USOO954.0633B2
(12) United States Patent (10) Patent No.: US 9,540,633 B2 Brinch-Pedersen et al. (45) Date of Patent: Jan. 10, 2017
(54) HIGH EXPRESSION CEREAL PHYTASE FOREIGN PATENT DOCUMENTS GENE WO O1/83763 11 2001 (75) Inventors: Henrik Brinch-Pedersen, Skaelsker WO WO O1/83763 A2 * 11, 2001 (DK); Claus K Madsen, Ringsted WO 2009091518 A2 T 2009 (DK); Giuseppe Dionisio, Slagelse (DK); Preben Bach Holm, Valby (DK) OTHER PUBLICATIONS Sequence 8 from Patent WO0183763, Gen Bank Accession No. (73) Assignee: AARHUS UNIVERSITET, Aarhus C AX298.2091. (DK) Keskin et al., 2004, Protein Science 13: 1043-1055.* Guo et al., 2004, Proceedings of the National Academy of Sciences (*) Notice: Subject to any disclaimer, the term of this USA 101: 9205-9210. patent is extended or adjusted under 35 Thornton et al., 2000, Nature Structural Biology, structural genomic supplement, Nov. 2000:991-994.* U.S.C. 154(b) by 346 days. Clark et al., 2006, Nature Genetics 38: 594-597.* “Accession No. NGB10901” SESTO data portal, May 30, 2001, (21) Appl. No.: 14/110,763 XP000002658140, retrieved from the Internet: URL:http://nordgen. org/index.php/en/content/view/full/344 (retrieved on Sep. 2, 2011). (22) PCT Filed: Apr. 25, 2012 Baumlein, H., Nagy I., et al (1992) Cis-analysis of a seed protein gene promoter: the conservative RY repeat CATGCATG within the (86). PCT No.: PCT/EP2012/057515 legumin box is essential for tissue-specific expression of a legumin gene, Plant Journal 2: 233-239. S 371 (c)(1), Blackwell, T.K., Bowerman, B., et al., (1994) Formation of a (2), (4) Date: Jan. 23, 2014 monomeric DNA binding domain by Skin-1 b/IP and homeodomain elements, Science 266: 621-628. Brinch-Pedersen, H. Galili, F., Knudsen, S., & Holm, P.B., (1996) (87) PCT Pub. No.: WO2012/146597 Engineering of the aspartate family biosynthetic pathway in barley PCT Pub. Date: Nov. 1, 2012 (Hordeum vulgare L.) by transformation with heterologous genes encoding feed-back-insensitive aspartate kinase and (65) Prior Publication Data dihydrodipicolinate synthase, Plant Molecular Biology, 32(4), 611 620. US 2014/O2592 11 A1 Sep. 11, 2014 Brinch-Pedersen et al., (2002) Engineering crop plants: getting a handle on phosphate, Trends in Plant Science, vol. 7, No. 3, Mar. 2002, 118-125. Related U.S. Application Data Database Emb|L—Apr. 19, 2011 “Hordeum vulfare cv. Igri PAPhy a gene for pruple acid phosphatase isoform a.” XP (60) Provisional application No. 61/479.689, filed on Apr. 00000268141, retrieved from EBI accession No. 27, 2011. EM PL:FR851293, Database accession No. FR851293. Database Emb|L (Online) May 18, 2011, “Secale cereale cultivar (30) Foreign Application Priority Data Picasso clone ScPCRG1 PAPhy all gene, complete cds.” XP0000026858143, retrieved from EBI accession No. EM PL: Apr. 27, 2011 (EP) ...... 11163875 JF838319. Database accession No. JF838319, “sequence”. Database Emb|L (Online) May 18, 2011, “Secale cereale cultivar Picasso clone Sc2G1 PAPhy all gene, partial cds.” (51) Int. Cl. XP0000026858144, retrieved from EBI accession No. EM PL: CI2N IS/OI (2006.01) JF838320, Database accesison No. JF838320, "sequence”. AOIH I/06 (2006.01) Database EMBL, May 18, 2011, “Triticum monococcum cultivar AOIH 5/10 (2006.01) NGB10901 PAPhy a1 gene, complete cds,” XP0000026858142, CI2N 9/16 (2006.01) retrieved from EBI accession No. EM PL: JF838315, Database accesison No. JF8383.15. CI2N 5/82 (2006.01) Depater S. Katagirl, et al (1994) bZIP proteins bind to a CI2O I/68 (2006.01) palindromic sequence without an ACGT core located in a seed (52) U.S. Cl. specific element of the pea lectin promoter, Plant Journal 6: 133 CPC ...... CI2N 15/01 (2013.01); A0IH 5/10 140. (2013.01); C12N 9/16 (2013.01); CI2N Dvorakova, 1998, Phystase: Sources, Preparation and Exploitation, 15/8234 (2013.01); C12N 15/8243 (2013.01); Folia Microbiol. 43 (4), 323-338. CI2O I/6895 (2013.01); C12Y-301/03026 (Continued) (2013.01); C12O 2600/156 (2013.01) Primary Examiner — David T Fox (58) Field of Classification Search Assistant Examiner — Bratislav Stankovic None (74) Attorney, Agent, or Firm — McKee, Voorhees & See application file for complete search history. Sease, PLC (56) References Cited (57) ABSTRACT The present invention provides mutant cereal plants and U.S. PATENT DOCUMENTS mature grain thereof, characterised by enhanced levels of the enzyme phytase in the grain, and methods for inducing, 7,214,786 B2 * 5/2007 Kovalic ...... CO7K 14,415 detecting and selecting the mutant cereal plants. The inven 530/324 tion further relates to animal feed comprising said grain 2008/031 1659 A1* 12/2008 Huynh ...... C12N 15,8218 435/375 having enhanced amounts of phytase. 2010, 0186127 A1 7/2010 Byrum et al. 4 Claims, 11 Drawing Sheets US 9,540,633 B2 Page 2
(56) References Cited Olsen, O., et al. Sodium azide mutagenesis: Preferential generation of AT-> GC transitions in the barley Ant18 gene, Proc. Natl. Acad. Sci USA (1993) vol. 90, pp. 8043-8047. OTHER PUBLICATIONS PlantCARE, a database of plant cis-acting regulatory elements and Eeckhout W. Depaepe M (1994) Total phosphorus, phytate-phos a portal to tools for in silico analysis of promoter sequences: Magali phorus and phytase activity in plant feedstuffs, Anim. Feed SciTech Lescot, Patrice Déhais, Gert Thijs, Kathleen Marchal, Yves Moreau, 47: 19-29. Yves Van de Peer, Pierre Rouzéand Stephane Rombauts, Nucleic Engelen, A.J., Vanderheeft, Randsorp, et al (1994. Simple and Acids Res., Jan. 1, 2002; 30(1): 325-327. Rapid-Determination of Phystase Activity, Journal of Aoac inter Rasmussen et al., 2007, Transitions from Nonliving to Living national, 77(3), 760-764. Matter, Science, vol. 303, Feb. 13, 2004, pp. 963-965. Fujiwaraa, T. Mabara E., et al (2002) Storage Proteins. The Veintraub, I. A. &Lapteva, N.A. (1988) Colorimetric determination arabidopsis Book, 2002 American Scoiety of Plant Biologists. of phytate in unpurified extracts of seeds and the products of their G. Dionisio et al. “Cloning and Characterization of Purple Acid processing, Analytical Biochemistry 175(1), 227-23, dio: 10. 1016/ Phosphatase Phytases from Wheat, Barley, Maize, and Rice.” Plant 0003-2697(88)90382-x. Physiology, vol. 156, No. 3, Jan. 10, 2011, pp. 1087-1100, Wittwer, C. T., et al., (2003) High resolution genotyping by XP55006061 amplicon melting analysis using LCgreen Clinical Chemistry: 49:6 Mixed, Mutated and Random Nucleotide Sequences, Retrieved 853-860. from Internet on Jan. 10, 2014, URL: http://molbio.ru/eng/scripts/ Wu CY, Suzuki A. et al., ( 1998) The GCN4 motif in a rice glutelin 01. 16.html. gene is essential for endosperm-specific gene expression and is Jeffersen, R.A., Kavanagh, T.A., & Bevan, M. W. (1987) GUS activated by Opaque-2 in transgenic rice plants. Plant Journal 14: fusions: beta-glucuronidase as a sensitive and versatile gene fusion 673-683. marker in higher plants, Embo Journal 6(13), 3901-3907. Zhu, B. G., Cai, G. F., Hall, E. O., & Freemen, G. J. (2007X. Kimber, G., * Sears, E.G. (1979) Use of wheat aneuploids, Basic In-Fusion (TM) assembly: Seamless engineering of multidomain Life Sciences, 13, 427. fusion proteins. modular vectors, and mutations. Biotechniques, Lott, 1984. Accumulation of Seed Reserves of Phosphorus and 43(3), 356-359, doi:10.2144/0001 12536. Other Minerals, Mineral Reserves, Seed Physiology, vol. 1, pp. 139-166. * cited by examiner
U.S. Patent Jan. 10, 2017 Sheet 2 of 11 US 9,540,633 B2
on 6000 S 5000 4000 3OOO 2OOO 1OOO s
Figure 2. U.S. Patent US 9,540,633 B2
©?un61– U.S. Patent Jan. 10, 2017 Sheet 4 of 11 US 9,540,633 B2
U.S. Patent Jan. 10, 2017 Sheet S of 11 US 9,540,633 B2
00:00!----00'00100:00!00:00! 00‘001,100'004
G?un61– U.S. Patent Jan. 10, 2017 Sheet 6 of 11 US 9,540,633 B2
-83 2. ag2 is imbda ciore, Skage cultivar secreccAAAAAAaaca 45 Skage; PCR clone scietscassicacas, 5. 3. PC cling AcAAAAAAACA As Per PR is """A"AAAAAAAA As a CR GcGCGGCAAGAAAAAA a. arease cine GGGCACAAGAAAAAA s Race EPR line scoresc Accessaic is Spe: PCR cine GCCACCACAA A. High Phy D. PCR clone fit GTGCTGcGct AGTTGAAGGAAG rigAGAAGA a. High Phy 2 PCR ciore first rescroscot Actric AACAC Artist AGAAA ais 393 PCR is coor AAAAAAA is NGSSS PR care GCGCAGAAAAAA 4. 8. & TaG2 abda cloie, Skage. Litiwar AscassacAAAAA Skager PCR claris sesselagic Age AAAA Scier AAAAAAAAA sire ASCAAGAAAACA 9. air Rise As AAAcAAAAAA 9. gica: PCR cle As AAA-CSAAAA 9. acac PCR is: ASCAGAGCCAAACAGAC 9. Spelt PCR clone AAGGGAAAAAAGAA HighPhy. PCR clone AAAAAAAEC 9. High Piry O2 PCR clone AAAssissCA's s Gisg:3 c is GAAccAggAAAccesco, Aag Ace Age 90 NGS355 Rare CAAAAAs CA 9. i -: s a2 iambda ciore, Skagen cultivar AAAAAAAssissCAA 35 Skagen PCR clone scalist Assiss 35 38 ge scAAAAAAAssass 3S Petit PCR if GCGSACAAGAAAAGGCAGGGGAAG 135 air PCR cing ScAAAAAACA CAAAs. 13s cris: 3 is GGGAAAAAAACAGGGAA 3S airic PR car GCGs AAGAAAAAGAA 135 Spe. PCR clone GGCSAAAAAAA 3s High Phy? PCR clone sccess AACAAAAsssssss 3S High Phy (2 PCR clone GAAAAAAAGAAAA 35 GSS-3 Fire GcGCGCGT CACAAGGCACCAAAGCGCAGGCGGCAAAG GC 35 GSS5 class GCTGCGCGTTCACAAGGCACCAAAGGGCAGGCGGGAAAGTTT GC 3S . :2 s Tag2 ambda ciore, Skagen cultivar AAAAAssissCAA 8 Skagen PCR clare GAA Segas. Aggs AGA 8 Firs AccA 8 eign A cassissCAssaac 8. circle Associates asses date: PCR ch CAAAAAGs. A 8. if 2 PR car GAATGGAAGs. A 8. Sps PCR rifle A seases high Pily PCR title cassass 8. HighPhy2 PCR clong Accoa AgesscasAs. 8. GE93 PCR core is A. Access AAA gag AGA 8 NGSSSSS PCR GAAGCCAAGGGAGA i8O x: 8. ag2 and cine, Skage Litva AgataAAccAAAccAAcc s Skager PCR clone GAACTAC 2S cit We CRiene AGGAAAAACACACCACCC 22S retirie Asiacea AAccaccaccitacc 22 arrier AAAACAATCAA 225 first PR is GAAAGAAAG ACTGGAA 22 aica FCR ir AGAAAAGASATAA 25 Sps PCR clone AACAAcces 25 High Phy: PCR clare Asgaas ACAcostscasAAC 225 High Phy & PCR clone AGGAAAAGAA.GGAA 25 393 if AGAAAACTAC 23S NBSSSR tra GAAAAACCACCACCCCCGGCCAAcc 225 s: xi. aG2 lambda ciore, Skagen cultivar AAAA; AGA As f Skagen PCR core GAAAAAAGAAA 27 the CRierge cacAAAAccessalacc 27 PR cine CAAAAAAAACAA 2. af" rice CCCGACAAGAAAGACCAA E. ise PCR is CAAATAAGAAA 27 andrac 2. PCR core AAAAACAA 27 Spelt PCR core AAAAGAAA 27 lighPhy O, PCR cine cGCCCGAAAAAGTFGCCAAAGGC AccAATCG 27 HighPriy 2 (R. clone cGCCCGATCATAAAGTTCCTGcc AAAGGGATCCAATTC to 2 GS3 PR is crgccCGATTCATA TAAGTTTCCTGct AAAGcc AtcCAATTCTG f MS355 Rice crescCCGA Trc Air ATAAG TrccTGccAAAGGc ArcCAA TrcTG 27 i Tag2 lambda ciore, Skage citiwar AGAAGAAAAA 29 Skager. PCR clans CAAAAAAAACA 21 Eja Rise AAAGAAAAA 2 respite AAAAGAAAAAs 2 air : Agg AAA 2. arrace PCR cle AAAAAAAAA 2 its PCR cities cacca AAAA 29 Spelt PCR clone AGAAAAAAA, 2. High Phy PCR clone AAGAAGAAAACAG igh Phy C2PCR core AAAGAAAA 23 G39:3PRise AAAAACA 2. MiGE355 F is CAACCAAGAAAACA 23 Figure 6 U.S. Patent Jan. 10, 2017 Sheet 7 of 11 US 9,540,633 B2
s t 38
Normhy element w as a lar : a- a - a sac - as a as a da: as a a -a a -- a- - a As AA . . . . . 3. TaPAPhy at NomiPhy AAAAAAAAAAA 25 TaFAriyas Higrity Asaac AcacesAAAAAs carcassac as fighty eierrent - is s: - - - - - As A - - - - - 3. ScPAhy as Highey AGAAAAAAAAAGA 4. SciPAPhya Norary AGAACAAGAAAAGAGGGA s aPAPriya3 As AACAAGAAAAAAAGG s TaPAPriya-4 AAGAAAAAAAAGAs s a PAP as AAAGAAAAAAAAG As sis aparty as AAAAGAAAACASAGA nPAPya AAAAAAAAA s: Hypariya & AATTCAAGCAC Art Test AGA ACATGAGCCATG CASGAA CG s 2. g 8 Norrahy eterinert 13 TaPAPhy at NomPhy AAAAA - A As a TaPAPhy at HighPhy As AAA...... cs. . Acc. highPhy eterrent 3. ScPAPya HighPhy AAAAAccAAAAcc. - s SciPAPhy a Nory AAGAAAAAAGGGGAGCCG 88 aAPya3 AAgggia AAAAACGGA, GAGGGGAC 88 aparty at AAAs a ...... 7 TaraPhy as AAccAAAcca. . . cAge a s TaFAPyas AA AAAAAA ...... f mPAPhya AAGAAAAAA's Aggie, 85 !-wrapy at AAAA ...... A. - AscAt a 8 a. ic Mormhy element '3 TaPAPhya Norrify AAACAAAAs. As A s Tararhy a High Py AAAAAAA. As 5 highly eleTigrat 3 ScPAPhya Higy - - - AAAAACAA. AAAAAA s SciPAFhy at Nory ... - X AAAAGASA - GAAAA - - $ TaPAPya3. GGGAGAAAGGGAAAAG gAGGGGGAAAC 3. aFAPya. w w w w w w w w w w w w m n - - W w w w w w - w w w w M wr AGGGGAAAG 83 TaPAPhy as a s & AGAAAAs a CGAs a 12 aFAPfy a X Q Q Va a AAAAs. CAAAs 3. mFAriya . . . AGAAAAAAAs. Aggies 2 wPAPhy a? s & Xa s: A. { T C A. A. A. e G A c A. A. A. G G A G G C s G A. A. s T s
Mormhy element 3. aFAhy at Normy GCACASGCCGs S8. aPAPity at hig Pity - catacic as GA: 58 igiFly eier it 13 ScPAFhy at HighPhy cCAAcacies ir ScPAFhy at Norrirhy . . CAATCAA Age 18 aAPya3 - - AAAAAGAA C 3 aPAPyat. gig AGGAAGAgggggage aFAPily as GCA ACSCAAAGGGSAG t Taraphy as is . AAAAAC in PAPhy at s - CCAAccAAAcces 5. wFAriya GcGASGGCAAGASA...... s s 33 8. mornity eterrierst 3. a Arhya NorrPhy CASCAGASAACCCACCGAs CCACCCGC AA 2 Tapahy a? HighPhy AGATGGAAAAAs CCiCAA highly ete reit s SciPAPhya Highly A ------cacascaccess ca, 2 ScFAfhy at Norrify AAAAAAAAAAs. Accia TaPAPya3 AATAAAAAAAAGAA 28 apayat AAAAAA . TaFAPy a 5 AGAGATGACAAGACACAA CACCCAA 28 aparty as CAGAGASACAAGAC m r n e s m r s r...... A. 3 mPAPhy at AAAAAAAACAA 2S iv Arya AACSSAAA, is a as a a . . . Acces 8.
MorriPhy eterrieri s aFAFhy at Nory Coctes" as AA. AGA A. Tararhy a HigPhy CTCCGAAAAAGCCTCCAA. Acc 2. ighPily element 3. ScPAFhy at HighPhy SepAphy at Norrify cc ecclesac.A.A. cc GAA. AAcc 25 aPAPhy as "cts AAA (AA-AAA. s TaPAiya-4 coca CAA. AA TaFAPriyas occaccAccAAA-AA 2S3 aFPAPyas cCCCCACA, A - AGAcc 2 Trn PAPhya cc ccticcicacci Acacic Asa - ascarcic 23 vPAPya CAccAs casAcc 23
Northy element aPAPhya Northy ATAAAAGAA ------AAAs a TaPAPhya Highphy AACAAGAAAA ...... A HighPhy element a : X : X a a s & a as a is S. s. s. . . 13 ScPAPhya High phy AATAAAAAA ...... AAA E3 ScPAphy at Norrispy AATAAAAAA ...... CAC 284 Tapaya3 TAA AAA ------At 29 TaPAPyaa A GAAAAAAA ...... AAAG si TaPAPyas AAAAAAAA . . . . . G 38 a Aiyas ATAAAAAA . . . . . AAC 235 mAPyat AAAAAAAA...... C 2. iy PAPhy at AAccAAAAAAAAAAAA's 265 Figure 7 U.S. Patent Jan. 10, 2017 Sheet 8 of 11 US 9,540,633 B2
Figure 8
i
U.S. Patent Jan. 10, 2017 Sheet 10 of 11 US 9,540,633 B2
Figure 11
ogo
Figure 12
U.S. Patent Jan. 10, 2017 Sheet 11 of 11 US 9,540,633 B2
Figure 13
MMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMMMMMMMMMMWMMMMMMMMMWWMMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMMMWWMMMMMMrew FAPya3 Chinese spring) High Phy PAPhy gene (High Phy (1) --- on it as APFry at Chinese spring rest Tarafiya Chise spring US 9,540,633 B2 1. 2 HIGH EXPRESSION CEREAL PHYTASE Monogastric animals such as pigs, poultry and humans have GENE little or no phytase activity in their digestive tracts and thus depend on either a phosphate Supplement or on the presence CROSS-REFERENCE TO RELATED of the enzyme phytase in their diet, in order to meet their APPLICATIONS nutritional phosphate requirements. In most cases the This is a U.S. national stage entry of International Patent amount of preformed phytase activity in mature cereal grain Application No. PCT/EP2012/057515, filed on Apr. 25, is not sufficient to ensure Sufficient phytate degradation 2012, which claims priority to European Patent Application when included in animal feed. As a consequence, most of the No. 11163875.5, filed on Apr. 27, 2011, and U.S. Patent cereal grain phytate consumed by an animal is excreted, Application No. 61/479,.689, filed on Apr. 27, 2011, the 10 thereby adding to the phosphate load on the environment contents of all of which are fully incorporated herein by which can be massive in areas with intense livestock pro reference. duction. One current solution to this problem has been to Supplement animal feed, on a large scale, with inorganic SEQUENCE LISTING 15 phosphate, in order to meet an animal's need for phosphate. The instant application contains a Sequence Listing which However, this solution can only continue in the short term has been submitted in ASCII format via EFS-Web and is since phosphate is a non-renewable resource, which will be hereby incorporated by reference in its entirety. Said ASCII depleted within a few decades. An alternative solution relies copy, created on Mar. 26, 2014, is named P1275 US01 on the addition of phytase enzyme, in particular microbial 030547-9022-US00SEQ-LIST-03-26-14.txt, and is 194,104 derived phytase, to feed intended for intense pig and poultry bytes in size. production. It has become common practise to include the enzyme phytase in pre-mixes for addition to animal fodder, TECHNICAL FIELD OF THE INVENTION and animal fodder, which is an additional cost factor. Thus there exists a need for alternative cheaper methods for The present invention relates to mutant cereal plants and 25 enhancing the bioavailability of phosphate in cereals used mature grain thereof, characterised by an enhancer poly for animal feed. nucleotide capable of directed enhanced expression of a A DNA sequence comprising a coding sequence for wheat operably-linked gene, in particular a operably-linked gene phytase has been deposited in GenBank (AX298209). Patent encoding the enzyme phytase, causing enhanced levels of application (WO2001/083763A2) describes said wheat phytase in the grain. The invention further relates to animal 30 phytase as a 66 kDa PAPhy with the same temperature and feed comprising said cereal grain having enhanced amounts pH optima as PHYI (Rasmussen et al., 2004), and describes of phytase. the production of transgenic wheat plants comprising said BACKGROUND DESCRIPTION OF THE coding sequence. INVENTION 35 SUMMARY OF THE INVENTION Phytases (myo-inositol hexakisphosphate phosphohydro lase) EC 3.1.3.26 and EC 3.1.3.8 are phosphatases that According to a first embodiment, the present invention initiate the sequential liberation of orthophosphate groups provides a mutant cereal plant comprising a polynucleotide from phytate (InsP, myo-inositol 1.2.3,4,5,6-hexakisphos 40 selected from any one of: phate), providing phosphate, inositol phosphates and inosi a. ACA VGA GTCATG CAT SEQID NO: 1 or TAGA tol required for a range of cellular activities (Brinch-Peder ACAVGA GTCATG CAT SEQID NO: 2 wherein V sen et al., 2002). A number of enzymes with phytase activity is any nucleotide other than T. more preferably where are known from plants, animals and microorganisms V is C or G, (Dvorakova, 1998). 45 b. polynucleotide comprising a nucleotide sequence Phytases are of particular importance during seed germi selected from SEQ ID NO: 5, 6, 14, 15 and 44, nation where they mobilize phosphate from phytate, the c. polynucleotide comprising a nucleotide sequence major reserve of phosphorus (P) in plant seeds accounting selected from SEQ ID NO: 1, 5, 6, 14, 15 and 44, for -70% of the total P (Lott, 1984). Different plant species wherein said polynucleotide is operably linked to a have developed various strategies for phytase mediated 50 second polynucleotide encoding a polypeptide, degradation of phytate during germination. Among cereals, wherein said polynucleotide is capable of enhancing gene barley (Hordeum vulgare L.), wheat (Triticum aestivum and expression in a grain of said plant, and, and wherein said durum L.) and rye (Secale cereale L.) Synthesize and accu cereal is selected from Avena L species, Hordeum L Species; mulate phytase during grain development and the mature Oryza L species; Secale L species; Sorghum L Species; seed has a significant level of preformed phytase activity. 55 Triticum aestivum, Triticum durum, Triticum spelta and Zea Levels of phytase activity of 582, 1193 and 5130 Ukg' species. have been detected in mature grain of barley, wheat and rye respectively (Eeckhout and de Paepe, 1994). Preformed In a further embodiment, the polypeptide of the mutant cereal plant is phytase IEC 3.1.3.26 and EC 3.1.3.8 and has phytase catalyses the first wave of phytate hydrolysis during myo-inositol hexakisphosphate phosphohydrolase activity. early germination. Other cereals possess little (maize (Zea 60 mays L.) ~41 Ukg) or close to no (rice (Oryza sativa L.)) Further to the first embodiment according to (a), the preformed phytase activity in the mature seed and depend genomic DNA of the mutant cereal plant comprises a first entirely on de novo synthesis during germination (Eeckhout polynucleotide located 5' upstream of a second polynucle and de Paepe, 1994). otide, and operably-linked to the second polynucleotide, The spatial and temporal regulation of phytase biosyn 65 wherein said first polynucleotide comprises the nucleotide thesis in plant seeds has profound effects on phosphate sequence ACA VGA GTCATG CAT SEQ ID NO: 1 or T bioavailability when dry grains are used as food and feed. AGA ACA VGA GTC ATG CAT SEQ ID NO: 2), and US 9,540,633 B2 3 4 wherein said second polynucleotide encodes a phytase poly AGA ACA VGA GTCATG CAT SEQID NO: 2), wherein peptide having myo-inositol hexakisphosphate phosphohy said polynucleotide is comprised in said genomic DNA. drolase activity. According to a seventh embodiment, the invention Further to the above embodiments, the mutant cereal plant teaches a method for inducing and selecting a mutant cereal is selected from Avena sativa. (Oats); Hordeum vulgare plant, said plant comprising a polynucleotide selected from (Barley); Oryza sativa (rice); Secale cereale (Rye); Sorghum one of: bicolor, Triticum aestivum, Triticum durum, Triticum spelta (wheat species); Zea mays (maize). Further to the above embodiments, the mutant cereal plant a) ACA VGA GTC ATG CAT; SEQ ID NO: 1 is a Triticum spp., and the phytase polypeptide has an amino 10 b) a polynucleotide comprising a nucleotide sequence acid sequence having at least 70% sequence identity to a selected from SEQ ID NO: 5, 6, 12, 14 and 15, and sequence selected from SEQ ID NO: 18, 20, and 22. c) polynucleotide comprising a nucleotide sequence Further to the above embodiments, the mutant cereal plant selected from SEQ ID NO: 1, 5, 6, 12, 14 and 15, is a Secale spp., and the phytase polypeptide has an amino 15 wherein said polynucleotide is operably linked to a acid sequence having at least 70% sequence identity to a second polynucleotide encoding a polypeptide, and sequence selected from SEQ ID NO: 26 or 28. wherein said polynucleotide is capable of enhancing Further to the above embodiments, the mutant cereal plant gene expression in a grain of said plant, is a Hordeum spp., and the phytase polypeptide has an amino comprising the steps of: (i) treating a cereal plant, or plant acid sequence having at least 70% sequence identity to a part thereof, with a chemical mutagen; (ii) growing and/or sequence selected from SEQ ID NO: 30. multiplying the treated plant, or plant part; (iii) isolating Further to the above embodiments, the mutant cereal plant genomic DNA from said plant or progeny thereof, and (d) is selected from a mutant of Triticum aestivum having detecting the presence of a polynucleotide having the Deposit No: PTA-11732 TaHighPhy 01, and PTA-11731 nucleotide sequence ACA VGA GTC ATG CAT SEQ ID Tahigh Phy 02; and a mutant of Secale cereale having 25 NO: 1) or TAGA ACA VGA GTCATG CAT SEQID NO: Deposit No PTA-11730 ScHighPhy 01, said plants being 2, wherein said polynucleotide is comprised in said deposited with ATCC Patent Depository, 10801 University genomic DNA. Blvd., Manassas, Va. 20110, Further to the sixth or seventh embodiments, the genomic Further to the above embodiments, the mutant cereal plant DNA comprises a first polynucleotide located 5' upstream of is a grain. 30 and operably-linked to a second polynucleotide, wherein the According to a second embodiment, the invention pro first polynucleotide comprises the nucleotide sequence ACA vides a plant part (e.g. grain or caryopsis) derived from a VGA GTCATG CATSEQID NO: 1) or TAGA ACAVGA mutant cereal plant of the first embodiment or further GTC ATG CAT SEQ ID NO: 2), and wherein the second embodiments of the invention. polynucleotide encodes a phytase polypeptide having myo According to a third embodiment, the invention teaches 35 inositol hexakisphosphate phosphohydrolase activity. the use of grain derived from a mutant cereal plant according Further to the sixth or seventh embodiments, the cereal is to the first or further embodiments of the invention, for the selected from Avena L spp., Hordeum L spp.; Oryza L spp.; manufacture of a composition, wherein said composition is Secale L spp., Sorghum L spp.; Triticum aestivum, Triticum any one of a milled grain composition; animal fodder; and durum, Triticum monococcum; and Zea spp. steam-pelleted animal fodder. 40 Further to the sixth or seventh embodiments, the cereal is According to a fourth embodiment, the invention provides selected from Avena L spp., Hordeum L spp.; Oryza L spp.; a composition comprising a mutant cereal plant according to Secale L spp., Sorghum L spp.; Triticum aestivum, Triticum the first or further embodiments of the invention, wherein durum, Triticum monococcum; and Zea spp., and the amino said composition is any one of a milled grain composition; acid sequence of the phytase polypeptide has at least 70% 45 sequence identity to a sequence selected from SEQ ID NO: animal fodder and steam-pelleted animal fodder. 18, 20, 22, 24, 26, 28, and 30. According to a fifth embodiment, the invention teaches a Further to the sixth or seventh embodiments, the cereal is use of a composition, comprising a mutant cereal plant, selected from Avena L spp., Hordeum L spp.; Oryza L spp.; according to the fourth embodiment as animal fodder. Secale L spp., Sorghum L spp.; Triticum aestivum, Triticum According to a sixth embodiment, the invention teaches a 50 durum, Triticum monococcum; and Zea spp., and the amino method for detecting a mutant cereal plant, said plant acid sequence of the phytase polypeptide has at least 70% comprising a polynucleotide selected from one of: sequence identity to a sequence selected from SEQ ID NO: 18, 20, 22, 24, 26, 28, and 30, wherein said polypeptide is a) ACA VGA GTC ATG CAT; SEQ ID NO: 1 encoded by a polynucleotide having a nucleotide sequence 55 having at least 70% sequence identity to a sequence selected b) a polynucleotide comprising a nucleotide sequence from SEQID NO: 17, 19, 21, 23, 25, 27, 29, and nucleotides selected from SEQ ID NO: 5, 6, 12, 14 and 15, and 2091-4090 of 45, respectively. c) polynucleotide comprising a nucleotide sequence selected from SEQ ID NO: 1, 5, 6, 12, 14 and 15, DETAILED DESCRIPTION OF THE wherein said polynucleotide is operably linked to a 60 INVENTION second polynucleotide encoding a polypeptide, and wherein said polynucleotide is capable of enhancing Listing of the Figures: gene expression in a grain of said plant, FIG. 1. Phytase activity in mature whole grain derived comprising the steps of: (i) isolating genomic DNA from from 52 individual lines of wheat (Triticum aestivum). said plant, and (ii) detecting the presence of the nucleotide 65 FIG. 2. Phytase activity in mature whole grain, bran and V at the 5' end of a polynucleotide having the nucleotide endosperm fractions of grain derived from 52 individual sequence ACA VGA GTCATG CAT SEQ ID NO: 1 or T lines of wheat (Triticum aestivum). US 9,540,633 B2 5 6 FIG. 3. Cartoon showing the exon-intron structure of a FIG. 12. Percentage residual phytate in flour of Bob White TaPAPhy a1 gene isolated from Triticum aestivum cv Ska wild type and HighPhy T. aestivum (HIGHPHY) wheat after gen (TaC2) corresponding to SEQ ID NO: 45. 0.5, 1, 1.5, 2 and 3 hrs of fermentation. FIG. 4. Pair wise comparison of the nucleotide sequence FIG. 13. UPGMA tree of the HIGHPHY and TaPA of the 1000 bp 5' flanking promoter region of phytase genes Phy a1, a2 and a 3 genes. amplified from 9 T. aestivum cultivars and the corresponding promoter region from two HighPhy T. aestivum cultivars. ABBREVIATIONS The upper comparison counts differences, whereas the lower comparison shows the identity in percent. AS-PCR: Allele specific-polymerase chain reaction; FIG. 5. Pair wise comparison of the nucleotide sequence 10 CTP: cytosine 5'-triphosphate: of the 288 bp 5' flanking promoter region of phytase genes dNTP: Deoxynucleotide Triphosphate: amplified from eight T. aestivum cultivars, two T. tauschii PAPhy: Purple acid phosphates (PAP) with phytase activ accession lines (NGB90403; NGB98.55), and the corre ity; also called PAP phytases (PAPhy): sponding promoter regions from two HighPhy T. aestivum Pfu: plaque forming units; cultivars. The upper comparison counts differences, whereas 15 SNP: single-nucleotide polymorphism is a DNA sequence the lower comparison shows the identity in percent. variation occurring when a single nucleotide (A, T, C, or G) FIG. 6. Multiple alignment of the start codon and 288 bp in the genome differs between members of a species or 5' flanking promoter region 7 T. aestivum cultivars (cV paired chromosomes in an individual Skagen; cv Bob White; cv Pentium; cv Flair, cv landrace 01: 1XSSPE buffer: 150 mM Sodium Chloride, 10 mM cv Landrace 02; cv Spelt, which share SEQID NO: 7), two Sodium Hydrogen T. tauschii accession lines (NGB90403; NGB9855, which Phosphate, 1 mM EDTA, pH 7.4): share SEQ ID NO: 8), and the corresponding promoter SPP: species: regions from two HighPhy T. aestivum lines (HighPhy 01: V: is the nucleotide A or C or G (not T), where B is the HighPhy 02 which share SEQ ID NO: 5). The 5' flanking nucleotide in the complementary sequence. promoter region of the T. aestivum cv Skagen is represented 25 by both the lambda clone TaG2 and a PCR amplicon, with DEFINITIONS SEQ ID NO: 7. The enhancer sequence ACA CGA GTC ATG CAT in the HighPhy 01 and 02 cultivars is located a Cereal: A plant belonging to the Poaceae family, in position: -247 to -237 in the 5' flanking region. Note that particular a plant belonging to the Genus and species SEQ ID NO: 5, 7 and 8 are identical to the corresponding 30 thereof. Avena L (e.g. Avena sativa, Oats); Hordeum L e.g. sequences in FIG. 6, but with the exception that the last 3 Hordeum vulgare, Barley); Oryza L (e.g. Oryza sativa, rice); nucleotides (ATG) of each corresponding sequence in FIG. Secale L (e.g. Secale cereale, Rye); Sorghum L (e.g. Sor 6 are excluded from the sequence given in the SEQID NO ghum bicolor); Triticum (e.g. Triticum aestivum, Triticum listing. durum, Triticum monococcum, Triticum spelta, wheat); Zea FIG. 7. Multiple alignment of the start codon and 5' 35 (e.g. Zea mays, maize). flanking promoter region 5 wild type T. aestivum cultivars Promoter operably-linked to a gene: a promoter is a DNA (TaPAPhy a1: NormPhy SEQ ID NO: 9: TaPAPhy a3 molecule that is located on the same DNA strand and SEQ ID NO: 10), TaPAPhy a4 SEQ ID NO: 11: TaPA upstream (towards the 5' region of the sense strand) of the Phy as: TaPAPhy ao) and the corresponding promoter transcriptional start site of a down-stream gene, where the region from a High Phytase T. aestivum line (TaPaPhy a1: 40 operational function of the promoter is to regulate the HighPhy SEQID NO: 6). The 5' flanking promoter region expression of the down-stream gene to which it is operably of the T. monococcum (TmPAPhy_al SEQ ID NO: 12): linked. DNA molecules, whose function is to regulate Hordeum vulgare (HvPAPhy_al SEQID NO: 13) and high expression of a down-stream gene, typically comprise a and normal phytase Secale cereale (ScPAPhy al HighPhy smaller DNA molecule that acts as an "enhancer, the SEQ ID NO: 15) and (ScPAPhy a1 NormPhy SEQ ID 45 enhancer serving to modulate expression levels of the down NO: 16). Note that SEQID NO: 6, 9, 10, 11, 13, 13, 15 and stream gene. An "Enhancer is characterised by a conserved 16 are identical to the corresponding sequences in FIG. 7, nucleotide sequence, often comprising various conserved but with the exception that that the last 3 nucleotides (ATG) sequence motifs whose function is to modulate gene expres of each corresponding sequence in FIG. 6 excluded from the sion levels. A gene is defined to include a polynucleotide sequence given in the SEQ ID NO listing. 50 molecule comprising coding and optionally non-coding The nucleotide sequence of the polynucleotides com sequence(s), the coding sequence(s) encoding a polypeptide, prised within the NormalPhy element and the HighPhy e.g. phytase. enhancer element are included in the alignment. Triticum aestivum: line of T. aestivum, cultivar of T. FIG. 8. Phytase activity in mature whole grain derived aestivum is a cultivated variety of T. aestivum that has been from 5 individual lines of rye (Secale cereale). One line 55 created or selected intentionally for specific desirable char (LPP03) has low phytase activity and 4 lines have medium acteristics and maintained through cultivation. to high phytase activity. Sequence identity: Identity can be measured as percent FIG. 9. Phytase activities in Bob White wild type (BW) identity. The term “percent sequence identity” indicates a and HighPhy T. aestivum (HIGHPHY) wheat flour after 0, quantitative measure of the degree of homology between 10, 20 and 40 min of incubation at 80° C. in 100% relative 60 two nucleotide sequences of equal length. When the two humidity. sequences to be compared are not of equal length, they are FIG. 10. Phytase activities in HighPhy Secale cereale aligned to give the best possible fit, by allowing the insertion (rye) flour after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of of gaps or, alternatively, truncation at the ends of the incubation at 80° C. in 100% relative humidity. nucleotide sequences. The (Nref-Ndlf)100 can be calculated FIG. 11. Phytate content in Bob White wild type (BW) 65 as
PAP ex3 RW: GAGAAGGACCCGCTCTCC (SEO ID NO : 32) (SEQ ID NO: 33) 25 TaPAPhy a1-pro-ex1 Fw: TTATGTGTCCGCGTGAAGTG and a template consisting of a plasmid comprising a cDNA and molecule whose nucleotide sequence encoded the wheat Purple Acid Phosphatase Phytase b (TaPAPhy b). The prim (SEQ ID NO: 34) ers amplified a portion of the cDNA molecule whose nucleo TaPAPhy a1-pro-ex1 Rv: ACCAAGAGTCAATGCCATCC tide sequence corresponds to the highly conserved third exon of the Triticeae PAPhy b gene. The amplified sequence 30 An additional primer pair was designed to amplify a generated a DNA probe of 479 nucleotides in length. shorter sequence which includes 288 bp of the 5' flanking Remaining unincorporated dNTPs were removed with an region (promoter) and 147 bp of the first exon of the Illustra MicroSpin G-50 Column (GE Healthcare). The TaPAPhy a1 gene. probe was denaturated by boiling followed by shock cooling in 500 uL of 10 ug/uL sonicated salmon sperm DNA. 35 2.4 Isolation and Characterisation of Triticeae PAPhy (SEO ID NO : 35) Phytase Gene: TaPAPhy a1 -311 cons Fw: TTTGGACGAGCCATAGCTGCATA Isolated lambda (w) clones, selected by the Triticeae and PAPhy specific probe, were amplified on five to twenty 82 (SEQ ID NO: 36) mm diameter NZYagar plates and ADNA was isolated from 40 TaPAPhy a1 167 Rv: CGCTGCACCCGGGGGTCCGT the phage harvested from the plates using the Lambda midi kit (Qiagen) according to the manufacturers instructions. The latter primer pair was used with cultivars where the One isolated W clone, comprising the genomic DNA first primer pair failed to yield an amplification product. molecule designated TaG2, was sequenced (SEQ ID NO: PCR was performed with Herculase II (Agilent Technolo 45) and found to comprise a polynucleotide comprising a 45 gies-Stratagene Products) according to the manufacturers ~2000 bp promoter region having the sequence (SEQ ID instructions, but with the modification that 6% DMSO was NO: 43). used in the reaction mixture. Amplicons of the expected size were isolated from aga EXAMPLE 3 rose gels and cloned in the pCR4Blunt TOPO vector (Invit Amplification and Characterization of Phytase Gene 50 rogen) and sequenced. Promotors from Different Triticum aestivum and 3.2 Characterization of the Promoter Region of Isolated T. Triticum tauschii Cultivars Aestivum and T. tauschi Phytase Genes—Alignment of 1000 bp 3.1 Isolation of Phytase Gene Promoters by PCR 55 The long PCR amplicon, (corresponding to 2041 bp 5' Genomic DNA was isolated from 10 cultivars of T. upstream flanking promoter region the first exon and of the aestivum and 2 accessions of T tauschii (also known as Ae. TaPAPhy a1 gene) was obtained from 10 cultivars of T. Tauschii), as shown in table 1. aestivum, whereas only the short amplicon (corresponding to 147 bp of the first exon and 288 bp of the 5' flanking TABLE 1. 60 promoter region of the TaPAPhy_al gene) was obtained Cultivars and accessions from which the from two accessions of T tauschii. The 1000 bp 5' flanking TaPAPhy all promoter was amplified. region and start codon of each of the T. aestivum genes were aligned, and used for a pair wise comparison (see FIG. 4). Cultivari accession Notes The T. aestivum PAPhy phytase gene (in w clone TaG2) Bob White T. aestivum model cultivar 65 and the PCR amplicon obtained from amplifying genomic Skagen T. aestivain commercial cultivar DNA from the same cultivar, Skagen, had the same nucleo tide sequence, and are included in FIG. 4. The nucleotide US 9,540,633 B2 15 16 sequence of the 1000 bp 5' flanking promoter region of each to be an enhancer of seed-specific expression and a repressor of the T. aestivum genes share at least 99.7% identity, of vegetative expression in A. thaliana (7. whereas the nucleotide sequence of the corresponding pro Consider now the Sequence from the Highphy T. Aesti moter regions from two HighPhy cultivars only share 97.7- vum Cultivars: 98.1% sequence identity to the other T. aestivum genes. The nucleotide sequence of the promoter regions of the two HighPhy cultivars SEQ ID NO: 5 and 6), however, share AACAGAGTbATGCATGGGA (SEQID NO: 63) 99.8% sequence identity with each other, differing in nucleo tide sequence by only two base pairs. A polynucleotide comprising a -2000 bp promoter region from the HighPhy 10 The mutation, identified by the elevated “C”, abolishes cultivars, corresponding to the promoter region of the wild the odd base palindrome and the GCN4 motif, but leaves the type T. aestivum PAPhy phytase gene, has the nucleotide skin-1 motif and the RY-repeat unchanged. A new motif, sequence (SEQ ID NO. 44). boxed, is thereby introduced. This motif shows similarity to the G-box CACGTG (1) but lacks the highly conserved 3.3 Characterization of the Promoter Region of Isolated T. 15 palindromic nature of the G-box, and represents a com Aestivum and T. tauschii Phytase Genes—Alignment of 288 pletely novel motif, acting as a cis-acting regulatory ele bp ment. This mutation, found in HighPhy T. aestivum culti The 288 bp 5' flanking region and start codon of each of vars, is either the result of the abolition of the odd base the T. aestivum genes together with the corresponding palindrome or the result of the introduction of the novel sequence from T. tauschii were aligned, and used for a pair motif. wise comparison (FIG. 5). The amplified 288 bp 5' flanking promoter region from EXAMPLE 5 each of wild-type T. aestivum cultivars; HighPhy T. aesti vum cultivars; and T. tauschii cultivars shared nucleotide Method for Detecting the HighPhy SNP in the sequence identity within each of the three groups. However, 25 Genome of Cereal Plants the nucleotide sequence of the promoter regions of the two HighPhy T. aestivum cultivars differs from the wild-type 9 T. The SNP in the genome of a cereal plant that is located in aestivum cultivars in two nucleotides, and differs from the a polynucleotide comprising the enhancer element having two T. tauschii cultivars in 3 nucleotides. In turn the nucleo the nucleotide sequence “CGAGTCATGCATGGGA' (SEQ tide sequence of the promoter regions from the two T. 30 ID NO: 64) was detected using the technique of “High tauschii cultivars differs from wild-type T. aestivum culti Resolution Amplicon Melting Analysis’ 10. PCR was vars in 3 nucleotides. performed in 10 ul, volumes in a LightCycler (Roche It can be seen from the alignment in FIG. 6, that the 5' Applied Systems) with programmed transitions of 20° C./s flanking promoter region of the two HighPhy T. aestivum unless otherwise indicated. The amplification mixture 35 included 50 ng genomic DNA as template, 200 uM each cultivars SEQ ID NO: 5 comprises a single nucleotide deoxynucleotide triphosphate (dNTP), 0.4 U KlenTaq1 polymorphism (SNP) (-244 T->C), that is unique to these polymerase (ABPeptides), 88 ng TaqStart antibody (Clon HighPhy cultivars, when compared to the wild type cultivars Tech), 3 mM MgCl2, 50 mM Tris (pH 8.3), 500 ng/uL SEQ ID NO: 7 and 8. bovine serum albumin, 0.5uM primers located upstream and 40 downstream of the SNP and 1-10 uM LCGreen, in order to EXAMPLE 4 amplify an polynucleotide of around 40-300 nucleotides in length. Melting analysis was performed on the LightCycler. Genomic Context of the SNP in HighPhy T. After amplification, the samples are heated momentarily in aestivum Cultivars the LightCycler to 94° C. and cooled to 40°C. The Light Sequence analyses of the immediate surroundings of the 45 Cycler capillary is then transferred to the high-resolution HighPhy SNP reveals sequence motifs known to be involved melting instrument and heated at 0.3°C./s. Sample tempera in gene regulation. Consider first the sequence found in wild ture and fluorescence signals are converted to 16-bit digital type T. aestivum (wheat) cultivars (wt): signals, which are then analysed to detect the SNP. 50 EXAMPLE 6 AACATGAGCAGCATGGGA SEQ ID NO: 4 Method for Inducing and Selecting Wheat It consists of four overlapping motifs: Germplasm Comprising the HighPhy SNP and In bold font, the odd base palindrome sequence reported Grain with High Levels of the Enzyme Phytase by 3: 55 In enlarged font, GCN4 motif, involved in endosperm HighPhy wheat can be generated by mutagenesis and specific gene expression 4; Subsequent Screening for individuals where the polynucle In italic font, the skin-1 motif reported by 5: otide TGAGTCATGCATG (SEQ ID NO: 65), correspond In underlined font, the palindomic RY-repeat identical to ing to the wild type (NormPhy) element, in the wheat that reported by 6. 60 genome has been converted into the mutant (HighPhy) Note that the skin-1 and GCN4 motifs are contained within element CGAGTCATGCATG (SEQ ID NO: 66). The muta the odd base palindrome. The odd base palindrome and genesis is carried out with sodium azide which preferentially GCN4 motif have been shown to interact with Opaque2, a generates A:T to G:C substitutions in barley (8). Screening maize basic leucine zipper (bZIP) transcription factor mutagenized populations for the desired mutation could be involved in the regulation of seed storage proteins 3.4. 65 done by allele specific polymerase chain reaction (AS-PCR). whereas the RY-repeat has been shown to interact with Procedure: Wheat grains are presoaked for 15 hours in transcription factors containing the B3 domain. It is known demineralised water at 5° C. and then treated with an US 9,540,633 B2 17 18 oxygenated solution of 1 mM sodium azide at pH 3 for 2 EXAMPLE 8 hours. The grains are washed and sown out, and grown to mature plants. Genomic DNA is isolated from leaves of each Amplification and Characterization of Phytase Gene individual plant before the plant begins to senesce, using a Promotors from Different Secale cereale and standard DNA extraction procedure 9, whereas grains are Hordeum vulgare Cultivars harvested at maturity. Grains from individual plants are kept apart and labelled so they can be matched with the corre 8.1 Isolation of Phytase Gene Promoters by PCR sponding DNA isolates. The DNA isolates are screened by Genomic DNA was isolated from Secale cereale and AS-PCR using the following primer pair: Hordeum vulgare cultivars and the phytase gene promoter 10 was amplified by PCR as described in Example 3.1.
SEQ ID NO : 37) EXAMPLE 9 HighPhy Fw : 5. CAAGCTACACTTTGTAGAACAC 3' Structural Characterisation of Cereal Phytase SEQ ID NO: 38 15 Enzymes and the Coding Sequence of their PAPhy Rv: s' CGCTGCACCCGGGGGTCCGT 3 Cognate Genes The first 21 nucleotides of the HighPhy Fw primer anneal The promoter of the invention comprising an enhancer 5' to the HighPhy enhancer polynucleotide, whereas the 3'C polynucleotide having SEQ ID NO: 1 or 2, is structurally nucleotide anneals to the actual SNP, this SNP being the and operably linked to a polynucleotide molecule compris distinguishing nucleotide between the HighPhy and Norm ing a coding sequence encoding a phytase enzyme. The Phy element polynucleotides. The PAPhy RV primer anneals polynucleotide molecule in the genome of a cereal plant to a highly conserved part of the coding sequence of the encoding a phytase enzyme comprises a coding sequence PAPhy phytase gene, and can thus be expected to anneal to (comprising one or more exon) and a non-coding sequence all known loci in the genome containing the wheat PAPhy 25 (comprising one or more intron). The amino sequence and phytase gene. The AS-PCR is performed using a non the nucleotide sequence of the coding sequence encoding a proofreading polymerase to ensure specificity, and detection phytase enzyme derived from the Triticum aestivum cv., of the SNP. A series of replicate AS-PCR, using the HighPhy (Ta); Secale cereale cV., (Sc); and Hordeum vulgare cV. Fw primer and PAPhy RV primer pair, are performed under (HV) are as follows: 30 TaPAPhy_al phytase (SEQ ID NO: 18) encoded by conditions of increasing stringency (e.g. increasing PCR TaPAPhy a1 cDNA (SEQ ID NO: 17); annealing temperature), on control genomic DNA samples TaPAPhy a2 phytase (SEQ ID NO: 20) encoded by isolated from HIGHPHYO1 wheat grain of the invention and TaPAPhy a2 cDNA (SEQ ID NO: 19); a wildtype NormPhy wheat plant. Under selected conditions TaPAPhy a3 phytase (SEQ ID NO: 22) encoded by of stringency, AS-PCR is then performed on DNA isolated 35 TaPAPhy a3 cDNA (SEQ ID NO: 21); from HighPhy mutation positive plants to amplify an ampli TmPAPhy a4 phytase (SEQ ID NO: 24) encoded by con of 300 to 700 bp in length, which can be identified by TmPAPhy a4 cDNA (SEQ ID NO. 23); agarose gel electrophoresis, whereas plants lacking the ScPAPhy_al phytase (SEQ ID NO: 26) encoded by HighPhy mutation will not produce an amplicon. The ampli ScPAPhy_al cDNA (SEQ ID NO: 25); fied product is then cloned and sequenced to confirm that the 40 ScPAPhy a2 phytase (SEQ ID NO: 28) encoded by presence of the mutant (HighPhy) element CGAGTCATG ScPAPhy_al cDNA (SEQ ID NO: 26); CATG (SEQ ID NO: 66) in the genomic DNA isolate. HvPAPhy_al phytase (SEQ ID NO: 30) encoded by AS-PCR conditions that are sufficiently stringent to selec HvPAPhy a1 cDNA (SEQ ID NO: 29); tively amplify HighPhy mutation positive plants, are then The phytase enzyme in mutant HighPhy Triticum aesti employed to screen genomic DNA isolated from each indi 45 vum has an amino acid sequence similar to the phytase vidual mutagenized plant. Grain from HighPhy mutation enzyme in wild type Triticum aestivum cv's Bobwhite and positive plants can then be cultivated further to generate Skagen. Their amino acid sequences differ by the deletion of Sufficient grain for Subsequence breeding and crop produc three amino acid residues and the substitution of three tion. residues in the HighPhy cultivar when compared to cv's 50 Bobwhite and Skagen, these differences being located within the 120 residue long signal peptide region at the EXAMPLE 7 amino-terminus. The substitutions are conservative, G->A and S-sT.
Phytase Activity of Different Secale cereale 55 EXAMPLE 10 Cultivars Stability of Phytase Activity in Wheat Flour 7.1 Comparative Levels of Total Phytase Enzymatic Subjected to Steam Treatment Activity in Mature Secale cereale (Rye) Grain 60 Animal feed comprising milled cereal grain, is commonly The phytase activity was measured in mature seeds of 5 Subjected to steam pelleting, which is a two-step process of individual cultivars rye, as described for seeds of Triticum conditioning followed by pelleting. During conditioning the aestivum, detailed in Example 1.1. Phytase activity ranged milled feed is mixed and simultaneously heated to about 80° from ~1600 to -6000 FTU/kg in grain from the 5 rye line C. and its moisture content is increased by exposure to (FIG. 8). In one line, LPPO3, the level of phytase activity 65 steam. The experimental set up used in this example simu was ~1600 FTU/kg, which was lower than levels measured lates the combination of heat and moisture used during in the other 4 lines, of which one line had ~6000 FTU/kg. conditioning. US 9,540,633 B2 19 20 The experimental setup consisted of a GFL 1083 water phytase degradation enhances inorganic phosphate levels bath with a plastic tray floating on the surface of the water and mineral content in bread, and is known to improve and occupying approximately half of the Surface area of the dough mixing quality. Dough made from HighPhy wheat is water. A thermometer, placed inside the tray, was used to shown to provide these advantages. monitor the headspace temperature before and after incuba tion. The water bath was equipped with a thermostat and a Wild type wheat (T. aestivum cv Bobwhite (BW)) and lid so a constant temperature and steam-filled headspace HighPhy wheat (HP) grains were milled on a Retsch RM100 with 100% relative humidity could be maintained. The water mortar grinder mill. The phytate content in the resulting bath was set to 80° C., and once this temperature was flour was determined using the procedure described by reached, it was allowed to equilibrate for one hour. The (Vaintraub & Lapteva, 1988). Flour (250 mg) was mixed headspace temperature was found to be 80° C. at this point. 10 with 0.1 ml of bakers yeast water stock (dry yeast in 3 mg/ml Eight to nine grams of sample wheat grains were milled water). An additional 0.2 ml of water was added to form a on a Retsch RM100 mortar grinder mill, and the resulting dough. The dough was fermented at 25°C. for 0.5, 1, 3 and flour was distributed in weighing boats, 500 mg in each. The 3 hrs. After fermentation, the phytate content was deter steam treatment consisted of incubating the weighing boats mined again, using the same procedure (Vaintraub and with samples on the plastic tray for various periods of time. 15 The lid of the water bath remained closed for the duration of Lapteva, 1988). the incubation and the temperature of 80° C. in the head The initial phytate content of HP wheat flour was a little space was verified before and after each incubation. Fol higher than that of BW wheat (FIG. 11). However during lowing steam treatment, the wheat flour samples were des fermentation, phytate levels were decreased to a lower level Sicated overnight in an exicator with silica gel. in flour from HP than BW wheat. Thus, phytate levels were Once dried, the phytase activity of the wheat flour reduced significantly more during fermentation in wheat samples was assayed using the assay described by (Engelen, dough from HP in comparison to dough from BW, both in Vanderheeft, Randerheeft & Smidt, 19941) terms of percentage and in the final phytate levels. Already Two measurements, (A) and (B), of phytase activities of after 0.5 hr, phytate was reduced more in HP than in BW wild type wheat (T. aestivum cv. Bobwhite (BW)) and 25 HighPhy (HIGHPHY) wheat, after 0, 10, 20 and 40 min of wheat (FIG. 12 and table 2). After 3 hrs, only ~44% of the incubation at 80° C. at 100% relative humidity, are shown in initial phytate was left in the HP wheat, whereas -68% was FIG.9. At t=0, the phytase activities of BW and HIGHPHY left in the wild type BW wheat. were 1286 and 4311 FTU/kg, respectively. After 10 min of incubation, HIGHPHY still exhibited a very substantial TABLE 2 phytase activity of 3046 FTU/kg, while BW only exhibited 30 940 FTU/kg. After 20 min of incubation, HIGHPHY had Percent residual phytate (IP6) in dough of 1801 FTU/kg residual phytase activity, still higher than the wild-type (BW) and HighPhw (HP) wheat flour starting level in BW, while in BW the activity was only 667 BW HP FTU/kg. The most extreme incubation of 40 min reduced Time residual IP6 (%) residual IP6 (%) 35 phytase activity in the HIGHPHY to 962 FTU/kg, while O 1OO 1OO levels in BW were reduced to 476 FTU/kg. O.S 97.8 85.9 The experimental conditions used to test phytate stability 1.O 91.9 82.7 were more extreme than those of commercial steam-pellet 1.5 86.2 66.9 2.0 73.8 S3.6 ing, where the duration of steam treatment of normally 3.0 68.3 43.8 around 1 minute. It is thus expected that the residual phytase 40 activity in pelleted feed made from HighPhy cereal grains of the invention will lie above the level at which supplementary phytase is required (circa 2500 FTU/kg). EXAMPLE 13 EXAMPLE 11 45 The HighPhy Enhancer in the Barley Phytase Gene Confers Both Aleurone and Endosperm-specific Stability of Phytase Activity in HighPhy Secale Expression in Developing Barley Grain cereale (Rye) Subjected to Steam Treatment 13.1 Cloning of Promoter-GUS Constructs for Examina Grain of HighPhy rye were milled and the resulting flour 50 tion of the HighPhy Mutation: was subjected to simulated conditioning, using the same The HighPhy Mutation was Introduced in the pCLEAN experimental set up as used for wheat flour in example 10. G185-PAPhy a Construct with the Mutagenic Primers: A single measurement of phytase activity of HighPhy rye, after 0, 1, 2, 3, 4, 5, 10, 30, 45 and 60 min of incubation at 80° C. at 100% relative humidity, are shown in FIG. 10. At 55 (SEQ ID No. 46) t=0, the phytase activities of HighPhyrye was 4013 FTU/kg, HvPAPhy a SDmut Fw 5 GTAGAACACGAGCCATGCATGAGAC3" and after 10 min still exhibited a very substantial phytase (SEQ ID No. 47) activity of 3818 FTU/kg. After 30 min of incubation phytase HvPAPhy a SDmut Rv s'TGGCTCGTGTTCTACAAAATGTAGC3' activities in the flour dropped to 1746 FTU/kg. 60 This yielded the pCLEAN-G185-HP-PAPhy a construct. EXAMPLE 12 The two constructs pCLEAN-G185-PAPhy_a and pCLEAN-G185-HP-PAPhy a were further modified to Enhanced Phytate Degradation in High-Phy. Wheat serve as promoter-reporter gene constructs. To achieve this, Flour the PAPhy a coding open reading frame and terminator was 65 replaced by the UidA open reading frame followed by the Phytase degradation during fermentation of dough NOS terminator. The cloning was performed with the “In improves its nutritional and bread-making quality, since Fusion” technology as described in (Zhu, Cai, Hall and US 9,540,633 B2 21 22 Freeman, 2007). This approach ensured seamless joining of sion of the uidA gene was assayed in the plant tissues two the promoter and reporter gene so the start codon context days after bombardment, using the gus reaction buffer, as was preserved. described in Jefferson, Kavanagh, & Bevan, 1987. Gus The vector backbone and promoter of both constructs expression was scored by localizing blue spots on the were amplified using the primers: 5 bombarded tissues. In tissues bombarded with the pCLEAN-G 185-wt-pro GUS plasmid, blue spots were mainly identified in the (SEQ ID No. 48) aleurone layers, with very limited expression in the Cis to GUS Fw s' TCGAGTCGACGTTCCTTGAC3" endosperm. In pCLEAN-G185-HP-proGUS bombarded tis 10 (SEQ ID No. 49) Sues more expression could be observed in the endosperm Cis to GUS Rw s' GTTGATGTTGTTGCTTGGCATTG3 tissue. No expression was detected in grain bombarded with The UidA and NOS terminator were amplified from the pCLEAN-G185-KOtriad-proGUS. These data confirm pGUSN which is a puC18 plasmid comprising an UidA that the HighPhy mutation in the context of the barley phytase gene enhancer confers both aleurone and gene and a downstream NOS terminator, using the primers: 15 endosperm-specific expression
GUS Fw m. overhang EXAMPLE 1.4 (SEQ ID No. 50) 5' AGCAACAACATCAACATGTTACGTCCTGTAGAAACC3" Identification of the Wild Type Locus in the Wheat GUS Rv m. overhang Genome Corresponding to the HighPhy Phytase (SEQ ID No. 52) Gene 5 GGAACGTCGACTCGACTATGACCATGATTACGAATTCC3" Performing the In-Fusion with the resulting amplicons The mutant gene was aligned to the three homeologous gave the two GUS reporter constructs, pCLEAN-G 185-wt 25 PAPhy a genes from the wild type cultivar “Chinese proGUS (SEQID No. 52) and pCLEAN-G 185-HP-proGUS spring. The alignment was adjusted to include only the (SEQ ID No. 54). exons and introns of the gene. An UPGMA tree was gen 13.2: Constructing Randomized Phytase Gene Enhancer erated with 1000 bootstrap replications (FIG. 13). The tree Element Sequences to Confirm the Criticality of the Pro clearly points to TaPAPhy a1 as the wild type locus corre moter Enhancer Element Comprising the HighPhy Muta 30 sponding to the HighPhy gene. tion. 14.1 Chromosomal Mapping of the TaPAPhy a1 Gene: The enhancer element motifs surrounding the HighPhy Wheat chromosomal mapping was performed using the mutation were removed by sequence randomization by Chinese Spring nullisomic-tetrasomic lines described by taking the 20 bp corresponding to SEQ ID 4 in the (Kimber & Sears, 1979. There are 42 possible nullisomic pCLEAN-G 185-PAPhy a construct and subjecting the 35 tetrasomic lines, of which two were missing in the present sequence to a nucleotide randomizer world wide web at set of lines (the nullisomic (N) 2A tetrasomic (T) 2B and the molbiol.ru/eng/scripts/01. 16.html using settings designed N4BT4D lines), but their absence did not compromise the to preserve the nucleotide ratios of the original sequence. mapping. The following primers where designed to specifi The resulting sequence, 5' gcatacgaagcatagtacga3', was only cally amplify a 522 basepair segment of the TaPAPhy a1 identical to the original in three nucleotide positions and did 40 not contain any regulatory elements known by PlantCARE*. gene. The original 20 bp in pCLEAN-G185-wt-proGUS was replaced by the randomized sequence as described by Zhu (SEQ ID NO: and co-workers using the primers: Forward 5' GAGATTCCGAGACCAACGAA3" 45 (SEQ ID NO: 61) Kill triad Fw Rewerse st TTTGCCTCCACTCTGCC TAC3 (SEQ ID No. 56) 5' gcatacgaagcatagtacgaCGTAGGCGTCCAAACTTTG3'; The amplicon was exclusively absent from two lines nulisomic for chromosome 5D and tetrasomic for chromo Kill triad RV 50 (SEO ID No. 57) some 5A and 5B respectively (N5DT5A and N5DT5B). s' Thus, TaPAPhy a1 maps to chromosome 5D. togtactatgctitcg tatgcCTACAAAATGTAGCTTGAAATTAAAGAG3' LITERATURE CITED (SEQ ID No. 58) 55 The resulting construct was pCLEAN-G185 1 Engelen A. J. Heeft F C yen der, Randsdorp P HG, Smit E L C (1994) Simple and rapid determination of KOtriad-proGUS. phytase activity. J AOAC Internat 77: 760-764. 13.3 Transient Expression in Developing Barley 2 Eeckhout W. Depaepe M (1994) Total phosphorus, Endosperm and Aleurone: 60 phytate-phosphorus and phytase activity in plant feedstuffs. The three constructs were individually introduced into Anim Feed SciTech 47: 19-29. developing (from 14 to 35 days after pollination) barley 3 Depater S, Katagiri F, Kijne J, Chua N H (1994) Bzip endosperm and aleurone cells by particle gun bombardment. Proteins Bind to A Palindromic Sequence Without An Acgt Immature barley seeds were sterilized, and cultured on Core Located in A Seed-Specific Element of the Pea Lectin media and bombarded in a DuPont PDS 1100 helium 65 Promoter. Plant Journal 6: 133-140 biolistic delivery system using the procedures described in 4) Wu CY, Suzuki A, Washida H, Takaiwa F (1998) The (BrinchPedersen, Galili, Knudsen, & Holm, 1996). Expres GCN4 motif in a rice glutelin gene is essential for US 9,540,633 B2 23 24 endosperm-specific gene expression and is activated by aspartate kinase and dihydrodipicolinate synthase. Plant Opaque-2 in transgenic rice plants. Plant Journal 14: 673 Molecular Biology, 32(4), 611-620. 683 Engelen, A.J., Vanderheeft, F. C., Randsdorp, P. H. G., & Smit, E. L. C. (1994). Simple and Rapid-Determination of 5 Blackwell T K, Bowerman B, Priess J R, Weintraub H Phytase Activity. Journal of Aoac International, 77(3), 760 (1994) Formation of A Monomeric Dna-Binding Domain by 764. Skin-1 BZip and Homeodomain Elements. Science 266: Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). 621-628 GUS FUSIONS-BETA-GLUCURONIDASE ASA SENSI 6 Baumlein H, Nagy I, Villarroel R, Inze D, Wobus U TIVE AND VERSATILE GENE FUSION MARKER IN (1992) Cis-Analysis of A Seed Protein Gene Promoter the 10 HIGHER-PLANTS. EmboJournal, 6(13), 3901-3907. Kim Conservative Ry Repeat Catgcatg Within the Legumin Box ber, G., & Sears, E. G. (1979). Use of wheat aneuploids. Is Essential for Tissue-Specific Expression of A Legumin Basic Life Sciences, 13, 427. Gene. Plant Journal 2: 233-239 Vaintraub, I.A., & Lapteva, N. A. (1988). COLORIMET 7 Fujiwaraa, T., Nambara, E., Yamagishi, K., Goto, D. RIC DETERMINATION OF PHYTATE IN UNPURIFIED B., Naito, S. (2002) Storage Proteins. The Arabidopsis 15 EXTRACTS OF SEEDS AND THE PRODUCTS OF Book, 2002 American Society of Plant Biologists. THEIR PROCESSING. Analytical Biochemistry, 175(1), 8 Olsen, 0., et al. Proc. Natl. Acad. Sci. USA (1993) Vol. 227-230. doi:10.1016/0003-2697(88)90382-x 90, pp. 8043-8047. Zhu, B. G., Cai, G. F., Hall, E. O., & Freeman, G. J. 9 Sambrook, Fritsch and Maniatis (2001) Molecular (2007). In-FusionTM assembly: seamless engineering of mul Cloning: A Laboratory Manual (2" Edition) Cold Spring tidomain fusion proteins, modular vectors, and mutations. Harbor Laboratory Press. Biotechniques, 43(3), 356-359. doi:10.2144/000112536 10. Wittwer, C. T., et al., (2003) High resolution geno PlantCARE, a database of plant cis-acting regulatory typing by amplicon melting analysis using LCgreen Clinical elements and a portal to tools for in silico analysis of Chemistry: 49:6853-860. promoter sequences: BrinchPedersen, H., Galili, G., Knudsen, S., & Holm, P. 25 MAGALI Lescot, Patrice Déhais, Gert Thijs, Kathleen B. (1996). Engineering of the aspartate family biosynthetic Marchal, Yves Moreau, Yves Van de Peer, Pierre Rouzé and pathway in barley (Hordeum vulgare L) by transformation Stephane Rombauts Nucleic Acids Res. 2002 Jan. 1:30(1): with heterologous genes encoding feed-back-insensitive 325-327
SEQUENCE LISTING
SEO ID NO 1 LENGTH: 15 TYPE: DNA ORGANISM: Triticum aestivum FEATURE; NAME/KEY: enhancer LOCATION: (1) ... (15) FEATURE; NAME/KEY: modified base LOCATION: (4) . . (4) OTHER INFORMATION: W = C. G or A FEATURE; NAME/KEY: modified base LOCATION: (4) . . (4)
<4 OOs SEQUENCE: 1
acavgagt ca togcat 15
<21 Os SEQ ID NO 2 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Triticum aestivum 22 Os. FEATURE: <221s NAMEAKEY: enhancer <222s. LOCATION: (1) . . (19) 22 Os. FEATURE: <221s NAMEAKEY: modified base <222s. LOCATION: (8) ... (8) <223> OTHER INFORMATION: W = C, G or A
<4 OOs SEQUENCE: 2
tagaacaviga gt catgcat 19
<21 Os SEQ ID NO 3 &211s LENGTH: 15 &212s. TYPE: DNA US 9,540,633 B2 25 26 - Continued
ORGANISM: Triticum aestivum FEATURE: NAMEAKEY: enhancer LOCATION: (1) ... (15)
< 4 OOs SEQUENCE: 3 acatgagt ca tdcat 15
SEQ ID NO 4 LENGTH: 2O TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAMEAKEY: enhancer LOCATION: (1) ... (20)
< 4 OOs SEQUENCE: 4 alacatgagtic atgcatggga
SEO ID NO 5 LENGTH: 288 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: promoter LOCATION: (1) ... (288) OTHER INFORMATION: Mutant promoter and 5' untranslated region FEATURE: NAMEAKEY: enhancer LOCATION: (42) ... (56)
< 4 OOs SEQUENCE: 5 ttttgttgct togcgctittag tittcaagcta cactttgtag alacacgagtic atgcatggga 6 O cgaaggcgtc. caaacttggc tagtgcagct gcc ticgcgt. t caca aggca cCaaag.cgca 12 O ggcggcaaag tittgct cott tattatcttg gcggit coaag atggg.cggca ggttc.ca.gac 18O gatggacgaa gacccaccga gttcc acttic cggct coaac citcctctgcc cgatt catat 24 O aagttt cotg ccaaaggcat cocaattctg t caatgccaa gcaacaac 288
SEQ ID NO 6 LENGTH: 271 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: promoter LOCATION: (1) ... (271) OTHER INFORMATION: TaPAPhy a1 mutant promoter and 5' untranslated region FEATURE: NAMEAKEY: enhancer LOCATION: (25) . . (39)
< 4 OOs SEQUENCE: 6 tagtttcaag ctacactittg tagaacacga gtcatgcatg ggacgaaggc gtccaaactt 6 O ggct agtgca gctgcctg.cg C9ttcacaag gcaccalaagc gcaggcggca aagtttgctic 12 O gttt attatc ttggcggit Co. aagatgggcg gCaggttcca gacgatggac gaaga cc cac 18O cgagttccac titc.cggct co aacct cotct gcc.cgattica tataagttt c Ctgccaaagg 24 O catcc caatt ctdtcaatgc caa.gcaacaa c 271
SEO ID NO 7 LENGTH: 288 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: US 9,540,633 B2 27 28 - Continued NAME/KEY: promoter LOCATION: (1) ... (288) OTHER INFORMATION: Wild typeTaPAPhy Promoter and 5' untranslated region FEATURE: NAMEAKEY: enhancer LOCATION: (42) ... (56)
< 4 OOs SEQUENCE: 7 ttttgttgct togcgctittag tittcaagcta cactttgtag aacatgagtic atgcatggga 6 O cgaaggcgtc. caaacttggc tagtgcagct gcct cqcgt t caca aggca cCaaag.cgca 12 O ggcggcaaag tittgct cott tattatcttg gcggit coaag atgggcggca ggttc.ca.gac 18O gatggacgaa gacccaccga gttcc acttic cqgct coaac ctic ct ctdcc cgatt catat 24 O aagttt cotg ccaaaggcat tccaattctg. t caatgccaa gcaacaac 288
SEQ ID NO 8 LENGTH: 288 TYPE: DNA ORGANISM: Triticum tauschii FEATURE: NAME/KEY: promoter LOCATION: (1) ... (288) OTHER INFORMATION: Wild typeTtPAPhy Promoter and 5' untranslated region FEATURE: NAMEAKEY: enhancer LOCATION: (42) ... (56)
< 4 OOs SEQUENCE: 8 ttttgttgct tcc.gctittag tittcaagcta cattttgtag aac atgagtic atgcatggga 60 cgaaggcgtc. caaacttggc tagtgcagct gcgtgcgcgt t caca aggca cCaaag.cgca 12 O ggcggcaaag tittgct cott tattatcttg gcggit coaag atgggcggca ggttc.ca.gac 18O gatggacgaa gacccaccga gttcc acttic cqgct coaac ctic ct ctdcc cgatt catat 24 O aagttt cotg ccaaaggcat cocaattctg. t caatgccaa gcaacaac 288
SEO ID NO 9 LENGTH: 271 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: promoter LOCATION: (1) ... (271) OTHER INFORMATION: Wild typeTaPAPhy a1 Promoter and 5' untranslated region FEATURE: NAMEAKEY: enhancer LOCATION: (25) . . (39)
< 4 OOs SEQUENCE: 9 tagtttcaag ctacactittg tagaacatga gtcatgcatg ggacgaaggc gtccaaactt 6 O ggct agtgca gctgcctg.cg C9ttcacaag gCaccaaagc gcaggcggca aagtttgctic 12 O gttt attatc ttggcggit Co. aagatgggcg gCaggttcca gacgatggac gaaga cc cac 18O cgagttccac titc.cggct co aacct cotct gcc.cgattica tataagttt c Ctgccaaagg 24 O catt coaatt ctdtcaatgc caa.gcaacaa c 271
SEQ ID NO 10 LENGTH: 287 TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: promoter US 9,540,633 B2 29 30 - Continued
&222s. LOCATION: (1) ... (287) <223> OTHER INFORMATION: Wild type TaPAPhy a3 promoter and 5' non-coding region 22 Os. FEATURE: <221 > NAMEAKEY: enhancer &222s. LOCATION: (25) . . (39)
<4 OOs, SEQUENCE: 10 tagtttcaag ctacattttg tagalacatga gtcatgcatg ggacgalaggt gtccaaagtic 6 O caaact cqgc tagtgcagct gccticacgt. tctgacgttc acaaggcacc aaag.cgcagg 12 O cggcaaactt tgct cqttta ttatctogcc ggtccalagat ggg.cggcaa.g ttctagacgc 18O tggacgaaga cccaccgaat tccatttic cq gct cocaiacc toctotgccc gattic ct gta 24 O agtttcctgc Caaaat catc. cca attct ct Caatgccaag Calaca CC 287
<210s, SEQ ID NO 11 &211s LENGTH: 24 O 212. TYPE : DNA <213> ORGANISM: Triticum aestivum 22 Os. FEATURE: <221> NAME/KEY: promoter &222s. LOCATION: (1) . . (240) <223> OTHER INFORMATION: Wild type TaPAPhy a 4 promoter and 5' non-coding region 22 Os. FEATURE: <221 > NAMEAKEY: enhancer &222s. LOCATION: (25) . . (39)
<4 OOs, SEQUENCE: 11 tattittcaag ctacattttg tagalacatga gtcatgcatg ggacgalaggt ggccaaagtic 6 O caaacttggc aggcggcaaa gtttgct cqt titat cat citt gcc.ggtc.cala gatgggcggc 12 O aggttcCagg cgatggacga agacccaccg agt cc cactt ccggctic cca acctic ct citg 18O cc.cgatt cat ataagttt co tgc.calaaggc atcCtaattic tgtcaat acc aagcaacaac 24 O
<210s, SEQ ID NO 12 &211s LENGTH: 278 212. TYPE : DNA <213> ORGANISM: Triticum monococcum 22 Os. FEATURE: <221> NAME/KEY: promoter &222s. LOCATION: (1) ... (278) <223> OTHER INFORMATION: High Phy TmPAPhy mutant promoter and 5' untranslated region 22 Os. FEATURE: <221 > NAMEAKEY: enhancer &222s. LOCATION: (25) . . (39)
<4 OOs, SEQUENCE: 12 tagtttcaag ctacattttg tagalacagga gtcatgcatg gacga aggtg tccaaagt cc 6 O aaacttggct agcgcagctg cctgcacgtt Cacaaggcac caaag.cgcag gcggcaaagt 12 O ttgct cqttt attatc.ttgc cggtcCaaga cgggcggcag gttcCagacg atggacgaag 18O acccaccgaa t to cattt co ggctic ccaac citcctctgcc cgatt cotac aagtttic ctd 24 O ccalaaggcat cc caattctg t caatgccaa gcaacgc.c 278
<210s, SEQ ID NO 13 &211s LENGTH: 262 212. TYPE : DNA <213> ORGANISM: Hordeum vulgare 22 Os. FEATURE: <221> NAME/KEY: promoter &222s. LOCATION: (1) . . (262) <223> OTHER INFORMATION: Wild type HvPAPhy promoter and 5' untranslated region US 9,540,633 B2 31 - Continued
FEATURE: NAMEAKEY: enhancer LOCATION: (25) . . (39) OTHER INFORMATION: Wild type cereal enhancer SEQUENCE: 13 taatttcaag ctacattttg tagaacatga gcc atgcatg agacgtaggc gtccaaactt 6 O tggctagogc agctgcatgc acgt.ccacaa ggCaccalaag gCdCagg.cgg caactittgct 12 O cgtttattitt Cttgcgggtc. Caagatgagt tccagac cat gigacgaattic Cactt.cgggc 18O t cccaatcto citctg.ccgga titcctataag titt cotgcca agaag catcc CaatcCCCt C 24 O aatgccaa.gc aacaa.catca ac 262
SEQ ID NO 14 LENGTH: 262 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: promoter LOCATION: (1) ... (262) OTHER INFORMATION: High Phy HvPAPhy mutant promoter and 5' non-coding region FEATURE: NAMEAKEY: enhancer LOCATION: (25) . . (39)
< 4 OOs SEQUENCE: 14 taatttcaag ctacattttg tagaacacga gcc atgcatg agacgtaggc gtccaaactt 6 O tggctagogc agctgcatgc acgt.ccacaa ggCaccalaag gCdCagg.cgg caactittgct 12 O cgtttattitt Cttgcgggtc. Caagatgagt tccagac cat gigacgaattic Cactt.cgggc 18O t cccaatcto citctg.ccgga titcctataag titt cotgcca agaag catcc CaatcCCCt C 24 O aatgccaa.gc aacaa.catca ac 262
SEO ID NO 15 LENGTH: 270 TYPE: DNA ORGANISM: Secale cereale FEATURE: NAME/KEY: promoter LOCATION: (1) ... (270) OTHER INFORMATION: HighPhy ScPAPhy a1 promoter and 5' non-coding region FEATURE: NAMEAKEY: enhancer LOCATION: (25) . . (39)
< 4 OOs SEQUENCE: 15 tagtttcaag ctacatttitc tagaacacga gtcatgcatg ggacgaaggit gtccaaagtic 6 O caaacttggc titttgtgcag ctgcc tigcac gttcaca agg caccalaagcg Caggcggcaa. 12 O acttaatttg citcgttcatt atc.ttgctgg tccalagatgg gcggCaggitt gCacccaccg 18O agttcc actt coggct coca atctoctdtg cctgatt colt ataagttt cc tgccaaaagc 24 O atcc caattic tdt caatgcc aagcaacaac 27 O
SEQ ID NO 16 LENGTH: 28O TYPE: DNA ORGANISM: Secale cereale FEATURE: NAME/KEY: promoter LOCATION: (1) ... (280) OTHER INFORMATION: Wild type ScPAPhy a2 promoter and 5' non-coding region
US 9,540,633 B2 37 38 - Continued
Asn Glin Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg 510 515 gag cc.g CaC agg ttg CaC aag CaC aac tog agc agg cc.g gca CaC 1637 Glu Pro His Arg Cys Lell His Lys His Asn Ser Ser Arg Pro Ala His 525 53 O 535 ggit cga to a aac a CC a Ca cgg gala tog gga ggt talaccgttgt acc actggag 1690 Gly Arg Ser Asn Thir Thir Arg Glu Ser Gly Gly 54 O 545 tagat.cgc.gt ggtgtaatgg caactgtata gacggttcgc cCaag.cgtgg aaataaaaa 1749
<210s, SEQ ID NO 18 &211s LENGTH: 548 212. TYPE : PRT &213s ORGANISM: Triticum aestivum
<4 OOs, SEQUENCE: 18
Met Trp Trp Gly Ser Lell Lell Luell Luell Luell Luell Lell Ala Ala Ala Wall 1. 5 15
Ala Ala Ala Ala Glu Pro Ala Ser Thir Luell Thir Gly Pro Ser Arg Pro 25
Wall Thir Wall Ala Lell Arg Glu Asp Arg Gly His Ala Wall Asp Luell Pro 35 4 O 45
Asp Thir Asp Pro Arg Wall Glin Arg Arg Ala Thir Gly Trp Ala Pro Glu SO 55 6 O
Glin Ile Ala Wall Ala Lell Ser Ala Ala Pro Thir Ser Ala Trp Wall Ser 65 70
Trp Ile Thr Gly Glu Phe Gln Met Gly Gly Thr Wall Pro Lieu Asp 85 90 95
Pro Gly Thir Wall Gly Ser Wall Wall Arg Gly Lell Ala Ala Asp Ser 105 11 O
Lell Wall Arg Glin Ala Ser Gly Asp Ala Luell Wall Ser Glin Luell Tyr 115 12 O 125
Pro Phe Glu Gly Lell Glin Asn Tyr Thir Ser Gly Ile Ile His His Wall 13 O 135 14 O
Arg Luell Glin Gly Lell Glu Pro Ala Thir Tyr Glin Gly 145 150 155 160
Asp Pro Ala Luell Pro Gly Ala Met Ser Ala Wall His Ala Phe Arg Thir 1.65 17s
Met Pro Ala Wall Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Wall Wall 18O 185 19 O
Gly Asp Luell Gly Lell Thir Asn Thir Thir Ser Thir Wall Asp His Met 195
Ala Ser Asn Arg Pro Asp Lell Wall Luell Luell Wall Gly Asp Wall 21 O 215 22O
Ala Asn Met Lell Thir Asn Gly Thir Gly Ala Asp Ser Cys 225 23 O 235 24 O
Ala Phe Gly Ser Thir Pro Ile His Glu Thir Glin Pro Arg Trp 245 250 255
Asp Trp Gly Arg Met Glu Ala Wall Thir Ser Gly Thir Pro Met 26 O 265 27 O
Met Wall Wall Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly Asn 28O 285
Thir Phe Ala Ala Ser Arg Phe Ala Phe Pro Ser Thir Glu Ser 29 O 295 3 OO
Gly Ser Phe Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His US 9,540,633 B2 39 40 - Continued
3. OS 310 315 32O Phe Lieu Met Lieu. Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Glin 3.25 330 335 Tyr Arg Trp Lieu. Glu Lys Asp Lieu Ala Lys Val Asp Arg Ser Val Thr 34 O 345 35. O Pro Trp Leu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys 355 360 365 Ala His Tyr Arg Glu Val Glu. Cys Met Arg Val Ala Met Glu Glu Lieu 37 O 375 38O Lieu. Tyr Ser His Gly Lieu. Asp Ile Ala Phe Thr Gly His Val His Ala 385 390 395 4 OO Tyr Glu Arg Ser Asn Arg Val Phe Asn Tyr Thr Lieu. Asp Pro Cys Gly 4 OS 41O 415 Ala Wal His Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 42O 425 43 O Thir Thr His Ala Asp Glu Pro Gly His Cys Pro Asp Pro Arg Pro Llys 435 44 O 445 Pro Asn Ala Phe Ile Gly Gly Phe Cys Ala Ser Asn Phe Thr Ser Gly 450 45.5 460 Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg Glin Pro Asp Tyr Ser Ala 465 470 47s 48O Tyr Arg Glu Ser Ser Phe Gly His Gly Ile Lieu. Glu Val Lys Asn. Glu 485 490 495 Thir His Ala Lieu. Trp Arg Trp His Arg Asn Glin Asp His Tyr Gly Ser 500 505 51O Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Lieu. His 515 52O 525 Llys His Asn. Ser Ser Arg Pro Ala His Gly Arg Ser Asn. Thir Thr Arg 53 O 535 54 O Glu Ser Gly Gly 5.45
<210s, SEQ ID NO 19 &211s LENGTH: 1743 &212s. TYPE: DNA <213> ORGANISM: Triticum aestivum 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (22) ... (1665) <223> OTHER INFORMATION: CDS encoding phytase of TaPAPhy a2 Phytase cDNA
<4 OOs, SEQUENCE: 19 Ctct caatgc caa.gcaacac C atg tdg togg ggg tog Ctg cgg Ctg ctg. Ctg 51 Met Trp Trp Gly Ser Lieu. Arg Lieu. Lieu. Lieu 1. 5 1O
Ctg Ct c gC9 gC9 gcg gtg gC9 gcg gct gct gag CC9 gC9 tog acg Ctic 99 Lieu. Lieu Ala Ala Ala Wall Ala Ala Ala Ala Glu Pro Ala Ser Thr Lieu 15 2O 25 acc ggc cc.g. tcg C9g CC9 gtg acg gtg gC9 Ctg C9g aaa gac agg gC 147 Thr Gly Pro Ser Arg Pro Val Thr Val Ala Lieu. Arg Lys Asp Arg Gly 3O 35 4 O cac gcg gtg gac Ctg ccg gac acg gaC ccc cqg gtg cag cqc cqg gCC 195 His Ala Val Asp Lieu Pro Asp Thr Asp Pro Arg Val Glin Arg Arg Ala 45 SO 55 acg ggc tigg gct CCC gag cag at C acc gtC gog Ctc. tcc gcc gct coc 243 Thr Gly Trp Ala Pro Glu Glin Ile Thr Val Ala Leu Ser Ala Ala Pro 60 65 70
US 9,540,633 B2 43 44 - Continued
a CC ggc Cat gtg cac gcg tac gag cgc to c aac C9g gtg ttic aac tac 251 Thir Gly His Wall His Ala Glu Arg Ser Asn Arg Wall Phe Asn Tyr 395 4 OO 4 OS 41O acg Ctg gac cc.g tgc ggc gcg gtg CaC at C tcg gtg ggc gac ggc 999 299 Thir Luell Asp Pro Cys Gly Ala Wall His Ile Ser Wall Gly Asp Gly Gly 415 42O 425
aac cgg gag aag atg gcc a CC acc CaC gcc gac gag cc.g 999 CaC tgc 347 Asn Arg Glu Lys Met Ala Thir Thir His Ala Asp Glu Pro Gly His Cys 43 O 435 44 O cc.g gac cc.g cgg c cc aag c cc aac gcc ttic atc ggc tgc ttic tgc gcc 395 Pro Asp Pro Arg Pro Llys Pro Asn Ala Phe Ile Gly Cys Phe Cys Ala 445 450 45.5 tto aac ttic acg tcc ggc cc.g gcc gcc ggc agg ttc tgc tgg gac cgg 443 Phe Asn Phe Thir Ser Gly Pro Ala Ala Gly Arg Phe Cys Trp Asp Arg 460 465 470
Cag cc.g gac tac agc gcc tac cgg gag agc agc titc ggc CaC ggc at C 491 Glin Pro Asp Ser Ala Arg Glu Ser Ser Phe Gly His Gly Ile 47s 48O 485 490 citc. gag gtg aag aac gag acg CaC gct Ctg tgg aga tgg CaC agg aac 539 Lell Glu Wall Lys ASn Glu Thir His Ala Luell Trp Arg Trp His Arg Asn 495 SOO 505
Cag gac CaC tac gga agc gcc gga gat gag att tac att gtC cgg gag 587 Glin Asp His Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile Wall Arg Glu 510 515 52O cc.g CaC agg ttg cac aag CaC aac tog acc agg cc.g gca CaC ggt 635 Pro His Arg Cys Lieu. His Lys His Asn Ser Thr Arg Pro Ala His Gly 525 53 O 535 cga Cala aac acc aca C9g gaa tog gga ggt taactgctgt actgctggag 685 Arg Glin Asn Thir Thr Arg Glu Ser Gly Gly 54 O 5.45 tagat.cgc.gc ggtgtaatgg caactittata gatgatt.cgc cca agcgtgg aaataaaa 743
<210s, SEQ ID NO 2 O &211s LENGTH: 548 212. TYPE : PRT <213> ORGANISM: Triticum aestivum
<4 OOs, SEQUENCE:
Met Trp Trp Gly Ser Luell Arg Luell Luell Luell Luell Luell Ala Ala Ala Wall 1. 5 15
Ala Ala Ala Ala Glu Pro Ala Ser Thir Luell Thr Gly Pro Ser Arg Pro 2O 25
Wall Thir Wall Ala Lieu. Arg Asp Arg Gly His Ala Wall Asp Luell Pro 35 4 O 45
Asp Thir Asp Pro Arg Val Glin Arg Arg Ala Thr Gly Trp Ala Pro Glu SO 55 6 O
Glin Ile Thir Wall Ala Lieu Ser Ala Ala Pro Thir Ser Ala Trp Wall Ser 65 70
Trp Ile Thir Gly Glu Phe Glin Met Gly Gly Thir Wall Pro Luell Asn 85 90 95
Pro Gly Thir Wall Ala Ser Wall Wall Arg Gly Lieu. Ala Ala Asp Ser 105 11 O
Lell Wall His Glu Ala Thr Gly Asp Ala Luell Val Tyr Ser Glin Luell 115 12 O 125
Pro Phe Glu Gly Lieu. Glin Asn Thir Ser Gly Ile Ile His His Wall 13 O 135 14 O
Arg Luell Glin Gly Lieu. Glu Pro Ala Thir Glin Gly US 9,540,633 B2 45 46 - Continued
145 150 155 160
Asp Pro Gly Ile Pro Gly Ala Met Ser Ala Wall His Ala Phe Arg Thir 1.65 17O 17s
Met Pro Ala Wall Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Wall Wall 18O 185 19 O
Gly Asp Luell Gly Lell Thir Asn Thir Thir Ser Thir Wall Asp His Met 195
Wall Ser Asn Arg Pro Asp Lell Wall Luell Luell Wall Gly Asp Wall 21 O 215 22O
Ala Asn Met Lell Thir Asn Gly Thir Gly Ala Asp Ser Cys 225 23 O 235 24 O
Ala Phe Gly Ser Thir Pro Ile His Glu Thir Glin Pro Arg Trp 245 250 255
Asp Trp Gly Arg Met Glu Ala Wall Thir Ser Gly Thir Pro Met 26 O 265 27 O
Met Wall Wall Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly Asn 28O 285
Thir Phe Ala Ala Arg Ser Arg Phe Ala Phe Pro Ser Thir Glu Ser 29 O 295 3 OO
Gly Ser Phe Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His 3. OS 310 315 32O
Phe Ile Met Luell Ala Ala Ala Asp Tyr Ser Arg Ser Gly Glu Glin 3.25 330 335
Arg Trp Luell Wall Asp Luell Ala Wall Asp Arg Ala Wall Thir 34 O 345 35 O
Pro Trp Luell Wall Ala Gly Trp His Ala Pro Trp Thir Thir 355 360 365
Ala His Arg Glu Wall Glu Met Arg Wall Ala Met Glu Glu Luell 37 O 375
Lell Ser His Gly Lell Asp Ile Ala Phe Thir Gly His Wall His Ala 385 390 395 4 OO
Glu Arg Ser Asn Arg Wall Phe Asn Tyr Thir Lell Asp Pro Cys Gly 4 OS 415
Ala Wall His Ile Ser Wall Gly Asp Gly Gly ASn Arg Glu Lys Met Ala 425 43 O
Thir Thir His Ala Asp Glu Pro Gly His Pro Asp Pro Arg Pro 435 44 O 445
Pro Asn Ala Phe Ile Gly Cys Phe Ala Phe Asn Phe Thir Ser Gly 450 45.5 460
Pro Ala Ala Gly Arg Phe Trp Asp Arg Glin Pro Asp Ser Ala 465 470 48O
Arg Glu Ser Ser Phe Gly His Gly Ile Luell Glu Wall Asn Glu 485 490 495
Thir His Ala Luell Trp Arg Trp His Arg Asn Glin Asp His Tyr Gly Ser SOO 505 51O
Ala Gly Asp Glu Ile Ile Wall Arg Glu Pro His Arg Luell His 515 52O 525
His Asn Ser Thir Pro Ala His Gly Arg Glin Asn Thir Thir Arg 53 O 535 54 O
Glu Ser Gly Gly 5.45
<210s, SEQ ID NO 21
US 9,540,633 B2 51 52 - Continued
<4 OOs, SEQUENCE: 22
Met Trp Trp Gly Ser Lell Arg Luell Luell Luell Luell Lell Ala Ala Ala Wall 1. 15
Ala Ala Ala Ala Glu Pro Ala Ser Thir Luell Thir Gly Pro Ser Arg Pro 25
Wall Thir Wall Thir Lell Arg Glu Asp Arg Gly His Ala Wall Asp Luell Pro 35 4 O 45
Asp Thir Asp Pro Arg Wall Glin Arg Arg Ala Thir Gly Trp Ala Pro Glu SO 55 6 O
Glin Ile Ala Wall Ala Lell Ser Ala Ala Pro Thir Ser Ala Trp Wall Ser 65 70
Trp Ile Thir Gly Glu Phe Glin Met Gly Gly Thir Wall Pro Luell Asp 85 90 95
Pro Gly Thir Wall Ala Ser Wall Wall Arg Gly Lell Ala Ala Asp Ser 105 11 O
Lell Wall Arg Glin Ala Thir Gly Asp Ala Luell Wall Ser Glin Luell Tyr 115 12 O 125
Pro Phe Glu Gly Lell Glin Asn Tyr Thir Ser Gly Ile Ile His His Wall 13 O 135 14 O
Arg Luell Glin Gly Lell Glu Pro Ala Thir Tyr Glin Gly 145 150 155 160
Asp Pro Ala Luell Pro Gly Ala Met Ser Ala Wall His Ala Phe Arg Thir 1.65
Met Pro Ala Wall Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Wall Wall 18O 185 19 O
Gly Asp Luell Gly Lell Thir Asn Thir Thir Ser Thir Wall Asp His Met 195
Ala Ser Asn Arg Pro Asp Lell Wall Luell Luell Luell Gly Asp Wall Ser 21 O 215 22O
Ala Asn Luell Tyr Lell Thir Asn Gly Thir Gly Ala Asp Ser Cys 225 23 O 235 24 O
Ala Phe Gly Ser Thir Pro Ile His Glu Thir Glin Pro Arg Trp 245 250 255
Asp Trp Gly Arg Met Glu Ala Wall Thir Ser Gly Thir Pro Met 26 O 265 27 O
Wall Wall Wall Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly Asn 28O 285
Thir Phe Ala Ala Arg Ser Arg Phe Ala Phe Pro Ser Thir Glu Ser 29 O 295 3 OO
Gly Ser Phe Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His 3. OS 310 315 32O
Phe Wall Met Luell Gly Ala Ala Asp Tyr Gly Arg Ser Gly Glu Glin 3.25 330 335
Arg Trp Luell Glu Asp Luell Ala Wall Asp Arg Ser Wall Thir 34 O 345 35. O
Pro Trp Luell Wall Ala Gly Trp His Ala Pro Trp Thir Thir 355 360 365
Ala His Arg Glu Wall Glu Met Arg Wall Ala Met Glu Glu Luell 37 O 375 38O
Lell Tyr Ser His Gly Lell Asp Ile Ala Phe Thir Gly His Wall His Ala 385 390 395 4 OO
Glu Arg Ser Asn Arg Wall Phe Asn Tyr Thir Lell Asp Pro Cys Gly 4 OS 41O 415 US 9,540,633 B2 53 54 - Continued
Ala Wall His Ile Ser Wall Gly Asp Gly Gly ASn Arg Glu Lys Met Ala 425 43 O
Thir Thir His Ala Asp Glu Pro Gly His Pro Glu Pro Arg Ala 435 44 O 445
Pro Asn Ala Phe Ile Gly Gly Phe Ala Phe Asn Phe Thir Ser Gly 450 45.5 460
Pro Ala Ala Gly Arg Phe Trp Asp Arg Glin Pro Asp Ser Ala 465 470 48O
Arg Glu Ser Ser Phe Gly His Gly Ile Luell Glu Wall Asn Glu 485 490 495
Thir His Ala Luell Trp Arg Trp His Arg Asn Glin Asp Met Tyr Gly Ser SOO 505 51O
Ala Gly Asp Glu Ile Tyr Ile Wall Arg Glu Pro His Arg Luell His 515 52O 525
His Asn Ser Thr Arg Pro Thir His Gly Arg 53 O 535
SEQ ID NO 23 LENGTH: 173 O TYPE: DNA ORGANISM: Triticum monococcum FEATURE: NAME/KEY: CDS LOCATION: (17) . . (1651) OTHER INFORMATION: Phytase coding sequence of TmPAPhy a1 phytase cDNA
SEQUENCE: 23 aatgccaa.gc aacgcc atg tdg tog ggg gcg ctg. Cag ctg. Ctg ctg. Ctg ct c 52 Met Trp Trp Gly Ala Lieu Gln Lieu Lleu Lieu. Lieu. Lieu. 1. 5 1O gtg gcg gct gct gag cc.g gcg tog acg citc. a CC ggc cc.g tog cgg Wall Ala Ala Ala Glu Pro Ala Ser Thir Luell Thir Gly Pro Ser Arg 2O 25 cc.g gtg gtg gcg Ctg cgg a.a.a. gac agg ggc CaC gcg gtg gac Ctg 148 Pro Wall Wall Ala Lieu Arg Asp Arg Gly His Ala Wall Asp Luell 3O 35 4 O cc.g gac gac CCC cq9 gtg cag cgc cgg gcc acg ggc tgg gct cc c 196 Pro Asp Asp Pro Arg Wall Glin Arg Arg Ala Thir Gly Trp Ala Pro 45 SO 55 60 gag cag acc gtC gC9 citc. to c gcc gct coc a CC tot gcc gt C 244 Glu Glin Thir Wall Ala Lell Ser Ala Ala Pro Thir Ser Ala Wall 65 70 t cc tgg acc ggg gala tto cag atg ggc ggc a Ca gtc aag cc.g Ctg 292 Ser Trp Thir Gly Glu Phe Glin Met Gly Gly Thir Wall Lys Pro Luell 8O 85 90
CaC cc c ggc acg gtc gcc agc gt C gtg cgc tac 999 citc. gcc gcc gat 34 O His Pro Gly Thir Wall Ala Ser Wall Wall Arg Gly Lell Ala Ala Asp 95 1OO 105 tot ttg gtt cgc gag gCC a CC ggc gac gcg citt gtg tac agc cag citc. 388 Ser Luell Wall Arg Glu Ala Thir Gly Asp Ala Luell Wall Ser Glin Luell 11 O 115 12O tac cc c ttic gag ggc ctic Cag aac tac acc to c ggc atc. at C CaC CaC 436 Tyr Pro Phe Glu Gly Lieu. Glin Asn Tyr Thir Ser Gly Ile Ile His His 125 13 O 135 14 O gtc cgc citc. Cala ggg Ctt gag cott gcg acg aag tac tac tac cag tgc 484 Wall Arg Luell Glin Gly Lieu. Glu Pro Ala Thir Tyr Glin 145 150 155 ggc gac ggc atc cc.g 999 atg agc gcc gtc CaC ttic cgg 532
US 9,540,633 B2 57 - Continued gcc tac C9g gala agc agc titc ggc cac ggc atc ctic gag gtg aag aac 492 Ala Tyr Arg Glu Ser Ser Phe Gly. His Gly Ile Lieu. Glu Val Lys Asn 48O 485 49 O gag acg cac got Ctg tdg aga tigg cac agg aac Cag gaC cac tac gga 54 O Glu Thir His Ala Lieu. Trp Arg Trp His Arg Asn Glin Asp His Tyr Gly 495 SOO 5 OS agc gcc gga gat gag att tac att gtc. c99 gag ccg cac agg tec ttg 588 Ser Ala Gly Asp Glu Ile Tyr Ile Val Arg Glu Pro His Arg Cys Lieu. 510 515 52O cac aag cac aac tog acc agg ccg gca cac ggit ca caa aac acc aca 636 His Llys His Asn Ser Thr Arg Pro Ala His Gly Arg Glin Asn. Thir Thr 525 53 O 535 54 O cgg gala tog gga ggc taactgctgt actgctggag tagat.cgc.gc ggtgtaatgg 691 Arg Glu Ser Gly Gly 5.45
Calactatata gacggttcgc cca agcgtgg aaataaaaa 73 O
<210s, SEQ ID NO 24 &211s LENGTH: 545 212. TYPE: PRT <213> ORGANISM: Triticum monococcum
<4 OOs, SEQUENCE: 24 Met Trp Trp Gly Ala Lieu Gln Lieu. Lieu. Lieu. Lieu. Lieu Val Ala Ala Ala 1. 5 1O 15 Ala Glu Pro Ala Ser Thr Lieu. Thr Gly Pro Ser Arg Pro Val Thr Val 2O 25 3O Ala Lieu. Arg Lys Asp Arg Gly His Ala Val Asp Lieu Pro Asp Thr Asp 35 4 O 45 Pro Arg Val Glin Arg Arg Ala Thr Gly Trp Ala Pro Glu Glin Ile Thr SO 55 6 O Val Ala Leu Ser Ala Ala Pro Thr Ser Ala Trp Val Ser Trp Ile Thr 65 70 7s 8O Gly Glu Phe Gln Met Gly Gly Thr Val Llys Pro Leu. His Pro Gly Thr 85 90 95 Val Ala Ser Val Val Arg Tyr Gly Lieu Ala Ala Asp Ser Lieu Val Arg 1OO 105 11 O Glu Ala Thr Gly Asp Ala Leu Val Tyr Ser Gln Leu Tyr Pro Phe Glu 115 12 O 125 Gly Leu Glin Asn Tyr Thr Ser Gly Ile Ile His His Val Arg Leu Gln 13 O 135 14 O Gly Lieu. Glu Pro Ala Thr Lys Tyr Tyr Tyr Glin Cys Gly Asp Pro Gly 145 150 155 160 Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr Met Pro Ala 1.65 17O 17s Val Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp Lieu 18O 185 19 O
Gly Lieu. Thir Tyr Asn Thr Thr Ser Thr Val Asp His Met Val Ser Asn 195 2OO 2O5
Arg Pro Asp Lieu Val Lieu. Lieu Val Gly Asp Val Cys Tyr Ala Asn Met 21 O 215 22O
Tyr Lieu. Thir Asn Gly Thr Gly Ala Asp Cys Tyr Ser Cys Ala Phe Gly 225 23 O 235 24 O Lys Ser Thr Pro Ile His Glu Thr Tyr Glin Pro Arg Trp Asp Tyr Trp 245 250 255
Gly Arg Tyr Met Glu Ala Val Thr Ser Gly Thr Pro Met Met Val Val US 9,540,633 B2 59 60 - Continued
26 O 265 27 O
Glu Gly Asn His Glu Ile Glu Glu Glin Ile Arg Asn Arg Thir Phe Ala 27s 28O 285
Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Thir Glu Ser Gly Ser Phe 29 O 295 3 OO
Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His Phe Wall Met 3. OS 310 315
Lell Ala Ala Ala Asp Ser Arg Ser Gly Glu Glin Tyr Arg Trp 3.25 330 335
Lell Asp Lell Ala Wall Asp Arg Ala Wall Thir Pro Trp Luell 34 O 345 35. O
Wall Ala Gly Trp His Ala Pro Trp Thir Thir Lys Ala His 355 360 365
Arg Glu Wall Glu Met Arg Wall Ala Met Glu Glu Lell Luell Ser 37 O 375 38O
His Gly Luell Asp Ile Ala Phe Thir Gly His Wall His Ala Glu Arg 385 390 395 4 OO
Ser Asn Arg Wall Phe Asn Tyr Thir Luell Asp Pro Gly Ala Wall His 4 OS 415
Ile Ser Wall Gly Asp Gly Gly Asn Arg Glu Lys Met Ala Thir Thir His 425 43 O
Ala Asp Glu Pro Gly His Pro Asp Pro Arg Pro Lys Pro Asn Ala 435 44 O 445
Phe Ile Gly Gly Phe Ala Ser Asn Phe Thir Ser Gly Pro Ala Ala 450 45.5 460
Gly Arg Phe Trp Asp Arg Glin Pro Asp Tyr Ser Ala Arg Glu 465 470
Ser Ser Phe Gly His Gly Ile Luell Glu Wall Asn Glu Thir His Ala 485 490 495
Lell Trp Arg Trp His Arg Asn Glin Asp His Tyr Gly Ser Ala Gly Asp SOO 505 51O
Glu Ile Tyr Ile Wall Arg Glu Pro His Arg Cys Lell His His Asn 515 525
Ser Thir Arg Pro Ala His Gly Arg Glin Asn Thir Thir Arg Glu Ser Gly 53 O 535 54 O Gly 5.45
SEO ID NO 25 LENGTH: 1744 TYPE: DNA ORGANISM: Secale cereale FEATURE: NAME/KEY: CDS LOCATION: (17) . . (1639) OTHER INFORMATION: ScPAPhy a1 phytase cDNA
<4 OOs, SEQUENCE: 25 aatgccaa.gc aacaac atg tdg C9g ggg tog Ctg C9g ctg. Ctg ctg. Ctg ct c 52 Met Trp Arg Gly Ser Lieu. Arg Lieu Lleu Lieu. Lieu. Lieu. 1. 5 gcg gcg gcg gtg acg gC9 gct gct gag cc.g. gigg tog acg citc. atg ggc 1OO Ala Ala Ala Wall. Thir Ala Ala Ala Glu Pro Gly Ser Thir Luell Met Gly 15 2O 25 cc.g to a cgg ccg gtt acg gtg gcg Ctg cgg gaa gac agg ggc CaC gcg 148 Pro Ser Arg Pro Val Thr Wall Ala Lieu. Arg Glu Asp Arg Gly His Ala 3O 35 4 O
US 9,540,633 B2 65 66 - Continued
Lell Wall Arg Wall Ala Thir Gly Asp Ala Luell Wall Tyr Ser Glin Luell 115 12 O 125
Pro Phe Glu Gly Lell Glin Asn Thir Ser Gly Ile Ile His His Wall 13 O 135 14 O
Arg Luell Glin Gly Lell Glu Pro Gly Thir Tyr Tyr Glin Gly 145 150 155 160
Asp Pro Ala Luell Pro Gly Ala Met Ser Ala Wall His Ala Phe Arg Thir 1.65
Met Pro Ala Wall Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Wall Wall 18O 185 19 O
Gly Asp Luell Gly Lell Thir Asn Thir Thir Ser Thir Wall Asp His Met 195
Wall Ser Asn Arg Pro Asp Lell Wall Wall Luell Wall Gly Asp Wall Ser 21 O 215 22O
Ala Asn Luell Tyr Lell Thir Asn Gly Thir Gly Ala Asp Ser Cys 225 23 O 235 24 O
Ala Phe Gly Ser Thir Pro Ile His Glu Thir Tyr Glin Pro Arg Trp 245 250 255
Asp Trp Gly Arg Met Glu Ala Wall Thir Ser Gly Thir Pro Met 26 O 265 27 O
Met Wall Wall Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly 28O 285
Thir Phe Glu Ala Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser 29 O 295 3 OO
Gly Ser Phe Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His 3. OS 310 315 32O
Phe Ile Met Luell Ala Ala Asp Asp Tyr Ser Arg Ser Gly Glu Glin 3.25 330 335
Arg Trp Luell Glu Asp Luell Ser Wall Asp Arg Ser Wall Thir 34 O 345 35. O
Pro Trp Luell Wall Ala Gly Trp His Ala Pro Trp Tyr Thir Thir 355 360 365
Ala His Arg Glu Wall Glu Met Arg Wall Ser Met Glu Glu Luell 37 O 375
Lell Tyr Ser His Gly Lell Asp Ile Ala Phe Thir Gly His Wall His Ala 385 390 395 4 OO
Glu Arg Ser Asn Arg Wall Phe Asn Tyr Thir Lell Asp Pro Cys Gly 4 OS 415
Ala Wall His Ile Ser Wall Gly Asp Gly Gly ASn Arg Glu Lys Met Ala 425 43 O
Thir Thir His Ala Asp Glu Pro Gly His Pro Asp Pro Arg Pro 435 44 O 445
Pro Asn Ala Phe Ile Gly Gly Phe Gly Phe Asn Phe Thir Ser Gly 450 45.5 460
Pro Ala Ala Gly Arg Tyr Trp Asp Arg Glin Pro Asp Ser Ala 465 470
Arg Glu Ser Ser Phe Gly His Gly Ile Luell Glu Wall Asn Glu 485 490 495
Thir His Ala Luell Trp Arg Trp His Arg Asn Glin Asp Met Tyr Gly Ser SOO 505 51O
Ala Gly Asp Glu Ile Ile Wall Arg Glu Pro Glu Arg Luell His 515 52O 525
US 9,540,633 B2 71 72 - Continued
&211s LENGTH: 539 212. TYPE : PRT <213s ORGANISM: Secale cereale
<4 OOs, SEQUENCE: 28
Met Trp Leu Gly Ser Lell Arg Luell Luell Luell Luell Lell Ala Ala Ala Wall 1. 5 15
Thir Ala Ala Ala Glu Pro Ala Ser Thir Luell Met Gly Pro Ser Arg Pro 25
Wall Thir Wall Ala Lell Arg Glu Asp Arg Gly His Ala Wall Asp Luell Pro 35 4 O 45
Asp Thir Asp Pro Arg Wall Glin Arg Arg Ala ASn Gly Trp Ala Pro Glu SO 55 6 O
Glin Ile Ala Wall Ala Lell Ser Ala Ala Pro Thir Ser Ala Trp Wall Ser 65 70
Trp Ile Thir Gly Glu Phe Glin Met Gly Gly Thir Wall Pro Luell Asp 85 90 95
Pro Gly Thir Wall Gly Ser Wall Wall Arg Gly Lell Ala Ala Asp Ser 105 11 O
Lell Wall Arg Wall Ala Thir Gly Asp Ala Luell Wall Ser Glin Luell 115 12 O 125
Pro Phe Glu Gly Lell Glin Asn Thir Ser Gly Ile Ile His His Wall 13 O 135 14 O
Arg Luell Glin Gly Lell Glu Pro Gly Thir Tyr Glin Gly 145 150 155 160
Asp Pro Ala Lieu Pro Gly Thr Met Ser Ala Wall His Ala Phe Arg Thr 1.65
Met Pro Ala Wall Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Wall Wall 18O 185 19 O
Gly Asp Luell Gly Lell Thir Asn Thir Thir Ser Thir Wall Asp His Met 195
Met Ser Asn Arg Pro Asp Lell Wall Wall Luell Wall Gly Asp Wall Ser 21 O 215 22O
Ala Asn Luell Lell Thir Asn Gly Thir Gly Ala Asp Ser Cys 225 23 O 235 24 O
Ala Phe Gly Ser Thir Pro Ile His Glu Thir Glin Pro Arg Trp 245 250 255
Asp Trp Gly Arg Met Glu Ala Wall Thir Ser Gly Thir Pro Met 26 O 265 27 O
Met Wall Wall Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly 28O 285
Thir Phe Glu Ala Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Asn 29 O 295 3 OO
Gly Ser Phe Ser Pro Phe Ser Phe Asp Ala Gly Gly Ile His 3. OS 310 315 32O
Phe Ile Met Luell Ala Ala Ala Asp Tyr Ser Ser Gly Glu Glin 3.25 330 335
Arg Trp Luell Glu Asp Luell Ala Wall Arg Ser Wall Thir 34 O 345 35. O
Pro Trp Luell Wall Ala Gly Trp His Ala Pro Trp Thir Thir 355 360 365
Ala His Arg Glu Wall Glu Met Arg Wall Ala Met Glu Glu Luell 37 O 375 38O
Lell Ser His Gly Lell Asp Ile Ala Phe Thir Gly His Wall His Ala US 9,540,633 B2 73 74 - Continued
385 390 395 4 OO
Glu Arg Ser Asn Arg Wall Phe Asn Tyr Thir Lieu. Asp Pro Cys Gly 4 OS 41O 415
Ala Wall His Ile Ser Wall Gly Asp Gly Gly Asn Arg Glu Lys Met Ala 425 43 O
Thir Thir His Ala Asp Glu Pro Gly His Pro Asp Pro Arg Pro 435 44 O 445
Pro Asn Ala Phe Ile Gly Gly Phe Gly Phe Asn Phe Thir Ser Gly 450 45.5 460
Pro Ala Ala Gly Arg Tyr Trp Asp Arg Glin Pro Asp Ser Ala 465 470
Arg Glu Ser Ser Phe Gly His Gly Ile Lieu. Glu Wall Asn Glu 485 490 495
Thir His Ala Luell Trp Arg Trp His Arg Asn Glin Asp Met Tyr Gly Ser SOO 505 51O
Ala Gly Asp Glu Ile Ile Wall Arg Glu Pro Glu Arg Luell His 515 525
His Asn Ser Thir Pro Ala His Gly Arg 53 O 535
SEQ ID NO 29 LENGTH: 1773 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: CDS LOCATION: (40) . . (1650) OTHER INFORMATION: Phytase coding sequence of HvPAPhy a1 phytase cDNA
SEQUENCE: 29 agcatcc.caa ticcitct caat gccaa.gcaac aac at Caac atg togg togggg. tcg 54 Met Trp Trp Gly Ser 1.
Ctg Ctg Ctg citc. gcg gcg gcg gtg gcg gtg gct gcc gct gag cc.g cc.g Lell Luell Luell Luell Ala Ala Ala Wall Ala Wall Ala Ala Ala Glu Pro Pro 10 15 2O tcg acg citc. gct ggc cc.g tcg cgg cc.g gtg acg gtg acg cc.g cgg gala 15 O Ser Thir Luell Ala Gly Pro Ser Arg Pro Wall Thir Wall Thir Pro Arg Glu 25 3O 35
aac agg ggc CaC gcg gtg gac Ctg gac acg gac c cc cgg gtg cag 198 Asn Arg Gly His Ala Wall Asp Luell Pro Asp Thir Asp Pro Arg Wall Glin 4 O 45 SO cgc cgg gcc acg ggc tgg gct cc c gag cag gtc gcc gtc gcg citc. to c 246 Arg Arg Ala Thir Gly Trp Ala Pro Glu Glin Wall Ala Wall Ala Luell Ser 55 6 O 65 gcc gct cc c acc tot gcc tgg gt C to c tgg atc. acc 999 gala ttic cag 294 Ala Ala Pro Thir Ser Ala Trp Wall Ser Trp Ile Thr Gly Glu Phe Glin 70 7s 8O 85 atg ggc ggc acc gtg aag cc.g Ctg gac cc c cgc acg gtc ggc agc gt C 342 Met Gly Gly Thir Wall Lys Pro Luell Asp Pro Arg Thr Wall Gly Ser Wall 9 O 95 1OO gtg cgc tac 999 citc. gcc gcc gac tot ttg gtt CC gag gcc acc ggc 390 Wall Arg Gly Lell Ala Ala Asp Ser Luell Val Arg Glu Ala Thir Gly 105 11 O 115 gac gcg citc. gtg tac agc Cag citc. tac cc c ttic gag ggc citc. CaC aac 438 Asp Ala Luell Wall Ser Glin Luell Tyr Pro Phe Glu Gly Luell His Asn 12 O 125 13 O tac acc to c ggc atc. atc. CaC CaC gt C cgc Ctc. Caa 999 citt gag cott 486
US 9,540,633 B2 77 78 - Continued ttic tic gcc titt aac ttic acg to C ggc ccg gCC gcc ggc agg tt C to 446 Phe Cys Ala Phe Asn Phe Thr Ser Gly Pro Ala Ala Gly Arg Phe Cys 45.5 460 465 tgg gaC cq9 cag ccg gac tac agc gcg tac cqg gag agc agc titC ggc 494 Trp Asp Arg Glin Pro Asp Tyr Ser Ala Tyr Arg Glu Ser Ser Phe Gly 470 47s 48O 485
Cat ggc at C ct c gag gtg aag aac gag acg cac gct Ctg tdg aga tigg 542 His Gly Ile Lieu. Glu Wall Lys Asn. Glu Thir His Ala Lieu. Trp Arg Trp 490 495 SOO cac agg aac cag gac Ctg tac ggg agc gcc gga gat gag att tac att 590 His Arg Asn Glin Asp Lieu. Tyr Gly Ser Ala Gly Asp Glu Ile Tyr Ile 505 510 515 gtt cqg gag ccg gag agg to ttg cac aag cac aac tog acc agg ccc 638 Val Arg Glu Pro Glu Arg Cys Lieu. His Llys His Asn. Ser Thr Arg Pro 52O 525 53 O gca cac ggit cog taaaaatggc aactacagac ggttcgc.cca agc.cggagat 69 O. Ala His Gly Pro 535 taactgttct accact actg gagtatat cq ccc.cgtgcaa taatggcaac tatagacggit 7 O tcgcc.catgc gtggaaataa aaa. 773
<210s, SEQ ID NO 3 O &211s LENGTH: 537 212. TYPE: PRT <213> ORGANISM: Hordeum vulgare
<4 OOs, SEQUENCE: 30 Met Trp Trp Gly Ser Lieu Lleu Lieu Lieu Ala Ala Ala Val Ala Val Ala 1. 5 1O 15 Ala Ala Glu Pro Pro Ser Thr Lieu Ala Gly Pro Ser Arg Pro Val Thr 2O 25 3O Val Thr Pro Arg Glu Asn Arg Gly. His Ala Val Asp Lieu Pro Asp Thr 35 4 O 45 Asp Pro Arg Val Glin Arg Arg Ala Thr Gly Trp Ala Pro Glu Glin Val SO 55 6 O Ala Val Ala Lieu. Ser Ala Ala Pro Thir Ser Ala Trp Val Ser Trp Ile 65 70 7s 8O Thr Gly Glu Phe Gln Met Gly Gly Thr Val Llys Pro Leu Asp Pro Arg 85 90 95 Thr Val Gly Ser Val Val Arg Tyr Gly Lieu Ala Ala Asp Ser Lieu Val 1OO 105 11 O Arg Glu Ala Thr Gly Asp Ala Lieu Val Tyr Ser Glin Lieu. Tyr Pro Phe 115 12 O 125 Glu Gly Lieu. His Asn Tyr Thr Ser Gly Ile Ile His His Val Arg Lieu. 13 O 135 14 O Gln Gly Lieu. Glu Pro Gly Thr Lys Tyr Tyr Tyr Glin Cys Gly Asp Pro 145 150 155 160
Ala Ile Pro Gly Ala Met Ser Ala Val His Ala Phe Arg Thr Met Pro 1.65 17O 17s
Ala Ala Gly Pro Arg Ser Tyr Pro Gly Arg Ile Ala Val Val Gly Asp 18O 185 19 O
Lieu. Gly Lieu. Thr Tyr Asn Thr Thr Ser Thr Val Asp His Met Thir Ser 195 2OO 2O5
Asn Arg Pro Asp Lieu Val Val Lieu Val Gly Asp Wal Ser Tyr Ala Asn 21 O 215 22O
Met Tyr Lieu. Thir Asn Gly Thr Gly Thr Asp Cys Tyr Ser Cys Ser Phe US 9,540,633 B2 79 - Continued
225 23 O 235 24 O Gly Lys Ser Thr Pro Ile His Glu Thr Tyr Gln Pro Arg Trp Asp Tyr 245 250 255 Trp Gly Arg Tyr Met Glu Pro Val Thr Ser Ser Thr Pro Met Met Val 26 O 265 27 O Val Glu Gly Asn His Glu Ile Glu Glu Glin Ile Gly Asn Llys Thr Phe 27s 28O 285 Ala Ala Tyr Arg Ser Arg Phe Ala Phe Pro Ser Ala Glu Ser Gly Ser 29 O 295 3 OO Phe Ser Pro Phe Tyr Tyr Ser Phe Asp Ala Gly Gly Ile His Phe Ile 3. OS 310 315 32O Met Lieu. Gly Ala Tyr Ala Asp Tyr Gly Arg Ser Gly Glu Glin Tyr Arg 3.25 330 335 Trp Lieu. Glu Lys Asp Lieu Ala Lys Val Asp Arg Ser Val Thr Pro Trp 34 O 345 35. O Lieu Val Ala Gly Trp His Ala Pro Trp Tyr Thr Thr Tyr Lys Ala His 355 360 365 Tyr Arg Glu Val Glu. Cys Met Arg Val Ala Met Glu Glu Lieu. Lieu. Tyr 37 O 375 38O Ser His Gly Lieu. Asp Ile Ala Phe Thr Gly His Val His Ala Tyr Glu 385 390 395 4 OO Arg Ser Asn Arg Val Phe Asn Tyr Thr Lieu. Asp Pro Cys Gly Ala Val 4 OS 41O 415 Tyr Ile Ser Val Gly Asp Gly Gly Asn Arg Glu Lys Met Ala Thir Thr 42O 425 43 O. His Ala Asp Glu Pro Gly. His Cys Pro Asp Pro Arg Pro Llys Pro Asn 435 44 O 445 Ala Phe Ile Ala Gly Phe Cys Ala Phe Asin Phe Thr Ser Gly Pro Ala 450 45.5 460 Ala Gly Arg Phe Cys Trp Asp Arg Glin Pro Asp Tyr Ser Ala Tyr Arg 465 470 47s 48O Glu Ser Ser Phe Gly His Gly Ile Leu Glu Val Lys Asn Glu. Thr His 485 490 495 Ala Lieu. Trp Arg Trp His Arg Asn Glin Asp Lieu. Tyr Gly Ser Ala Gly SOO 505 51O Asp Glu Ile Tyr Ile Val Arg Glu Pro Glu Arg Cys Lieu. His Llys His 515 52O 525 Asn Ser Thr Arg Pro Ala His Gly Pro 53 O 535
<210s, SEQ ID NO 31 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) . . (19 <223> OTHER INFORMATION: Triticum spp. PAPhy gene forward primer: PAP ex3 Fw primer
<4 OOs, SEQUENCE: 31 Cttgagcctg ggacgaagt
<210s, SEQ ID NO 32 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. US 9,540,633 B2 81 82 - Continued
22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) . . (18 <223> OTHER INFORMATION: Triticum spp. PAPhy gene reverse primer: PAP ex3 Rv primer
<4 OOs, SEQUENCE: 32 gaga aggacc cqctict Co 18
<210s, SEQ ID NO 33 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: Triticum spp. PAPhy promoter forward primer: TaPAPhy a1-pro-exl Fw
<4 OOs, SEQUENCE: 33 titatgtgtcc gcgtgaagtg 2O
<210s, SEQ ID NO 34 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: Triticum spp. PAPhy promoter reverse primer: TaPAPhy a1-pro-exl Rv
< 4 OO SEQUENCE: 34 accalagagtic aatgccatcc 2O
<210s, SEQ ID NO 35 &211s LENGTH: 23 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (23) <223> OTHER INFORMATION: Triticum spp. PAPhy promoter forward primer 2 : TaPAPhy a1 - 311 cons Fw
<4 OOs, SEQUENCE: 35 tittggacgag ccatagctgc ata 23
<210s, SEQ ID NO 36 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: Triticum spp. PAPhy promoter reverse primer 2 : TaPAPhy a1 167 Rv
<4 OOs, SEQUENCE: 36 cgctgcaccc gggggit cogt 2O
<210s, SEQ ID NO 37 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (22) <223> OTHER INFORMATION: Triticum spp. PAPhy enhancer forward primer: US 9,540,633 B2 83 84 - Continued AS-PCR enhancer forward primer <4 OO > SEQUENCE: 37 caagctacac tttgtagaac ac 22
<210s, SEQ ID NO 38 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: Triticum spp. PAPhy gene reverse primer: AS-PCR enhancer reverse primer <4 OOs, SEQUENCE: 38 cgctgcaccc gggggit cogt
<210s, SEQ ID NO 39 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (25) <223> OTHER INFORMATION: HighPhy SNP forward primer
<4 OOs, SEQUENCE: 39 tittcaa.gcta cactttgtag aacac 25
<210 SEQ ID NO 40 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: HighPhy SNP reverse primer <4 OOs, SEQUENCE: 4 O gCactagoca agtttggacg
<210s, SEQ ID NO 41 &211s LENGTH: 25 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (25) <223> OTHER INFORMATION: Wildtype Phy SNP forward primer <4 OOs, SEQUENCE: 41 tittcaa.gcta cactttgtag aac at 25
<210s, SEQ ID NO 42 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Triticum sp. 22 Os. FEATURE: <221> NAME/KEY: primer bind <222s. LOCATION: (1) ... (20) <223> OTHER INFORMATION: Wildtype Phy SNP reverse primer
<4 OOs, SEQUENCE: 42 gCactagoca agtttggacg
<210s, SEQ ID NO 43
US 9,540,633 B2 97 98 - Continued
< 4 OOs SEQUENCE: 46 gtagalacacg agc catgcat gagac 25
SEO ID NO 47 LENGTH: 25 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (25 OTHER INFORMATION: HvPAPhy a SDmut Rv primer for mutant enhancer SEQUENCE: 47 tggctcgtgt totacaaaat gtagc 25
SEQ ID NO 48 LENGTH: 2O TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (20) OTHER INFORMATION: Cis to GUS Fw primer SEQUENCE: 48 tcgagt cac gttcCttgac 2O
SEQ ID NO 49 LENGTH: 23 TYPE DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (23) OTHER INFORMATION: Cis to GUS Rv primer SEQUENCE: 49 gttgatgttgttgcttggca ttg 23
SEO ID NO 5 O LENGTH: 36 TYPE: DNA ORGANISM: Escherichia coli FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (36 OTHER INFORMATION: GUS Fw m. overhang primer
SEQUENCE: 5 O agcaacaa.ca toaacatgtt acgtc.ctgta gaalacc 36
SEO ID NO 51 LENGTH: 38 TYPE: DNA ORGANISM: Escherichia coli FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (38 OTHER INFORMATION: GUS Rv m. overhang primer
SEQUENCE: 51 ggaacgt.cga citcgactato accatgatta cqaatticc 38
SEO ID NO 52 LENGTH: 81.32 TYPE: DNA
US 9,540,633 B2 109 110 - Continued
212. TYPE: PRT <213> ORGANISM: Hordeum vulgare
<4 OOs, SEQUENCE: 53 Met Lieu. Arg Pro Val Glu Thr Pro Thr Arg Glu Ile Llys Llys Lieu. Asp 1. 5 1O 15
Gly Lieu. Trp Ala Phe Ser Lieu. Asp Arg Glu Asn. Cys Gly Ile Asp Glin 2O 25 3O
Arg Trp Trp Glu Ser Ala Lieu. Glin Glu Ser Arg Ala Ile Ala Val Pro 35 4 O 45
Gly Ser Phe Asin Asp Glin Phe Ala Asp Ala Asp Ile Arg Asn Tyr Ala SO 55 6 O
Gly Asn Val Trp Tyr Glin Arg Glu Val Phe Ile Pro Lys Gly Trp Ala 65 70 7s Gly Glin Arg Ile Val Lieu. Arg Phe Asp Ala Val Thr His Tyr Gly 85 90 95
Val Trp Val Asn Asn Glin Glu Val Met Glu. His Glin Gly Gly Tyr Thir 1OO 105 11 O
Pro Phe Glu Ala Asp Val Thr Pro Tyr Val Ile Ala Gly Lys Ser Wall 115 12 O 125
Arg Ile Thr Val Cys Val Asn. Asn. Glu Lieu. Asn Trp Glin Thir Ile Pro 13 O 135 14 O Pro Gly Met Val Ile Thr Asp Glu Asn Gly Lys Llys Lys Glin Ser Tyr 145 150 155 160
Phe His Asp Phe Phe Asn Tyr Ala Gly Ile His Arg Ser Val Met Luell 1.65 170 175
Tyr Thir Thr Pro Asn. Thir Trp Val Asp Asp Ile Thr Val Val Thr His 18O 185 19 O
Val Ala Glin Asp Cys Asn His Ala Ser Val Asp Trp Glin Val Val Ala 195 2OO 2O5
Asn Gly Asp Val Ser Val Glu Lieu. Arg Asp Ala Asp Glin Glin Val Wall 21 O 215 22O
Ala Thr Gly Glin Gly Thr Ser Gly Thr Lieu. Glin Val Val Asn Pro His 225 23 O 235 24 O
Lieu. Trp Gln Pro Gly Glu Gly Tyr Lieu. Tyr Glu Lieu. Cys Val Thr Ala 245 250 255 Llys Ser Glin Thr Glu. Cys Asp Ile Tyr Pro Lieu. Arg Val Gly Ile Arg 26 O 265 27 O
Ser Val Ala Wall Lys Gly Glu Glin Phe Lieu. Ile Asn His Llys Pro Phe 27s 28O 285 Tyr Phe Thr Gly Phe Gly Arg His Glu Asp Ala Asp Lieu. Arg Gly 29 O 295 3 OO Gly Phe Asp Asin Val Lieu Met Val His Asp His Ala Lieu Met Asp Trp 3. OS 310 315 32O
Ile Gly Ala Asn Ser Tyr Arg Thr Ser His Tyr Pro Tyr Ala Glu Glu 3.25 330 335
Met Lieu. Asp Trp Ala Asp Glu. His Gly Ile Val Val Ile Asp Glu Thir 34 O 345 35. O
Ala Ala Val Gly Phe Asn Lieu. Ser Lieu. Gly Ile Gly Phe Glu Ala Gly 355 360 365
Asn Llys Pro Lys Glu Lieu. Tyr Ser Glu Glu Ala Val Asn Gly Glu Thir 37 O 375 38O
Glin Glin Ala His Lieu. Glin Ala Ile Lys Glu Lieu. Ile Ala Arg Asp Lys 385 390 395 4 OO US 9,540,633 B2 111 112 - Continued
Asn His Pro Ser Val Val Met Trp Ser Ile Ala Asn Glu Pro Asp Thir 4 OS 415
Arg Pro Glin Gly Ala Arg Glu Tyr Phe Ala Pro Leu. Ala Glu Ala Thir 42O 425 43 O
Arg Llys Lieu. Asp Pro Thr Arg Pro Ile Thir Cys Val Asn Wall Met Phe 435 44 O 445
Cys Asp Ala His Thr Asp Thr Ile Ser Asp Lieu. Phe Asp Wall Luell 450 45.5 460
Lieu. Asn Arg Tyr Tyr Gly Trp Tyr Val Glin Ser Gly Asp Luell Glu Thir 465 470 47s
Ala Glu Lys Val Lieu. Glu Lys Glu Lieu. Luell Ala Trp Glin Glu Lys Luell 485 490 495
His Glin Pro Ile Ile Ile Thr Glu Tyr Gly Val Asp Thir Luell Ala Gly SOO 505
Lieu. His Ser Met Tyr Thr Asp Met Trp Ser Glu Glu Tyr Glin Ala 515 52O 525
Trp Lieu. Asp Met Tyr His Arg Val Phe Asp Arg Val Ser Ala Wall Wall 53 O 535 54 O
Gly Glu Glin Val Trp Asn. Phe Ala Asp Phe Ala Thr Ser Glin Gly Ile 5.45 550 555 560
Lieu. Arg Val Gly Gly Asn Llys Lys Gly Ile Phe Thir Arg Asp Arg 565 st O sts
Pro Llys Ser Ala Ala Phe Lieu. Lieu. Glin Arg Trp Thir Gly Met Asn 58O 585 59 O
Phe Gly Glu Lys Pro Glin Glin Gly Gly Glin 595 6OO
<210s, SEQ ID NO 54 &211s LENGTH: 81.32 &212s. TYPE: DNA <213> ORGANISM: Hordeum vulgare 22 Os. FEATURE: <221> NAME/KEY: gene <222s. LOCATION: (1) ... (81.32) <223> OTHER INFORMATION: pCLEAN-G185-HP-proGUS 22 Os. FEATURE: <221> NAME/KEY: gene <222s. LOCATION: (1) ... (2599 <223> OTHER INFORMATION: Wector backbone, pCLEAN-G185 22 Os. FEATURE: <221> NAME/KEY: promoter <222s. LOCATION: (26 OO) . . (4799 &223s OTHER INFORMATION: HighPhy HvPAPhy a promoter 22 Os. FEATURE: <221 > NAMEAKEY: mutation <222s. LOCATION: (4565) . . (4565 <223> OTHER INFORMATION: HighPhy enhancer mutation 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (4800) . . (6611 <223> OTHER INFORMATION: UidA gene (encoding GUS) 22 Os. FEATURE: <221 > NAMEAKEY: terminator <222s. LOCATION: (6612) . . (6959) 223s OTHER INFORMATION: NOS terminator 22 Os. FEATURE: <221> NAME/KEY: gene <222s. LOCATION: (6960 ) . . (81.32) <223> OTHER INFORMATION: Wector backbone, pCLEAN-G185
<4 OOs, SEQUENCE: 54 Catgtgagca aaaggc.ca.gc aaaaggc.cag galaccgtaala aaggcc.gcgt totggcgtt tttic catagg Ctcc.gc.cccc ctgacgagca t cacaaaaat cacgct cala gtcagaggtg 12 O
US 9,540,633 B2 123 124 - Continued
Pro Gly Met Wall Ile Thir Asp Glu Asn Gly Lys Lys Lys Glin Ser Tyr 145 150 155 160
Phe His Asp Phe Phe Asn Ala Gly Ile His Arg Ser Wall Met Luell 1.65 17O
Thir Thir Pro Asn Thir Trp Wall Asp Asp Ile Thir Wall Wall Thir His 18O 185 19 O
Wall Ala Glin Asp Asn His Ala Ser Wall Asp Trp Glin Wall Wall Ala 195
Asn Gly Asp Wall Ser Wall Glu Luell Arg Asp Ala Asp Glin Glin Wall Wall 21 O 215
Ala Thir Gly Glin Gly Thir Ser Gly Thir Luell Glin Wall Wall Asn Pro His 225 23 O 235 24 O
Lell Trp Glin Pro Gly Glu Gly Luell Tyr Glu Lell Wall Thir Ala 245 250 255
Ser Glin Thir Glu Asp Ile Tyr Pro Luell Arg Wall Gly Ile Arg 26 O 265 27 O
Ser Wall Ala Wall Gly Glu Glin Phe Luell Ile Asn His Pro Phe 285
Phe Thir Gly Phe Gly Arg His Glu Asp Ala Asp Lell Arg Gly 29 O 295 3 OO
Gly Phe Asp Asn Wall Lell Met Wall His Asp His Ala Lell Met Asp Trp 3. OS 310 315
Ile Gly Ala Asn Ser Arg Thir Ser His Pro Ala Glu Glu 3.25 330 335
Met Luell Asp Trp Ala Asp Glu His Gly Wall Wall Ile Asp Glu Thir 34 O 345 35. O
Ala Ala Wall Gly Phe Asn Lell Ser Luell Ile Gly Phe Glu Ala Gly 355 360 365
Asn Lys Pro Glu Lell Tyr Ser Glu Ala Wall Asn Gly Glu Thir 37 O 375
Glin Glin Ala His Lell Glin Ala Ile Luell Ile Ala Arg Asp Lys 385 390 395 4 OO
Asn His Pro Ser Wall Wall Met Trp Ser Ala Asn Glu Pro Asp Thir 4 OS 415
Arg Pro Glin Gly Ala Arg Glu Phe Pro Lell Ala Glu Ala Thir 425 43 O
Arg Luell Asp Pro Thir Arg Pro Ile Thir Wall Asn Wall Met Phe 435 44 O 445
Asp Ala His Thir Asp Thir Ile Ser Asp Luell Phe Asp Wall Luell 450 45.5 460
Lell Asn Arg Gly Trp Wall Glin Ser Gly Asp Luell Glu Thir 465 470 47s 48O
Ala Glu Wall Lell Glu Glu Luell Luell Ala Trp Glin Glu Lys Luell 485 490 495
His Glin Pro Ile Ile Ile Thir Glu Tyr Gly Wall Asp Thir Luell Ala Gly SOO 505
Lell His Ser Met Thir Asp Met Trp Ser Glu Glu Tyr Glin Ala 515 525
Trp Luell Asp Met His Arg Wall Phe Asp Arg Wall Ser Ala Wall Wall 53 O 535 54 O
Gly Glu Glin Wall Trp Asn Phe Ala Asp Phe Ala Thir Ser Glin Gly Ile 5.45 550 555 560 US 9,540,633 B2 125 126 - Continued Lieu. Arg Val Gly Gly Asn Llys Lys Gly Ile Phe Thr Arg Asp Arg Llys 565 st O sts Pro Llys Ser Ala Ala Phe Lieu. Lieu. Glin Lys Arg Trp Thr Gly Met Asn 585 59 O Phe Gly Glu Lys Pro Glin Glin Gly Gly Lys Glin 595
SEQ ID NO 56 LENGTH: 39 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (39) OTHER INFORMATION: Kill triad Fw primer to randomise mutant enhancer
<4 OOs, SEQUENCE: 56 gCatacgaag cat agtacga C9taggcgt.c caaactittg 39
SEQ ID NO f LENGTH: 48 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (48) OTHER INFORMATION: Kill triad Rv primer to randomise mutant enhancer
<4 OOs, SEQUENCE: f tcqtactato citt cqtatgc ctacaaaatg tagcttgaaa ttaaagag 48
SEQ ID NO 58 LENGTH: 81. 32 TYPE: DNA ORGANISM: Hordeum vulgare FEATURE: NAME/KEY: gene LOCATION: (1) ... (81.32) OTHER INFO RMATION: pCLEAN-G185-KOtriad-ProGUS FEATURE: NAME/KEY: gene LOCATION: (1) ... (2599) OTHER INFO RMATION: Vector backbone, pCLEAN-G185 FEATURE: NAME/KEY: promoter LOCATION: (26 OO) ... (4799 OTHER INFO RMATION: KOtriad HvPAPhy a promoter FEATURE: NAME/KEY: enhancer LOCATION: (4561) ... (4580 OTHER INFO RMATION: Randomized sequence replacing the enhancer triad (GCN4, skin1, RY-element) FEATURE: NAME/KEY: CDS LOCATION: (4800) . . (6611 OTHER INFORMATION: UidA gene (encoding GUS) FEATURE: NAME/KEY: terminator LOCATION: (6612) . . (6959 OTHER INFORMATION: NOS terminator FEATURE: NAME/KEY: gene LOCATION: (696O) . . (81.32) OTHER INFORMATION: Vector backbone, pCLEAN-G185
& 4 OO SEQUENCE: 58
Catgtgagca aaaggc.ca.gc aaaaggc.cag galaccgtaala aaggcc.gcgt totggcgtt 6 O tttic catagg Ctcc.gc.cccc ctgacgagca t cacaaaaat cacgct cala gtcagaggtg 12 O
US 9,540,633 B2 137 138 - Continued
Pro Gly Met Wall Ile Thir Asp Glu Asn Gly Lys Lys Lys Glin Ser Tyr 145 150 155 160
Phe His Asp Phe Phe Asn Ala Gly Ile His Arg Ser Wall Met Luell 1.65 17O
Thir Thir Pro Asn Thir Trp Wall Asp Asp Ile Thir Wall Wall Thir His 18O 185 19 O
Wall Ala Glin Asp Asn His Ala Ser Wall Asp Trp Glin Wall Wall Ala 195
Asn Gly Asp Wall Ser Wall Glu Luell Arg Asp Ala Asp Glin Glin Wall Wall 21 O 215
Ala Thir Gly Glin Gly Thir Ser Gly Thir Luell Glin Wall Wall Asn Pro His 225 23 O 235 24 O
Lell Trp Glin Pro Gly Glu Gly Luell Tyr Glu Lell Wall Thir Ala 245 250 255
Ser Glin Thir Glu Asp Ile Tyr Pro Luell Arg Wall Gly Ile Arg 26 O 265 27 O
Ser Wall Ala Wall Gly Glu Glin Phe Luell Ile Asn His Pro Phe 285
Phe Thir Gly Phe Gly Arg His Glu Asp Ala Asp Lell Arg Gly 29 O 295 3 OO
Gly Phe Asp Asn Wall Lell Met Wall His Asp His Ala Lell Met Asp Trp 3. OS 310 315
Ile Gly Ala Asn Ser Arg Thir Ser His Pro Ala Glu Glu 3.25 330 335
Met Luell Asp Trp Ala Asp Glu His Gly Wall Wall Ile Asp Glu Thir 34 O 345 35. O
Ala Ala Wall Gly Phe Asn Lell Ser Luell Ile Gly Phe Glu Ala Gly 355 360 365
Asn Lys Pro Glu Lell Tyr Ser Glu Ala Wall Asn Gly Glu Thir 37 O 375
Glin Glin Ala His Lell Glin Ala Ile Luell Ile Ala Arg Asp Lys 385 390 395 4 OO
Asn His Pro Ser Wall Wall Met Trp Ser Ala Asn Glu Pro Asp Thir 4 OS 415
Arg Pro Glin Gly Ala Arg Glu Phe Pro Lell Ala Glu Ala Thir 425 43 O
Arg Luell Asp Pro Thir Arg Pro Ile Thir Wall Asn Wall Met Phe 435 44 O 445
Asp Ala His Thir Asp Thir Ile Ser Asp Luell Phe Asp Wall Luell 450 45.5 460
Lell Asn Arg Gly Trp Wall Glin Ser Gly Asp Luell Glu Thir 465 470 47s 48O
Ala Glu Wall Lell Glu Glu Luell Luell Ala Trp Glin Glu Lys Luell 485 490 495
His Glin Pro Ile Ile Ile Thir Glu Tyr Gly Wall Asp Thir Luell Ala Gly SOO 505
Lell His Ser Met Thir Asp Met Trp Ser Glu Glu Tyr Glin Ala 515 525
Trp Luell Asp Met His Arg Wall Phe Asp Arg Wall Ser Ala Wall Wall 53 O 535 54 O
Gly Glu Glin Wall Trp Asn Phe Ala Asp Phe Ala Thir Ser Glin Gly Ile 5.45 550 555 560 US 9,540,633 B2 139 140 - Continued Lieu. Arg Val Gly Gly Asn Llys Lys Gly Ile Phe Thr Arg Asp Arg Llys 565 st O sts Pro Llys Ser Ala Ala Phe Lieu. Lieu. Glin Lys Arg Trp Thr Gly Met Asn 58O 585 59 O Phe Gly Glu Lys Pro Glin Glin Gly Gly Lys Glin 595 6OO
SEQ ID NO 60 LENGTH: 2O TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (20) OTHER INFORMATION: TaPAPhy a1 gene forward primer
SEQUENCE: 6 O gagatt CC9a gaccaacgaa
SEQ ID NO 61 LENGTH: 2O TYPE: DNA ORGANISM: Triticum aestivum FEATURE: NAME/KEY: primer bind LOCATION: (1) ... (20) OTHER INFORMATION: TaPAPhy a1 gene reverse primer SEQUENCE: 61 tittgcct c ca citctgcctac
SEQ ID NO 62 LENGTH: 16 TYPE: DNA ORGANISM: Triticum aestivum
< 4 OOs SEQUENCE: 62 acavgagt catcatg 16
SEQ ID NO 63 LENGTH: 2O TYPE: DNA ORGANISM: Triticum aestivum
< 4 OOs SEQUENCE: 63 alacacgagtic atgcatggga
SEQ ID NO 64 LENGTH: 16 TYPE: DNA ORGANISM: Triticum aestivum
< 4 OOs SEQUENCE: 64 cgagt catgc atggga 16
SEO ID NO 65 LENGTH: 13 TYPE: DNA ORGANISM: Triticum sp.
< 4 OOs SEQUENCE: 65 tgagt catgc atg 13
SEQ ID NO 66 US 9,540,633 B2
- Continued
&211s LENGTH: 13 &212s. TYPE: DNA <213> ORGANISM: Triticum sp. <4 OOs, SEQUENCE: 66 cgagt catgc atg 13
10 The invention claimed is: otide having the nucleotide sequence ACA VGA GTC 1. A method for producing a Triticum plant capable of ATG CAT (SEQ ID NO: 1), and wherein said V is a producing an average phytase endosperm content of greater cytosine. than 4300 FTU/kg, said method comprising: 2. The method according to claim 1, wherein said sample 15 of nucleic acids comprises a first polynucleotide located 5' a) obtaining a sample of nucleic acids from a Triticum upstream of and operably linked to a second polynucleotide, plant or portion thereof; wherein said first polynucleotide comprises the nucleotide b) detecting in said sample the presence of the nucleotide sequence ACA VGA GTC ATG CAT (SEQ ID NO:1), V at the 5' end of a polynucleotide having the nucleo wherein V is a cytosine, and wherein said second polynucle tide sequence ACA VGA GTC ATG CAT (SEQ ID otide encodes a phytase polypeptide having myo-inositol NO:1), wherein V is a cytosine; hexakisphosphate phosphohydrolase activity. c) breeding a Triticum plant comprising said nucleotide 3. The method according to claim 1, wherein a population sequence with a second Triticum plant to obtain grains; of Triticum plants grown from said grains have an average and phytase grain content of greater than 4300 FTU/kg. d) growing at least one Triticum plant from said grains; 25 4. The method of claim 1 wherein said polynucleotide is wherein said Triticum plant grown from said grains com operably linked to a phytase encoding sequence. prises said nucleotide V at the 5' end of a polynucle k k k k k