB medium under optimal conditions for each microorganism.

DISC DIFFUSION ASSAY Prior to antimicrobial screening, McFarland standard corresponding to 0.5 was prepared as discussed by Donay, Fernandes, Lagrange, and Herrmann (2007). The disc diffusion method used to test the antimicrobial activities of the herb and spice extracts was of Tadeg, Mohammed, Asres and Gebre- Mariam (2005) with some modifications. For susceptibility testing, 200 mg/ml of each crude extract concentration was prepared in dimethyl sulfoxide (DMSO). Sterile antibiotic assay discs (Whatman, 6 mm) were impregnated with 100 μl of the reconstituted extract and dried at 37 °C overnight in an incubator. Each disc was gently pressed onto Muller-Hinton agar already inoculated with test microorganisms and indicator strains, adjusted to 0.5 McFarland standard equivalents of 107 CFU/ ml, to ensure complete contact with the medium. The standard antibiotic disc of ampicillin (20 μg per disc) was used as positive control and DMSO as a negative control. The plates were then incubated at 37 °C for 18-24 hours. Inhibition zones were measured after incubation using a ruler to the nearest millimetre and recorded as the diameter of growth-free zones. The agar disc diffusion test was done in triplicates and repeated twice.

BROTH DILUTION ASSAY

The Minimum Inhibitory Concentration (MIC) and 50% Growth Reduction (IC50) values were determined for all plant extracts, using a modified macro dilution broth method by Weerakkody, Caffin, Turner and Dykes (2010). Briefly, serial dilutions ranging from 100 to 1.25 mg/ml of plant extracts were prepared in solvents. Distilled water was used as a solvent for water extracts, whereas 70% methanol was used for DCM:MeOH extracts. About 200 mg of concentrated plant extracts was weighed in test tubes and 2 ml of the solvents was added to make the concentration of 100 mg/ml. After 100 mg/ml was prepared, 1ml of this concentration was transferred to another tube containing 1ml of the solvent, to make 50 mg/ml. The same procedure was performed to make 25 mg/ml, 12.5

~ 82 ~ mg/ml, and 6.25 mg/ml, respectively. A similar method was used to prepare a concentration of 5 mg/ ml, 2.5 mg/ml, and 1.25 mg/ml, but 10 mg of plant extracts was used as an initial weight instead of 200 mg for plant extracts with inhibitory concentration below 6.25 mg/ml.

About 1 ml of overnight test microorganisms and indicator strains adjusted to 0.5 McFarland standard equivalents of 107 CFU/ml in TSB medium was added to test tubes containing prepared plant extracts concentrations and incubated for overnight at 37°C. After 18-24 hours of incubation, 100 μl of culture/extract was spread on TSA plates and incubated for another 24 hours at 37°C. The ampicillin was used as positive control and 70% methanol as a negative control. The presence of test bacteria colonies were examined after the incubation period. The MIC and IC50 were defined as the lowest concentration of the extract which completely inhibited the growth of a particular microorganism, and the concentration which inhibited 50% of growth, respectively. The experiments were replicated three times on different occasions with duplicate samples analysed per replicate.

DATA ANALYSIS The FI was calculated for each herb and/or spice species collected. Data was analysed using Microsoft Excel 2013 (Microsoft Corporation, Redmond, WA, USA).

RESULTS AND DISCUSSION

ETHNOBOTANICAL SURVEY OF TRADITIONAL HERBS AND SPICES Thirty-two (32) informants in Kabbe North and Kabbe South constituencies (Figure 1) between the ages of 23-89 participated in the study. Although, most of the informants (11) were in the <30- 39 years age group, but figures gradually decreased onwards (Figure 2). This is in agreement with several studies which also indicated that indigenous knowledge among the youths is declining due to ignorance and disbelieve in learning traditions and indigenous knowledge from elders (Negi, Maikhuri, Phondani, & Rawat, 2010; Wilder, O’Meara, Monti, & Nabhan, 2016). On the other hand, male informants (11 out of 32) were fewer than females (Figure 2). This could be because women, in general, are traditionally known to take care most of the cooking and culinary activities in families. Therefore, rural women have particular roles in traditional health care delivery (such as cooking and cultivating gardens) in comparison with men in most families (Asowata- Ayodele, Afolayan, & Otunola, 2016). As a result, age and gender have significant influence on types of informants with respect to indigenous knowledge of plants used as traditional herbs and spices in Kabbe constituencies.

~ 83 ~ Figure 2: Overall number of informants by age and gender participated in the ethnobotanical survey in Kabbe constituencies, Zambezi Region

This study documented 8 spice and herbal plants species belonging to 7 plant families used traditionally in food as leafy vegetables, seasoning, preservation, and traditional medicines (Table 1). The plant families indicated eight diversity of plants used as culinary herbs and spices in the study area and could be attributed to the rich diversity of plants in Zambezi region (Timberlake, 2000). Moreover, leaves were the most commonly used plant part after barks and roots (Figure 3). In agreement with this, a similar study by Chinsembu, Negumbo, Likando, and Mbangu (2014) discovered that harvesting of leaves, unlike bark and roots, is not labour-intensive and may not permanently damage the plants; therefore most people prefer leaves compared to other plants parts.

Figure 3: Overall percentage of herbal and spice plants part used in Kabbe constituencies, Zambezi Region

Two of eight plant species were found to have the highest frequency index above 50. These were Hibiscus fuscus (59.375) and Amaranthus thunbergii (71.875) (Table 1). Therefore, these two plant

~ 84 ~ species were very common and relatively important as herbs and spices in Kabbe constituencies. This was explained by Asowata-Ayodele, Afolayan, and Otunola (2016) who noted that the use-value and informant frequency index were used to determine the relative importance of the herbs and spices, their culinary and medicinal uses, as well as the homogeneity of the informants’ knowledge.

Moreover, seasoning and preservation purposes were the most common plant uses after medicinal uses (Figure 4). This mean that most families in Kabbe constituencies use these plants to prevent their food from spoiling in comparison with treating and managing illnesses such as diarrhoea, malaria, low blood pressure, TB symptoms, stomach-ache, joint pain, connective tissues, swelling, mouth and throat sores, kidney infections, expel parasitic worms and other internal parasites. Furthermore, the highest number of plants (2) traditional used as spices and herbs documented belong to the family Moraceae which includes Ficus exasperate and Morus sp. followed by the other plants families which were represented by a plant species each (Figure 5).

Figure 4: Overall of percentage of frequency plants use in Kabbe constituencies of Zambezi region

Figure 5: Overall distribution of collected plant species across different plant families

~ 85 ~ Mode of preparation Infusion Decoction or Infusion Infusion Decoction Decoction or Infusion Decoction or Infusion Decoction Infusion Culinary/Therapeutic uses Seasoning and preservative. Boiled as herbal tea. as herbal Boiled Seasoning and preservative. Can be used as relish. Leafy vegetable. Help to expel parasitic worms and worms parasitic expel to Help vegetable. Leafy production increased Help parasites. internal other TB and infections kidney of urine. Used to treat sores. Used as relish. Leafy vegetable. Fresh/dry used as relish. Treat Treat Fresh/dry used as relish. vegetable. Leafy sores. Boost low blood and throat mouth diarrhoea, pressure. Seasoning and preservative. Fresh fruits used to Seasoning and preservative. tea. Roots used as herbal and salad. juice make stomach-ache and malaria. Treat Seasoning and preservative. Leaves used as herbal preservative. Seasoning and boost low blood pressure and help to Leaves tea. diarrhea treat TB. Barks improve appetite, treat and malaria. Seasoning and preservative. Barks and roots are Seasoning and preservative. system. and general immune to boost appetite help and Leaves and roots used to treat diarrhoea malaria. Seasoning and preservative. Roots used as herbal preservative. and Seasoning Roots are used as toothbrush. tea/coffee. Seasoning and preservative. Barks are added to added Barks are preservative. and Seasoning Barks and as food supplement. food when cooking treat used to are used as toothbrush. Leaves leaves symptoms of coughs, colds, and congestion. index Frequency Frequency 21.875 71.875 59.375 15.625 37.500 25.000 6.250 9.375 Plant parts used Leaves Leaves Leaves Fruits (T016a), Roots (T016b) Leaves (T014a), Bark (T014b) Leaves (T013a), Bark (T013b), Roots (T013c) Roots Leaves (T005a), Bark (T005b) plant Local name of Murobeni Libowa, Ihato, Untuhu, Tepe, Sitepe, Shombo Sindambi Malolo Mukwiyu, Muchaba Mubuyu Muvunje Kapulanga number Voucher Voucher T021 T020 T019 T016 T014 T013 T008 T005 Pers. L.

sp. (Myrtaceae) Scientific name (Family) Morus sp. (Moraceae) Amaranthus thunbergii Amaranthus thunbergii Moq. (Amaranthaceae) Hibiscus fuscus Garcke (Malvaceae) Annona senegalensis (Annonaceae) Ficus exasperata (Moraceae) Adansonia digitata (Bombaeae) Eucalyptus Taub Baphia massaiensis Taub (Fabaceae) Table 1: Plant species traditionally used herbs and spices purposes in Kabbe constituencies, Zambezi Region. Table

~ 86 ~ ANTIMICROBIAL SCREENING TEST OF SELECTED PLANTS TRADITIONALLY USED AS HERBS AND SPICES The disc diffusion method was performed on seven of the eight collected plant species. The DCM:MeOH barks and roots extracts of the A. digitata at 200 mg/ml showed strong activity against C. albicans with 24.0±3.559 and 23.0±6.976 mm respectively (Figure 6). In agreement with this study, a similar study by Masola, Mosha, and Wambura (2009) reported that the root and bark of A. digitata ethanolic extracts show high zones of inhibition against the growth of various Gram-positive bacteria, Gram-negative bacteria and yeast due to the presence of tannins, phlobatannins, terpenoids and saponins in the plant parts. However, the organic extracts of A. thunbergii showed no activity at 200 mg/ml against E. faecalis and E. coli. Similar results of A. thunbergii has been documented previously by Al-Mamun et al. (2016) against S. aureus, B. subtilis, E. coli, P. aeruginosa, and S. typhimurium.

Figure 6: The mean of inhibition zones for DCM:MeOH plant extracts (mm)

On the other hand, the dd-H2O extracts of B. massaiensis at 200 mg/ml showed inhibition zones of 19.7±2.494 mm against E. coli, 18.7±0.471 mm against Bacillus cereus, and 18.3±0.943 mm against P. aeruginosa (Figure 7). The similar findings by Keroletswe, Mazimba, Majinda, and Masesane (2017) documented 10-16 mm inhibition zone of B. massaiensis against E. coli, S. aureus and B. subtilis, and this could be due to the presence of linoleic acid and linolenic methyl esters in B. massaiensis. On another distinction, the Morus sp. aqueous extracts showed negative inhibition strength on average at 200 mg/ml against S. aureus, B. cereus, L. monocytogenes, E. faecalis, and S. typhimurium. This was in agreement with the study by Niratker, Preeti, and Malti (2015).

~ 87 ~ Figure 7: The mean of inhibition zones for double distilled water plant extracts (mm)

Above all, the inhibition zone values of organic extracts were more effective in comparison with those of aqueous extracts). This is because the combination of DCM and MeOH has higher polarity than water. Therefore, it extracts more bioactive compounds than water, which mostly break up active compounds that are responsible for antibacterial activity (Barchan, Bakkali, Arakrak, Pagán, & Laglaoui, 2014). Although this might be true, the agar disc diffusion methods alone cannot reliable. This is because they are strongly influenced by agar depth, diffusion rate of the antimicrobial agent and growth rate of the specific microorganisms (Lehtopolku, et al., 2012).

BROTH DILUTION ASSAY OF SELECTED TRADITIONAL HERBS AND SPICES The results showed that the bark alcohol extracts of Eucalyptus sp. had the lowest MIC value at 6.25 mg/ ml against S. typhimurium and S. sonnei (Table 2). Furthermore, the barks of this plant species had the lowest IC50 values between 5-6.25 mg/ml against S. aureus, C. perfringens, S. typhimurium and S. sonnei (Table 3). The results found are in agreement with the scientific literature recently produced by Sabo and Knezevic (2019), which also reported higher inhibition of Eucalyptus sp. leaves and bark extracts on S. aureus, and equally for Gram negative bacteria and fungi. According to this study, the essential oil found in Eucalyptus sp. plant parts is the main reason behind the antimicrobial activity of this plant species.

On average, the roots extracts of B. massaiensis aqueous extracts showed the lowest MIC value between 6.25-12.5 mg/ml against S. aureus, S. typhimurium, P. aeruginosa, C. albicans, and S. cerevisiae (Table 4). Moreover, the aqueous extracts of the similar plant species had the lowest IC50 values on average between 5-6.25 mg/ml against S. aureus, C. perfringens, S. typhimurium, S. sonnei, P. aeruginosa, C. albicans, and S. cerevisiae (Table 5). These results were in agreement with a study by Keroletswe, Majindaa, and Masesane (2018). This study discussed that the antimicrobial activity of B. massaiensis are due to compounds such as Linoleic acid, linolenic methyl esters, 3-prenyl-2- flavene (named baphiflavene A), and eleven new known compounds isolated and reported for the first time from this plant species. According to this study, these compounds have moderate activities against both Gram positive and Gram bacteria, and good activity against C. albicans.

~ 88 ~ - + 50 50 25 100 >100 >100 >100 >100 >100 >100 >100 - S. cerevi siae - + 25 25 50 25 100 100 6.25 >100 >100 >100 >100 C. albi - cans - + 50 50 25 100 100 12.5 >100 >100 >100 >100 >100 P. vul - P. garis - + 50 50 50 25 100 100 12.5 12.5 12.5 >100 >100 P. aerugi - P. nosa - + 50 100 100 100 100 6.25 >100 >100 >100 >100 >100 S. sonnei - + 25 100 100 6.25 6.25 6.25 >100 >100 >100 >100 >100 S. typh - imurium - + 50 100 100 >100 >100 >100 >100 >100 >100 >100 >100 E. coli - - + 100 12.5 >100 >100 >100 >100 >100 >100 >100 >100 >100 Test microorganisms and indicator strains and indicator microorganisms Test E. faeca lis Extract concentrations (mg/mL ± Standard Error) Extract concentrations (mg/mL - - + 50 25 100 100 100 100 100 >100 >100 >100 >100 C. per fringens - + >100 >100 >100 >100 >100 >100 >100 >100 >100 >100 >100 L. mono - cytogenes - + 25 100 >100 >100 >100 >100 >100 >100 >100 >100 >100 B. cereus - + 50 25 12.5 >100 >100 >100 >100 >100 >100 >100 >100 S. aureus Part Plant Roots Fruits Roots Barks Roots Barks Leaves Leaves Leaves Leaves Leaves sp. Plant species 70% Methanol Ampicillin Morus sp. A. thunbergii H. fuscus A. senegalensis A. digitata B. massaiensis Eucalyptus Table 2: Overall minimum inhibitory concentration (MIC) of DCM:MeOH extracts (mg/mL). Table Key: (-) absence of inhibition, while (+) presence inhibition.

~ 89 ~ 25 50 50 25 100 100 12.5 >100 >100 >100 >100 - S. cerevi siae 50 25 50 100 100 100 100 6.25 12.5 6.25 12.5 C. albi - cans 50 25 50 25 100 100 100 100 12.5 6.25 >100 P. vul - P. garis 50 50 25 25 25 100 100 6.25 6.25 6.25 12.5 P. aerugi - P. nosa 5 25 50 50 25 50 100 100 100 100 100 S. sonnei 5 5 25 100 100 6.25 6.25 6.25 >100 >100 >100 S. typh - imurium 25 50 50 50 50 100 100 100 100 100 12.5 E. coli - Extract concentrations (mg/mL) 50 50 25 100 100 100 100 6.25 >100 >100 >100 Test microorganisms and indicator strains and indicator microorganisms Test E. faeca lis - 25 50 25 25 25 100 12.5 12.5 6.25 >100 >100 C. per fringens ) of DCM:MeOH extracts (mg/mL). 50 100 100 100 >100 >100 >100 >100 >100 >100 >100 >100 L. mono - cytogenes 50 25 100 100 100 12.5 >100 >100 >100 >100 >100 B. cereus 50 50 50 6.25 6.25 6.25 >100 >100 >100 >100 >100 S. aureus Part Plant Roots Fruits Roots Barks Roots Barks Leaves Leaves Leaves Leaves Leaves sp. Plant species Morus sp. A. thunbergii H. fuscus A. senegalensis A. digitata B. massaiensis Eucalyptus Table 3: Overall 50% growth reduction concentrations (IC Table

~ 90 ~ - + 25 25 100 100 100 12.5 >100 >100 >100 >100 >100 - S. cerevi siae - + 25 25 100 100 6.25 >100 >100 >100 >100 >100 >100 C. albi - cans - + 50 25 50 50 6.25 12.5 >100 >100 >100 >100 >100 P. vul - P. garis - + 50 50 100 100 100 6.25 6.25 6.25 12.5 >100 >100 P. aerugi - P. nosa - + 25 25 50 100 100 >100 >100 >100 >100 >100 >100 S. sonnei - + 25 100 100 12.5 6.25 >100 >100 >100 >100 >100 >100 S. typh - imurium - + 50 25 100 100 6.25 >100 >100 >100 >100 >100 >100 E. coli - Extract concentrations (mg/mL) - + 50 50 50 100 100 >100 >100 >100 >100 >100 >100 Test microorganisms and indicator strains and indicator microorganisms Test E. faeca lis - - + 50 50 50 50 25 O water extracts (mg/mL). 50 100 100 100 2 12.5 >100 C. per fringens - + >100 >100 >100 >100 >100 >100 >100 >100 >100 >100 >100 L. mono - cytogenes - + 50 50 50 100 100 12.5 >100 >100 >100 >100 >100 B. cereus - + 25 25 100 100 6.25 6.25 12.5 6.25 12.5 >100 >100 S. aureus Part Plant Roots Fruits Roots Barks Roots Barks Leaves Leaves Leaves Leaves Leaves sp. Plant species O 2 dd-H Ampicillin Morus sp. A. thunbergii H. fuscus A. senegalensis A. digitata B. massaiensis Eucalyptus Table 4: Overall minimum inhibitory concentration (MIC) of dd-H Table Key: (-) absence of inhibition, while (+) presence inhibition.

~ 91 ~ 25 25 25 25 12.5 6.25 6.25 6.25 >100 >100 >100 - S. cerevi siae 5 50 50 50 100 100 12.5 12.5 6.25 6.25 >100 C. albi - cans 100 100 6.25 12.5 12.5 12.5 6.25 6.25 >100 >100 >100 P. vul - P. garis 25 50 100 6.25 6.25 6.25 12.5 6.25 6.25 12.5 6.25 P. aerugi - P. nosa 25 25 50 100 100 100 100 100 6.25 6.25 12.5 S. sonnei 25 25 50 100 100 100 100 12.5 6.25 6.25 6.25 S. typh - imurium 5 25 50 50 100 100 6.25 12.5 12.5 12.5 12.5 E. coli - Extract concentrations (mg/mL) 25 50 25 50 12.5 12.5 12.5 6.25 12.5 12.5 12.5 Test microorganisms and indicator strains and indicator microorganisms Test E. faeca lis O extracts (mg/mL). - 2 50 25 25 25 100 12.5 12.5 12.5 6.25 6.25 6.25 C. per fringens ) of dd-H 50 25 25 50 100 100 12.5 >100 >100 >100 >100 >100 L. mono - cytogenes 50 25 50 25 25 6.25 >100 >100 >100 >100 >100 B. cereus 25 50 50 12.5 6.25 6.25 6.25 6.25 6.25 12.5 >100 S. aureus Part Plant Leaves Leaves Leaves Roots Fruits Roots Barks Leaves Roots Barks Leaves sp. Plant species Morus sp. A. thunbergii H. fuscus A. senegalensis A. digitata B. massaiensis Eucalyptus Table 5: Overall 50% growth reduction concentrations (IC Table

~ 92 ~ CONCLUSION This study was undertaken to investigate the indigenous knowledge of traditional culinary herbs and spices used in the Kabbe constituencies of Zambezi region. Eight spice and herbal plants species belonging to seven plant families were documented. These plants are mostly used as herbs and spices for seasoning, leafy vegetables, preservatives and traditional medicine. Moreover, the preliminary results showed that alcohol extracts of Eucalyptus sp. had the lowest MIC value at 6.25 mg/ml against S. typhimurium and S. sonnei, while the roots extracts of B. massaiensis aqueous extracts showed the lowest MIC value between 6.25-12.5 mg/ml against S. aureus, S. typhimurium, P. aeruginosa, C. albicans, and S. cerevisiae. The MIC value of Eucalyptus sp. and B. massaiensis offer supporting evidence for traditional uses of these plants as seasonings, preservatives, and traditional medicine. Extraction, isolation and characterization of bioactive compounds of these plants may be required. Toxicity studies are needed to support the safe usage of these plants. It is expected that the results of this study will contribute to the indigenous information about the usage of plants as traditional herbs and spices in Zambezi region, and their contributions toward improving human health.

ACKNOWLEDGEMENTS The authors would like to thank the National Botanical Research Institute for helping with the scientific identification of the plants; Namibia Students Financial Assistance Fund (NSFAF) and Mrs Ester Kalangula for the financial assistance.

REFERENCES Al-Mamun, M. A., Husna, J., Khatun, M., Hasan, R., Kamruzzaman, M., & Hoque, K. M. (2016). Assessment of antioxidant, anticancer and antimicrobial activity of two vegetable species of Amaranthus in Bangladesh. BMC Complementary and Alternative Medicine, 1-11. Aniszewski, T. (2007). Alkaloids - secrets of life: Aklaloid chemistry, Bbological significance, applications and ecological role. Amsterdam: Elsevier. Asowata-Ayodele, A. M., Afolayan, A. J., & Otunola, G. A. (2016). Ethnobotanical survey of culinary herbs and spices used in the traditional medicinal system of Nkonkobe Municipality, Eastern Cape, South Africa. South African Journal of Botany 104, 69–75. Barchan, A., Bakkali, M., Arakrak, A., Pagán, R., & Laglaoui, A. (2014). The effects of solvents polarity on the phenolic contents and antioxidant activity of three Mentha species extracts. International Journal of Current Microbiology and Applied Sciences, 399-412. Chinsembu, C. K., Negumbo, J., Likando, M., & Mbangu, A. (2014). An ethnobotanical study of medicinal plants used to treat livestock diseases in Onayena and Katima mulilo, Namibia. South African Journal of Botany, 94, 101-107. Chinsembu, K. C., & Hedimbi, M. (2010). An ethnobotanical survey of plants used to manage HIV/AIDS opportunistic infections in Katima Mulilo, Caprivi region, Namibia. ournal of Ethnobiology and Ethnomedicine, 6(25), 1-9. Donay, J. L., Fernandes, P., Lagrange, P. H., & Herrmann, J. L. (2007). Evaluation of the Inoculation Procedure Using a 0.25 McFarland Standard for the BD Phoenix Automated Microbiology System. Journal of Clinical Microbiology, 45(12), 4088–4089.

~ 93 ~ El-Massry, K. F., Farouk, A., & Abou-Zeid, M. (2008). Free Radical Scavenging Activity and Lipoxygenase Inhibition of Rosemary (Rosmarinus officinalis L) Volatile Oil. Journal of Essential Oil Bearing Plants, 11(5), 536-543. Embuscado, M. E. (2018). Bioactives from spices and herbs. In Reference Module in Food Science. Hunt Valley, MD: Elsevier Inc. Gottardi, D., Bukvicki, D., Prasad, S., & Tyagi, A. K. (2016). Beneficial effects of spices in ffood preservation and safety. Frontiers in Microbiology, 7;1394, doi: 10.3389/fmicb.2016.01394 Kabbe Constituency. (2018). Retrieved from Wikipedia: https://en.wikipedia.org/wiki/Kabbe_ Constituency Keroletswe, N., Majindaa, R. R., & Masesane, I. B. (2018). A new 3-Prenyl-2-flavene and other extractives from Baphia massaiensis and their antimicrobial activities. Natural Product Communications, 13(4),435-438. Keroletswe, N., Mazimba, O., Majinda, R. R., & Masesane, I. (2017). Fatty acid composition and antimicrobial activity of Baphia massaiensis seed oil. Journal of Complementary and Alternative Medical Research 2(3), 1-7. Kong, B., Wang, J., & Xiong, Y. L. (2007). Antimicrobial activity of several herb and spice extracts in culture medium and in vacuum-packaged pork. Journal of Food Protection, 70(3), 641–647. Lehtopolku, M., Kotilainen, P., Puukka, P., Nakari, U.-M., Siitonen, A., Eerola, E., and Hakanen, A. J. (2012). Inaccuracy of the disk diffusion method compared with the Agar dilution method for susceptibility testing of Campylobacter spp. Journal of Clinical Microbiology, 50(1), 52–56. Mahwasane, S. T., Middleton, L., & Boaduo, N. (2013). An ethnobotanical survey of indigenous knowledge on medicinal plants used by the traditional healers of Lwamondo area, Limpopo province, South Africa. South African Journal of Botany, 88, 69–75. Maroyi, A. (2013). Traditional use of medicinal plants in south-central Zimbabwe: review and perspectives. Journal of Ethnobiology and Ethnomedicine 9:31, 1-18. Masola, S. N., Mosha, R. D., & Wambura, P. N. (2009). Assessment of antimicrobial activity of crude extracts of stem and root barks from Adansonia digitata (Bombacaceae) (African baobab). African Journal of Biotechnology , 8(19), 5076-5083. Mostafa, A. A., Al-Askar, A. A., Almaary, K. S., M.Dawoud, T., Sholkamy, E. N., & Bakri, M. M. (2018). Antimicrobial activity of some plant extracts against bacterial strains causing food poisoning diseases. Saudi Journal of Biological Sciences, 25(2), 361-366. Namibia 2011 Population and Housing Census Atlas. (2013). Retrieved from Namibia Statistics Agency: https://d3rp5jatom3eyn.cloudfront.net/cms/assets/documents/ p19dmmo1b61d7n1ke2e22dr31u0k1.pdf Negi, V. S., Maikhuri, R. K., Phondani, P. C., & Rawat, L. S. (2010). An inventory of indigenous knowledge and cultivation practices of medicinal plants in Govind Pashu Vihar Wildlife Sanctuary, Central Himalaya, India. International Journal of Biodiversity Science, Ecosystem Services & Management, 6(3-4), 96-105. Niratker, C. R., Preeti, & Malti. (2015). Antimicrobial activity of leaf extract of Morus indica (Mulberry) from Chhattisgarh . Asian Journal of Plant Science and Research, 5(1), 28-31.

~ 94 ~ Nyambe, M. M. (2018). Phytochemical and antibacterial analysis of indigenous chewing sticks, Diospyros lyciodes and Euclea divinorum of Namibia. Biofarmasi 16, 29-43. Raghavan, S. (2006). Handbook of spices, seasonings, and flavorings (2nd ed.). New York: CRC Press. Sabo, V. A., & Knezevic, P. (2019). Antimicrobial activity of Eucalyptus camaldulensis Dehn. plant extracts and essential oils: A review. Industrial Crops & Products, 132, 413-429. Spencer, M. (2017, September 18). Difference between herbs and spices. Retrieved from https:// www.almanac.com/news/cooking/herbs-and-spices/difference-between-herbs-and-spices Srinivasan, K. (2016). Spices and flavoring crops: Uses and health effects.Encyclopedia of Food and Health, 5, 98-105. Tadeg, H., Mohammed, E., Asres, K., & Gebre-Mariam, T. (2005). Antimicrobial activities of some selected traditional Ethiopian medicinal plants used in the treatment of skin disorders. Journal of Ethnopharmacology, 100(1-2), 168-175. Tajkarimi, M. M., Ibrahim, S. A., & Cliver, D. O. (2010). Antimicrobial herb and spice compounds in food. Food Control, 21(9), 1199-1218. Tassou, C. C., Chorianopoulos, N. G., Skandamis, P. N., & Nychas, G.-J. E. (2012). Herbs, spices and their active components as natural antimicrobials in foods. Woodhead Publishing Limited, 2, 17-50. Timberlake, J. (2000). Biodiversity of the Zambezi basin. Bulawayo, Zimbabwe: Biodiversity Foundation for Africa. Weerakkody, N. S., Caffina, N., Turnera, M. S., & Dykes, G. A. (2010). In vitro antimicrobial activity of less-utilized spice and herb extracts against selected food-borne bacteria. Food Control, 21(10), 1408-1414. Wilder, B. T., O’Meara, C., Monti, L., & Nabhan, G. P. (2016). The importance of indigenous knowledge in curbing the loss of language and biodiversity . BioScience, 66(6), 499–509. Witkowska, A. M., Hickey, D. K., Alonso-Gomez, M., & Wilkinson, M. (2013). Evaluation of antimicrobial activities of commercial herb and spice extracts against selected food-borne bacteria. Journal of Food Research, 2(4), 37-54. Zawirska-Wojtasiak, R., & Wąsowicz, E. (2009). GC analysis of rosemary aroma isolated traditionally by distillation and by SPME. Journal of Essential Oil Research, 21(1), 8-15.

~ 95 ~ PHYSICO-CHEMICAL PROPERTIES AND MICROBIAL COMMUNITIES OF FERMENTED OLIVES IN NAMIBIA USING CULTURE DEPENDENT METHOD

W. Zwart1, J. Uzabakiriho1 and A. Cheikhyoussef2* 1 Department of Biological Sciences, Faculty of Science, University of Namibia Email: [email protected] and [email protected] 2 Science and Technology Division, Multi-disciplinary Research Centre, University of Namibia Email: [email protected]

ABSTRACT Table olives are one of the lesser known fermented fruits with naturally associated lactic acid bacteria (LAB) and yeast. The aim of this study was to determine the acidity, pH, salinity and enumerate the microbial community of table olives from Noab and Shalom farms in Namibia. Total plate count, total phenolic content (TPC), total lactic acid bacteria (LAB) and total yeast count were determined over specific time intervals in a total of 30 olive samples that were collected from Noab and Shalom olives farms in Namibia. TPC were extracted from table olives using the Folin-Ciocalteu method. Olive samples had an average pH of 4.5 and TPC ranged from 2.33 ± 9.50 ×10-5 to 8.26 ± 3.4×10-4 µg Gallic Acid Equivalent (GAE)/g. Titratable acidity ranged from 0.35 ± 0.032 to 2.71 ± 0.07 g/L, and combined acidity from 0.013 ± 0.0053 to 0.12 ± 0.069 mol NaOH/L. NaCl content of both sites was 8.4 ±0.14 g/L. There was no significant difference (P> 0.01) in total yeast and mould count between Noab and Shalom olive samples. Although Shalom table olives had a higher Total Plate Count and lower total coliform count, there were no differences between the two sites on all tests performed. Therefore, there was no difference between the two sites’ processing methods of table olives, except for the Total Plate Counts (largely due to the olive variety used) and total coliform counts (due mainly to handling or storage conditions).

Keywords: Namibia, olive fermentation, lactic acid bacteria, organoleptic properties, microbial communities.

INTRODUCTION Namibia has a diverse range of traditional fermented foods and beverages (Misihairabgwi & Cheikhyoussef, 2017). The lesser known fermented product in Namibia is table olives (Olea europaea). However, there is a gap of knowledge on olive fermentation with only a small degree of research and scientific data available for future table olive research and development for this industry (examples include lack of standard starter culture, LAB, and promising probiotic candidates) in Namibia. The fermentation process plays a crucial role in rendering the table olive safe and edible because table olives first have to be fermented so as to lower the level of bitter phenolic compounds for human consumption (Heperkan, 2013). The phenolic compounds found in table olives are also bioavailable to humans in active components with many enhanced health benefits (Heperkan, 2013). Initially, table olives undergo spontaneous fermentation by native mixed microbiota, including Gram-negative

~ 96 ~ bacteria, LAB and yeast in the 10% brine water. After the initial fermentation process where there is extensive competition for nutrients, the process is mostly dominated by LAB and yeast. Additionally, the microbiota of the table olives in 10% brine depends on different intrinsic factors including pH, phenols, water activity and extrinsic factors like temperature, oxygen and salt to facilitate in the diffusion of salt into the olives and the breakdown of nutrients of the table olives (Romeo, 2012). LAB species such as Lactobacillus plantarum, L. pentosus, and, L. paraplantarum compete for the nutrients of the table olives in 10% salt concentrated brine during olive fermentation (Heperkan, 2013). Furthermore, yeast also competes for the nutrients in the 10% brine and can produce desirable volatile compounds and metabolites that improve the organoleptic properties of the final product (Arroyo- López, Querol, Bautista, & Fernández, 2008). Currently, culture dependent and culture independent methods are used to determine the molecular aspect of olive fermentation. Culture independent methods use modern approaches towards the extraction of the DNA of almost all microorganisms within the 10% brine environment of the table olives (Botta & Cocolin, 2012).

METHODOLOGY

SAMPLE COLLECTION The table olives in 10% brine samples (30 in total and in duplicate) were collected at different intervals during the fermentation for Noab and Shalom farms.

PHYSICO-CHEMICAL ANALYSES The changes in physico-chemical properties of fermentation for days 0, 15, 30, 60, 90 and 150 were determined. The analyses of pH, salt, titratable acidity and combined acidity were carried out according to the standard methods developed for table olives by Garrido-Fernández et al. (1997). The pH of olive brine was measured using a pH meter (Oakton Instruments, Vernon Hills, United States). The Volhard’s Titration method was used to determine the salt content as described by Smyth (2012).

TOTAL PHENOLIC CONTENT The Folin-Ciocalteu method of Singleton and Rossi (1965) was used to determine the total phenolic content. Table olives were depitted using a sharp clean blade and then place into a blender. The sample was macerated at high speed for 2 minutes and centrifuged at 5000 rpm for 5 minutes. One hundred microlitre of undiluted Folin-Ciocalteu (Merck, Germany) was directly added to 500 µl of the table olive extract and kept in a dark room. After 15 minutes, 2.5 mL of saturated sodium carbonate (1 M) was added and kept for a further 30 min in a dark room. The absorbance at 760 nm was read using a spectrophotometer (GeneSyn 20, Thermo, USA) (Cheikhyoussef, Summers, & Kahaka, 2015). Gallic acid was used to construct the standard curve.

ENUMERATION OF LAB, YEAST AND MOULDS OF TABLE OLIVES Serial dilutions from the brine were prepared using 1% buffered peptone water. The various general cultivation media for total plate count, total plate count agar and nutrient agar was used. Total LAB count was done using De Man, Rogosa and Sharpe (MRS) agar, M17 and Rogosa. Total Yeast and

~ 97 ~ Mould count was also done using Sabouraud dextrose agar (SDA) and Yeast Extract Chloramphenicol (YEGC) agar. Total coliform count used MacConkey agar. The various growth media were prepared for microbial enumeration, identification, and physiological determination as described by Asehraou et al. (2000).

GENOMIC DNA EXTRACTION AND AMPLIFICATION OF 16S RIBOSOMAL RNA GENE Genomic DNA was extracted from cultures that were isolated and regrown on MRS agar whereby the isolated colonies were grown from different agars and were used as template for PCR. The growth conditions were at the room temperature and grown colonies appeared white. The grown cultures were pelleted by centrifugation at 13 000 × g for 5 minutes and washed with double distilled water (Eppendorf centrifuge 5424, Eppendorf Instruments, Germany). DNA was then extracted using the Zymo Bacterial/Fungal DNA Extraction Kit (Zymo Research, Irvine, CA, USA) following the manufacturer’s instructions. Then the DNA was run on 1% agarose gel to confirm the presence of DNA, before proceeding to do the polymerase chain reaction (PCR).

Only 5 out of 30 isolates were used for PCR amplification in the thermocycler (BIO RAD, Singapore). The 1.5 Kb 16S rRNA bacterial gene was amplified using the universal primers 27F (5’ AGAGTTTGATCTGGCTCAG 3’) and 1492R (5’ CGGTTACCTTGTTACGACTT 3’) (Weisburg, Barns, Pelletier, & Lane, 1991). The oligonucleotide primers were manufactured by Inqaba Biotech (South Africa). The amplification of the DNA was similar to Randazzo et al. (2017) with some modifications. An amount of 50 μl PCR reaction mixture included 10 mM dNTPS 3 μl, 0.2 mM forward primer 3 μl and 0.2 mM reverse primer 3 μl, Taq polymerase 1 μl, 10x buffer 5 μl, 1.5 mM MgCI2 3 μl, RNase-free water 30 μl and the genomic DNA template 2 μl (Thermo Scientific, USA). In the negative control, DNA template was substituted with nuclease free water (Thermo Scientific, USA). The PCR reaction consisted of 1 cycle initial denaturation at 94 ºC for 4 minutes, followed by 23 cycles of 94ºC for 1 minutes (melting), 23 cycles of 48 ºC for 30 seconds (annealing) and final extension step for 23 cycles of 72 ºC for 2 minutes. Thereafter DNA samples were stored at 4 ºC until used for gel electrophoresis and sequencing (Lucena-Padrós,Caballero-Guerrero, Maldonado-Barragán, & Ruiz- Barba, 2014). After the completion of PCR reaction, amplified products were added in 1 % agarose gel containing 5 μl ethidium bromide solution (10 mg/ml). A 1 kb DNA ladder was used to identify the approximate size of each sample run on the gel. Electrophoresis was performed at 150 V for 45 min. The gel was viewed under UV light to confirm amplification and the un-purified PCR products were sent to Inqaba Biotech, South Africa for purification and sequencing. After editing sequences using BIOEDIT, a consensus sequence was generated. Putative bacterial taxonomic affiliation of each library was assigned based on the closest match sequence using the NCBI nucleotide BLASTn. The partial rRNA gene sequences of bacterial isolates obtained were used to construct a phylogenetic tree used the software clustal programme. The CLUSTAL W programme was used to align the sequences using default parameters.

~ 98 ~ STATISTICAL ANALYSIS The colony counts were transformed to log CFU (Colony Forming Units) / mL values before using Microsoft Excel 2016 to compute the means and standard deviation. The changes in physico-chemical properties of fermentation for days were analysed using the t-test for TPC, total plate count, total yeast and mould, and total coliforms count. Initially, an F-test was performed to assess the normal distribution on the tested samples dataset, to assume equal or unequal variances. One-way analysis of variance (ANOVA) was used to compare total LAB count values among different olive sites by SPSS with Levene’s test.

RESULTS AND DISCUSSION

PHYSICO-CHEMICAL AND MICROBIOLOGICAL ATTRIBUTES OF TABLE OLIVES The physico-chemical attributes are summarised in Table 1 and 2. The combined acidity of Noab olive samples (Table 1) ranged from 0.013 ± 0.0053 to 0.12 ± 0.069 mol NaOH/L and Shalom olive samples (Table 2) range from 0.027 ± 0.002 to 0.12 ± 0.0027 mol NaOH/L. Noab and Shalom olive samples had a slight increase of combined acidity over time. The combined acidity increased significantly for both Noab and Shalom olive samples, this allowed the pH to stabilise around 4 for most of the fermentation process after an initial decrease for both sites. Combined acidity of table olives plays a vital role in stabilising and maintaining the final pH, largely due to the presence of organic acids (Lopez-Lopez, García-García, Duran-Quintana, & Garrido-Fernández, 2004). The combined acidity was similar to that of Lucena-Padrós et al. (2014) of 0.14 (±0.04) NaOH/L and 0.16 (±0.01) NaOH/L. The titratable acidity of Noab olive samples had a mean value of 1.38 ± 0.17 g/L and Shalom olive samples had a mean of 1.69 ± 0.22 g/L. There is a slight increase in titratable acidity till the end of fermentation days and there was no significant difference overall (P< 0.01) in titratable acidity between Noab and Shalom olive samples. It appears to be an inverse relationship between pH and combined acidity. The titratable acidity increased with fermentation period. This is largely due to the presence of organic acids such as acetic, malic and lactic acids (Pereira, Ramalhosa, Borges, Pereira, & Baptista, 2015).

The NaCl of Noab olive samples had a mean value of 9.57 ± 0.11 % NaCl and the NaCl of shalom olive samples had a mean of 9.24 ± 0.15 % NaCl (Table 1 and 2). There is a slight decrease in NaCl during the fermentation period. There was no overall significant difference (P< 0.01) in pH between Noab and Shalom olive samples. An inverse relationship between pH and combined acidity was observed and confirmed. There are no uniform specifications for the salt concentration in table olives, which makes comparisons difficult (Lopez-Lopez et al., 2004).

The TPC of Noab olive samples (Table 1) had a mean value of 3.86 ± 0.000035 µg of GAE / mL and the TPC of Shalom (Table 2) had a mean of 6.37 ± 0.000030 µg GAE/ mL. There was a slight decrease in TPC as the fermentation days elapsed and there was a significant overall difference (P< 0.01) in TPC between Noab and Shalom olive samples. Total phenol content consists mainly of oleuropein, which should get reduced to make olives edible, therefore a decrease in total phenol content is good

~ 99 ~ for olive processing methods. The total phenol count was similar to the findings of Kamtekar, Keer

& Patil (2014) of 3.5725 ± 0.2336 GAE / mL. Noab olive samples had a mean of 4.64 ± 0.16 log10

CFU/ mL and Shalom olives samples had a mean of 4.7515 ± 0.43 log10 CFU/ mL for total plate count. There was no significant difference (P< 0.01) in total plate count between Noab and Shalom olive samples. In Figure 1, an increase in log10 CFU/ mL can be observed for plate count agar of both Noab and Shalom can be observed. Total LAB count consisted of three different agars used, namely

MRS, M17 and Rogosa. Noab olives total LAB count (Figure 2) had a mean of 3.83 ± 0.20 log10 CFU/ mL and Shalom had a mean of 3.67 ± 0.18 log10 CFU/ mL. There was no significant difference (P> 0.01) in LAB between Noab and Shalom olive samples. There was no overall significant difference (P> 0.01) between the different agars (MRS, M17 and Rogosa). The LAB count indicated a higher number of potential probiotic microorganisms during the fermentation of table olives.

Figure 1: The Total Plate Count of Noab and Shalom Farms Table Olives

~ 100 ~ -4 c -5 d c b d d b c d d e c e c d b d b

Day 150 Day 150 4.48 ± 0.3 5.67 ± 2.31 5.39 ± 1.80 5.20 ± 2.12 5.83 ± 1.94 5.86 ± 2.39 2.64 ± 0.03 8.84 ± 0.08 3.10 ± 1.78 2.76 ± 0.70 2.11 ± 1.22 2.11 7.14 ± 4.91 0.12 ± 0.01 4.48 ± 0.06 8.44 ± 0.12 0.12 ± 0.00 4.43 ± 1.8×10 2.33 ± 9.5×10 -4 d -4 b c c b b d d b P < 0.01) c d c c c b d c c

Day 90 Day 90 9.7 ± 0.41 5.17 ± 2.11 9.07 ± 0.20 5.23 ± 2.13 5.01 ± 2.04 2.71 ± 0.07 4.43 ± 0.02 4.87 ± 1.62 1.69 ± 0.02 5.44 ± 2.22 2.89 ± 1.67 4.45 ± 0.02 0.10 ± 0.00 5.04 ± 1.68 2.02 ± 1.17 0.12 ± 0.07 2.48 ± 1.0×10 5.45 ± 2.2×10 c -4 c -3 b c d b b b d c c c c b b b b b Day 60 Day 60 0.10 ± 0.01 1.67 ± 0.06 2.21 ± 0.21 5.24 ± 2.14 4.46 ± 0.09 9.82 ± 0.08 9.12 ± 0.07 5.05 ± 2.06 1.94 ± 1.12 5.12 ± 2.09 4.75 ± 1.58 4.69 ± 1.92 2.24 ± 1.29 4.37 ± 0.03 4.88 ± 1.63 0.093 ± 0.01 3.21 ± 1.3×10 6.09 ± 2.5×10 b -4 a -4 b a b c c c c b b b b b b b b a Day 30 Day 30 1.92 ± 1.11 1.14 ± 0.03 3.99 ± 1.33 1.27 ± 0.02 3.91 ± 1.30 4.14 ± 0.06 9.76 ± 0.12 4.74 ± 1.94 4.53 ± 1.85 4.43 ± 0.03 0.07 ± 0.01 9.33 ± 0.29 4.64 ± 1.89 1.75 ± 1.01 4.16 ± 1.70 0.077 ± 0.01 ferent lowercase letters are significantly different ( ferent lowercase letters are significantly different 4.11 ± 1.7×10 4.11 6.79 ± 2.7×10 -4 a -4 b b b a b b b b b a b b b b b b b Day 15 Day 15 1.54 ± 0.89 4.13 ± 0.02 4.64 ± 1.89 2.23 ± 0.74 5.25 ± 0.02 0.77 ± 0.03 9.62 ± 0.20 2.62 ± 1.07 1.70 ± 0.98 0.82 ± 0.02 9.70 ± 0.31 4.07 ± 1.66 4.36 ± 1.78 2.46 ± 0.82 0.061 ± 0.03 0.035 ± 0.01 7.15 ± 2.9×10 4.46 ± 1.8×10 a a a a -4 a -4 a a a a a a a a a a a

a a Day 0 Day 0 0.35 ± 0.03 1.48 ± 0.49 1.51 ± 0.62 1.55 ± 0.63 2.61 ± 1.07 2.60 ± 1.06 1.58 ± 0.91 1.48 ± 0.85 8.77 ± 0.04 7.75 ± 0.07 1.57 ± 0.53 0.42 ± 0.01 10.14 ± 0.20 0.027 ± 0.00 10.14 ± 0.02 0.013 ± 0.01 8.26 ± 3.4×10 6.63 ± 2.7×10 CFU/ mL) CFU/ mL) CFU/ mL) CFU/ mL) 10 10 10 10 CFU/ mL) CFU/ mL) CFU/ mL) CFU/ mL) 10 10 10 10 µg of GAE / mL)

pH pH Combined Acidity (mol NaOH/L) Combined Acidity Titratable (g/L) NaCl (%) TPC ( Plate Count (log Total LAB Count (log Total and Mould (log Yeast Total Coliform Count (log Total Acidity (mol NaOH/L) Combined NaCl (%) TPC (µg of GAE / mL) Plate Count (log Total LAB Count (log Total and Mould (log Yeast Total Coliform Count (log Total Titratable Acidity(g/L) Titratable Table 1: Physicochemical and microbiological properties of olive samples from Noab farm Table ( P < 0.01) what was n=3 letters in the same row are significantly different are means ± standard deviation; values with different Values 2: Physicochemical and microbiological attributes for the olive samples from Shalom farm Table Mean values of pH and each microbial group in the same row followed by dif

~ 101 ~ Figure 2: The Total LAB Count of Noab and Shalom Table Olives

Total yeast and mould for olive samples from Noab farm had a mean of 4.14 ± 0.21 log10 CFU/ mL; meanwhile, Shalom olive samples had a mean of 3.96 ± 0.27 log10 CFU/ mL. There was no significant difference (P> 0.01) in total yeast and mould count between Noab and Shalom olive samples. The high presence of yeast and mould in brine may be important in the contribution to aroma and flavour of the final product (Fernández, Pedro, & Balbuena, 1995) Yeast tends to predominate on the skin surfaces and in the stomal openings of olives, whereas bacteria predominated in the intercellular spaces of the sub-stomal cells (Nychas, Panagou, Parker, Waldron, & Tassou, 2002). Figure 3 shows that the yeast and mould count increased during the duration of the fermentation process. There was no significant difference (P> 0.05) total yeast and mould counts obtained from SDA and YEGC agars. The total coliform count was determined by using MacConkey Agar (ordinary formulation). Noab had a mean value of 2.23 ± 0.13 log10 CFU/ mL and Shalom had a mean of 1.55 ± 0.17 log10 CFU/ mL.

Figure 3: The Total Yeast and Mould Count for Noab and Shalom Table Olives

Figure 4 shows that total coliform count increases with time and there was a significant difference (P< 0.01) in total coliform count between Noab and Shalom olive samples. The low total coliform

~ 102 ~ count, indicates good hygiene practices employed and proper storage conditions, there are no reports of illness outbreaks caused by these microorganisms in table olive so no standard has been formed yet (Medina-Pradas & Arroyo-López, 2015).

Figure 4: The Total Coliform Count of Noab and Shalom Table Olives

After DNA isolation, the 16S rDNA region was amplified, the molecular weight of amplified products was around 50 bp. The purified amplified 16 rDNA isolates were sequenced and received from Inqaba biotech. South Africa. The 5 isolates were then analysed using the NCBI Nucleotide BLAST database. Isolate 1 was closely related to B. licheniformis, with a 99% similarity. All the searched sequenced, came from the genus Bacillus. In particular, a 99% similar for isolate 1 showed similarity to Bacillus licheniformis, Bacillus haynesii and Bacillus paralicheniformis. Isolate 2 showed similarity to Bacillus cereus, Bacillus nitratireducens, Bacillus thuringiensis and Bacillus mycoides. Isolate 3 showed similarity to Bacillus subtilis, Bacillus amyloliquefaciens and Bacillus velezensis. Isolate 4 showed similarity to Bacillus cereus, Bacillus thuringiensis and Bacillus mycoides and isolate 5 showed Bacillus cereus, Bacillus velezensis and Bacillus thuringiensis and found to be the closest species related to the sequence after the BLAST search. The identification at the species level showed that on the genus level Bacillus was the predominant species in the brine of table olives from both sites (Figure 5).

Figure 5: CLUSTALW Rooted Phylogenetic Tree of 99% ID Isolates of Table Olives in brine for both sites

~ 103 ~ CONCLUSION Table olive is one of the fermented foods (not common) in Namibia and naturally associated with LAB and yeast, even though this study found Bacillus to be the representative genus. The TPC and total coliform count had significant differences between the two sites’ table olive samples. The pH remained at around 4.5 which is the desired pH and should render the table olives safe for human consumption. The high NaCl content throughout the fermentation process controls the growth of most spoilage bacteria to a safe level, even though coliforms increased. The table olives are rich in phenols, which can be largely due to the different table olive cultivars used and makes table olives inedible, but after fermentation the level of phenol is decreased and the table olives becomes edible. The LAB count indicated a higher number of potential probiotic microorganisms during the fermentation of table olives. The total yeast can be due to the brine conditions that are favourable to the growth of yeast. The total coliform count gives an indicator of the overall safety of the product. Days 60, 90 and 150 had the highest number of microorganisms and there is no difference between the LAB and yeast and mould count. All sequences analysed through the dependent method, showed that the genus Bacillus spp. was present in all samples. The study documented both processing methods of table olive production, showed the presence of microbial communities associated with olive fermentation in Namibian table olives and the physicochemical properties. The knowledge of the microbial community involved during table olive fermentation is crucial for the safety of the final product and to define a procedure to control the fermentation process. Although some species are known to have probiotic properties, others are highly pathogenic to both humans and animals. Further studies need to be conducted to identify whether the Bacillus will be beneficial or pathogenic.

REFERENCES Arroyo-López, F. N., Querol, A., Bautista-Gallego, J., & Garrido-Fernández, A. (2008). Role of yeasts in table olive production. International Journal of Food Microbiology, 128(2), 189– 196. https://doi.org/10.1016/j.ijfoodmicro.2008.08.018 Asehraou, A., Peres, C., Brito, D., Faid, M., & Serhrouchni, M. (2000). Characterization of yeast strains isolated from bloaters of fermented green table olives during storage. Grasas y Aceites, 51(4), 225–229. https://doi.org/10.3989/gya.2000.v51.i4.415 Botta, C., & Cocolin, L. (2012). Microbial dynamics and biodiversity in table olive fermentation: Culture-dependent and -independent approaches. Frontiers in Microbiology, 3, 245. https:// doi.org/10.3389/fmicb.2012.00245 Cheikhyoussef, A., Summers, R. W., & Kahaka, G. (2015). Qualitative and quantitative analysis of phytochemical compounds in Namibian Myrothamnus flabellifolius. International Science and Technology Journal of Namibia, 5, 71–83. Fernández, A. G., Pedro, G. G., & Balbuena, M. B. (1995). Olive fermentations. In Biotechnology: enzymes, biomass, food and feed (pp. 593–627). Weinheim, Germany. https://doi. org/10.1002/9783527620920.ch16 Heperkan, D. (2013). Microbiota of table olive fermentations and criteria of selection for their use as starters. Frontiers in Microbiology, 4, 143. https://doi.org/10.3389/fmicb.2013.00143

~ 104 ~ Kamtekar, S., Keer, V., & Patil, V. (2014). Estimation of phenolic content, flavonoid content, antioxidant and alpha amylase inhibitory activity of marketed polyherbal formulation. Journal of Applied Pharmaceutical Science, 4(9), 61–65. https://doi.org/10.7324/JAPS.2014.40911 Lopez-Lopez, A., García-García, P., Duran-Quintana, M., & Garrido-Fernández, A. (2004). Physicochemical and microbiological profile of packed table olives. Journal of Food Protection, 67(10), 2320–2325. Lucena-Padrós, H., Caballero-Guerrero, B., Maldonado-Barragán, A., & Ruiz-Barba, J. L. (2014). Microbial diversity and dynamics of Spanish-style green table-olive fermentations in large manufacturing companies through culture-dependent techniques. Food Microbiology, 42, 154–165. https://doi.org/10.1016/j.fm.2014.03.020 Medina-Pradas, E., & Arroyo-López, F. N. (2015). Presence of toxic microbial metabolites in table olives. Frontiers in Microbiology, 6, 1–6. https://doi.org/10.3389/fmicb.2015.00873 Misihairabgwi, J., & Cheikhyoussef, A. (2017). Traditional fermented foods and beverages of Namibia. Journal of Ethnic Foods, 4(3), 145-153. https://doi.org/10.1016/J.JEF.2017.08.001 Nychas, G. J. E., Panagou, E. Z., Parker, M. L., Waldron, K. W., & Tassou, C. C. (2002). Microbial colonization of naturally black olives during fermentation and associated biochemical activities in the cover brine. Letters in Applied Microbiology, 34(3), 173–177. Pereira, E. L., Ramalhosa, E., Borges, A., Pereira, J. A., & Baptista, P. (2015). Yeast dynamics during the natural fermentation process of table olives (Negrinha de Freixo cv.). Food Microbiology, 46, 582–586. https://doi.org/10.1016/j.fm.2014.10.003 Randazzo, C. L., Todaro, A., Pino, A., Pitino, I., Corona, O., & Caggia, C. (2017). Microbiota and metabolome during controlled and spontaneous fermentation of Nocellara Etnea table olives. Food Microbiology, 65, 136–148. https://doi.org/10.1016/j.fm.2017.01.022 Romeo, F. (2012). Microbiological aspects of table lives. In Olive Germplasm - The olive cultivation, table olive and olive oil industry in Italy. InTech Open. https://doi.org/10.5772/51479 Singleton, V. L., & Rossi, J. A. (1965). Colorimetry of total phenolics with phosphomolybdic- phosphotungstic acid reagents. American Journal of Enology and Viticulture, 16(3), 144–158. Smyth, J. D. (2012). Table olive production manual. Rural Industries Research and Development Corporation. Canberra, Australia. Weisburg, W.G., Barns, S.M., Pelletier, D.A., & Lane, D.J. (1991). 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, 173(2), 697-703.

~ 105 ~ PROXIMATE CONTENT AND FUNCTIONAL PROPERTIES OF PUTATIVE PEARL MILLET (PENNISETUM GLAUCUM) MUTANTS DERIVED THROUGH GAMMA IRRADIATION IN NAMIBIA

F.N. Shindume1, L.N. Horn2 and G. Kahaka3 1Directorate of Agricultural Research and Development, Ministry of Agriculture, Water and Forestry, Namibia 2Multidisciplinary Research Centre, University of Namibia 3Department of Academic Affairs and Research, University of Namibia

Email: [email protected] Tel: +264813549196

ABSTRACT Pearl millet is a staple food and fodder crop of marginal areas of sub-Saharan Africa, South Asia and the Americas. Although, it is a staple food for 70 % of the Namibian population, its productivity is very low and has a limited genetic diversity. For the purpose of developing high yielding and drought resistant pearl millet, the Kangara and Okashana 2 varieties were mutated using a Colbalt-60 Gammacell, Model No. 220 irradiation source. Twelve samples from 30 putative mutants of Okashana 2 and Kangara were randomly selected using stratified sampling technique in order to select putative mutants that shown phenotypically high yielding trait. This study aimed to examine their biochemical parameters using dumas method (crude protein), fiber extractor (crude fibre, ADF and NDF), fat solvent extractor (fat), ICP-OE spectrophotometer (minerals) and UV/VIS spectrometer (phytate). Biochemical parameters showed no consistency in up/down regulation pattern in comparison to their parental lines. Only total energy content (however direct correlated with crude protein, crude lipid and carbohydrate) showed a constant trend of down regulation between mutant and their parental lines. Line R9P5, L8P5Rep2, L9P3Rep1, L10P18, L5P1Rep2 and L0P3Rep1 are selected for their higher protein content, while L5AP18, L9P3Rep1 and L8P5Rep2 selected for trait such as higher content of WAC and swelling capacity. L5AP18 and R6P1-1 were selected for higher content of iron and zinc minerals. Generally, majority of biochemical markers showed a significant difference (P ≤ 0.05) within and among Kangara and Okashana 2 derivatives and in comparison with the parental lines. Crude protein content of the mutant lines in this study showed significant increment of up to 24 % in comparison with parental lines. Finally, the results further revealed that putative mutant germplasms were significantly different from their parental lines with better improvement in biochemical traits. Therefore, these putative mutants are recommended to be used further in the country’s breeding programme in order to produce diverse crop varieties that meet consumers’ different preferences and needs.

Keywords: Pearl millet, putative mutant, biochemical characterization, Kangara, Okashana 2, mutation breeding.

~ 106 ~ INTRODUCTION

Pearl millet [Pennisetum glaucum (L.) R. Br.] is an important crop to most farmers in the tropics and sub-tropics of Africa, South Asia and the Americas (Issoufou, Mahamadou, & Guo-Wei, 2013; Saleh, Zhang, Chen, & Shen, 2013). It was first domesticated in the Sahel zone of West Africa specifically in north-eastern Mali about 4,500 years ago as confirmed by the archaeobotanical evidence (Deepak, Niranjan-Raj, Lavanya, Mithöfer, & Shetty, 2012; Manning, Pelling, Higham, Schwenniger, & Fuller, 2011). In Namibian, pearl millet is locally known as “Mahangu” with two main local varieties of Okashana 2 (SDMV 93032) and Kangara (SDMV 92040) (Ipinge, 1998; Rohrbach, Lechner, Ipinge, & Monyo, 1999).

Pearl millet is the sixth most important cereal crop globally and it is a staple crop for over 70 % of the Namibian population (Dwivedi et al., 2012; McBenedict, Chimwamurombe, Kwembeya, & Maggs- Kölling, 2016). Due to its drought and high temperature tolerance, pearl millet is widely cultivated under rain-fed but also under irrigation in hot and drought-prone regions (Sehgal et al., 2012). In many African and Asian countries, millet serves as a primary food commodity and various traditional foods and beverages, such as bread, porridges, and snack foods, are made specifically among the non- affluent segments in their respective societies (Issoufou et al., 2013; Saleh et al., 2013). However, in North America and Europe, millet serves as a major ingredient in multigrain and gluten-free cereal products only (Saleh et al., 2013).

Its production has declined recently due to abiotic (drought, temperature, salinity and low nutrient supply) and biotic (mainly diseases) factors (Bado et al., 2015). Induced mutations technology, over the past decades, appeared to be one of the most coherent approaches in broadening genetic variability, improving the association among various economic and morphological characters (currently over 3,220 officially released mutant cultivars in over 210 plant species) as it creates a new allelic combination in the desirable traits within a short period of time without disturbing the basic genomic structure of the plant (Laskar & Khan, 2017; Olasupo, Ilori, Forster, & Bado, 2016). Related research findings indicated that induced mutagenesis generates macromolecular variations, which ultimately alters the bio-physiological and morphological nature of the crop genotypes (Laskar, Laskar, Raina, Khan & Younus, 2018).The Government of the Republic of Namibia in collaboration with the joint Food and Agriculture Organisation of the United Nations/International Atomic Energy Agency (FAO/IAEA) under a technical cooperation programme launched a project on crop improvement using induced mutation breeding during 2007 (Horn & Shimelis, 2013). Gamma irradiation was recommended by the Namibian Radiation Regulatory Authority as an alternative option to create new crop genotypes in a short period of time without any significant negative impact to the environment. Through this initiative, seeds of Kangara and Okashana 2 were irradiated at the International Atomic Energy Agency (IAEA), Agriculture and Biotechnology Laboratory, Austria during 2009 using a Colbalt-60 gamma source. Prior to gamma irradiation, preliminary seed germination and viability tests were conducted (Horn & Shimelis 2013). This created a platform for pre-breeding and breeding of high yielding, drought tolerant and insect pest resistant genotypes of

~ 107 ~ pearl millet. The project on induced mutation continued in Namibia since 2009 at three Government Research stations (Omahenene, Mannheim and Bagani) evaluating the mutant lines to identify traits of interest (Horn, Ghebrehiwot, & Shimelis, 2016). According to Horn, Shimelis, Sarsu, Mwadzingeni and Laing (2018), the project developed a number of novel cowpea, pearl millet and sorghum mutant lines which are useful genetic resources for production or future crop breeding programmes in Namibia. Therefore, the objective of this study was to examine the biochemical markers (proximate content, nutritionally valuable minerals, anti-nutrients and functional properties of the seed flour) of selected novel pearl millet mutant lines with improved agronomic traits.

METHODOLOGY

PLANT MATERIAL AND STUDY SITE Thirty two (32) dry pearl millet grain samples (sixth generation of Okashana 2 putative mutant lines produced using 350 Gray (Gy) dose level while six generation of the Kangara putative mutants were produced using 400 Gy) were collected from the study sites (Mannheim, Bagani and Omahenene research stations) after harvesting in June 2015. Mannheim Research Station is located in Oshikoto region along the north central of Namibia and it is situated at 1234 m above sea level (masl). Bagani Research Station is located at 1007 masl, north east in the Kavango East region in North-Eastern Namibia, whereas Omahenene research station is situated in the Omusati Region in North-Western Namibia at 1109 masl. Furthermore, subsampling of collected samples was conducted using a stratified sampling technique whereby two putative mutant samples of both Kangara and Okashana 2 were randomly selected depending on the harvested weight of its grains at each Research Station. In total, fourteen samples of Kangara putative mutant lines (L5AP18, L7AP1A, R6P1-1, R9P5, L8P5Rep2 and L9P3Rep1) and Okashana 2 putative mutant lines (L3P5, L4P1, L8P12, L10P18, L5P11Rep2 and L10P13Rep1) including the two parental lines as controls of Kangara (SDMV 92040) and Okashana 2 (SDMV 93032) varieties were used in this study.

BIOCHEMICAL CHARACTERISATION OF PEARLL MILLET’S PUTATIVE MUTANTS

PROXIMATE COMPOSITION ANALYSIS

In this study, moisture, crude lipid/fat and ash contents were determined by Association of Official Analytical Chemists (AOAC) method numbers 945.38 and 923.03 according to AOAC (2005a, 2005b). Crude protein content was estimated using Leco CHN628 Determinator (Leco corporation, St. Joseph MI, USA) based on Dumas combustion method (Palic, Claassens, Collier, Loock, & Hattingh, 2007). Total protein for grain was estimated by multiplying the percentages of nitrogen with 5.83 Jones factor (FAO/INFOODS, 2012). Crude fibre, neutral detergent fibre (NDF) and acid detergent fibre (ADF) were determined according to Palic et al. (2007) protocol. Total carbohydrates calculated using formula reported by Ijarotimi, Adeoti, and Ariyo (2013):

Total Carbohydrates = 100 – (%Moisture + %Lipid + %Ash + Crude Fibre + Crude Protein).

~ 108 ~ Energy value was estimated by multiplying the percentages of crude protein, crude lipid/fat, and carbohydrate with the factors of 2.44, 8.37 and 3.57, respectively (Ijarotimi et al., 2013). Furthermore, anti-nutrient of phytate was determined using indirect colorimetric method of Wheeler & Ferrel (1971) while oxalate was determined according to Horwitz and Latimer (2006).

MINERALS The AOAC 984.27 (AOAC 2005c) was used to determine the levels of calcium, potassium, sodium, phosphorus, magnesium, iron and zinc in the samples using inductively coupled plasma optical emission spectrometry iCAP 6000 Series (Thermo Scientific, Newington NH, USA) after digestion with concentrated nitric acid.

FUNCTIONAL PROPERTIES OF PEARL MILLET’S FLOUR Water absorption capacity of the homogenised sample was determined according to the method reported by Beuchat (1977) with modification for small samples. The bulk density was determined using the method described by Okaka and Potter (1979, as cited by Ijarotimi et al., 2013). Swelling power was determined using the method cited by Ijarotimi et al. (2013) with modification for small samples.

DATA ANALYSIS Data were subjected to the standard analysis of variance procedure using Statistical Package for Social Sciences (SPSS) released 2007, SPSS for Windows, Version 16.0. Chicago, SPSS Inc. for comparing the biochemical traits of the putative mutants. The mean standard error of the mean (SEM) of the samples, Pearson’s correlation, coefficient of variation, Fisher’s least significant difference, as well as the significant differences determined at P ≤ 0.05 of biochemical characters of pearl millet mutants were calculated. All samples were collected from three agro-ecological zones and therefore all the measurements had three independent valuables (n = 3) and each measurement had triplication of analysis per assay. Moisture content in the cereal grains were analysed and the nutrient contents were then calculated from dry weight values assuming such moisture contents.

RESULTS AND DISCUSSION

BIOCHEMICAL CHARACTERISATION OF PUTATIVE MUTANTS PEARL MILLET PROXIMATE COMPOSITION ANALYSIS Proximate composition analysis of 12 pearl millet mutant lines derived from Kangara and Okashana 2 parental lines are presented in Table 1 and Table 2, respectively. The results on proximate composition showed a significant difference (P ≤ 0.05) within and among Kangara and Okashana 2 derivatives and also in comparison to their parental lines. Crude protein content of the two parental lines was within the range reported by Kumaravel and Natarajan (2015) but Okashana 2 crude protein is higher than a range reported by Embashu and Nantanga (2019). Some of the pearl millet putative mutants showed high crude protein content, though they were within a wider range as reported by Deepak et al. (2012) and Serna-Saldivar and Espinosa-Ramírez (2018). Crude protein content of the putative

~ 109 ~ mutants in this study showed significant increment of up to 24 % in comparison with parental lines that contain 11.24 – 11.71 %, these values were within the range reported by earlier studies (Devi, Vijayabharathi, Sathyabama, Malleshi, & Priyadarisini, 2014; Sade, 2009; Saleh et al., 2013). Protein content variations observed in this study could be due to both genotype effects caused by gamma irradiation and environmental variations (water availability, temperature and soil fertility) during grain development (Omondi et al., 2012). Mutagen generally produces induced mutations, which lead to base pair substitution especially GC to AT resulting in amino acid changes, which changes the function of proteins, without abolishing their functions (Gnanamurthy, Mariyammal, Dhanavel, & Bharathi, 2012). In general, pearl millet is known for its higher protein content compared to other major cereal crops with more balanced amino acid profile and high protein efficiency ratio. Pearl millet is gluten-free and it has a therapeutic effect for those prone to gluten allergy and celiac disease (Devi et al., 2014; Rai, Gupta, Yadav, & Govindaraj, 2015; Saleh et al., 2013).

A significant difference in crude fibre content at p ≤ 0.05 was observed between parental lines and their corresponding mutant derivatives. Generally, a reduction of crude fibre content in mutant lines was observed in comparison to the parental lines, and this could have happened due to the other proximate composition incremental effect, especially crude protein that increased up to 24% in comparison to parental lines. All the crude fibre figures (2.51-4.7 %) observed in this study were in arange as reported by Embashu and Nantanga (2019) and Serna-Saldivar and Espinosa-Ramírez (2018). However, they are higher than the earlier studies reports (Devi et al., 2014; Nambiar, Dhaduk, Sareen, Shahu, & Desai, 2011; Saleh et al., 2013) but lower than a range of 8-12.19 % reported by Issoufou et al. (2013) and Deepak et al. (2012).

In addition, the fibre fractions (NDF (19 %) and ADF (6.8 %)) content of pearl millet reported by Kumaravel and Natarajan (2015) were lower in comparison to the study findings. The NDF has been shown to be negatively correlated with dry matter intake, while ADF has been shown to be negatively correlated with digestibility of food stuffs (Palic et al., 2007).

This study revealed that the two parental lines (Okashana 2 and Kangara) were richer in energy levels than the putative mutants and such a pattern was almost identical with fat and carbohydrates content. All pearl millet lines under this study, on the other hand, displayed less energy content (307.52-331.47 kcal/g) compared to other reports (Deepak et al., 2012; Nambiar et al., 2011; Sade, 2009; Saleh et al., 2013). A higher fat content was however, observed among both putative mutant and parental lines in this study than what is reported by Devi et al. (2014), Issoufou et al. (2013), Nambiar et al. (2011) and Sade (2009). However, fat content for both Kangara and its putative mutants are below the range reported by Embashu and Nantanga (2019).

The observed carbohydrates contents (66.84-75.61 %) were less than what was reported by Saleh et al. (2013) and higher than the values reported by Devi et al. (2014) but within the range reported by Deepak et al. (2012). The nutritional quality of pearl millet is at par with or even superior to most other cereals such as rice, maize and wheat as observed that its amino acid profile, vitamins, minerals,

~ 110 ~ dietary fibres, and antioxidant phytochemcials are present in a more balanced ratio in pearl millet than in other cereals (Deepak et al., 2012; Saleh et al., 2013). Therefore, it is generally superior to sorghum, wheat, and maize in terms of the efficiency ratio (PER), and metabolisable energy levels (Saleh et al., 2013).

~ 111 ~ a a a a a a 1.11 1.47 1.457 329.98 327.60 319.39 328.57 328.26 323.34 322.76 Energy 325.70 ± a a a b b b 1.71 Carb 0.786 73.56 74.05 75.61 74.50 71.58 72.92 73.84 72.41 ± 0.51 a a a a a a Fat 5.12 5.63 6.20 5.74 5.72 5.56 5.25 5.57 5.34 0.105 ± 0.12 a a a a a a 9.71 NDF 0.283 30.06 36.29 28.47 30.10 30.29 26.10 30.59 28.56 ± 1.19 a a a a a a 8.08 8.97 8.19 8.73 8.43 ADF 0.098 38.24 10.43 20.01 10.63 ± 1.63 a a a a a a CF 4.7 3.89 4.47 4.20 3.83 2.51 4.21 3.29 0.086 18.07 ± 0.29 Parameter a a a a a a 9.45 9.85 11.74 11.74 13.54 10.92 11.84 0.653 13.56 13.55 13.00 ± 0.65 Protein a a a a a a CP 14.5 11.71 0.700 13.51 12.58 10.13 10.56 12.69 14.54 13.94 ± 0.69 a a a a a a OM 1.10 0.200 93.03 91.12 93.65 91.85 93.26 94.02 93.82 93.48 ± 0.42 a a a a b b Ash 2.25 1.87 2.23 3.18 2.12 2.59 1.77 1.99 0.127 20.16 ± 0.19 a a a a a a 6.97 8.88 6.35 6.18 6.52 6.74 8.15 5.98 0.200 14.64 ± 0.42 Moisture Ka CV LSD R9P5 Mean R6P1-1 L5AP18 L7AP1A Genotype L8P5Rep2 L9P3Rep1 Table 1: Proximate composition (%) of Kangara pearl millet putative mutants Table CV – fibre, detergent Neutral NDF- fibre, detergent acid - ADF fibre; crude – CF protein; crude - CP matter; organic – OM line; parental Key: Ka– Kangara triplicate 3 of = n for (SEM) mean the of error standard are ± SEM while means are Values difference. significant least Fisher’s LSD- variation; of coefficient the in superscript ‘b’ a with while line parental to compare 0.05) ≤ (P difference significant show column same the in superscript ‘a’ an with means samples, > 0.05) compare to parental line (P same column show no significant difference

~ 112 ~ a a a a a a 2.78 1.794 ± 3.67 322.80 331.47 326.30 327.60 330.13 310.32 307.52 326.27 Energy a a a b b b 4.35 Carb 0.925 61.70 74.50 69.49 66.84 74.23 ± 1.10 72.97 73.85 73.45 a a a a a b Fat 7.68 5.75 6.33 5.78 5.62 5.18 5.77 5.19 6.36 0.281 ± 0.18 a a a a a a 7.86 NDF 0.407 30.89 29.78 32.75 32.65 32.89 33.14 28.47 26.58 ± 0.99 a a a a a a 8.64 8.53 9.83 7.99 8.34 8.38 7.00 ADF 0.119 12.16 10.38 ± 0.43 a a a a a b CF 3.84 4.25 4.43 3.77 3.63 3.65 2.97 4.21 0.092 12.03 ± 0.19 Parameter a a a a a a 6.78 0.681 12.00 10.49 12.11 11.12 12.26 12.54 12.99 12.48 ± 0.33 Protein a a a a a a CP 6.65 11.24 0.731 12.88 13.14 12.99 12.04 13.44 13.93 13.38 ± 0.35 a a a a a a OM 1.96 0.310 92.42 89.38 93.33 92.67 94.16 94.25 90.00 93.17 ± 0.74 Okashana 2 pearl millet putative mutants a a a b b b Ash 2.78 1.94 4.25 5.16 2.19 1.91 1.96 2.03 0.094 44.83 ± 0.51 a a a a a a 7.58 6.67 7.33 5.84 5.75 6.83 0.310 23.88 10.62 10.00 ± 0.74 Moisture CV LSD L3P5 L4P1 Oka2 Mean L8P12 L10P18 Genotype L5P11Rep2 L10P13Rep1 Table 2: Proximate composition (%) of Table are means ± standard error of the mean (SEM) superscript for Key: Oka2 – Okashana 2 in n parental the = Values line. same 3, column means with an ‘a’ show significant difference (P ≤ 0.05) compare to parental line while with a superscript ‘b’ in the same column show no significant(P difference > 0.05) compare to parental line

~ 113 ~ FUNCTIONAL AND ANTI-NUTRIENTS PROPERTIES ANALYSIS Functional properties and anti-nutrients analysis of 12 pearl millet mutant lines derived from Kangara and Okashana 2 varieties are presented in Table 3 and Table 4 respectively. The regression equation of Phytic acid within the range of the standard sample concentration of 0 - 40 % was Y = 0.0816x - 0.1993 with a good linearity (R2 = 0. 9964).

Table 3: Functional and anti-nutrient properties of Kangara putative mutants Parameter Genotype Water absorbance Bulk density (g/ Swelling capacity Phytic Oxalate capacity (%) cm3) (g/g) acid (%) (mg/100 g) Ka 269.33 0.80 4.32 6.21 20.0 L5AP18 299.33a 0.82a 4.65a 6.56a 26.2a L7AP1A 307.67a 0.90b 4.63a 5.98a 22.4b R6P1-1 261.00b 0.91b 3.96a 6.00a 12.9a R9P5 253.50b 0.81a 4.03a 6.26b 18.3b L8P5Rep2 297.17a 0.83a 4.47a 5.87a 25.0b L9P3Rep1 327.00a 0.86b 4.98a 6.63a 13.9a 287.86 0.85 4.43 6.22 19.81 Mean ± 10.22 ± 0.02 ± 0.14 ± 0.11 ± 1.95 CV 8.70 4.79 7.55 4.36 24.09 LSD 19.279 0.045 0.115 0.081 5.609

Key: Ka – Kangara parental line; CV – coefficient of variation; LSD- Fisher’s least significant difference. Values are means while ± SEM are standard error of the mean (SEM) for n = 3 of triplicate samples, means with an ‘a’ superscript in the same column show significant difference (P ≤ 0.05) compare to parental line while a ‘b’ superscript in the same column show no significant difference (P > 0.05) compared to parental line.

Table 4: Functional and anti-nutrient properties of Okashana 2 putative mutants Parameter Genotype Water absorbance Bulk density Swelling capacity Phytic Oxalate capacity (%) (g/cm3) (g/g) acid (%) (mg/100 g) Oka2 252.33 0.84 4.13 6.26 33.7 L3P5 303.17a 0.91a 4.65a 6.37b 25.0a L4P1 276.00a 0.92a 4.39a 6.10a 25.0a L8P12 207.33a 0.83b 3.90a 6.95a 12.3a L10P18 265.50b 0.92a 4.20b 6.41a 22.4a L5P11Rep2 217.67a 0.98a 4.01b 6.21b 28.6a L10P13Rep1 206.67a 0.96a 4.05b 6.10a 21.4a 246.95 0.91 4.19 6.34 24.06 Mean ± 14.17 ± 0.02 ± 0.10 ± 0.11 ± 2.50 CV 14.05 5.72 5.64 4.28 25.50 LSD 14.669 0.029 0.134 0.111 4.749

~ 114 ~ Key: Oka2 – Okashana 2 parental line CV – coefficient of variation; LSD- Fisher’s least significant difference. Values are means while ± SEM are standard error of the mean (SEM) for n = 3 of triplicate samples, means with an ‘a’ superscript in the same column show significant difference (P ≤ 0.05) compared to the parental line, while a ‘b’ superscript in the same column shows no significant difference (P > 0.05) compared to the parental line.

“The functional properties of food product are defined as the intrinsic physico-chemical characteristics which affect the behaviour of protein in food system during preparation, processing and storage” (Kiin-Kabari, Eke-Ejiofor, & Giami, 2015, p. 75). The majority of functional and anti-nutrients properties showed a significant difference at P ≤ 0.05 within and among Kangara and Okashana 2 putative mutants and in comparison to their parental lines.

The majority of both Kangara and Okashana 2 lines displayed higher water absorption capacity (WAC) than the 226 % reported by Sade (2009). Higher WAC values observed in the pearl millet seed flour could be due to the high protein content of the mutant lines, which has a high affinity for water molecules (Ijarotimi et al., 2013).

Bulk density values found in this study were higher than the values of 0.57 g/cm3 reported by Ogori, Jatua, Apeh, and Adamu (2013). This variation could be due to the fact that bulk density is a measure of heaviness of the flour and this is generally affected by the particle size and the density of the flour (Gull, Prasad, & Kumar, 2015). Bulk density is a very important parameter in the food industry as it influences the packaging requirements, material handling, energy density, texture and application especially in wet processing units (Gull et al., 2015; Ijarotimi et al., 2013).

Findings of the swelling power were in agreement with the early report by Ogori et al. (2013). Using swelling power’s classification indicators reported by Schoch and Maywald (1968) and Bhupender, Rajneesh, and Baljeet (2013), the pearl millet flours in this study were highly restricted (below 16 g/g) and the starches that were showing restricted swelling behaviour are relatively stable against shearing action during cooking in water. The starch swelling power depends mainly on the amylose content, the structure of amylose and amylopectin, and the presence of non-carbohydrate substances, especially in the presence of lipids acting as inhibitors of swelling (Bhupender et al., 2013; Ocloo, Bansa, Boatin, Adom, & Agbemavor, 2010). Therefore, swelling power might be highly influenced by the higher lipid content observed among samples in this study than what is reported earlier. According to Chandra and Samsher (2013, p. 4851), “[t]he swelling power of flours depends on particle size, types of variety and processing methods or unit operations used”. Therefore, the better functional properties of the putative mutants may indicate that they might have better processing properties in comparison to parental lines. Pearl millets have polyphenols, tannin, phytic acid/phytate, goitrogens and oxalic acid as anti-nutrient components (Nambiar et al., 2011). Nutritional quality is considerably lowered by the presence of anti-nutritional factors leading to poor digestibility of proteins, carbohydrates and bioavailability of minerals (especially iron and zinc in cereal-based food for infants, young children and women in developing countries) (Sade, 2009; Suma & Urooj, 2014).

~ 115 ~ Phytic acid contents of the pearl millet grain obtained in this study were higher than 0.57-0.78 g/100g range reported by Suma and Urooj (2014) and Serna-Saldivar and Espinosa-Ramírez (2018). These anti-nutrients found in pearl millet have other benefits of anti-oxidant properties (Rai et al., 2015). Therefore, the considerable amount of phytate contained in the pearl millet putative mutants in this study may have a negative influence on mineral bioaccessibility (Suma & Urooj, 2014). However, the oxalate content observed in this study is less than 50 mg/100 g which is classified as low oxalate foods but these were not reported to pose nutritional problems (Suma & Urooj, 2014). The consumption of high oxalate-containing foods may result in hyperoxaluria and subsequent formation of insoluble calcium oxalate (CaOx) and/or magnesium oxalate (MgOx) crystals, a primary component of kidney stones (Al-Wahsh, Wu, & Liebman, 2012; Nambiar et al., 2011) .

3.1.3 MINERAL CONTENT ANALYSIS Five major and two trace mineral elements analysis of the 12 pearl millet mutant lines that were derived from Kangara and Okashana 2 parental lines are presented in Table 5 and Table 6 respectively.

Table 5: Mineral content of Kangara putative mutants (mg/100 g calculated on dry matter) Parameter Genotype Ca K Mg Na P Fe Zn Ka 15.7 331.4 73.5 140.4 32.6 7.9 5.7 L5AP18 34.5a 362.3b 66.2a 128.6b 40.2b 10.4a 6.5a L7AP1A 20.0a 305.2b 69.3b 125.6a 57.7a 6.6a 5.9b R6P1-1 20.0a 362.1b 71.1b 141.4b 75.1a 7.1a 6.9a R9P5 8.5a 255.3a 54.2a 119.1a 100.3a 5.9a 4.8a L8P5Rep2 11.0a 237.3a 59.7a 115.5a 99.1a 6.7a 5.1a L9P3Rep1 21.4a 330.2b 66.7b 118.3a 128.0a 6.0a 5.3a Mean 18.73 311.97 65.81 126.99 76.14 7.23 5.74 ± 3.21 ± 18.64 ± 2.55 ± 3.97 ± 13.21 ± 0.59 ± 0.29 CV 41.98 14.63 9.48 7.66 42.50 19.89 12.20 LSD 3.569 21.585 6.550 6.792 8.858 0.635 0.362

Key: Ka – Kangara parental line; CV – coefficient of variation; LSD- Fisher’s least significant difference. Values are means while ± SEM are the standard error of the mean (SEM) for n = 3 of triplicate samples, means with an ‘a’ superscript in the same column shows a significant difference (P ≤ 0.05) compared to a parental line while a ‘b’ superscript in the same column shows no significant difference (P > 0.05) compared to the parental line.

~ 116 ~ Table 6: Mineral content of Okashana 2 putative mutants (mg/100 g calculated on dry matter) Parameter Genotype Ca K Mg Na P Fe Zn Oka2 23.5 367.3 73.5 135.6 147.7 7.0 5.7 L3P5 19.3a 295.7a 58.9a 123.2a 138.6a 4.6a 5.1a L4P1 16.2a 303.2a 59.4a 127.1a 154.7a 5.1a 5.5b L8P12 16.3a 313.0a 57.4a 128.0a 2.8a 4.5a 3.7a L10P18 21.9b 368.5b 78.9a 126.2a 5.0a 6.0a 4.2a L5P11Rep2 21.5b 309.6a 72.2b 151.5a 9.3a 4.4a 4.1a L10P13Rep1 15.0a 332.8b 71.9b 143.1a 18.6a 5.0a 3.4a 19.10 327.16 67.46 133.53 68.10 5.23 4.53 Mean ± 1.25 ± 11.36 ± 3.27 ± 3.94 ± 28.01 ± 0.36 ± 0.34 CV 16.08 8.51 11.87 7.22 100.76 16.82 18.46 LSD 2.365 13.591 3.429 5.539 2.899 0.572 0.278

Key: Oka2 – Okashana 2 parental line; CV – coefficient of variation; LSD- Fisher’s least significant difference. Values are means while ± SEM are standard error of the mean (SEM) for n = 3 of triplicate samples, means with an ‘a’ superscript in the same column shows a significant difference (P ≤ 0.05) compared to a parental line while a ‘b’ superscript in the same column shows no significant difference (P > 0.05) compared to a parental line.

Results showed a significant difference (P ≤ 0.05) within and among Kangara and Okashana 2 derivatives and their parental lines. Most potassium and phosphorus contents obtained in this study were below the range of 97-373 mg/100 g (Deepak et al., 2012; Nambiar et al., 2011; Sade, 2009). Similarly, magnesium contents detected in this study were below the range 106-137 mg/100 g reported by Deepak et al. (2012), Nambiar et al. (2011) and Sade (2009). According to Deepak et al. (2012), high potassium and magnesium in pearl millet helps in lowering blood pressure and maintenance of cardiovascular health. Generally, the grain minerals nutrient concentrations detected in this study were considerably wider in range and some of the values were below the range reported by the early studies. Such observed differences could be caused by the differences among the genotypes in absorbing different minerals from the soil and the ability to accumulate minerals in the grains (Velu, Rai, Sahrawat, & Sumalini, 2008, p. 4). In addition, concentrations of minerals in grains are influenced by numerous complex and dynamic factors, including genotype, soil properties, environmental conditions and nutrient interactions (Bashir et al., 2014).

The greatest interest among microelements is the iron (Fe) and zinc (Zn) contents, for which widespread deficiencies with numerous adverse health effects have been reported worldwide, especially in populations of the developing countries that are heavily dependent of cereal-based diets (Rai et al., 2015; Velu et al., 2008). The iron content of the genotypes analysed in this study were within the range values of 3-11.0 mg/100 g (Deepak et al., 2012; Nambiar et al., 2011; Sade, 2009; Saleh et al., 2013). All the 14 genotypes tested showed more zinc content than the range value of 2.2 – 3.1 mg/100 g reported by Nambiar et al. (2011), while the values in this study ranged from 3.4 – 6.9 mg/100 g.

~ 117 ~ CORRELATION ANALYSIS As can be seen on the correlation Table 7, there is little if any correlation between biochemical markers studied. Low correlation was observed among the proximate compositions, while moderate positive or negative correlations were observed among mineral contents and among functional and anti-nutrients properties. CH and energy, and SC and WAC revealed a significant high positive correlation while moisture and OM, energy and ash had significant high negative correlation compared to the classification reported by Mukaka (2012). Previous reports have shown that grain yield was negatively associated with some of the mineral nutrient contents due to the dilution effect (Bashir et al., 2014; Jiang, Wu, Feng, Yang, & Shi, 2007). Therefore, these traits can be used as indirect selection criteria for yields.

Table 7: Correlation analysis of biochemical markers of pearl millet putative mutants

CONCLUSION The results of proximate analysis, nutritionally valuable minerals, anti-nutrients and functional properties of the seed flour of pearl millet putative mutants showed significant variations. Therefore, there are significant differences (P ≤ 0.05) within and amongKangara and Okashana 2 derivatives and in comparison to their parental lines probably caused by the gamma radiation. However, proximate content (moisture, ash, crude protein, fat, crude fibre and carbohydrates) of putative mutants showed no consistence in up or down regulation patterns in comparison to their parental lines. Only total energy content showed a constant trend of down regulation between mutant derivatives and their parental lines. Furthermore, due to positive correlations among different biochemical markers, it is possible to develop high-yielding varieties that are rich in several deficient micronutrients. Therefore, the putative mutants are recommended to be used further in the country’s breeding programme in order to produce diverse crop varieties that meet consumers’ different preferences and needs.

ACKNOWLEDGEMENTS My profound appreciation goes to the Ministry of Agriculture, Water and Forestry (MAWF) for giving me the opportunity to participate in the Master of Science (MSc) programme and also for having co-sponsored the research project with the joint Food and Agriculture Organisation of the United Nations/International Atomic Energy Agency (FAO/IAEA).

~ 118 ~ REFERENCES Al-Wahsh, I. A., Wu, Y., & Liebman, M. (2012). A comparison of two extraction methods for food oxalate assessment. Journal of Food Research, 1(2), 233–239. https://doi.org/10.5539/jfr. v1n2p233 AOAC (2005a). Official methods of analysis of AOAC International. In W. Horowitz (Ed.), Official methods of analysis, 16th ed, method 4.6.01 (962.09). Maryland, MA: AOAC International. Retrieved from . AOAC (2005b). Official methods off analysis of AOAC international. In W. Horowitz (Ed.),Official methods of analysis (16th ed.). Maryland, MA: AOAC International. Retrieved from . AOAC (2005c). Official methods off analysis of AOAC International. In W. Horowitz (Ed.).Official methods of analysis. (16th ed.) Maryland, MA: AOAC International. Retrieved from . Bado, S., Forster, B. P., Nielen, S., Ali, A. M., Lagoda, P. J. L., Till, B. J., & Laimer, M. (2015). Plant mutation breeding: Current progress and future assessment. In Plant Breeding Reviews, pp. 23–88). Hoboken, N.J.: John Wiley & Sons, Inc. https://doi.org/10.1002/9781119107743. ch02 Bashir, E. M. A., Ali, A. M., Ali, A. M., Melchinger, A. E., Parzies, H. K., & Haussmann, B. I. . G. (2014). Characterization of Sudanese pearl millet germplasm for agro-morphological traits and grain nutritional values. Plant Genetic Resources, 12(1), 35–49. https://doi.org/10.1017/ S1479262113000233 Bashir, Elfadil M.A., Ali, A. M., Ali, A. M., Ismail, M. I., Parzies, H. K., & Haussmann, B. I. G. (2014). Patterns of pearl millet genotype-by-environment interaction for yield performance and grain iron (Fe) and zinc (Zn) concentrations in Sudan. Field Crops Research, 166, 82–91. https://doi.org/10.1016/j.fcr.2014.06.007 Beuchat, L. R. (1977). Functional and electrophoretic characteristics of succinylated peanut flour protein. Journal of Agricultural and Food Chemistry, 25(2), 258–261. https://doi.org/10.1021/ jf60210a044 Bhupender, S. K., Rajneesh, B., & Baljeet, S. Y. (2013). Physicochemical, functional, thermal and pasting properties of starches isolated from pearl millet cultivars. International Food Research Journal, 20(4), 1555–1561. Chandra, S., & Samsher. (2013). Assessment of functional properties of different flours. African Journal of Agricultural Research, 8(38), 4849–4852. https://doi.org/10.5897/AJAR2013.6905 Deepak, S., Niranjan-Raj, S., Lavanya, N. S., Mithöfer, A., & Shetty, S. H. (2012). Nutritional Bio- fortification in pearl millet. The European Journal of Plant Science and Biotechnology, 6(2), 87–90. Retrieved from http://www.harvestplus.org/content/pearl-millet-set-release- Devi, P. B., Vijayabharathi, R., Sathyabama, S., Malleshi, N. G., & Priyadarisini, V. B. (2014). Health benefits of finger millet (Eleusine coracana L.) polyphenols and dietary fiber: a review. Journal of Food Science and Technology, 51(6), 1021–1040. https://doi.org/10.1007/s13197- 011-0584-9

~ 119 ~ Dwivedi, S. L., Upadhyaya, H. D., Senthilvel, S., Hash, C. T., Fukunaga, K., Diao, X., … Prasad, M. (2012). Millets: Genetic and genomic resources. (J. Jannick, Ed.) (1st ed.) John Wiley & Sons, Inc. Retrieved from http://oar.icrisat.org/5375/1/Millets_genetic_and_genomic_ resources_2012.pdf Embashu, W., & Nantanga, K. K. M. (2019). Malts: Quality and phenolic content of pearl millet and sorghum varieties for brewing nonalcoholic beverages and opaque beers. Cereal Chemistry, 96(4), 1–10. https://doi.org/10.1002/cche.10178 FAO/INFOODS. (2012). FAO / INFOODS guidelines for checking food composition data prior to the publication of a User / Table database -Version 1.0. Retrieved from http://www.fao. org/fileadmin/templates/food_composition/documents/Guidelines_data_checking_final_ oct2012.pdf Gnanamurthy, S., Mariyammal, S., Dhanavel, D., & Bharathi, T. (2012). Effect of gamma rays on yield and yield components characters R 3 generation in cowpea (Vigna unguiculata (L.) Walp). International Journal of Research in Plant Science, 2(2), 39–42. Retrieved from http:// www.urpjournals.com Gull, A., Prasad, K., & Kumar, P. (2015). Physico-chemical, functional and antioxidant properties of millet flours. Journal of Agricultural Engineering and Food Technology, 2(1), 73–75. Retrieved from http://www.academia.edu/11327988/Physico-chemical_Functional_and_ Antioxidant_Properties_of_Millet_Flours Horn, L. N., Ghebrehiwot, H. M., & Shimelis, H. A. (2016). Selection of novel cowpea genotypes derived through gamma irradiation. Frontiers in Plant Science, 7(262), 1–13. https://doi. org/10.3389/fpls.2016.00262 Horn, L, & Shimelis, H. (2013). Radio-sensitivity of selected cowpea (Vigna unguiculata) genotypes to varying gamma irradiation doses. Academic Journals, 8(40). https://doi.org/10.5897/ SRE2013.5682 Horn, L, Shimelis, H., Sarsu, F., Mwadzingeni, L., & Laing, M. D. (2018). Genotype-by-environment interaction for grain yield among novel cowpea (Vigna unguiculata L.) selections derived by gamma irradiation. The Crop Journal, 6(3), 306–313. https://doi.org/10.1016/J.CJ.2017.10.002 Ijarotimi, O. S., Adeoti, O. A., & Ariyo, O. (2013). Comparative study on nutrient composition, phytochemical, and functional characteristics of raw, germinated, and fermented Moringa oleifera seed flour. Food Science & Nutrition, 1(6), 452–463. https://doi.org/10.1002/fsn3.70 Ipinge S.N.A. (1998). A proposal for release of pearl millet varieties SDMV 93032 (Okashana 2) SDMV 92040 (Kangara). Windhoek, Namibia. Retrieved from http://www.the-eis.com/data/ literature/Namibia National Sorghum and Pearl Millet Improvement Programme.pdf Issoufou, A., Mahamadou, E. G., & Guo-Wei, L. (2013). Millets: Nutritional composition, some health benefits and processing — A review.Emirates Journal of Food and Agriculture, 25(7), 501–508. https://doi.org/10.9755/ejfa.v25i7.12045 Jiang, S. L., Wu, J. G., Feng, Y., Yang, X. E., & Shi, C. H. (2007). Correlation analysis of mineral element contents and quality traits in milled rice (Oryza stavia L.). Journal of Agricultural and Food Chemistry, 55(23), 9608–9613.

~ 120 ~ Kiin-Kabari, D. B., Eke-Ejiofor, J., & Giami, S. Y. (2015). Functional and pasting properties of wheat / plantain flours enriched with bambara groundnut protein concentrate. International Journal of Food Science and Nutrition Engineering, 5(2), 75–81. https://doi.org/10.5923/j. food.20150502.01. Kumaravel, V., & Natarajan, A. (2015). Nutritive value of pearl millet grains for poultry feed: A review. International Journal of Science, Environment and Technology, 4(1), 230–233. Retrieved from http://www.ijset.net/journal/537.pdf Laskar, R. A., & Khan, S. (2017). Assessment on induced genetic variability and divergence in the mutagenized lentil populations of microsperma and macrosperma cultivars developed using physical and chemical mutagenesis. PLOS ONE, 12(9), 1–18. https://doi.org/10.1371/journal. pone.0184598 Laskar, R. A., Laskar, A. A., Raina, A., Khan, S., & Younus, H. (2018). Induced mutation analysis with biochemical and molecular characterization of high yielding lentil mutant lines. International Journal of Biological Macromolecules, 109, 167–179. Manning, K., Pelling, R., Higham, T., Schwenniger, J.-L., & Fuller, D. Q. (2011). 4500-Year old domesticated pearl millet (Pennisetum glaucum) from the Tilemsi Valley, Mali: new insights into an alternative cereal domestication pathway. Journal of Archaeological Science, 38(2), 312–322. McBenedict, B., Chimwamurombe, P., Kwembeya, E., & Maggs-Kölling, G. (2016). Genetic diversity of Namibian Pennisetum glaucum (L.) R. BR. (Pearl millet) landraces analyzed by SSR and morphological markers. The Scientific World Journal, 2016, 1–11. https://doi. org/10.1155/2016/1439739 Mukaka, M. M. (2012). Statistics corner: A guide to appropriate use of correlation coefficient in medical research. Malawi Medical Journal, 24(3), 69–71. Nambiar, V. S., Dhaduk, J. J., Sareen, N., Shahu, T., & Desai, R. (2011). Potential functional implications of pearl millet (Pennisetum glaucum) in health and disease. Journal of Applied Pharmaceutical Science, 1(10), 62–67. Retrieved from http://r4d.dfid.gov.uk/Output/190751/ Default.aspx Ocloo, F. C. K., Bansa, D., Boatin, R., Adom, T., & Agbemavor, W. S. (2010). Physico-chemical, functional and pasting characteristics of flour produced from Jackfruits (Artocarpus heterophyllus) seeds. Agriculture and Biology Journal of North America, 1(5), 903–908. https://doi.org/10.5251/abjna.2010.1.5.903.908 Ogori, A. F., Jatua, M. K., Apeh, M. O., & Adamu, L. (2013). Chemical and functional characteristics of flours from blends of millet grain flour from distilled water soaking and malting (Pennesitum glacum). International Research Journal of Food Science and Technology, 1(1), 1–7. Retrieved from http://acascipub.com/Journals.php Okaka, J. C., & Potter, N. N. (1979). Physico-chemical and functional properties of cowpea powders processed to reduce beany flavor. Journal of Food Science, 44(4), 1235–1240. https://doi. org/10.1111/j.1365-2621.1979.tb03488.x

~ 121 ~ Olasupo, F. O., Ilori, C. O., Forster, B. P., & Bado, S. (2016). Mutagenic effects of gamma radiation on eight accessions of cowpea (Vigna unguiculata [L.] Walp.). American Journal of Plant Sciences, 7(7), 339–351. https://doi.org/10.4236/ajps.2016.72034 Omondi, E. G. O., Makobe, M. N., Onyango, C. A., Matasyoh, L. G., Imbuga, M. O., & Kahangi, E. N. (2012). Nutritional evaluation of mutants and somaclonal variants of sorghum (Sorghum bicolor (L) moench) in Kenya. Scientific Conference Proceedings, 5, 577–587. Retrieved from http://www.elearning.jkuat.ac.ke/ Palic, P., Claassens. A. S., Collier. J., Loock. A., & Hattingh. D. (Eds). (2007). Handbook on feeds and plant analysis (2nd ed.). AgriLASA (Agri Laboratory Association of Southern Africa). Rai, K. N., Gupta, S. K., Yadav, O. P., & Govindaraj, M. (2015). Pearl millet improvement for food and nutritional security. Society for Millets Research, ICAR Indian Institute of Millets Research. Retrieved from http://oar.icrisat.org/8800/1/Chapter3.pdf Rohrbach, D. D., Lechner, W. R., Ipinge, S. A., & Monyo, E. S. (1999). Impact from investments in crop breeding: The case of Okashana 1 in Namibia. International Crops Research Institute for the Semi-Arid Tropics. Retrieved from http://oar.icrisat.org/1160/1/RA_00391.pdf Sade, F. O. (2009). Proximate, antinutritional factors and functional properties of processed pearl millet (Pennisetum glaucum). Journal of Food Technology Technology, 7(3), 92–97. Retrieved from http://www.medwelljournals.com/fulltext/?doi=jftech.2009.92.97 Saleh, A. S. M., Zhang, Q., Chen, J., & Shen, Q. (2013). Millet grains: Nutritional quality, processing, and potential health benefits.Comprehensive Reviews in Food Science and Food Safety, 12(3), 281–295. https://doi.org/10.1111/1541-4337.12012 Schoch, T. J., & Maywald, E. C. (1968). Preparation and properties of various legume starches. Cereal Chemistry, 45(6), 564-573. Retrieved from http://www.aaccnet.org/publications/cc/ backissues/1968/Documents/chem45_564 Sehgal, D., Rajaram, V., Armstead, I. P., Vadez, V., Yadav, Y. P., Hash, C. T., & Yadav, R. S. (2012). Integration of gene-based markers in a pearl millet genetic map for identification of candidate genes underlying drought tolerance quantitative trait loci. BMC Plant Biology, 12, 1–13. https://doi.org/10.1186/1471-2229-12-9 Serna-Saldivar, S. O., & Espinosa-Ramírez, J. (2018). Grain structure and grain chemical composition. In J. R. N. Taylor & K. G. Duodu (Eds.), Sorghum and Millets (pp. 85–129). Elsevier. https:// doi.org/10.1016/b978-0-12-811527-5.00005-8 Suma, P. F., & Urooj, A. (2014). Influence of germination on bioaccessible iron and calcium in pearl millet (Pennisetum typhoideum). Journal of Food Science and Technology, 51(5), 976–981. Velu, G., Rai, K., Sahrawat, K., & Sumalini, K. (2008). Variability for grain iron and zinc contents in pearl millet hybrids. Jornal of SAT Agricultural Research, 6, 1–4. Retrieved from http:// ejournal.icrisat.org/Volume6/Sorgum_Millet/KN_Rai.pdf Wheeler, E. L., & Ferrel, R. E. (1971). A method for phytic acid determination in wheat and wheat fractions. Retrieved from http://www.aaccnet.org/publications/cc/backissues/1971/ Documents/cc1971a39.html

~ 122 ~ THE EFFECTIVENESS OF ABORTION LAWS AND POLICIES IN REDUCING THE PREVALENCE OF CHILD MOTHERHOOD IN ZIMBABWE: A REVIEW

Obdiah Mawodza1 and Tendai Makwara2 1 University of the Western Cape, South Africa, Email: [email protected] 2 Central University of Technology, South Africa, Email: [email protected]

ABSTRACT This paper assesses the effectiveness of abortion laws and policies in reducing the prevalence of child motherhood in Zimbabwe. Using a desk research method, the analysis reveals that Zimbabwe falls short in adopting a legal and policy framework that complies with human rights instruments, to which Zimbabwe is party, in guaranteeing the right to access abortion services. The existing abortion laws and policies are restrictive and contribute to elevate the rate of child motherhood and unsafe abortions since there is a high rate of adolescent pregnancy in the country. Courts of law are also limiting rather than expanding the right to access abortion services. Therefore, Zimbabwe must amend its laws and policies to give women, including girls, sufficient ‘enabling rights’ for abortion on request and/or on socio-economic grounds, which ultimately reduces the prevalence of child motherhood in the country. Keywords: Abortion; legal and policy reform; Zimbabwe; girls; reproductive and sexual rights

INTRODUCTION The issue of child motherhood is a problem that affects many girls in sub-Saharan Africa, including Zimbabwe (Darroch, Singh, Woog, Bankole & Ashford, 2016, p. 2). The prominent feature of child motherhood is that it involves a girl child whom by definition in the Convention on the Rights of the Child (CRC) and the African Charter on the Rights and Welfare of the African Child (ACRWC) is a person below the age of 18. This article, thus, defines child motherhood as a situation whereby a girl has given birth before the age of 18, whether she is single or married. Girls in sub-Saharan Africa are susceptible to health risks such as unintended pregnancies, unsafe abortions, and sexually transmitted infections (Savage-Oyekunle & Nienaber, 2017, p. 477). Due to their involvement in early and often unprotected sexual activities, Lukale (2015) noted that girls in sub-Saharan Africa contribute over 50 per cent of the global adolescent birth rate, as well as over 23 per cent of the burden of diseases associated with pregnancy and child and maternal ill health. Coming to Zimbabwe, which is the focus of this study, according to the Zimbabwe National Statistics Agency (2015, p. 25), almost 30 per cent of young women aged 15-19 years have started childbearing (either they have had a live birth or were pregnant with first child). The Ministry of Health and Child Care, through the 2016 Zimbabwe National Adolescent Fertility Study (2016, p. 5) further reveals that 20 per cent of girls become child mothers at the ages between 12 and 17 years. In addition, Zimbabwe National Statistics Agency (2015, p. 27), reports that child motherhood rates are higher in rural areas (20 per cent) than in urban areas (10 per cent). In light of the above, Chandra-Mouli, McCarraher, Phillips, Williamson, and Hainsworth (2014, pp.3-4) observe that the high rates of child motherhood decrease chances of educational attainment by increasing school dropout rates. Additionally, child pregnancy and motherhood is associated with interrupted schooling and school

~ 123 ~ adjustment difficulties during and after pregnancies (Undiyaundeye, Agba, & Mandeun, 2015, p. 285). In support of Undiyaundeye et al. (2015), a survey by Luseno et al. (2017, pp. 8-9) reveals that 82% of the participant young girls who had married prematurely wished that they had done things differently and that they delayed marriage to first obtain secondary school qualifications, a professional course and secure employment. This therefore shows that early childbearing diminishes girls’ access to education and career progression opportunities. Studies show that adolescent girls are frequently victims of sexual assault and violence (UNAIDS, 2015, p.12). Mutumba, Wekesa and Stephenson (2018, p. 3) state that the high level of unintended pregnancies that give effect to children mothered among adolescent girls in Zimbabwe is also associated with a low level of contraceptive use. In a study by UNAIDS (2015, p.12), findings revealed that adolescent girls face significant discrimination and inequality when accessing contraceptive information and services, including particular information on where and how to access emergency contraceptives (UNAIDS, 2015, p.12). As a result Agaba (2018, pp.124-125) conclude that while emergency contraception does not protect against STIs, unhindered access to it is an important tool in the prevention of unintended pregnancies among adolescents, especially pregnancies resulting from sexual violence, and this consequently lends protection against sexual ill health and maternal mortality. More importantly, Zimbabwe is party to human rights treaties that oblige her to guarantee adolescent girls the right to enjoy the highest attainable standard of health. These include the CRC; the ACRWC; the Convention on the Elimination of all Forms of Discrimination Against Women (CEDAW) and the Protocol to the African Charter on Human and Peoples’ Rights on the Rights of Women in Africa (Maputo Protocol). To comply with these treaties, Zimbabwe has integrated the right to health, including access to emergency contraception in its legislation and policies. These legislative and policy frameworks, read together with human rights law, oblige Zimbabwe to firstly, provide girls with access to emergency contraceptives, and secondly to ensure that emergency contraceptives are affordable and readily available. Despite these guarantees, the prevalence of child motherhood remains high in the country and one of the key reasons is inaccessibility to abortion services. In light of the above, this article argues that the strengthening of abortion laws and policies is vital to address child motherhood in Zimbabwe. It addresses how the restrictive laws and policies contribute to elevate the rate of child motherhood and unsafe abortions. It also employs the main case(s) brought before Zimbabwean courts and decisions made thereof. Recommendations emanating from the study are also proffered. While some girls may intend to become child mothers, many of them neither plan nor want pregnancy and childbirth (Yakubu & Salisu, 2018, p. 4). Unintended pregnancies among adolescents, therefore, represent a major socio-economic challenge in Zimbabwe.

METHODOLOGY The study employed a desktop research methodology since it is a desk-based research. It specifically used case law, legislation, textbooks and journal articles, human rights treaties and their treaty bodies, internet resources, government and non-governmental documents. The research method was advantageous because it was inexpensive, provided rich data, good sources of background information, and was unobtrusive. The research method was a platform for critical engagement, analyses and evaluation of literature on the effectiveness of abortion laws in reducing unintended pregnancies among girls.

~ 124 ~ RESULTS AND DISCUSSION

HUMAN RIGHTS STANDARDS ON ACCESS ABORTION SERVICES The CRC and the ACRWC, in articles 24(1) and 14(1), guarantee every child the right to have the best attainable standard of physical, mental and spiritual health. In order to have the best attainable standard of health, Articles 21(1) and 24(3) of the ACRWC and the CRC respectively enjoin State Parties to remove all practices that are prejudicial to the health of children (Mezmur, 2008, p.12). Thus, State Parties must ensure that parents or guardians guard against the use of practices that are prejudicial to the health of children. The Committee on the Rights of the Child (CRC), General comment No. 15 (2013) emphasised that Article 24(1) guarantees a child the right to control his or her health and body, as well as sexual and reproductive freedom to make responsible choices. This interpretation bestows upon girl children, not their parents or guardians, the sole authority to make sexual and reproductive choices concerning their bodies (Detrick, 1999, p. 402). In support of this position, Durojaye (2009, p.152) argues that the adoption of a rights-based approach to realise the rights of adolescents to emergency contraception positively creates an avenue for holding governments accountable to fulfil adolescents’ sexual rights. The ACRWC further contains four major guarantees that influence girls’ access to emergency contraception in Zimbabwe: equality and non-discrimination, the best interests of the child, the right of the child to participate in decisions affecting her, and the evolving capacities of the child concept. This demonstrates an acceptance that adolescent girls not only mature at different rates, but that they attain various levels of competence and insight as they grow (Savage-Oyekunle & Nienaber, 2017, p. 484). Therefore, state parties must ensure that as girls develop into adolescence and adulthood, they must receive confidential information on emergency contraception or about the services themselves.

Apart from the CRC and the ACRWC, the Convention on the Elimination of all Forms of Discrimination Against Women (CEDAW) and the Protocol to the African Charter on Human and Peoples’ Rights on the Rights of Women in Africa (Maputo Protocol) also provide for the right to have the best attainable standard of physical, mental and spiritual health. For example, articles 12 and 14(2)(b) of CEDAW call upon state parties to eliminate discrimination against women, including girls so that they can have access to health care services, including those related to family planning (Pruitt, 2011, p. 350). According to Cusack and Cook (2009, p. 50), article 12 gives women and girls the right to access reproductive services, such as emergency contraception, which are largely inaccessible to them. CEDAW General Recommendation No. 24 (1994) emphasises the need for emergency contraception as ‘girl children and adolescent girls are often vulnerable to sexual abuse by older men and family members, placing them at risk of physical and psychological harm and unwanted and early pregnancy’. For this reason, CEDAW General Recommendation 22 (1995) lists laws that criminalise or restrict abortion as examples of laws that state parties must repeal.

Furthermore, the Maputo Protocol expressly sets forth the reproductive rights of women and girls to medical abortion. Article 14(2)(c) guarantees the right to medical abortion when pregnancy results from sexual assault, rape or incest, or when the continuation of a pregnancy endangers the health

~ 125 ~ or life of the mother, or when there is danger to the life of the foetus (Ngwena & Durojaye, 2014, p.334). Berro Pizzarossa and Durojaye (2019, p. 56) further opine that the right to abortion is two-fold as it, on one hand prohibits the State Parties from interfering with the girl’s decision to have a safe abortion in the permitted circumstances and on the other hand obligates State parties to take positive steps to fulfil the realisation of the right. These obligations require Zimbabwe, for example, not to simply recognise the grounds for abortion, but to also put in place adequate infrastructure, healthcare services and competent human resource for the termination of pregnancy under safe conditions. However, Article 14(2)(c) of the Maputo Protocol excludes socio-economic reasons and upon request as grounds for abortion. Ngwena (2010, p. 843) argues that the circumscribed abortion grounds do not give sufficient ‘enabling rights’ for women to request abortion. Ngwena (2004, p. 334) further observes that excluding socio-economic reasons and upon request as grounds for abortion ‘is a refusal to accept that the majority of women seek abortion because of their socio-economic circumstances and that women are entitled to safe, legal abortion’. Although the Maputo Protocol does not provide for abortion on request and on socio-economic grounds, Nabaneh (2012, p. 39) submits that the African Commission ‘can employ a purposive interpretation by reading implicitly into Article 14(2) (c) for broadly interpreting the right to health’. This would enable girls faced with pregnancy not directly linked with the circumscribed grounds under Article 14(2)(c) to make a choice whether to abort or keep the pregnancy (Nabaneh, 2012, p. 39). Clarifying states’ obligations under article 14(2)(c) of the Maputo Protocol, the African Commission in General Comment 2 (2014) requires state parties to ensure access to health services on a non-discriminatory basis and in ways that are physically and economically accessible, and in which information is accessible (Ngwena, Brookman- Amissah & Skuster, 2015, p.184). General Comment 2 (2014) further prohibits state parties from hindering, directly or indirectly, women’s and girls’ rights and to ensure that they are duly informed on family planning/contraception and safe abortion services (Cook, Dickens & Fathalla, 2004, p. 3). Similarly, Siegel (2007, p. 819) observes that state parties must prevent third parties from interfering with the enjoyment of women’s and girls’ sexual and reproductive rights. It particularly cautions on the use of conscientious objection to hinder access to abortion services for women. The African Commission further enjoins state parties to create legal, economic and social conditions that enable women to exercise their sexual and reproductive rights with regards to family planning/contraception and safe abortion, as well as to enjoy them. More importantly, state parties must adopt relevant laws, policies and programmes that ensure the fulfilmentde jure and de facto of women’s and girls’ sexual and reproductive rights, including the allocation of sufficient and available resources for the full realisation of those rights (Berro Pizzarossa & Durojaye, 2019, p. 57).

Grover (2011) posits that criminal laws penalising and restricting induced abortion are the paradigmatic examples of impermissible barriers to the realisation of women’s right to health and must be eliminated. The Human Rights Committee goes a step further noting that: “in cases where abortion procedures may lawfully be performed, all obstacles to obtaining them should be removed” (Human Rights Committee, 2015, para 11). Moreover, Mendez (2011) argues that the denial of legally available health services, such as abortion and post-abortion care can cause tremendous and lasting physical and emotional suffering that can amount to torture or ill-treatment. This is why the Committee on the

~ 126 ~ Elimination of Discrimination Against Women (2015, para 31) prohibits state parties from adopting unduly burdensome restrictions to abortion services. As will be shown in the discussion below, evidence from the ground continues to confirm that restrictive abortion laws and policies have direct linkages with a high incidence of unsafe abortions and the consequential negative health outcomes (Ashford, Sedgh & Singh, 2012, pp. 1-4). These restrictive abortion laws and policies contribute significantly to child motherhood, maternal mortality rates and preventable deaths. The decriminalisation of abortion and the elimination of barriers in access thereto are therefore also crucial to ensure compliance with other core obligations set forth by human rights instruments and, ultimately reduce the prevalence of child motherhood in Zimbabwe (Berro Pizzarossa, 2018, p.155).

THE ZIMBABWEAN LEGAL AND POLICY FRAMEWORK The Constitution of Zimbabwe Act 20 of 2013 (Constitution), in section 76, guarantees health rights. In keeping with human rights standards discussed above, section 76(1) guarantees every citizen and permanent resident of Zimbabwe access to sexual and reproductive health-care services (Durojaye, 2009, p.158; Banda, 2006, p.72). Thus, a purposive and transformative interpretation of this provision emphatically means that Zimbabwe guarantees girls access to abortion services (Erukhar, Onoka & Phiri, 2005, p. 9; Durojaye, 2011). Section 76(3) further enjoins the government of Zimbabwe to ensure that no person may be refused emergency medical treatment in any health-care institution. Though the Constitution neither defines ‘emergency medical treatment’ nor describes what a medical emergency entails, Jamison, Breman, Measham, Alleyne, Claeson, Evans and Musgrove (2006, pp.1261-1263) have defined emergency medical care as that care delivered in the first few hours after the onset of an acute medical or obstetric problem. Moore (1999, p. 325) also defines emergency medical service as ‘a comprehensive system which provides the arrangements of personnel facilities and equipment for the effective, coordinated and timely delivery of health and safety services to victims of sudden illness or injury. In light of these definitions, the study argues that section 76(3) enjoins Zimbabwe to provide timely emergency medical care to victims of sudden and/or life-threatening health conditions, such as obstetric fistula, in order to prevent needless mortality (Al-Shaqsi, 2010, p. 320). Section 76 is further buttressed by sections 56 and 81(1)(e) of the Constitution that guarantee every person and every child the right to non-discrimination and health care services, respectively. Collectively, these two provisions mandate Zimbabwe to provide for health care services such as abortion, which particularly prevent girls suffering from life-threatening pregnancy health complications. Providing girls with access to abortion services reinforces the CRC and ACRWC, which require Zimbabwe to respect, protect and fulfil the best interests of girls when making a decision whether to keep or terminate pregnancy (Dziva & Mazambani, 2017, 80). Thus, Zimbabwean health care institutions and personals are duty bound to provide girls with affordable and readily available abortion services when requested, without any impediments (CRC Committee, General comment No. 14, 2013, pp. 5-6). While sections 76 and 81 signify an important step towards the realisation of the right to access abortion services, section 48(3) is an obstacle for providing abortion upon request as it protects the rights of the unborn child. Section 48(3) states that: “An Act of Parliament must protect the lives of unborn children and that Act must provide that pregnancy may be terminated only in accordance with that law”. This provision recognises the foetus as an entity with rights worthy of constitutional

~ 127 ~ protection, thereby, protecting the foetus against termination. The constitutional infringement of the pregnant person’s rights is not justifiable until the fundamental proposition of our law that rights and obligations accrue only from birth, expressly alters to accommodate the foetus. This paper submits, therefore, that section 48(3) deprives women and girls their reproductive freedom to terminate pregnancy upon request as enshrined in sections 76 and 81 of the Constitution.

Although the Gender Policy of 2013 gives effect to section 56 of the Constitution that prohibits discrimination by obligating the government to improve gender sensitivity in health service delivery, the policy fails to recommend abortion as one of the effective ways of addressing high levels of maternity that predominantly affect women and girls. Newsday (2017) notes that the government remains enforcing restrictive abortion policies even though statistics reveal that almost 30 per cent of maternal deaths are due to unsafe abortions. There is no doubt that access to legal abortions enables a sexually active girl or one who experiences coerced sex the ability to seek contraceptive services that prevent, among others, pregnancy (Durojaye, 2013, pp. 392-393; Banda, 2006, p.72. This would address the high levels of child maternity that have a direct causal link with child motherhood, since child motherhood is a result of early teenage pregnancy (Zimbabwe National Adolescent Fertility Study, 2016, pp. 39-40). Denying women the freedom to choose and act on decisions concerning their reproduction treats them as a means to an end and strips them of their human dignity (Pickles, 2012, p. 403). As alluded by section 86 of the Constitution, the right to free choice of abortion may only be limited to the extent that the limitation is fair, reasonable, necessary and justifiable. Furthermore, section 86(2)(d) employs a balancing test that there is need to ensure that the enjoyment of rights and freedoms by the foetus does not prejudice the rights and freedoms of the pregnant person. Accordingly, Ngwena (2016) argues that the rights of the pregnant person to bodily integrity, liberty and security of person, human dignity, equality and non-discrimination ought to be accorded due weight. The paper, therefore, argues hereon that the rights of the pregnant girl override whatever rights the foetus may have when she exercises her reproductive freedom concerning fertility. Section 48(3) also validates the Termination of Pregnancy Act (TPA), while the TPA gives effect to the Constitution. TPA is the principal legislation that protects the lives of unborn children and provides circumstances for the termination of pregnancy. Section 3 of the TPA explicitly forbids any person to terminate a pregnancy except in accordance with section 4 of the Act. In accordance with the article 14(2) of Maputo Protocol, section 4, termination of pregnancy can only occur when the continuation of a pregnancy endangers the health or life of the mother, or when there is danger to the life of the foetus, or pregnancy results from unlawful intercourse. Although section 4 guarantees the right to medical abortion, section 5 of the TPA imposes burdensome requirements that pregnant women and girls must fulfil in order to access these services in a practical manner. Section 5 is so complicated that it even retracts the right to abortion that the TPA has already restricted to three circumstances stipulated under section 4. For example, section 5(2) requires two medical practitioners to undertake a medical diagnosis that determines whether the continuation of pregnancy endangers the life of a woman and/ or a girl before certifying her as eligible for abortion. This position contradicts with the Zimbabwe National Youth Policy (2013) that enjoins the government to, among others, “reduce the incidence of teenage and unwanted pregnancies, and the sequel of unsafe abortions” and “strengthen education

~ 128 ~ programmes engaging young people on health issues including HIV and AIDS, STIs, early pregnancy and illegal abortion” (Zimbabwe National Youth Policy, 2013, pp.11 & 19). It is also critical to note that despite denouncing illegal abortion, the Zimbabwe National Youth Policy categorically fails to specify medically authorised abortion as a means to respond to early and unwanted pregnancy.

In addition, Ngwena (2010, p. 849) submits that the requirement of “endangering” the woman’s health under section 4 imports a notion of medicalisation of abortion that has the capacity of reinforcing the present impediments to abortion. Another shortcoming of the TPA is that it only deals with the ‘physical health’ and negates the ‘mental health’ aspect as well as HIV positive pregnant woman desiring to terminate pregnancy. The psychological distress caused by being compelled to become a mother is detrimental to the person’s mental and physical health (Ngwena, 2010, p. 849). Moreover, Feltoe (2006) posits that if a pregnant person has full-blown AIDS, the pregnancy would pose a threat to her mental and physical health and she would be entitled to have the pregnancy terminated on that ground. As regards abortion resulting from of unlawful intercourse, termination can only take place if the medical practitioner firstly receives a court order satisfying that the victim lodged a complaint for the alleged unlawful intercourse (Termination of Pregnancy Act). Secondly, the victim must reasonably believe that the pregnancy is because of rape or incest (Termination of Pregnancy Act). Finally, the pregnant person must a sworn statement under oath that the pregnancy could be the result of rape or incest (Termination of Pregnancy Act). Banda (2005, p.176) critiques these requirements as treating victims of rape or incest as defendants who have to be acquitted in a court of law before they can be permitted to have an abortion. The case of Mildred Mapingure v Mapingure v Minister of Home Affairs & Ors S-22-14 (Mapingure case) bears testimony to the restrictive laws and policies concerning abortion in Zimbabwe. The summary of the facts of the case are that, robbers raped Mapingure at her home. She intended to have the pregnancy terminated in accordance with section 4(c) of the TPA but for her to do so, she needed both a police report confirming that indeed she had been raped and receive the report within 72 hours of the sexual intercourse having occurred. However, because of the delays from the police side, the 72-hour prescription lapsed before she could terminate the pregnancy. After further delays and frustrations from the police, public prosecutor as well as the magistrate, Mapingure finally acquired all the documentation needed. By this time, it was already unsafe to terminate the pregnancy and she eventually gave birth to her child. On appeal, the Supreme Court surprisingly found that the obligations of the state authorities did not extend to the duty to initiate that Mapingure obtain the certificate of termination. The court left the issue of autonomy in decision making open. It also overlooked the laborious process of satisfying the conditions provided for in the Act as being the cause of the delay in granting her permission to have the pregnancy aborted. Had the Supreme Court taken into account the purposive constitutional and human rights interpretation of the rights to health and non-discrimination in particular, it would have appreciated the fact that safe abortions have a time limit and the older the pregnancy is, the more unsafe it becomes to terminate (Van Look & Cottingham, 2002). The Supreme Court would also have appreciated that the lack of urgency by the police and misguided information from the judicial officers stretched Mapingure’s pregnancy into a period where it became unsafe to terminate, thereby infringing on her right to abortion. It is, therefore, evident that grounds for permitting abortion in terms of the TPA frequently fail pregnant

~ 129 ~ women and girls, as they are fraught with administration delays that are even judicially justified. The TPA excludes socio-economic and upon request as grounds for abortion, as does article 14(2) (c) of the Maputo Protocol. The immediate negative effect of limiting women’s and girls’ access to safe, affordable and legal abortion services leads to increases in unsafe and illegal abortions (Banda, 2015, p.1826). To make matters worse, the Criminal Law (Codification and Reform) Act, hereafter the Code, in section 60(1), criminalises any abortion that takes place outside the scope circumscribed by the TPA, with an “unlawful termination of pregnancy” offence. Of noteworthy is that the Code classifies the offence of unlawful termination of pregnancy is a crime against a person because the Constitution recognises a foetus as a person with rights worthy of protection. This further buttresses the restrictive position that gives health professionals and courts as decision makers to decide whether women and girls can terminate the pregnancy. The Code, just like its counterparts, does not give women and girls sufficient ‘enabling rights’ to terminate pregnancy upon request or based on their socio-economic reasons.

The paper further argues that criminalising abortion to prevent persons from making reproductive decisions including those that relate to abortion is inappropriate (Berer, 2017, p. 22). As stated earlier, the use of criminal law to regulate abortion contributes to the high rate of unwanted pregnancies and perpetually discriminates against pregnant girls. Siegel (2008, p.155) argues that the criminalisation of abortion gives preference to patriarchal and religious assumptions about the childbearing role of women in the society and this condones gender discrimination. To illustrate this further, the Girl and Young Women’s Empowerment Framework (2014) recognises that “ignoring the sexual and reproductive health rights of girls and young women has dire consequences that may include loss of life, early/ unwanted pregnancy, illness and untimely cessation of educational and economic advancement” (The Girl and Young Women’s Empowerment Framework, 2014, p.14). It further acknowledges that the lack of functional and accessible girl/young woman friendly comprehensive sexual and reproductive health centres and unequal power relations to negotiate safer sex are contributory factors to almost 30% of the girls that fall pregnant and become child mothers in Zimbabwe (The Girl and Young Women’s Empowerment Framework, 2014, p.14). However, as part of its strategic objective to curb early/unwanted pregnancy and illegal abortion, the framework enjoins Zimbabwe to provide and make accessible to girls and young women’s cultural and religious sensitive sexual and reproductive health services (The Girl and Young Women’s Empowerment Framework, 2014, p. 29). This position enforces stereotypes that compel girls to become mothers and invariably subject them to unsafe and illegal abortion the Framework sought to address. Zimbabwe also launched the National Adolescent Sexual and Reproductive Health Strategy II (Health Strategy II) in 2017. The Health Strategy II aims to address a myriad of sexual and reproductive health challenges facing adolescents and young people. While it recognises that adolescent pregnancy is high among young girls, the Health Strategy II enjoins the government to provide contraceptives, condoms, STD treatment drugs and Anti- Retroviral Therapy, but nowhere does it provide for the termination of pregnancy upon request or on socio-economic grounds. The fact that the National Youth Policy (2013, p.16) purposively states that the youth “have the freedom to choose, to participate in and take decisions in matters affecting them and be ready to accept the consequences of their decisions” is indicative of the government’s

~ 130 ~ restrictive stance on abortion. It puts the blame for pregnancy (whether intended or otherwise) on girls and as a result, they must have to bear the burden of keeping such pregnancy even if they do not wish to do so. This also explains why Zimbabwe couches its laws and policies in a very restrictive manner that is retrogressive in the reproductive freedom of women and girls. Therefore, the laws and policies in Zimbabwe need to confront the biological differences between women and men in a way that will make the legal system responsive to promoting the reproductive rights of women and girls regardless of the biological differences.

CONCLUSIONS AND PERSPECTIVES FOR THE FUTURE This paper reviewed the effectiveness of abortion laws and policies in reducing the prevalence of child motherhood in Zimbabwe. As shown, human rights law reiterates that restrictive abortion laws constitute a grave violation of women’s human rights. In addition, the laws and policies in Zimbabwe are a key barrier to the availability, accessibility, acceptability, and quality of abortion services. While all of the policies discussed above recognise girls face a myriad of sexual and reproductive health challenges, including pregnancy, lack of contraceptives, they fail to give girls sufficient ‘enabling rights’ to terminate pregnancy upon request or based on their socio-economic reasons. The restrictive and archaic laws also contribute to elevate the rate of unsafe abortions. There is no contention in terms of the human rights obligations assumed by Zimbabwe: it must repeal or reform laws that impede the exercise of sexual and reproductive health, including laws that criminalise or restrict access to abortion services. In addition, Zimbabwe must remove and refrain from enacting laws and policies that create barriers in access to sexual and reproductive health services. As discussed above, a critical analysis of the existing legal and policy framework reveals that Zimbabwe has fallen short of adopting a legal and policy framework that complies with international standards in guaranteeing effective access to abortion services, which ultimately reduces the incidences of child motherhood. Women and girls still face serious barriers in access to lawful services, thereby endangering their health and lives. In order to make abortion laws effective in reducing the prevalence of child motherhood in Zimbabwe, there is need to decriminalise abortion. Zimbabwe must shift from regulating abortion from a criminal approach to a human rights approach that enables women and girls to exercise reproductive autonomy on their bodies. There is also need to amend the Constitution and the TPA so that these can give girls sufficient ‘enabling rights’ to terminate pregnancy upon request or based on their socio-economic reasons. Zimbabwe must also enact a policy that provides women/girls and providers of abortion clear and enabling guidelines for implementing access to safe and legal abortion. The Mapingure case must also serve as a stark reminder to have timeous administrative procedures for abortion to ensure that any woman/girl who wishes to terminate her pregnancy may do so, with any impediments.

~ 131 ~ REFERENCES African Commission on Human and Peoples’ Rights. (2014). General Comment No. 2 on Article 14.1 (a), (b), (c) and (f) and Article 14. 2 (a) and (c) of the Protocol to the African Charter on Human and Peoples’ Rights on the Rights of Women in Africa. Retrieved from http://www. achpr.org/instruments/general-comment-two-rights-women/ Agaba, D. K. (2018). Implementing legal accountability to reduce maternal mortality and morbidity in Uganda. African human rights law journal, 18(2), 123-145. Retrieved from http://www. scielo.org.za/pdf/ahrlj/v18n2/08.pdf Al-Shaqsi, S. (2010, July). Models of international emergency medical service (EMS) systems. Oman Medical Journal, 25(4), 320-323. Ashford, L., Sedgh, G. & Singh, S. (2012, April). Making abortion services accessible in the wake of legal reforms. Issues in Brief (Alan Guttmacher Institute), 1, 1-4. Banda, F. (2005). Women, law and human rights: An African perspective. Oxford, UK: Hart Publishing. Banda, F. (2006). Blazing a trail: The African Protocol on Women’s Rights comes into force. Journal of African law, 50(1), 72-84. Banda, P. C. (2015). Status of maternal mortality in Zambia: Use of routine data. African Population Studies, 29(2), 1820-1830. Berer, M. (2017, June). Abortion law and policy around the world: in search of decriminalization. Health and Human Rights, 19(1), 13-27. Berro Pizzarossa, L. (2018, January). Legal barriers to access abortion services through a human rights lens: the Uruguayan experience. Reproductive Health Matters, 26(52), 151-158. Berro Pizzarossa, L., & Durojaye, E. (2019, November). International human rights norms and the South African choice on termination of pregnancy act: An argument for vigilance and modernisation. South African Journal on Human Rights, 35(1), 50-69. Chandra-Mouli, V., McCarraher, D.R., Phillips, S.J., Williamson, N.E., & Hainsworth, G. (2014). Contraception for adolescents in low and middle-income countries: Needs, barriers, and access. Reproductive Health, 11(1), 1-8. Committee on the Elimination of Discrimination against Women. (2015). Concluding observations on the combined seventh and eighth periodic reports of Spain. Retrieved from https://www. refworld.org/docid/5645918c4.html Committee on the Rights of the Child. (2013). General comment No. 15 (2013) on the right of the child to the enjoyment of the highest attainable standard of health (art. 24). Retrieved from https://www.refworld.org/docid/51ef9e134.html Committee on the Rights of the Child. (2013). General comment No. 14 on the right of the child to have his or her best interests taken as a primary consideration (art. 3, para. 1). Retrieved from https://www.refworld.org/docid/51a84b5e4.html Committee on the Rights of the Child. (2013). General comment No. 14 on the right of the child to have his or her best interests taken as a primary consideration (art. 3, para. 1). Retrieved from https://www.refworld.org/docid/51a84b5e4.html Cook R.J., Dickens, B.M., & Fathalla, M.F. (2004). Reproductive health and human rights: Integrating medicine, ethics, and law. Oxford, UK: Clarendon Press.

~ 132 ~ Cusack, S., & Cook, R.J. (2009). Stereotyping women in the health sector: Lessons from CEDAW. Washington and Lee Journal of Civil Rights and Social Justice, 16(1), 47-78. Retrieved from https://scholarlycommons.law.wlu.edu/cgi/viewcontent.cgi?article=1292&context=crsj Detrick, S. (1999). A commentary on the United Nations Convention on the Rights of the Child. The Hague: Kluwer Law International. Durojaye, E. (2009). Realising access to sexual health information and services for adolescents through the Protocol to the African Charter on the Rights of Women. Washington and Lee Journal of Civil Rights and Social Justice, 16(1), Retrieved from https://scholarlycommons. law.wlu.edu/cgi/viewcontent.cgi?article=1295&context=crsj Durojaye, E. (2011, March) Access to contraception for adolescents in Africa: a human rights challenge. Comparative and International Law Journal of Southern Africa, 44(1), 1-29. Durojaye, E. (2013). The potential of the expert committee of the African Children’s Charter in advancing adolescent sexual health and rights in Africa. Comparative and International Law Journal of Southern Africa, 46(3), 385-409. Dziva, C., & Mazambani, D. (2017). The constitutional court ruling against child marriages in Zimbabwe: A landmark decision for advancing the rights of the girl child. Eastern Africa Social Science Research Review, 33(1), 73-87. Erulkar, A.S., Onoka, C.J., & Phiri, A. (2005). What is youth-friendly? Adolescents’ preferences for reproductive health services in Kenya and Zimbabwe. African Journal of Reproductive Health, 9(3), 51-58. Feltoe, G. (2006). Commentary on the Criminal Law (Codification and Reform) Act, 2004. Harare, Zimbabwe: Legal Resources Foundation. Grover, A. (2011). Right of everyone to the enjoyment of the highest attainable standard of physical and mental health. Retrieved from https://documents-dds-ny.un.org/doc/UNDOC/GEN/ N11/443/58/PDF/N1144358.pdf?OpenElement Human Rights Committee. (2015). Concluding observations on The Former Yugoslav Republic of Macedonia. Retrieved from https://tbinternet.ohchr.org/_layouts/15/treatybodyexternal/ Download.aspx?symbolno=CCPR/C/MKD/CO/3&Lang=En Jamison, D. T., Breman, J. G., Measham, A. R., Alleyne, G., Claeson, M., Evans, D. B., & Musgrove, P. (2006). Disease control priorities in developing countries. (2nd. ed.). Washington, DC: The World Bank. Lukale, N. (2015). Adolescent reproductive health concerns in sub-Saharan Africa. Retrieved from https://www.girlsglobe.org/2015/12/15/adolescent-reproductive-health-concerns-in-sub- saharan-africa/ Luseno, W. K., Zhang, L., Iritani, B. J., Hartman, S., Rusakaniko, S., & Hallfors, D. D. (2017). Influence of school support on early marriage experiences and health services utilization among young orphaned women in Zimbabwe. Health Care for Women International, 38(3), 283-299. Memzur, B.D. (2008). The African Children’s Charter versus the UN Convention on the Rights of the Child: A zero-sum game? A Public Law, 23(1), 1-29.

~ 133 ~ Mendez, J. E. (2011). Report of the special rapporteur on torture and other cruel, inhuman or degrading treatment or punishment. Retrieved fromhttps://www.ohchr.org/Documents/ HRBodies/HRCouncil/RegularSession/Session22/A.HRC.22.53_English.pdf Moore, L. (1999). Measuring quality and effectiveness of prehospital EMS. Prehospital Emergency Care, 3(4), 325-331. Mutumba, M., Wekesa, E., & Stephenson, R. (2018). Community influences on modern contraceptive use among young women in low and middle-income countries: a cross-sectional multi- country analysis. BMC Public Health, 18(1), 1-9. Retrieved from https://bmcpublichealth. biomedcentral.com/track/pdf/10.1186/s12889-018-5331-y Nabaneh, S. (2012). A purposive interpretation of Article 14(2)(c) of the African Women’s Protocol to include abortion on request and for socio-economic reasons (Master’s dissertation, University of Pretoria, Pretoria, South Africa). Retrieved from https://repository.up.ac.za/ handle/2263/37388 Newsday. (2017). 20% of maternal deaths due to abortion among young women, girls. Retrieved from https://www.newsday.co.zw/2017/02/20-maternal-deaths-due-abortion-among-young- women-girls/ Ngwena, C. (2004). Access to legal abortion: developments in Africa from a reproductive and sexual health rights perspective. SA Public Law, 19(2), 328-350. Ngwena, C. G, & Durojaye, E. (2014). Strengthening the protection of sexual and reproductive health and rights in the African region through human rights. Pretoria, South Africa: Pretoria University Law Press. Ngwena, C.G. (2010). Inscribing abortion as a human right: Significance of the Protocol on the Rights of Women in Africa. Human Rights Quarterly, 32(4), 783-864. Ngwena, C.G. (2016). Taking women’s rights seriously: using human rights to require state implementation of domestic abortion laws in African countries with reference to Uganda. Journal of African Law, 60(1) 110-140. Ngwena, C.G., Brookman-Amissah, E., & Skuster, P. (2015, May). Human rights advances in women’s reproductive health in Africa. International Journal of Gynecology & Obstetrics, 129(2), 184-187. Pickles, C. (2012). Termination-of-pregnancy rights and foetal interests in continued existence in South Africa: the Choice on Termination of Pregnancy Act 92 of 1996. Potchefstroom Electronic Law Journal, 15(5), 403-433. Pruitt, L. R. (2011). Deconstructing CEDAW’s Article 14: Naming and explaining rural difference. William & Mary Journal of Women and the Law, 17(2), 347-394. Retrieved from https:// scholarship.law.wm.edu/cgi/viewcontent.cgi?article=1311&context=wmjowl Savage-Oyekunle, O. A., & Nienaber, A. (2017). Adolescents’ access to emergency contraception in Africa: An empty promise? African Human Rights Law Journal, 17(2), 475-526. Retrieved from http://www.scielo.org.za/pdf/ahrlj/v17n2/08.pdf Siegel, R. B. (2007). Sex equality arguments for reproductive rights: Their critical basis and evolving constitutional expression. Emory Law Journal 56(4), 815-842.

~ 134 ~ Siegel, R. B. (2008). Abortion as a sex equality right: its basis in feminist theory. In N., Ehrenreich (Ed.), The reproductive rights reader: Law, medicine, and the construction of motherhood (pp.147-160). New York, NY: New York University Press. UNAIDS. (2015). Empower young women and adolescent girls: Fast-tracking the end of the aids epidemic in Africa. Retrieved from https://www.unaids.org/sites/default/files/media_asset/ JC2746_en.pdf Undiyaundeye, F. A., Agba, A. A., & Mandeun, T. (2015). The effect of teenage pregnancy on the girl- child in Nigerian society. International Journal of Multidisciplinary Thought 5(4), 283–289. Van Look, P.F., & Cottingham, J.C. (2002). Unsafe abortion: an avoidable tragedy. Best Practice & Research Clinical Obstetrics & Gynaecology, 16(2), 205-220. Yakubu, I., & Salisu, W.J. (2018). Determinants of adolescent pregnancy in sub-Saharan Africa: A systematic review. Reproductive Health, 15(15), 1-8. Zimbabwe Ministry of Health and Child Care. (2016). Zimbabwe national adolescent fertility study. Retrieved from https://zimbabwe.unfpa.org/sites/default/files/pub-pdf/UNFPA%20NAFS%20 Main%20Report%20%202016%20For%20Web.pdf Zimbabwe. Zimbabwe National Statistics Agency. (2015). Zimbabwe multiple indicator cluster survey 2014: Final Report. Retrieved from http://microdata.worldbank.org/index.php/catalog/2527

~ 135 ~