DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 9,540,633 B2 Brinch-Pedersen Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 9,540,633 B2 Brinch-Pedersen Et Al USOO954.0633B2 (12) United States Patent (10) Patent No.: US 9,540,633 B2 Brinch-Pedersen et al. (45) Date of Patent: Jan. 10, 2017 (54) HIGH EXPRESSION CEREAL PHYTASE FOREIGN PATENT DOCUMENTS GENE WO O1/83763 11 2001 (75) Inventors: Henrik Brinch-Pedersen, Skaelsker WO WO O1/83763 A2 * 11, 2001 (DK); Claus K Madsen, Ringsted WO 2009091518 A2 T 2009 (DK); Giuseppe Dionisio, Slagelse (DK); Preben Bach Holm, Valby (DK) OTHER PUBLICATIONS Sequence 8 from Patent WO0183763, Gen Bank Accession No. (73) Assignee: AARHUS UNIVERSITET, Aarhus C AX298.2091. (DK) Keskin et al., 2004, Protein Science 13: 1043-1055.* Guo et al., 2004, Proceedings of the National Academy of Sciences (*) Notice: Subject to any disclaimer, the term of this USA 101: 9205-9210. patent is extended or adjusted under 35 Thornton et al., 2000, Nature Structural Biology, structural genomic supplement, Nov. 2000:991-994.* U.S.C. 154(b) by 346 days. Clark et al., 2006, Nature Genetics 38: 594-597.* “Accession No. NGB10901” SESTO data portal, May 30, 2001, (21) Appl. No.: 14/110,763 XP000002658140, retrieved from the Internet: URL:http://nordgen. org/index.php/en/content/view/full/344 (retrieved on Sep. 2, 2011). (22) PCT Filed: Apr. 25, 2012 Baumlein, H., Nagy I., et al (1992) Cis-analysis of a seed protein gene promoter: the conservative RY repeat CATGCATG within the (86). PCT No.: PCT/EP2012/057515 legumin box is essential for tissue-specific expression of a legumin gene, Plant Journal 2: 233-239. S 371 (c)(1), Blackwell, T.K., Bowerman, B., et al., (1994) Formation of a (2), (4) Date: Jan. 23, 2014 monomeric DNA binding domain by Skin-1 b/IP and homeodomain elements, Science 266: 621-628. Brinch-Pedersen, H. Galili, F., Knudsen, S., & Holm, P.B., (1996) (87) PCT Pub. No.: WO2012/146597 Engineering of the aspartate family biosynthetic pathway in barley PCT Pub. Date: Nov. 1, 2012 (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and (65) Prior Publication Data dihydrodipicolinate synthase, Plant Molecular Biology, 32(4), 611 620. US 2014/O2592 11 A1 Sep. 11, 2014 Brinch-Pedersen et al., (2002) Engineering crop plants: getting a handle on phosphate, Trends in Plant Science, vol. 7, No. 3, Mar. 2002, 118-125. Related U.S. Application Data Database Emb|L—Apr. 19, 2011 “Hordeum vulfare cv. Igri PAPhy a gene for pruple acid phosphatase isoform a.” XP (60) Provisional application No. 61/479.689, filed on Apr. 00000268141, retrieved from EBI accession No. 27, 2011. EM PL:FR851293, Database accession No. FR851293. Database Emb|L (Online) May 18, 2011, “Secale cereale cultivar (30) Foreign Application Priority Data Picasso clone ScPCRG1 PAPhy all gene, complete cds.” XP0000026858143, retrieved from EBI accession No. EM PL: Apr. 27, 2011 (EP) ..................................... 11163875 JF838319. Database accession No. JF838319, “sequence”. Database Emb|L (Online) May 18, 2011, “Secale cereale cultivar Picasso clone Sc2G1 PAPhy all gene, partial cds.” (51) Int. Cl. XP0000026858144, retrieved from EBI accession No. EM PL: CI2N IS/OI (2006.01) JF838320, Database accesison No. JF838320, "sequence”. AOIH I/06 (2006.01) Database EMBL, May 18, 2011, “Triticum monococcum cultivar AOIH 5/10 (2006.01) NGB10901 PAPhy a1 gene, complete cds,” XP0000026858142, CI2N 9/16 (2006.01) retrieved from EBI accession No. EM PL: JF838315, Database accesison No. JF8383.15. CI2N 5/82 (2006.01) Depater S. Katagirl, et al (1994) bZIP proteins bind to a CI2O I/68 (2006.01) palindromic sequence without an ACGT core located in a seed (52) U.S. Cl. specific element of the pea lectin promoter, Plant Journal 6: 133 CPC ................. CI2N 15/01 (2013.01); A0IH 5/10 140. (2013.01); C12N 9/16 (2013.01); CI2N Dvorakova, 1998, Phystase: Sources, Preparation and Exploitation, 15/8234 (2013.01); C12N 15/8243 (2013.01); Folia Microbiol. 43 (4), 323-338. CI2O I/6895 (2013.01); C12Y-301/03026 (Continued) (2013.01); C12O 2600/156 (2013.01) Primary Examiner — David T Fox (58) Field of Classification Search Assistant Examiner — Bratislav Stankovic None (74) Attorney, Agent, or Firm — McKee, Voorhees & See application file for complete search history. Sease, PLC (56) References Cited (57) ABSTRACT The present invention provides mutant cereal plants and U.S. PATENT DOCUMENTS mature grain thereof, characterised by enhanced levels of the enzyme phytase in the grain, and methods for inducing, 7,214,786 B2 * 5/2007 Kovalic ............... CO7K 14,415 detecting and selecting the mutant cereal plants. The inven 530/324 tion further relates to animal feed comprising said grain 2008/031 1659 A1* 12/2008 Huynh ............... C12N 15,8218 435/375 having enhanced amounts of phytase. 2010, 0186127 A1 7/2010 Byrum et al. 4 Claims, 11 Drawing Sheets US 9,540,633 B2 Page 2 (56) References Cited Olsen, O., et al. Sodium azide mutagenesis: Preferential generation of AT-> GC transitions in the barley Ant18 gene, Proc. Natl. Acad. Sci USA (1993) vol. 90, pp. 8043-8047. OTHER PUBLICATIONS PlantCARE, a database of plant cis-acting regulatory elements and Eeckhout W. Depaepe M (1994) Total phosphorus, phytate-phos a portal to tools for in silico analysis of promoter sequences: Magali phorus and phytase activity in plant feedstuffs, Anim. Feed SciTech Lescot, Patrice Déhais, Gert Thijs, Kathleen Marchal, Yves Moreau, 47: 19-29. Yves Van de Peer, Pierre Rouzéand Stephane Rombauts, Nucleic Engelen, A.J., Vanderheeft, Randsorp, et al (1994. Simple and Acids Res., Jan. 1, 2002; 30(1): 325-327. Rapid-Determination of Phystase Activity, Journal of Aoac inter Rasmussen et al., 2007, Transitions from Nonliving to Living national, 77(3), 760-764. Matter, Science, vol. 303, Feb. 13, 2004, pp. 963-965. Fujiwaraa, T. Mabara E., et al (2002) Storage Proteins. The Veintraub, I. A. &Lapteva, N.A. (1988) Colorimetric determination arabidopsis Book, 2002 American Scoiety of Plant Biologists. of phytate in unpurified extracts of seeds and the products of their G. Dionisio et al. “Cloning and Characterization of Purple Acid processing, Analytical Biochemistry 175(1), 227-23, dio: 10. 1016/ Phosphatase Phytases from Wheat, Barley, Maize, and Rice.” Plant 0003-2697(88)90382-x. Physiology, vol. 156, No. 3, Jan. 10, 2011, pp. 1087-1100, Wittwer, C. T., et al., (2003) High resolution genotyping by XP55006061 amplicon melting analysis using LCgreen Clinical Chemistry: 49:6 Mixed, Mutated and Random Nucleotide Sequences, Retrieved 853-860. from Internet on Jan. 10, 2014, URL: http://molbio.ru/eng/scripts/ Wu CY, Suzuki A. et al., ( 1998) The GCN4 motif in a rice glutelin 01. 16.html. gene is essential for endosperm-specific gene expression and is Jeffersen, R.A., Kavanagh, T.A., & Bevan, M. W. (1987) GUS activated by Opaque-2 in transgenic rice plants. Plant Journal 14: fusions: beta-glucuronidase as a sensitive and versatile gene fusion 673-683. marker in higher plants, Embo Journal 6(13), 3901-3907. Zhu, B. G., Cai, G. F., Hall, E. O., & Freemen, G. J. (2007X. Kimber, G., * Sears, E.G. (1979) Use of wheat aneuploids, Basic In-Fusion (TM) assembly: Seamless engineering of multidomain Life Sciences, 13, 427. fusion proteins. modular vectors, and mutations. Biotechniques, Lott, 1984. Accumulation of Seed Reserves of Phosphorus and 43(3), 356-359, doi:10.2144/0001 12536. Other Minerals, Mineral Reserves, Seed Physiology, vol. 1, pp. 139-166. * cited by examiner U.S. Patent Jan. 10, 2017 Sheet 2 of 11 US 9,540,633 B2 on 6000 S 5000 4000 3OOO 2OOO 1OOO s Figure 2. U.S. Patent US 9,540,633 B2 ©?un61– U.S. Patent Jan. 10, 2017 Sheet 4 of 11 US 9,540,633 B2 U.S. Patent Jan. 10, 2017 Sheet S of 11 US 9,540,633 B2 00:00!----00'00100:00!00:00! 00‘001,100'004 G?un61– U.S. Patent Jan. 10, 2017 Sheet 6 of 11 US 9,540,633 B2 -83 2. ag2 is imbda ciore, Skage cultivar secreccAAAAAAaaca 45 Skage; PCR clone scietscassicacas, 5. 3. PC cling AcAAAAAAACA As Per PR is """A"AAAAAAAA As a CR GcGCGGCAAGAAAAAA a. arease cine GGGCACAAGAAAAAA s Race EPR line scoresc Accessaic is Spe: PCR cine GCCACCACAA A. High Phy D. PCR clone fit GTGCTGcGct AGTTGAAGGAAG rigAGAAGA a. High Phy 2 PCR ciore first rescroscot Actric AACAC Artist AGAAA ais 393 PCR is coor AAAAAAA is NGSSS PR care GCGCAGAAAAAA 4. 8. & TaG2 abda cloie, Skage. Litiwar AscassacAAAAA Skager PCR claris sesselagic Age AAAA Scier AAAAAAAAA sire ASCAAGAAAACA 9. air Rise As AAAcAAAAAA 9. gica: PCR cle As AAA-CSAAAA 9. acac PCR is: ASCAGAGCCAAACAGAC 9. Spelt PCR clone AAGGGAAAAAAGAA HighPhy. PCR clone AAAAAAAEC 9. High Piry O2 PCR clone AAAssissCA's s Gisg:3 c is GAAccAggAAAccesco, Aag Ace Age 90 NGS355 Rare CAAAAAs CA 9. i -: s a2 iambda ciore, Skagen cultivar AAAAAAAssissCAA 35 Skagen PCR clone scalist Assiss 35 38 ge scAAAAAAAssass 3S Petit PCR if GCGSACAAGAAAAGGCAGGGGAAG 135 air PCR cing ScAAAAAACA CAAAs. 13s cris: 3 is GGGAAAAAAACAGGGAA 3S airic PR car GCGs AAGAAAAAGAA 135 Spe. PCR clone GGCSAAAAAAA 3s High Phy? PCR clone sccess AACAAAAsssssss 3S High Phy (2 PCR clone GAAAAAAAGAAAA 35 GSS-3 Fire GcGCGCGT CACAAGGCACCAAAGCGCAGGCGGCAAAG GC 35 GSS5 class GCTGCGCGTTCACAAGGCACCAAAGGGCAGGCGGGAAAGTTT GC 3S . :2 s Tag2 ambda ciore, Skagen cultivar AAAAAssissCAA 8 Skagen PCR clare GAA Segas. Aggs AGA 8 Firs AccA 8 eign A cassissCAssaac 8. circle Associates asses date: PCR ch CAAAAAGs. A 8. if 2 PR car GAATGGAAGs. A 8. Sps PCR rifle A seases high Pily PCR title cassass 8. HighPhy2 PCR clong Accoa AgesscasAs. 8. GE93 PCR core is A. Access AAA gag AGA 8 NGSSSSS PCR GAAGCCAAGGGAGA i8O x: 8. ag2 and cine, Skage Litva AgataAAccAAAccAAcc s Skager PCR clone GAACTAC 2S cit We CRiene AGGAAAAACACACCACCC 22S retirie Asiacea AAccaccaccitacc 22 arrier AAAACAATCAA 225 first PR is GAAAGAAAG ACTGGAA 22 aica FCR ir AGAAAAGASATAA 25 Sps PCR clone AACAAcces 25 High Phy: PCR clare Asgaas ACAcostscasAAC 225 High Phy & PCR clone AGGAAAAGAA.GGAA 25 393 if AGAAAACTAC 23S NBSSSR tra GAAAAACCACCACCCCCGGCCAAcc 225 s: xi.
Load more

Recommended publications
  • Lipids and Fats [email protected]
    The Biochemistry of Rice Human Metabolome Technologies America, Inc. 24 Denby Road, Suite 217, Boston, MA 02134 p. 617-987-0554 f. 617-902-2434 Lipids and Fats [email protected] THE STORY OF RICE LIPID CONTENT Rice (Oryza sativa L.) is one of the quality of rice. A number of studies have shown with a few exceptions, there is no Phosphatidylcholine most important cereal crops cul- that rice bran oil reduces the substantial difference in total lipid Oryza sativa, or Asian rice, con- CH2 tivated in the world; it feeds more tains two broad groups: indica harmful cholesterol (LDL) without content. − than half of the world’s popula- changing good cholesterol (HDL). R COO CH O (long-grain) and japonica − − − −OOCRˈ + tion. Metabolome analysis, the On the other hand, reports Phosphatidylethanolamine (short-grain). Other types of CH2 O P O CH2CH2N(CH3)3 investigation of all cellular me- Asian rice include glutinous rice showed that the hydrolysis and ox- ʺ − − tabolites, has become an import- idation of rice fat are responsible CH2 O and aromatic rice. All varieties of − − − − − for rice aging and deterioration of O ant strategy for gaining insight rice can be processed post-har- R COO CH Phosphatidyldimethylethanolamine − − into functional biology around vest as either white or brown grain flavor during storage, and − −OOCRˈ � low-oil rice cultivars are more suit- CH2 O P O CH2CH2NH2 CH understanding the flavor, health rice, affecting flavor, texture and 2 ʺ − − benefits, aroma and cultivation nutritive value. In short-grain rice able for grain storage The lipids of OH R COO CH− O these rice brans comprised mainly − − − − processes in rice production.
    [Show full text]
  • I S S U E 1 J U N 2 0 2 0 N O T E S F R O M T H E E D I T O R 01 of Sowing
    I S S U E 1 J U N 2 0 2 0 N O T E S F R O M T H E E D I T O R 01 OF SOWING: By EUGENE WAMBECK We started the year with jubilant topic last year. It should be a expectations for a new decade of recurring theme to guide our efforts change. In recent months though, to develop society even as we push an obscure virus has dominated through this decade. It is fitting the news and our thoughts, then that the United Nations has foreshadowing the joy of major declared 2020 as the International events around the World such Year of Plant Health. The UN as the Tokyo 2020 Olympics. General Assembly see this year as Despite the gloom, and desperate an opportunity to raise awareness measures most countries have on protecting plant health in been forced to take to contain the order to end hunger, protect the virus, the human spirit remains environment and sustain economic strong. We’ve seen great examples development. It is a clarion call for of neighbourliness and sacrifice measured stewardship! to help one another tide through this crisis. On the scientific front, In this maiden edition of there is a silver lining as well. Whilst ISawtheScience, we echo the conditions are tough for every one United Nations’ 2020 theme and and some fear prevails, there has cast the spotlight on plants. They been an unprecedented effort to inhabit the Earth with us, but we increase scientific communication. often take plants for granted.
    [Show full text]
  • Page 1 MAILLARD P E R F E C T I N G
    V O L . O N E MAILLARD PERFECTING RECIPES WITH SCIENCE The FoodSci Team THE FOODSCI TEAM President: William Hannon Vice President: Josephine Niu Secretary: Owen Hannon Director of Communications: Sienna Nimmer plus members and contributors MAILLARD MAILLARD PERFECTING RECIPES WITH SCIENCE The FoodSci Team LULU PUBLISHING DEDICATED TO THE READER: THAT YOU DO NOT FIND THIS BOOK BORING. Contents 64 Bread FoodSci's Favorite Baguettes • 67 Beginner's Sourdough Loaf • 71 Laugenbrötchen • 77 Cinnamon Swirl Bread • 81 Uber-Soft Dinner Rolls • 85 New York Bagels • 89 92 La Pizza Sourdough Pizza Dough • 95 Introduction • 10 FoodSci's Favorite Pizza Dough • 99 Basic Ingredients • 14 Neapolitan Pizza Sauce • 101 Basic Margherita Pizza • 103 Buffalo Chicken Pizza • 107 36 Frozen "Better-Than-The-Pizzeria" Garlic Knots • 109 Coconut Ice Cream • 39 Strawberry Honey Sorbet • 41 Spaghettieis • 43 112 Les pâtisseries Pain au Chocolat • 115 44 Brown Butter-Blueberry Pinwheel Cakes, Cookies, Pastries • 123 and Assorted Chaussons aux Pommes • 127 Desserts Browning Butter • 47 FoodSci's Favorite Chocolate Mousse • 132 Pies and Tarts 51 Chocolate Meringue Cookies • 55 FoodSci's Favorite Pie Crust • 135 Chocolate-Chunk Mousse Cake with Renaissance Apple Tart • 137 White Chocolate Whipped Cream • 57 FoodSci's Favorite Lemon Meringue FoodSci's Favorite Chocolate Chip Pie • 141 Cookies • 61 FoodSci's Favorite Coconut Cream Pie • 145 FoodSci's Favorite Key Lime Pie • 149 Resources • 150 Acknowledgments • 156 Introduction The Maillard reaction is perhaps the most predominant example of molecular gastronomy and culinary chemistry found in both cooking and baking. It refers to the process that gives brown food its distinctive flavor.
    [Show full text]
  • Protection of Farm-Stored Grains, Oilseeds and Pulses from Insects, Mites and Moulds
    Protection of farm-stored grains, oilseeds and pulses from insects, mites and moulds Publication 1851/E (Revised) 1 Protection of farm-stored grains, oilseeds and pulses from insects, mites and moulds Recommendations for pesticide use in this publication are intended as guide­ lines only. Any application of a pesticide must be in accordance with directions printed on the product label of that pesticide as prescribed under the Pest Control Products Act. Always read the label. A pesticide should also be recommended by provincial authorities. Because recommendations for use may vary from province to province, your provincial agricultural representatives should be consulted for specific advice. Covering Page Illustration (Top) Steel bins used for farm grain storage in Western Canada; (bottom left to right) Aspergillus mould on wheat, mould mites and rusty grain beetles. This document is available via the Internet at the Cereal Research Centre’s web page at http://www.agr.gc.ca/science/winnipeg/ Agriculture and Agri-Food Canada Publication 1851/E (Revised) © Cereal Research Centre. 2001. 195 Dafoe Road, Winnipeg, Manitoba R3T 2M9 Replaces 1851/E Également disponible en français sous le titre Protection des céréales, des oléagineux et des légumineuses à grain entreposés à la ferme contre les insectes, les acariens et les moisissures 2 Preface This publication describes pests of farm-stored grains, oilseeds and pulses and outlines methods for their prevention, detection and control. Prolonged storage of such crops occurs mainly on the farm, so pests are most likely to cause damage in farm bins. To avoid or control damage caused by pests, the producer needs to understand the problem and use current control practices.
    [Show full text]
  • SCIENTIFIC REVIEWS Bread, Oldest Man-Made Staple Food in Human
    WEBSITE: www.chem-tox-ecotox.org/ScientificReviews 15/11/2018 SCIENTIFIC REVIEWS Bread, Oldest Man-made Staple Food in Human Diet Bread intake is integral to good health and whole grain cereals beneficial against chronic diseases Athanasios Valavanidis Department of Chemistry, National and Kapodistrian University of Athens, University Campus Zografou, 15784 Athens, Greece ABSTRACT Bread is the most important staple food of humans from the prehistoric time. Baked bread is integral to human health with plenty of major nutrients, antioxidants and vitamins. After thousands of years, it remains the most regularly consumed food in the world, due to its convenience, portability, nutrition, and taste. Archaeological studies found that prehistoric human food hunter-gatherers started baking bread at least 30,000 years ago. Annual global wheat production is around 700 million tons. Over the same period the global average production of rice was 704 mt and for maize 874 mt. In the last decades a large number of scientific studies analysed wheat grain composition, protein content, essential amino acids, carbohydrates, mono- and oligo- saccharides, starch, vitamins, minerals, metals, dietary fibers, polyphenols, protenoids and carotenoids. All these components of wheat grain have direct relevance to human nutrition and health because they provide nutritional quality, energy and essential micro nutrients. Beneficial health effects from whole grain bread and other cereals have been studied by a large number of epidemiological and dietary studies. Most of the results found that consumption is associated with reduction of chronic diseases, such as coronary heart and cardiovascular diseases (CVDs), colon and breast cancers, obesity, type 2 diabetes and gastrointestinal diseases.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2005/0089602 A1 Kvist Et Al
    US 2005.00896O2A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2005/0089602 A1 Kvist et al. (43) Pub. Date: Apr. 28, 2005 (54) PROCESS FOR THE FRACTIONATION OF Publication Classification CEREAL BRANS (51) Int. Cl." ....................................................... A23K 1100 (76) Inventors: Sten Kvist, Odakra (SE); Tommie (52) U.S. Cl. ................................................................ 426/52 Carlsson, Hoganas (SE); John Mark Lawther, Roskilde (DK); Fernando (57) ABSTRACT Bastile DeCastro, Campinas/SP (BR) A process for the fractionation of valuable fractions from Correspondence Address: cereal brans (e.g. wheat, barley and oat brans, and rice Matthew E. Connors polish) is described. In particular, this invention describes a Gauthier & Connors LLP two step process, in which the Said bran is first Subjected to Suite 3300 a combination of enzymatic treatment and wet milling, 225 Franklin Street followed by Sequential centrifugation and ultrafiltration, Boston, MA 02110 (US) which aims at physically Separating the main bran factions, i.e. insoluble phase (pericarp and aleurone layer), germ-rich (21) Appl. No.: 10/643,402 fraction, residual endosperm fraction and Soluble Sugars. A Second Step consists of fractionating cereal brans Substan (22) Filed: Aug. 19, 2003 tially free of Soluble compounds, hence insoluble phase from the above-mentioned first Step, by enzymatic treatment Related U.S. Application Data with Xylanases and/or beta-glucanase and wet milling, fol (63) Continuation of application No. PCT/SE02/00309, lowed by Sequential centrifugation and ultrafiltration, which aims at physically Separating the main fractions, i.e. filed on Feb. 21, 2002. insoluble phase (remaining cell wall components), protein (30) Foreign Application Priority Data rich fraction, Soluble hemicellulose and oligosaccharide, and therefore maximizes the extraction rate of valuable cell wall Feb.
    [Show full text]
  • Public Health Reports Vol
    Public Health Reports Vol. 55 o MARCH 29, 1940 * No. 13 ATTEMPTS TO PRODUCE TUMORS IN RATS BY FEEDING CRUDE WHEAT GERM OIL MADE BY PROLONGED ETHER EXTRACTION' By HAROLD BLUMBERG, Research Fellow, Aational Cancer Institute, United States Public Health Service In 1937 Rowntree, Lansbury, and Steinberg (8) reported the occurrence of malignant intra-abdominal tumors in albino rats that were fed a crude wheat germ oil prepared by ether extraction. This initeresting observation was confirmed in a simultaneous publication by Dorranice and Ciccone (4), who repeated the work with the use of materials from Rowntree's laboratory at the Philadelphia Institute for Medical Research. Rowntree and his collaborators (10) were able to produce these tumors, usually transplantable spindle-cell sarcomas, in more than 90 percent of the animals fed. Rats of the NVistar, Buffalo, and Yale albino strains were used. When daily doses of 1 cc. were administered, either poured over the diet or given directly by dropper, tumors were palpable in fronm 36 to 268 days. When larger doses were used, as approximately 21 percent of a diet niixture or as daily supplements of 3.5 to 4 cc., tumors were produced in as little as 13 days and in an average of about 54 days. The active fraction was apparently in that portion of the oil which settled out when kept in the refrigerator. Negative results were secured with refined wheat germ oil from ether extraction, expressed oil, naphtha extracted oil, and vitamin E concentrate. After further investigation, Rowntree, Steiniberg, and Browm (9) reported that the prinary site of tumor oiging seemed to be chiefly tbe intestinal wall in the 109 tumor-bearing animals which they had observed.
    [Show full text]
  • Food Microbiology 79 (2019) 90–95
    Food Microbiology 79 (2019) 90–95 Contents lists available at ScienceDirect Food Microbiology journal homepage: www.elsevier.com/locate/fm Potential reservoirs and routes of Cronobacter transmission during cereal growing, processing and consumption T Xiuqin Loua, Hua Yua, Xuchu Wanga, Jianjiang Qib, Wei Zhanga, Haoqiu Wanga, Guojing Sia, ∗ Shujuan Songa, Chuang Huangc, Tao Liua, Wei Zhenga, Zhiguo Fangc, a Hangzhou Center for Disease Control and Prevention, Hangzhou, 310021, China b Hangzhou Xixi Hospital, Hangzhou, 310023, China c College of Environmental Science and Engineering, Zhejiang Gongshang University, Hangzhou, 310018, China ARTICLE INFO ABSTRACT Keywords: Cronobacter are opportunistic bacterial pathogens of both infants and adults. We investigated the incidence and Cronobacter distribution of Cronobacter in 1245 samples of cereal and related environments. 39.1% (101/258) rice-related Reservoir and 46.9% (98/209) wheat-related samples tested positive for Cronobacter, and the positive rate differed notably Routes of transmission according to processing method. Cronobacter was found in rice and wheat plants at the tillering, filling and Domestic environment mature stages. Soil, water and swab samples from nearby milling plants were assayed, and results revealed that 6.3% (7/122) of water from paddy fields, 49.1% (28/57) and 62.1% (41/67) of swab samples from rice and wheat flour milling plants were Cronobacter positive. Pulsed-field gel electrophoresis (PFGE) subtyping indicated that some strains had a common profile, which suggested their persistence in the environment, potential transmission routes and cross-contamination in processing. Finally, we surveyed 18 families to evaluate potential risks. None of the families who primarily ate rice cooked with water tested positive for Cronobacter, though of 66.7% families (6/9) whose food staples were produced from wheat flour tested positive.
    [Show full text]
  • Coriolis DAFWA Growing the North
    GROWING THE NORTH Market opportunities for irrigated agricultural produce from northern Western Australia FINAL DISCUSSION DOCUMENT; under contract DAFWA244; November 2015 INHERENT LIMITATIONS ACCESSIBILITY This work was commissioned by the Department of Agriculture and e. any Coriolis Commentary accompanying the Coriolis document Coriolis seeks to support the widest possible audience for this Food Western Australia (DAFWA) and prepared by Coriolis. This is an integral part of interpreting the Coriolis document. research. This document has been designed to be as accessible to work is based on secondary market research, analysis of Consideration of the Coriolis document will be incomplete if it is as many users as possible. information available or provided to Coriolis by our client, and a reviewed in the absence of the Coriolis Commentary and Coriolis range of interviews with industry participants and industry experts. conclusions may be misinterpreted if the Coriolis document is Any person – with or without any form of disability – should feel Coriolis have not independently verified this information and make reviewed in absence of the Coriolis Commentary. free to call the authors if any of the material cannot be understood no representation or warranty, express or implied, that such or accessed. information is accurate or complete. Coriolis is not responsible or liable in any way for any loss or damage incurred by any person or entity relying on the information We welcome opportunities to discuss our research with our Projected market
    [Show full text]
  • Functional Foods: Overview Functional Foods: Dietary Fibers, Prebiotics, Probiotics, and Synbiotics Nutrition: Soy-Based Foods
    NUTRITION AND FOOD GRAINS Food Grains and Well-Being Contents Functional Foods: Overview Functional Foods: Dietary Fibers, Prebiotics, Probiotics, and Synbiotics Nutrition: Soy-Based Foods Functional Foods: Overview G Bultosa, Botswana College of Agriculture, Gaborone, Botswana; Haramaya University, Dire Dawa, Ethiopia ã 2016 Elsevier Ltd. All rights reserved. Topic Highlights Consumption of an adequately balanced diet is a means of body structure formation, energy generation, and health. More • Functional food concepts/definitions. than 2500 years ago, ‘Let foods be our medicine and medicine • Bioactive compounds. be our foods’ was stated by Hippocrates. This shows that • Chronic diseases and functional foods. consumption of diets with health-promoting effects is not • Gluten-free foods for celiac patients. new. But evidence on the relationship between dietary chem- ical component(s) and health is on evolutionary development as technology and human comprehension advance. Within Learning Objectives such evolution, the concept of functional foods was started in the 1980s as Foods for Specified Health Use (FOSHU) • To achieve understanding on the concepts/definitions of in Japan. Foods, when consumed as a regular diet that supplies functional foods. one or more bioactive components beyond basic nutrients and • To achieve understanding of bioactive compounds used in offer health-promoting effects, are today branded as functional functional foods, grain dietary sources, and potential effects foods. Functional foods are not prescribed drugs, dietary sup- on health. plements, medical foods of therapeutic effects, traditional • To impart processing principles on grain-based functional medicines, or nutraceuticals. Functional foods are distinct foods. from macronutrient and micronutrient supplements targeted to achieve balanced diets and to treat nutrient deficiency syn- dromes.
    [Show full text]
  • April 30, 1946. E. LEVIN Re. 22,748 METHOD of TREATING CEREAL GRAIN GERM Original Filed Aug
    April 30, 1946. E. LEVIN Re. 22,748 METHOD OF TREATING CEREAL GRAIN GERM Original Filed Aug. 6, 1936 Reissued Apr. 30, 1946 Re. 22,748 UNITED STATES 22,748PATENT of FICE METHOD of TREATINGGBM CEREAL. GRAN. Erra Levin, Monticello, u. original No. 2,314,2s2, dated March 16, 1943, Seria No. 94.09, August 8, 1938. Appeation m for reissue October 27, 1943, serial No. 50,866 19 Claims. (C. 99-80). This invention relates to a method of prepar bryo of wheat grain, but it is also present in the ing anti-neuritic products of edible character, germ or embryo of other cereal gr such as such as foods and medicines, and to the products barley, rye, corn and oats. Heretofore the anti obtained by such method of treatment. neuritic factor in cereal grain germs has been It is known that the so-called vitamins possess but slightly utilized due to the fact that germs various properties and are intimately concerned tend to turn rancid on standing. The present with the maintenance of bodily processes, and invention contemplates treating the various cereal thus are inseparably connected with the normal grain germs, and particularly the wheat germ physiology of the animal, including man. Thus and the corn germ, to render them palatable and it is commonly accepted that vitamin A functions 10 preservable, thus making the vitamin “B” read to prevent certain types of infections, because its ily available for use as a food or medicine. To absence from the diet results in inflammation of ...this end the oil in the cereal grain germs, particu the eyes, the growth of the animal ceases, and if larly wheat germ and corn germ, is extracted, the condition be not corrected, death usually leaving a wholesome and preservable product.
    [Show full text]
  • Unite Statesp?T?Nt of "Ice Patented Mar
    2,879,167 Unite Statesp?t?nt of "ice Patented Mar. 24, 1959 1 . 2 , di?iculties, on roller mills. The production of super?ne ?our from such ground and milled substantially de-oiled 2,879,167 cereal germs by sifting and sieving does not cause any dif?culty. PROCESS OF MAKING GERM FLAKES The resulting germ ?ours’ are comparatively stable, Felix Grandel, Inningeu, near Augsburg, Germany due to their low oil content. They can be stored in the samemanner as wheat ?our without becoming rancid. No Drawing. Application June 24, 1954 However, they still possess a bitter taste which limits Serial No. 439,125 their use as foodstuff. It has been found that the bitter , Claims priority, application Germany June 26, 1953 _ taste of such germ ?ours is dependent upon their de* gree of comminution. Flours which have been ground 1 Claim. (or. 99-80) only to a low degree of comminution and have as low a content of crude ?ber and bran particles as possible, have the best taste while highly comminuted ?ours which _ The present invention relates to a process of debitter contain large amounts of bran contain also large amounts ing germs and/or seedlings of cereals and more particu 16 of bitter components. larly to a process of producing debittered ?akes of germs This observation proves that the bitter components and/or seedlings of cereals, ‘and to products obtained of cereal germs are mainly enriched in bran and husk thereby. - components of said material. Therefore, only germ -. It-is known to debitter germs of cereals by roasting ?ours of low degree of comminution are suitable for the or‘by a treatment with alkali hydroxide solutions and to 20 production of a starting material which can be used in further'process such debittered germs of cereals to food the manufacture of cereal germ ?akes.
    [Show full text]