N Small Active Subunit Gene Structure Characterization of Mouse

Characterization of Mouse Carboxypeptidase N Small Active Subunit Gene Structure Kirstin W. Matthews and Rick A. Wetsel This information is current as J Immunol 2001; 166:6196-6202; ; of September 25, 2021. doi: 10.4049/jimmunol.166.10.6196 http://www.jimmunol.org/content/166/10/6196 Downloaded from References This article cites 26 articles, 9 of which you can access for free at: http://www.jimmunol.org/content/166/10/6196.full#ref-list-1

Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on September 25, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Characterization of Mouse Carboxypeptidase N Small Active Subunit Gene Structure1

Kirstin W. Matthews* and Rick A. Wetsel2*†

Carboxypeptidase N (CPN) is a plasma zinc metalloprotease comprised of two small subunits that have enzymatic activity, and two large subunits, which protect the enzyme from degradation. CPN cleaves the carboxyl-terminal amino acids arginine and lysine from biologically active peptides such as complement anaphylatoxins, kinins, and ﬁbrinopeptides. To delineate the murine CPN small subunit coding region, gene structure, and chromosome location, cDNA and genomic clones were isolated, characterized, and used in Northern and ﬂuorescence in situ hybridization analyses. The results from this study demonstrate that the murine CPN small subunit gene is a single copy gene of ϳ29 kb that is transcribed in the liver into a 1793-bp mRNA with an open reading frame of 1371 nucleotides encoding 457 aa. The gene contains nine exons ranging in size from 455 bp (exon 1) to 100 bp (exon 7),

and eight introns ranging in size from 6.2 kb (intron 2) to 1.4 kb (intron 4). All intron/exon junctions follow the normal consensus Downloaded from rule. The mouse CPN small subunit gene localized to chromosomal band 19D2, which is syntenic to human chromosome 10q23–25. Primer extension experiments using mouse liver mRNA indicate one major transcriptional initiation site and three minor sites. ,Sequence analysis of the 5؅-ﬂanking region indicated a TATA-less promoter and numerous transcription factor binding sites which may confer liver-speciﬁc expression of the CPN small subunit gene. The Journal of Immunology, 2001, 166: 6196–6202.

arboxypeptidase N (CPN) is a zinc metalloprotease with CPN activity levels 21% of normal (9, 10). This individual http://www.jimmunol.org/

comprised of two small subunits (Mr 50,000 each) and exhibited chronic recurring angioedema characterized by swelling two large subunits (M 83,000 each) (1). The small sub- of the face and tongue and by red swellings on the extremities C r units contain the enzymatic activity for the protease, while the lasting ϳ24 h. The severe phenotype of a partial deficiency indi- large heavily glycosylated subunits protect the enzyme from being cates that CPN has an important role in vivo. degraded or filtrated from the bloodstream. These subunits form a The cDNA encoding the human CPN small and large subunits tetramer and are held together by noncovalent interactions. have been cloned (11, 12). Furthermore, the human large subunit CPN is produced by the liver (2) and, once secreted into the was localized to human chromosome 8p22–23, and the small sub- blood, it can cleave carboxyl-terminal arginine or lysine residues unit gene was mapped to chromosome 10 (13). In the current from biologically potent peptides released into the bloodstream, study, the cDNA and gene structure of mouse CPN small subunit by guest on September 25, 2021 such as kinins (3), kallidin (4), fibrinopeptides (5), and other sub- were identified. The CPN cDNA was isolated and found to encode strates (2). CPN also cleaves the carboxyl-terminal arginine from a protein 79% identical in amino acid sequence to the human CPN the complement anaphylatoxins C3a and C5a (3) (6). C3a and C5a small subunit. By Northern analysis, the gene expression was tis- are peptides generated from the activation of the complement cas- sue specific and detected only in the liver. The gene encoding for cade and can induce smooth muscle contraction, vasodilation, che- the murine CPN small subunit was 29 kb in length with nine exons motaxis of leukocytes, and the release of histamine from mast cells and located on mouse chromosome 19 band position D2, which is (7, 8). By removing the carboxyl-terminal arginine from the com- syntenic with the human CPN small subunit gene. plement anaphylatoxins, CPN greatly reduces C5a and C3a biological activities (8). Materials and Methods Currently, no known individual with a complete CPN deficiency Materials and reagents has been described. However, an individual has been identified Restriction enzymes and other molecular biology reagents were purchased from Roche Molecular Biochemicals (Indianapolis, IN) and used according ϩ *University of Texas-Houston Institute of Molecular Medicine for the Prevention of to manufacturer’s recommendations. Hybond N nylon membranes and 32 35 Human Diseases, and †Department of Biochemistry and Molecular Biology, Univer- radionucleotides [␣- P]dCTP and [ S]dATP were purchased from Am- sity of Texas-Houston Medical School, Houston, TX 77030 ersham (Arlington Heights, IL). [␥-32P]dATP was purchased from ICN Received for publication December 12, 2000. Accepted for publication March (Costa Mesa, CA). 5, 2001. Cloning of mouse CPN small subunit cDNA The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance Two expression tag clones were identified from American Type Culture with 18 U.S.C. Section 1734 solely to indicate this fact. Collection (ATCC, Manassas, VA), 261J and 26K. ATCC-261J was 79% Ј 1 This work was supported by National Institutes of Health Grant AI25011 and by identical with the 3 end of human CPN small subunit cDNA and was American Heart Association National Grant-in-Aid 9950394 (both to R.A.W.). The purchased from ATCC. ATCC-26K was 75% identical with the 5Ј end of sequence data presented in this article have been submitted to the EMBL/GenBank human CPN small subunit. Although a portion of the 26-K sequence has Data Libraries under the accession numbers AF326477 and AF326478. been determined, the clone was lost at ATCC and could not be obtained for 2 Address correspondence and reprint requests to Dr. Rick A. Wetsel, Institute of further study. To obtain the entire sequence of the murine CPN small Molecular Medicine for the Prevention of Human Disease, University of Texas-Hous- subunit cDNA, a mouse B10.D2/nSnJ liver cDNA library was screened ton, 2121 West Holcombe Boulevard, Suite 907, Houston, TX 77030. E-mail address: (14). Approximately 500,000 plaques were plated, and duplicate filters [email protected] were screened using a random primed 32P-labeled ATCC-261J (used ac- 3 Abbreviations used in this paper: CPN, carboxypeptidase N; C/EBP, CCAAT/en- cording to manufacturer instructions; Roche) as a probe. Filters were hy- hancer binding protein; HNF-5, hepatocyte nuclear factor 5; TIS, transcription initi- bridized at 65°C in a 5ϫ SSC, 10ϫ Denhardt’s, and 1% SDS solution at ation site. pH 7.4. After 16 h, the filters were washed at 65°C in 0.2ϫ SSC and 1%

FIGURE 1. Mouse CPN small subunit cDNA sequence. The cloning strategy for CPN with two ATCC clones (26K and 261J) and a cDNA library clone (pCPN.103K) (top). The nucleotide and translated amino acid sequences were determined from the cDNA clones, as described in the text (bottom). The coding region is depicted in capital letters with the initiating methionine deﬁned as ϩ1. The 5Ј- and 3Ј-untranslated sequence are depicted in lower case. The 5Ј-untranslated sequence begins at the TIS, as determined by primer extension experiments. The resulting cDNA has 232 bp of 5Ј-untranslated, 1371-bp coding region, and 190-bp 3Ј untranslated. The CPN small subunit exons are denoted with slash marks at exon splice sites. The putative polyadenylation site (attaaa) is marked in bold. This sequence has been submitted to the GenBank/EMBL Data Bank with accession number AF326477.

SDS and exposed to autoradiography film. Approximately 100 clones that For Southern analysis, ϳ25 ␮g of genomic DNA from 129SvJ mice was hybridized to the CPN probe were found after two additional rounds of digested with specified enzymes (see Results). The DNA was electropho- screening. Ten clones were plaque purified and sequenced on both strands. resed on a 0.8% agarose gel with radiolabeled molecular mass markers and then transferred to a nitrocellulose filter. The blots were hybridized in Northern blot and genomic Southern analysis modified Church and Gilbert buffer (500 mM sodium phosphate buffer (pH For Northern analysis, a blot containing 2 ␮g of mRNA from various 7.2), 10 mM EDTA, 7% SDS, and 1% BSA) individually with two probes. mouse tissues was obtained from Clontech (Palo Alto, CA). A random The first probe was a random primed labeled PCR genomic DNA fragment primed 32P-labeled ATCC-261J insert was used as the probe. The blot was of 205 bp. This fragment was made from primers corresponding to se- hybridized, washed, and autoradiographed, as described (15). quence in exon 8, e8p5 (GCACAGCACAGTGAAGCCCAGGA) and e8p3 6198 MOUSE CARBOXYPEPTIDASE N GENE STRUCTURE

(GCAGCCGGAAATCCCCGTGT). The second probe corresponded to a subunit (11). A truncated clone of 644 bp was discovered (ATCC- BamHI-digested exon 1 fragment of 248 bp. After hybridization, the blots 261J) and was 79% identical in DNA sequence to the human CPN ϫ were washed at 55°C in 0.2 SSC with 0.5% SDS and then exposed to film small subunit (Fig. 1, top). The search also revealed a clone that overnight. contained the open reading frame start site and 5Ј-untranslated Cloning of the mouse CPN small subunit gene sequence. This clone (ATCC-26K) had been lost at ATCC and ϳ A 129Sv/J liver-derived mouse genomic library in the Lambda Fix II vec- therefore could not be obtained, but 400 bp of the sequence was tor was obtained from Stratagene (La Jolla, CA). Approximately 500,000 known and used in the construction of the map. To complete the recombinants were plated, and duplicate filters were screened with the CPN small subunit cDNA sequence, the ATCC-261J clone was clone, ATCC-261J, and a ϳ500-bp probe that corresponded to the 5Ј end used to screen a murine liver cDNA library. Approximately 10 of the open reading frame. The probes were hybridized and washed in clones were isolated, and restriction digest maps were performed conditions similar to the cDNA library. Twelve positive clones were obtained. Phage DNA was purified and subjected to restriction enzyme digest to determine the clone with the largest insert. Clone pCPN.103K and sequence analysis. Three overlapping clones (⌽, T, and 6B) were used that contained the longest insert was fully sequenced. The to obtain the full-length gene. pCPN.103K insert was 1477 bp in length and overlapped the Intron size determination cDNA sequence of ATCC-26K and ATCC-261J, facilitating com- pletion of the CPN small subunit cDNA structure (Fig. 1, top). Three phage clones were used to determine the CPN gene structure (Fig. The CPN small subunit cDNA was 1793 bp, containing 1371 bp ␭ 3). The DNA was digested with various enzymes and run on a DNA gel of coding sequence, 232 bp of 5Ј-untranslated sequence, and 190 adjacent to radiolabeled DNA markers. The resulting Southern was probed Ј with oligonucleotides corresponding to each individual exon. Sizes of the bp of 3 -untranslated sequence (Fig. 1, bottom). The open reading fragments were estimated and arranged into a map of the gene. Intron sizes frame encoded an amino acid sequence of 457 residues with a Mr Downloaded from were deduced by overlapping enzyme fragments. Introns 4 and 5 were not of 51,845, which corresponds to the estimated molecular mass of cut by overlapping restriction enzymes and therefore were sized and the human CPN small subunit (1). The nucleotide sequence of the mapped by PCR using the same oligonucleotides. murine CPN small subunit is 85% identical with the human (11), Oligonucleotide synthesis and DNA sequence analysis and the human and mouse proteins are 79% identical in their over- All oligonucleotides were synthesized using an Oligo 1000 M DNA Syn- all amino acid alignment. A putative polyadenylation site (AT

thesizer (Beckman Instruments, Fullerton, CA). Oligonucleotides (20 bp) TAAA) was identified 21 bp upstream from the poly(A) tail with http://www.jimmunol.org/ were used as primers in the sequencing reactions. All cDNA and genomic one mismatch from consensus (18). sequencing was performed using double-stranded plasmid or phage tem- plates and a model 377A automated DNA sequencer from Applied Bio- Northern blot analysis systems (Foster City, CA), according to the standard protocol of the Am- pliTaq BigDye deoxy terminator cycle sequencing kit. To examine the expression of the mouse CPN small subunit mRNA, a Northern blot containing RNA from various mouse tis- Chromosome assignment and fluorescence in situ hybridization sues was probed with ATTC-261J (Fig. 2). Hybridization of the The mouse CPN small subunit gene was localized by fluorescence in situ probe revealed two messages that were ϳ1.8 and 2 kb in length. hybridization (16). The clones 6B and ␾, which contained ϳ30 kb and 76% Both mRNA are most likely transcripts that were derived from of the gene, were labeled with digoxigenin-11-dUTP by nick translation, alternative processing or alternative splicing of the CPN small sub- by guest on September 25, 2021 combined with sheared mouse DNA, and hybridized to normal metaphase chromosomes derived from mouse embryo fibroblast cells. Specific hy- unit gene. This conclusion is made from data indicating that: 1) the bridization was detected by incubating hybridization slides in fluorescein- ated anti-digoxigenin Abs, followed by counterstaining with propidium iodine. To verify specific hybridization to chromosome 19, a probe specific for chromosome 19 was cohybridized with 6B and ␾ clones. Primer extension Primer extension assays were performed as described with minor modifi- cations (17). An antisense 40-mer oligonucleotide was made ϳ150 bp downstream from the longest cDNA clone obtained (pCPN.103). Approx- imately 100 ng of the oligonucleotide was end labeled using [␥-32P]dATP and polynucleotide kinase (30 U/␮l) (Roche) for1hat37°C. The end- labeled oligonucleotide (150,000 cpm) was hybridized to 4 ␮g of poly(A)ϩ selected mouse liver mRNA for 16 h at 50°C in 30 ␮l formamide buffer (40 mM PIPES, 1 mM EDTA, 0.4 M NaCl, and 50% deionized formamide). As a negative control, 20 ␮g of yeast tRNA (Roche) was incubated with the labeled oligonucleotide simultaneously. The RNA-oligo was then precipitated and resuspended in 30 ␮l reverse transcriptase buffer (5 mM Tris, 50

mM KCl, 10 mM MgCl2, 1 mM DTT, 50 U RNase inhibitor, 3.2 mM sodium pyrophosphate, 2 mM deoxynucleotide triphosphates). Thirty units of avian myeloblastosis virus reverse transcriptase (Roche) were added to each sample and incubated at 42°C for 90 min. The mRNA was then digested by RNase A (100 ␮g/ml) for 30 min at 37°C. The samples were phenol/chloroform extracted and ethanol precipitated, and the samples were analyzed by electrophoresis on 6% acrylamide-urea gels in which a sequencing ladder was used to estimate the size of extended products. To assign the transcriptional initiation site accurately, the sequencing ladder was made by using the oligonucleotide in the primer extension analysis as primer and a plasmid clone that contained all of exon one as a template. Results FIGURE 2. Mouse CPN small subunit mRNA expression. A Northern ␮ Cloning of murine CPN small subunit cDNA blot containing 2 g mRNA from indicated mouse tissues was probed with a partial cDNA clone (ATCC-261J). Expression of CPN small subunit was An ATCC expression sequence tag database was searched for a only detected in the liver. There were two CPN small subunit mRNAs murine liver clone with high homology to the human CPN small detected in the liver with approximate sizes of 1.8 and 2 kb. The Journal of Immunology 6199

Table I. Structure of intron/exon junctions

Exon Location in cDNA Length (bp) Splice Acceptor Splice Donor Intron Size (bp)

1 1–455 455 CCT/gtaagt 4800 2 456–652 197 ttccag/TGG CAG/gtacac 6200 3 653–808 156 tcctag/GGC CAG/gtagg 3000 4 809–991 183 tcacag/GTG ACG/gtaggt 1400 5 992–1103 112 ctctag/CTG AGG/gtaacc 2050 6 1104–1243 140 cctag/GAA CAG/gtaaga 2300 7 1244–1343 100 ccgcag/GTC CAG/gtagga 3700 8 1344–1462 119 gtttag/GTG GTG/gtaagc 3800 9 1463–1793 330 ttgcag/GTT

CPN is most likely a single copy gene (see below), and 2) the interrupt after the first nucleotide of a codon. Exon 1 is 451 bp in ATCC-261J probe is specific for CPN, as demonstrated by the fact length and contains 232 bp of 5Ј-untranslated sequence as well as that no clones other than CPN cDNA were isolated for the mouse the initiating methionine. Exon 9 is 330 bp in length and contains liver cDNA library. Moreover, CPN-specific signal was detected the stop codon along with the entire 3Ј-untranslated sequence. only in mRNA isolated from the liver, indicating that the CPN small subunit is predominately, if not exclusively, expressed in the Transcription initiation site (TIS) Downloaded from liver (Fig. 2). To ascertain the TIS in the murine CPN small subunit gene, primer Single copy gene extension analysis was performed as described in Materials and Methods. The primer-extended products were subjected to electro- To determine the gene copy number of mouse CPN small subunit, phoresis adjacent to a DNA-sequencing ladder generated using the ␮ mouse 129SvJ genomic DNA (25 g) was digested with the en- same oligonucleotide as the primer. The template was a plasmid http://www.jimmunol.org/ zymes XbaI, BamHI, SmaI, BglII, EcoRV, HindIII, SacI, XhoI, and CPN.pe1 that contained 300 bp of exon 1 as well as 500 bp of EcoRI separately and then hybridized with the radiolabeled exon 8 DNA upstream of the gene. Analysis of the sequence revealed one or exon 1 probes. For each enzyme, a single band was present on major transcriptional initiation site with three minor bands present the Southern blot (data not shown). Because none of the enzymes (Fig. 4). All four TIS were within 21 bp from each other, and the cut the exon 8 or the exon 1 probes, these results strongly suggest major initiation site was located 31 bp upstream of the 5Ј end of that the murine CPN small subunit gene is present in the mouse the ATCC-26K cDNA clone. These results indicate that the gene genome as a single copy. encodes 232 bp of 5Ј-untranslated sequence. Murine CPN small subunit gene structure

CPN small subunit 5Ј-flanking sequence by guest on September 25, 2021 To determine the CPN small subunit gene structure, a murine Ј genomic library was screened for clones containing the CPN small The 5 -flanking sequence was determined by sequencing 916 bp ␭ subunit gene using the radiolabeled ATCC-261J partial cDNA as upstream of the major TIS found on the -phage 6B (Fig. 5). a probe. Two clones (⌽ and T) were identified and plaque purified. Classical CAAT and TATA boxes were not observed, nor was The exons 3–9 were fully sequenced on both strands, and intron- there a GC-rich region. The lack of a TATA box is consistent with exon boundaries were determined (Table I). The first two exons other CP genes, such as CPU (19) and CPH (20). The sequence were not present, so the library was rescreened using a 340-bp was compared with known cis-sequence motifs that bind transcrip- probe ϳ100 bp downstream of the initiating methionine. A clone tion factor proteins. The results included seven binding sites for (6B) was isolated that overlapped ⌽ and contained both exons 1 hepatocyte nuclear factor 5 (HNF-5) (21), a binding site to and 2. Exons 1 and 2 were also sequenced on both strands, and the CCAAT/enhancer binding protein (C/EBP) (21), and a binding site exon-intron boundaries were identified (Table I). for AP-2, which can be a tissue-specific repressor (22, 23). Restriction digest mapping and PCR determined the intron lengths (Table I). Collectively, the gene is ϳ29 kb in length with Chromosome localization nine exons and eight introns (see Fig. 3). The exons ranged in size The chromosome location of the CPN small subunit structural from 455 bp (exon 1) to 100 bp (exon 7), and the introns ranged gene was determined by fluorescence in situ hybridization of in size from 6.2 kb (intron 2) to 1.4 kb (intron 4). The donor and digoxigenin-labeled CPN small subunit ␭ clones to mouse meta- acceptor sites conform to normal consensus sequence. Most of the phase chromosome preparations. The probe specifically hybridized introns (2, 3, 4, 6, and 8) were type 0, which interrupts codes to the distal portion of chromosome 19 (Fig. 6). Measurements between codons. The other introns (1, 5, 7, and 9) were type I and from 10 separate chromosomes, which hybridized specifically to

FIGURE 3. Mouse CPN small subunit gene structure. The mouse CPN small subunit gene is ϳ29 kb with nine exons. Shown is a schematic that illustrates the structural organization of the gene. The exons are indicated by boxes, and the intervening introns are represented by lines separating the exons. Three overlapping phage clones (6B, ⌽, and T) were isolated to delineate the gene structure. 6200 MOUSE CARBOXYPEPTIDASE N GENE STRUCTURE

CPN is a member of a group of mammalian zinc CPs that have the ability to cleave carboxyl-terminal amino acids (2). This group can be separated based on sequence similarity into two subfamilies: 1) CPB, CPA, CPA2, mast cell CPA, and CPU; and 2) CPN, CPH, CPM, CPD, and CPZ. Although there is a low level of sequence identity between families, the active sites are conserved among the CPs (Fig. 7) (2). The only area not conserved is the amino acid involved in peptide specificity. From subfamily 1, CPA, CPA2, and mast cell CPA have an isoleucine that recognizes hydrophobic carboxyl-terminal amino acids. CPB and CPU of this subfamily have an aspartic acid residue, which interacts with lysine or arginine. The CPs in the CPN subfamily all have a glutamine residue in this position. Because subfamily 2 CPs also act on positively charged amino acids, it has been hypothesized that the glutamine undergoes posttranslational modification to a glu- tamic acid, or alternatively another negatively charged amino acid FIGURE 4. Determination of the TIS in the mouse CPN small subunit close by participates in peptide specificity (2). ϳ gene by primer extension. A radiolabeled oligonucleotide (40 mer), 150 The gene for murine CPN small subunit is ϳ29 kb, and has nine

bp downstream from the longest cDNA clone, was hybridized to mouse Downloaded from exons. After comparison with other known CP gene structures, it liver mRNA. Yeast tRNA was used as a control. After reverse transcriptase, the primer-extended products were subjected to electrophoresis adja- was observed that mouse CPN and rat CPH of subfamily 2 are cent to a DNA-sequencing ladder using the same oligonucleotide as primer. organized similarly (Fig. 8) (20). Both genes have nine exons, with The one major TIS is indicated by an arrow, and three minor sites are overall general homology in gene organization. In terms of exon/ indicated by circles. See Materials and Methods for experimental details. intron splice sites and exon size, exons 6, 7, and 8 were the most highly conserved between the two genes. In addition, the con-

served active site is located on exons 2–6 on both CPN and CPH. http://www.jimmunol.org/ the probe, conﬁrmed that the mouse CPN small subunit gene is In contrast, CPN gene structure has less similarity to the rat CPB positioned at an area that corresponds to band 19D2. gene of subfamily 1 (24). The CPB gene has 11 exons, which is typical of the gene structures from this subfamily (24–26). The one Discussion conserved exon/intron junction is located between exons 7 and 8 in In the current study, we describe the cloning and sequencing of the CPB, which corresponds to exons 2 and 3 in CPN. Unlike CPN murine CPN small subunit cDNA. The CPN small subunit cDNA and CPH, the active site for CPB is positioned on exons 6 and has a coding region of 1371 bp that encodes for a protein of 457 8–11. Overall, the gene organizations are conserved within each aa with a M of 51,845. When compared with the human cDNA, subfamily, but more distantly related between families. r by guest on September 25, 2021 there was a 79% amino acid identity (11). In addition, the mouse In this work, a multitissue Northern blot was performed to de- CPN small subunit gene was cloned, sequenced, and localized to termine expression of CPN. The results revealed a high level of mouse chromosome 19D2 by ﬂuorescence in situ hybridization. expression in liver, but no expression in heart, brain, spleen, lung,

FIGURE 5. Analysis of the CPN small subunit 5Ј-flanking sequence. Shown is 916 bp of 5Ј-flanking sequence of the mouse CPN small subunit gene. This sequence was analyzed by the GCG Findpatterns program to determine sequence motifs known to bind transcription factors. The results included seven sites for HNF-5, a C/EBP site, and an AP-2 site (shown in bold). A bold arrow depicts the major hepatic TIS, while the small arrows represent the three minor sites. The start of the CPN gene is defined as ϩ1, and exon one is present in bold. This sequence has been submitted to the GenBank/EMBL Data Bank with accession number AF326478. The Journal of Immunology 6201

FIGURE 8. Comparison of CP gene structures. The gene structure of mouse CPN small subunit was compared with two other CP gene structures: rat CPB and rat CPH. The exons containing the amino acids involved in zinc binding (diamond), substrate binding (circle), and peptide speciﬁc- ity and catalytic activity (star) are noted on the gene structure.

dominately in the liver, if not exclusively, with perhaps much Downloaded from lower expression in certain other tissues that can be observed only by a sensitive RT-PCR assay. Structural examination of the 5Ј-ﬂanking sequence of the CPN gene revealed transcription factor binding sites involved in liver- speciﬁc expression. Nine transcription factor sites, which corre-

spond to three different proteins, were located 916 bp upstream http://www.jimmunol.org/ from the TIS. The three transcription factors were HNF-5, AP-2, and C/EBP. HNF-5 is a liver-specific transcription factor, which has seven recognition sites in the 5Ј-flanking region (21). Five of the seven sites, located ϳ700 bp upstream of the TIS, overlapped. The second transcription factor site, located ϳ650 bp from the TIS, was AP-2. AP-2 is expressed in nonliver cells and can function as a repressor (22) (23). For the serum amyloid A1 gene, AP-2 is a tissue-specific repressor, allowing expression in liver cells only. In the CPN gene, AP-2 may also play a suppressing role, by guest on September 25, 2021 limiting nonliver tissue expression. The third factor, C/EBP, is FIGURE 6. Chromosomal localization of the mouse CPN small subunit found in liver and adipose tissue (21). The C/EBP site is located gene by fluorescence in situ hybridization. Shown in the top panel is the ϳ620 bp from the TIS and only 22 bp from the AP-2 site. The fluorescence hybridization of CPN genomic clones to mouse metaphase chromosome 19D2 (small arrow). Cohybridizating probes specific to close proximity of the two sites could provide a means to block the centromeric region of mouse chromosome 19 (large arrow) confirmed transcription in nonliver cells. Further work needs to be done to the identity of the chromosome 19. The chromosomal band location of the delineate which transcription factor sites are necessary for the ex- mouse CPN small subunit gene is shown schematically in the lower panel. pression and repression of the CPN gene. The human chromosome locations of several CPs have been determined. For the CPB subfamily, CPU is found on chromosome skeletal muscle, kidney, and testis. This is in agreement with pre- 13, while CPA and mast cell CPA are located on chromosomes 7 vious observations, which indicated that CPN expression was lim- and 3, respectively (26, 28, 29). In the CPN subfamily, CPN small ited to the liver (2). In contrast, a recent publication by Sato et al. subunit is on chromosome 10 (mouse 19), CPD is on chromosome (27) documented expression not only in the liver, but also in the 17 (mouse 11), and CPH and CPM are on chromosomes 4 and 12, stomach, lung, intestine, spleen, and kidney by RT-PCR. Collec- respectively (13, 30, 31). Regardless of subfamilies, the CP genes tively, the combined results indicate that CPN is expressed pre- are found throughout the genome with no conserved loci.

FIGURE 7. Comparison of amino acid sequences in regions of high homology between common CPs. The amino acid sequences of six CPs were compared. The active sites are highly conserved, and amino acids that are involved in the binding of substrates (box 1) and zinc (box 2), as well as those that are responsible for the catalytic activity (box 4) and peptide speciﬁcity (box 3) are marked. 6202 MOUSE CARBOXYPEPTIDASE N GENE STRUCTURE

Many of the CPs have similar roles in vitro. Three CPs (CPN, 11. Gebhard, W., S. Matthias, and M. Eulitz. 1989. cDNA cloning and complete cpm, and CPU) have been proposed to potentially have redundant primary structure of the small, active subunit of human carboxypeptidase N. Eur. J. Biochem. 178:603. in vivo functions as well. CPN and CPU are secreted into the 12. Tan, F., D. K. Weerasinghe, R. A. Skidgel, H. Tamei, R. K. Kaul, I. B. Roninson, bloodstream, while CPM is found on the cell membranes of var- J. W. Schilling, and E. G. Erdos. 1990. The deduced protein sequence of the human carboxypeptidase N high molecular weight subunit reveals the presence of ious tissues, including blood vessels (2). All three are capable of leucine-rich tandem repeats. J. Biol. Chem. 265:13. interacting with vasoactive peptides, such as bradykinin or com- 13. Riley, D. A., F. Tan, D. J. Miletich, and R. A. Skidgel. 1998. Chromosomal plement anaphylatoxins. CPU, unlike CPN and CPM, is secreted localization of the genes for human carboxypeptidase D (CPD) and the active 50-kilodalton subunit of human carboxypeptidase N (CPN1). Genomics 50:105. as a proenzyme whose known activators, plasmin and the throm- 14. Wetsel, R. A., D. T. Fleischer, and D. L. Haviland. 1990. Deficiency of the bin-thrombomodulin complex, are members of the coagulation murine fifth complement component 2-base pair gene deletion in a 5Ј-exon. pathway (32). Whether CPU can be activated to cleave comple- J. Biol. Chem. 265:2435. 15. Virca, G. D., W. Northemann, B. R. Shiels, G. Widera, and S. Broome. 1990. ment anaphylatoxins and kinins is not yet known. Another inter- Simplified Northern blot hybridization using 5% sodium dodecyl sulfate. Bio- esting discovery was the up-regulation of CPU, but not CPN, in Techniques 8:370. LPS-challenged mice (27). Because many of the known substrates 16. Lichter, P., C. J. Tang, K. Call, G. Hermanson, G. A. Evans, D. Housman, and D. C. Ward. 1990. High-resolution mapping of human chromosome 11 by in situ for these CPs are derived from acute phase proteins, it is plausible hybridization with cosmid clones. Science 247:64. that CPU acts as a potent regulator of acute phase mediators. With 17. Sambrook J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Labo- ratory Manual, Ch. 7. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, the cDNA and gene structure of mouse CPN small subunit deter- p. 79. mined, further work can be done to delineate its role in vivo. An 18. Lewin, B. 1994. Building the transcription complex: promoters, factors, and RNA approach would be to make a CPN knockout mouse and determine polymerases. In Genes V. Oxford University Press, Oxford, p. 845. 19. Boffa, M. B., T. S. Reid, E. Joo, M. E. Neshein, and M. L. Koschinsky. 1999. whether CPN has unique function, or if it has redundant roles with Characterization of the gene encoding human TAFI (thrombin-activable fibrino- Downloaded from other CPs. lysis inhibitor; plasma procarboxypeptidase B). Biochemistry 38:6547. 20. Jung, Y. K., C. J. Kunczt, R. K. Pearson, J. E. Dixon, and L. D. Fricker. 1991. Acknowledgments Structural characterization of the rat carboxypeptidase E gene. Mol. Endocrinol. 5:1257. We gratefully acknowledge Dr. Scott Drouin, Dr. Irma Gigli, Dr. David 21. Grange, T., J. Roux, G. Rigaud, and R. Pictet. 1991. Cell-type specific activity of Haviland, and Dr. Jens Kildsgaard for critical evaluation of data and text. two glucocorticoid responsive units of rat tyrosine aminotransferase gene is as- We also thank Robert D. Matthews for countless hours of help with graph- sociated with multiple binding sites for C/EBP and a novel liver-specific nuclear ics and limitless moral support and Dr. Ronald Watts for years of expert factor. Nucleic Acids Res. 19:131. http://www.jimmunol.org/ 22. Li, L., and W. S. L. Liao. 1999. An upstream repressor element that contributes mentoring. to hepatocyte-specific expression of the rat serum amyloid A1 gene. Biochem. Biophys. Res. Commun. 264:395. References 23. Ren, Y., S. A. G. Reddy, and W. S. L. Liao. 1999. Purification and identification 1. Levin, Y., R. A. Skidgel, and E. G. Erdos. 1982. Isolation and characterization of of a tissue-specific repressor involved in serum amyloid A1 gene expression. the subunits of human plasma carboxypeptidase N (kininase I). Proc. Natl. Acad. J. Biol. Chem. 274:37154. Sci. USA 79:4618. 24. Clauser, E., S. J. Gardell, C. S. Craik, R. J. MacDonald, and W. J. Rutter. 1988. 2. Skidgel, R. A. 1996. Structure and function of mammalian zinc carboxypepti- Structural characterization of rat carboxypeptidase A1 and B genes. J. Biol. dase. In Zinc Metalloprotease in Health and Disease. N. M. Hooper, ed. Taylor Chem. 263:17837. and Francis, London, p. 241. 25. Gardell, S. J., C. S. Craik, E. Clauser, E. J. Goldsmith, C. B. Stewart, M. Graf, 3. Erdos, E. G., and E. M. Sloane. 1962. An enzyme in human blood plasma that and W. J. Rutter. 1988. A novel rat carboxypeptidase, CPA2: characterization, by guest on September 25, 2021 inactivates bradykinin and kallidins. Biochem. Pharmacol. 11:585. molecular cloning, and evolutionary implications on substrate specificity in the 4. Erdos, E. G. 1979. Bradykinin, kallidin and kallikrein. In Handbook of Experi- carboxypeptidase gene family. J. Biol. Chem. 263:17828. mental Pharmacology. E. G. Erdos, ed. Springer-Verlag, Heidelberg, p. 427. 26. Reynolds, D. S., D. S. Gurley, and K. F. Austen. 1992. Cloning and character- 5. Belew, M., G. B. Lindeberg, J. Porath, T. Saldeen, and R. Wallin. 1980. Struc- ization of the novel gene for mast cell carboxypeptidase A. J. Clin. Invest. 89: ture-activity relationships of vasoactive peptides derived from fibrin or fibrinogen 273. degraded by plasmin. Biochim. Biophys. Acta 621:169. 27. Sato, T., T. Miwa, H. Akatsu, N. Matsukawa, K. Obata, N. Okada, W. Campbell, 6. Bokisch, V. A., and H. J. Muller-Eberhard. 1970. Anaphylatoxin inactivator of and H. Okada. 2000. Pro-carboxypeptidase R is an acute phase protein in the human plasma: its isolation and characterization as a carboxypeptidase. J. Clin. mouse, whereas carboxypeptidase N is not. J. Immunol. 165:1053. Invest. 49:2427. 28. Tsai, S. P., and D. Drayna. 1992. The gene encoding human plasma carboxypep- 7. Ember, J. A., M. A. Jagels, and T. E. Hugli. 1998. Characterization of comple- tidase B (CPB2) resides on chromosome 13. Genomics 14:549. ment anaphylatoxins and their biological responses. In Human Complement Sys- 29. Honey, N. K., A. Y. Sakaguchi, P. A. Lalley, C. Quinto, W. J. Rutter, and tem in Health and Disease. M. Frank and J. Volanakis, eds. Marcel Dekker, New S. L. Naylor. 1986. Assignment of the gene for carboxypeptidase A to human York, p. 241. chromosome 7q22-qter and to mouse chromosome 6. Hum. Genet. 72:27. 8. Wetsel, R. A., J. Kildsgaard, and D. L. Haviland. 2000. Complement anaphyla- 30. Hall, C., E. Manser, N. K. Spurr, and L. Lim. 1993. Assignment of the human toxins (C3a, C4a, C5a) and their receptors (C3aR, C5aR/CD88) as therapeutic carboxypeptidase E (CPE) gene to chromosome 4. Genomics 15:461. targets in inflammation. In Therapeutic Interventions in the Complement System. 31. Kas, K., E. F. P. M. Schoenmakers, and W. J. M. Van de Ven. 1995. Physical map J. D. Lambris and V. M. Holers, eds. Humana Press, Totowa, p. 113. location of the human carboxypeptidase M gene (CPM) distal to D12S375 and 9. Mathews, K. P. 1986. Deficiencies in regulator proteins 4: anaphylatoxin inac- proximal to D12S8 at chromosome 12q15. Genomics 30:403. tivator. Prog. Allergy 39:344. 32. Bajzar, L., J. Morser, and M. Nesheim. 1996. TAFI or plasma procarboxypep- 10. Mathews, K. P., J. G. Curd, and T. E. Hugli. 1986. Decreased synthesis of serum tidase B couples the coagulation and fibrinolytic cascades through the thrombin- carboxypeptidase N (SCPN) in familial SCPN deficiency. J. Clin. Immunol. 6:87. thrombomodulin complex. J. Biol. Chem. 271:16603.