DOCSLIB.ORG

Blueprint Genetics Coagulation Factor Deficiency Panel

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Blueprint Genetics Coagulation Factor Deficiency Panel Coagulation Factor Deficiency Panel Test code: HE0501 Is a 16 gene panel that includes assessment of non-coding variants. Is ideal for patients with a clinical suspicion of hemophilia A, hemophilia B, rare bleeding disorder or Von Willebrand disease. The genes on this panel are included in the Bleeding Disorder/Coagulopathy Panel and the Comprehensive Hematology Panel. Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions. About Coagulation Factor Deficiency Coagulation Factor Deficiencies refers to a heterogenous group of inherited bleeding disorders. The most common coagulation factor deficiencies are hemophilias (A and B) and von Willebrand disease (VWD), together accounting for 95% of bleeding disorders. The clinical presentation of inherited bleeding disorders can be highly variable and the severity of the clinical manifestations depends on the biological activity of the coagulation factor. The diseases are characterized by abnormal bleeding of variable severity occurring either spontaneously or in association with trauma or an invasive procedure. The age of onset in hemophilia is typically in infancy. In VWD, the symptoms can begin at any age. Hemophilia A and B and are inherited in an X-linked recessive manner through mutations in the F8 and F9 genes, respectively. The diseases primarily affect males, but female carriers of the disease may have milder forms of the disease. VWD is inherited in both autosomal dominant and recessive manners and the causative gene is VWF. Rare bleeding disorders (RBDs) include inherited deficiencies of coagulation factors fibrinogen, factor (F)II, FV, combined FV and FVIII, FVII, FX, FXI, FXIII, and congenital deficiency of vitamin K-dependent factors (VKCFDs). RBDs are autosomal recessive conditions and deficiencies in FVII and FXI together account for 64% of cases (PMID: 25712993). The associated genes are FGA, FGB, FGG, F2, F5, F7, F10, F11, F13A1, LMAN1 and VKORC1. The prevalence of hemophilia is estimated at 1:12,000 and the prevalence of symptomatic VWD that requires specific treatment is estimated at between 1:50,000 and 1:8,500. Availability 4 weeks Gene Set Description Genes in the Coagulation Factor Deficiency Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD F10 Factor X deficiency AR 15 155 F11 Factor XI deficiency AD/AR 77 271 F12 Angioedema, Factor XII deficiency AD/AR 7 53 F13A1 Factor XIIIA deficiency AR 20 180 F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, AD/AR 14 66 congenital F5 Factor V deficiency, Thrombophilia due to activated protein C resistance AD/AR 19 157 F7 Factor VII deficiency AR 27 322 https://blueprintgenetics.com/ F8* Hemophilia A XL 296 3205 F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX XL 117 1281 defect FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 10 144 Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 6 92 Hypodysfibrinogenemia, congenital FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, AD/AR 7 127 Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation factor AD/AR/Digenic 13 42 deficiency, Vitamin K-dependent clotting factors, combined deficiency LMAN1 Combined factor V and VIII deficiency AR 5 37 VKORC1 Drug metabolism, VKORC1-related, Vitamin K-dependent clotting AD/AR 4 27 factors, combined deficiency VWF* Von Willebrand disease AD/AR 57 1009 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HG19 HGVS RefSeq RS-number F11 Chr4:187186995 c.-456G>A NM_000128.3 F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853 F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976 F12 Chr5:176836590 NM_000505.3 rs187018744 F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3 F2 Chr11:46742048 c.241-25C>G NM_000506.3 F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963 F2 Chr11:46761064 c.*106T>A NM_000506.3 https://blueprintgenetics.com/ F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397 F5 Chr1:169494158 c.5717-12T>A NM_000130.4 F5 Chr1:169521527 c.1296+268A>G NM_000130.4 F5 Chr1:169521984 c.1119-12C>G NM_000130.4 F7 Chr13:113760060 c.-96C>T NM_000131.4 F7 Chr13:113760062 c.-94C>G NM_000131.4 F7 Chr13:113760091 c.-65G>C NM_000131.4 F7 Chr13:113760094 NM_000131.4 F7 Chr13:113760094 c.-62C>T NM_000131.4 F7 Chr13:113760095 c.-61T>G NM_000131.4 F7 Chr13:113760096 NM_000131.4 F7 Chr13:113760096 NM_000131.4 F7 Chr13:113760097 c.-59T>G NM_000131.4 F7 Chr13:113760099 c.-57C>T NM_000131.4 F7 Chr13:113760101 NM_000131.4 F7 Chr13:113760101 NM_000131.4 F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666 F7 Chr13:113760117 c.-39A>G NM_000131.4 F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787 F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931 F7 Chr13:113764993 c.131-11G>A NM_000131.4 F7 Chr13:113766228 c.291+1065delC NM_000131.4 F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909 F7 Chr13:113771068 c.572-12T>A NM_000131.4 F8 ChrX:154084603 c.6900+4104A>T NM_000132.3 F8 ChrX:154091516 c.6430-14A>G NM_000132.3 F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907 F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3 F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3 F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3 F8 ChrX:154130719 c.5999-277G>A NM_000132.3 https://blueprintgenetics.com/ F8 ChrX:154131240 c.5999-798G>A NM_000132.3 F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3 F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004 F8 ChrX:154132892 c.5587-93C>T NM_000132.3 F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3 F8 ChrX:154174820 c.2113+1152delA NM_000132.3 F8 ChrX:154175961 c.2113+12T>A NM_000132.3 F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232 F8 ChrX:154185464 c.1538-18G>A NM_000132.3 F8 ChrX:154189025 c.1537+325A>G NM_000132.3 F8 ChrX:154189458 c.1444-15C>A NM_000132.3 F8 ChrX:154197841 c.788-14T>G NM_000132.3 F8 ChrX:154213089 c.671-11T>C NM_000132.3 F8 ChrX:154215591 c.602-11T>G NM_000132.3 F8 ChrX:154215612 c.602-32A>G NM_000132.3 F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429 F8 ChrX:154221439 c.389-16T>G NM_000132.3 F8 ChrX:154227886 c.144-11T>G NM_000132.3 F8 ChrX:154227901 c.144-26A>T NM_000132.3 F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3 F8 ChrX:154249118 c.143+1567A>G NM_000132.3 F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565 F8 ChrX:154251045 c.-218T>C NM_000132.3 F8 ChrX:154251045 NM_000132.3 F8 ChrX:154251046 c.-219C>T NM_000132.3 F8 ChrX:154251048 c.-221T>A NM_000132.3 F8 ChrX:154251082 c.-255A>G NM_000132.3 F8 ChrX:154251084 c.-257T>C/G NM_000132.3 F8 ChrX:154251084 NM_000132.3 F8 ChrX:154251084 NM_000132.3 F8 ChrX:154251687 c.-860A>G NM_000132.3 https://blueprintgenetics.com/ F8 ChrX:154251793 c.-966G>T NM_000132.3 F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3 F9 ChrX:138612869 NM_000133.3 F9 ChrX:138612869 NM_000133.3 F9 ChrX:138612869 NM_000133.3 F9 ChrX:138612871 c.-53A>G NM_000133.3 F9 ChrX:138612871 NM_000133.3 F9 ChrX:138612872 c.-52C>G/T NM_000133.3 F9 ChrX:138612872 NM_000133.3 F9 ChrX:138612872 NM_000133.3 F9 ChrX:138612874 c.-50T>C/G NM_000133.3 F9 ChrX:138612874 NM_000133.3 F9 ChrX:138612874 NM_000133.3 F9 ChrX:138612875 c.-49T>A/C NM_000133.3 F9 ChrX:138612875 NM_000133.3 F9 ChrX:138612875 NM_000133.3 rs1178811105 F9 ChrX:138612876 c.-48G>C NM_000133.3 F9 ChrX:138612886 c.-38A>G NM_000133.3 F9 ChrX:138612889 c.-35G>A/C NM_000133.3 F9 ChrX:138612889 NM_000133.3 rs1166164399 F9 ChrX:138612889 NM_000133.3 F9 ChrX:138612890 c.-34A>G/T NM_000133.3 F9 ChrX:138612890 NM_000133.3 F9 ChrX:138612890 NM_000133.3 F9 ChrX:138612899 c.-22delT NM_000133.3 F9 ChrX:138612900 c.-24T>A NM_000133.3 F9 ChrX:138612901 c.-23T>C NM_000133.3 F9 ChrX:138612902 c.-22T>C NM_000133.3 F9 ChrX:138612903 c.-21C>G NM_000133.3 F9 ChrX:138612905 c.-19C>G NM_000133.3 F9 ChrX:138612905 c.-17delA NM_000133.3 https://blueprintgenetics.com/ F9 ChrX:138612906 c.-18A>G/T NM_000133.3 F9 ChrX:138612906
Load more

Recommended publications
  • The Rare Coagulation Disorders
    Treatment OF HEMOPHILIA April 2006 · No. 39 THE RARE COAGULATION DISORDERS Paula HB Bolton-Maggs Department of Haematology Manchester Royal Infirmary Manchester, United Kingdom Published by the World Federation of Hemophilia (WFH) © World Federation of Hemophilia, 2006 The WFH encourages redistribution of its publications for educational purposes by not-for-profit hemophilia organizations. In order to obtain permission to reprint, redistribute, or translate this publication, please contact the Communications Department at the address below. This publication is accessible from the World Federation of Hemophilia’s web site at www.wfh.org. Additional copies are also available from the WFH at: World Federation of Hemophilia 1425 René Lévesque Boulevard West, Suite 1010 Montréal, Québec H3G 1T7 CANADA Tel. : (514) 875-7944 Fax : (514) 875-8916 E-mail: [email protected] Internet: www.wfh.org The Treatment of Hemophilia series is intended to provide general information on the treatment and management of hemophilia. The World Federation of Hemophilia does not engage in the practice of medicine and under no circumstances recommends particular treatment for specific individuals. Dose schedules and other treatment regimes are continually revised and new side effects recognized. WFH makes no representation, express or implied, that drug doses or other treatment recommendations in this publication are correct. For these reasons it is strongly recommended that individuals seek the advice of a medical adviser and/or to consult printed instructions provided by the pharmaceutical company before administering any of the drugs referred to in this monograph. Statements and opinions expressed here do not necessarily represent the opinions, policies, or recommendations of the World Federation of Hemophilia, its Executive Committee, or its staff.
    [Show full text]
  • Library of Congress Classification
    R MEDICINE (GENERAL) R Medicine (General) Periodicals. Societies. Serials 5 International periodicals and serials 10 Medical societies Including aims, scope, utility, etc. International societies 10.5.A3 General works 10.5.A5-Z Individual societies America English United States. Canada 11 Periodicals. Serials 15 Societies British West Indies. Belize. Guyana 18 Periodicals. Serials 20 Societies Spanish and Portuguese Latin America 21 Periodicals. Serials 25 Societies 27.A-Z Other, A-Z 27.F7 French Europe English 31 Periodicals. Serials 35 Societies Dutch 37 Periodicals. Serials 39 Societies French 41 Periodicals. Serials 45 Societies German 51 Periodicals. Serials 55 Societies Italian 61 Periodicals. Serials 65 Societies Spanish and Portuguese 71 Periodicals. Serials 75 Societies Scandinavian 81 Periodicals. Serials 85 Societies Slavic 91 Periodicals. Serials 95 Societies 96.A-Z Other European languages, A-Z 96.H8 Hungarian Asia 97 English 97.5.A-Z Other European languages, A-Z 97.7.A-Z Other languages, A-Z Africa 98 English 98.5.A-Z Other European languages, A-Z 98.7.A-Z Other languages, A-Z 1 R MEDICINE (GENERAL) R Periodicals. Societies. Serials -- Continued Australasia and Pacific islands 99 English 99.5.A-Z Other European languages, A-Z 99.7.A-Z Other languages, A-Z Indexes see Z6658+ (101) Yearbooks see R5+ 104 Calendars. Almanacs Cf. AY81.M4 American popular medical almanacs 106 Congresses 108 Medical laboratories, institutes, etc. Class here papers and proceedings For works about these organizations see R860+ Collected works (nonserial) Cf. R126+ Ancient Greek and Latin works 111 Several authors 114 Individual authors Communication in medicine Cf.
    [Show full text]
  • Familial Multiple Coagulation Factor Deficiencies
    Journal of Clinical Medicine Article Familial Multiple Coagulation Factor Deficiencies (FMCFDs) in a Large Cohort of Patients—A Single-Center Experience in Genetic Diagnosis Barbara Preisler 1,†, Behnaz Pezeshkpoor 1,† , Atanas Banchev 2 , Ronald Fischer 3, Barbara Zieger 4, Ute Scholz 5, Heiko Rühl 1, Bettina Kemkes-Matthes 6, Ursula Schmitt 7, Antje Redlich 8 , Sule Unal 9 , Hans-Jürgen Laws 10, Martin Olivieri 11 , Johannes Oldenburg 1 and Anna Pavlova 1,* 1 Institute of Experimental Hematology and Transfusion Medicine, University Clinic Bonn, 53127 Bonn, Germany; [email protected] (B.P.); [email protected] (B.P.); [email protected] (H.R.); [email protected] (J.O.) 2 Department of Paediatric Haematology and Oncology, University Hospital “Tzaritza Giovanna—ISUL”, 1527 Sofia, Bulgaria; [email protected] 3 Hemophilia Care Center, SRH Kurpfalzkrankenhaus Heidelberg, 69123 Heidelberg, Germany; ronald.fi[email protected] 4 Department of Pediatrics and Adolescent Medicine, University Medical Center–University of Freiburg, 79106 Freiburg, Germany; [email protected] 5 Center of Hemostasis, MVZ Labor Leipzig, 04289 Leipzig, Germany; [email protected] 6 Hemostasis Center, Justus Liebig University Giessen, 35392 Giessen, Germany; [email protected] 7 Center of Hemostasis Berlin, 10789 Berlin-Schöneberg, Germany; [email protected] 8 Pediatric Oncology Department, Otto von Guericke University Children’s Hospital Magdeburg, 39120 Magdeburg, Germany; [email protected] 9 Division of Pediatric Hematology Ankara, Hacettepe University, 06100 Ankara, Turkey; Citation: Preisler, B.; Pezeshkpoor, [email protected] B.; Banchev, A.; Fischer, R.; Zieger, B.; 10 Department of Pediatric Oncology, Hematology and Clinical Immunology, University of Duesseldorf, Scholz, U.; Rühl, H.; Kemkes-Matthes, 40225 Duesseldorf, Germany; [email protected] B.; Schmitt, U.; Redlich, A.; et al.
    [Show full text]
  • Reframing Sport Contexts: Labeling, Identities, and Social Justice
    Reframing Sport Contexts: Labeling, Identities, and Social Justice Dr. Ted Fay and Eli Wolff Sport in Society Disability in Sport Initiative Northeastern University Critical Context • Marginalization (Current Status Quo) vs. • Legitimatization (New Inclusive Paradigm) Critical Context Naturalism vs. Trans-Humanism (Wolbring, G. (2009) How Do We Handle Our Differences related to Labeling Language and Cultural Identities? • Stereotyping? • Prejudice? • Discrimination? (Carr-Ruffino, 2003, p. 1) Ten Major Cultural Differences 1) Source of Control 2) Collectivism or Individualism 3) Homogeneous or Heterogeneous 4) Feminine or Masculine 5) Rank Status 6) Risk orientation 7) Time use 8) Space use 9) Communication Style 10) Economic System (Carr – Ruffino, 2003, p.27) Rationale for Inclusion • Divisioning by classification relative to “fair play” and equity principles • Sport model rather than “ism” segregated model (e.g., by race, gender, disability, socio-economic class, sexual orientation, look (body image), sect (religion), age) • Legitimacy • Human rights and equality Social Dynamics of Inequality Reinforce and reproduce Social Institutions Ideology Political (Patriarchy) Economic Educational Perpetuates Religious Prejudice & Are institutionalized by Discrimination Cultural Practices (ISM) Sport Music Art (Sage, 1998) Five Interlinking Conceptual Frameworks • Critical Change Factors Model (CCFM) • Organizational Continuum in Sport Governance (OCSG) • Criteria for Inclusion in Sport Organizations (CISO) • Individual Multiple Identity Sport Classifications Index (IMISCI) • Sport Opportunity Spectrum (SOS) Critical Change Factors Model (CCFM) F1) Change/occurrence of major societal event (s) affecting public opinion toward ID group. F2) Change in laws, government and court action in changing public policies toward ID group. F3) Change in level of influence of high profile ID group role models on public opinion.
    [Show full text]
  • Familial Haemophilia and Factor Vii Deficiency by M
    J Clin Pathol: first published as 10.1136/jcp.11.5.412 on 1 September 1958. Downloaded from J. clin. Path. (1958), 11, 412. FAMILIAL HAEMOPHILIA AND FACTOR VII DEFICIENCY BY M. CONSTANDOULAKIS Front the Group Laboratory, St. Mary Abbots Hospital, London* (RECEIVED FOR PUBLICATION MAY 12, 1958) This investigation is reported because of the months later he was readmitted with a few bruises combination of familial haemophilia and factor on the legs and bleeding gums. Bleeding subsided with VII deficiency and the unusual occurrence of a local treatment and vitamin K1. female haemophiliac. Brenda, his sister (aged 10), appears normal with- Cases of combined deficiencies of different out any haemorrhagic manifestations up till now. factors are extremely rare and up till now Eileen Br., his mother (aged 46), revealed that she clotting had had excessive bleeding during both her deliveries, there have been reported combinations of haemo- during and after a hysterectomy, being transfused in philia and factor V deficiency (Koller, 1954), order to control haemorrhage, and after tooth extrac- haemophilia and Christmas disease (Soulier and tions at different times. Larrieu, 1953), Christmas disease and factor VII Frank G. (aged 43), his maternal uncle, has bled deficiency (Bell and Alton, 1955; Stein and since a small child after trauma and tooth extrac- Abrahams, 1956; de Vries, Kettenborg, and van tions, oozing from sockets usually persisting for about der Pol, 1955), but not of haemophilia and factor three days. In 1948 he had a blow in the abdomencopyright. VII deficiency. which was followed by severe haematemesis and Female haemophiliacs in the homozygous state melaena and he was transfused in order to control have been reported by Merskey (1951), Israels, the haemorrhage.
    [Show full text]
  • Factor Vii Deficiency/Mariani, Bernardi 401
    Factor VII Deficiency Guglielmo Mariani, M.D.,1 and Francesco Bernardi, Ph.D.2 ABSTRACT The complex formed between the procoagulant serine protease activated factor VII (FVII) and the membrane protein tissue factor, exposed on the vascular lumen upon injury, triggers the initiation of blood clotting. This review describes the clinical picture of FVII deficiency and provides information on diagnosis and management of the disease. FVII deficiency, the most common among the rare congenital coagulation disorders, is transmitted with autosomal recessive inheritance. Clinical phenotypes range from asymp- tomatic condition, even in homozygotes, to severe disease characterized by life-threatening and disabling symptoms (central nervous system and gastrointestinal bleeding and hemarthrosis), with early age of presentation and the need for prophylaxis. In females, menorrhagia is prevalent and affects two thirds of the patients of fertile age. Although FVII gene mutations are extremely heterogeneous, several recurrent mutations have been reported, a few of them relatively frequent. The study of genotype-phenotype relationships indicates that modifier (environmental and/or inherited) components modulate expressiv- ity of FVII deficiency, as reflected by patients with identical FVII mutations and discordant clinical phenotypes. Several treatment options are available for FVII deficiency: the most effective are plasma-derived FVII concentrates and recombinant activated FVII (rFVIIa). Treatment-related side effects are rare. KEYWORDS: FVII deficiency, F7 database,
    [Show full text]
  • Pocket Filters Made of Non-Woven Synthetic Fibres – Type
    PFS 6.2 – X XPFStestregistrierung Pocket filters made of non- woven synthetic fibres Type PFS Prefilters or final filters in ventilation systems Pocket filters for the separation of fine dust Filter classes M5, M6, F7 Performance data tested to EN 779 AIR FILTERS CLASS M5-F9 Eurovent certification for fine dust filters Meets the hygiene requirements of VDI 6022 Non-woven synthetic fibres, welded 6 Eurovent certification Enlarged filter area due to filter pockets Low initial differential pressure and high dust holding capacity Variable number of pockets and pocket depth H Quick installation and filter changing times due to easy, safe handling ISC GE N TE IE S T Fitting into standard cell frames for filter walls (type SIF) or into universal G E Y T H casings (type UCA) for duct installation Optional equipment and accessories V 2 DI 602 Front frame made of plastic or galvanised sheet steel Tested to VDI 6022 09/2013 – DE/en K7 – 6.2 – 1 Pocket filters made of non-woven synthetic fibres General information PFS Type Page PFS General information 6.2 – 2 Order code 6.2 – 3 Dimensions and weight 6.2 – 4 Specification text 6.2 – 5 Basic information and nomenclature 10.1 – 1 Description Application Materials and surfaces – Pocket filter made of non-woven synthetic – Filter media made of non-woven synthetic fibres type PFS for the separation of fine dust fibres – Fine dust filter: Prefilter or final filter in – Frame made of plastic or galvanised sheet ventilation systems steel Classification Standards and guidelines – Eurovent certification for
    [Show full text]
  • Coagadex, Human Coagulation Factor X
    26 July 2018 EMA/CHMP/455550/2018 Committee for Medicinal Products for Human Use (CHMP) CHMP extension of indication variation assessment report Coagadex International non-proprietary name: human coagulation factor X Procedure No. EMEA/H/C/003855/II/0007 Note Assessment report as adopted by the CHMP with all information of a commercially confidential nature deleted. 30 Churchill Place ● Canary Wharf ● London E14 5EU ● United Kingdom Telephone +44 (0)20 3660 6000 Facsimile +44 (0)20 3660 5555 Send a question via our website www.ema.europa.eu/contact An agency of the European Union © European Medicines Agency, 2018. Reproduction is authorised provided the source is acknowledged. Table of contents 1. Background information on the procedure .............................................. 5 1.1. Type II variation .................................................................................................. 5 1.2. Steps taken for the assessment of the product ......................................................... 6 2. Scientific discussion ................................................................................ 6 2.1. Introduction......................................................................................................... 6 2.2. Non-clinical aspects .............................................................................................. 7 2.3. Clinical aspects .................................................................................................... 7 2.3.1. Introduction .....................................................................................................
    [Show full text]
  • Factor X Deficiency
    FACTSHEET Factor X deficiency This factsheet is about a bleeding disorder If you carry one copy of the gene fault for that is related to problems with a blood factor X deficiency, you are known as a clotting factor called factor X (pronounced carrier. You can only pass the condition on to factor 10). It is written to go with our Rare your children if your partner also carries the bleeding disorders booklet, where you will gene fault. You will not have the condition find much more information on living with yourself, but any children that inherit the one of these conditions. gene fault from you will also be carriers of the condition. What is factor X deficiency? It is also possible to develop a factor X Factor X deficiency is a bleeding disorder deficiency later in life. This is called acquired caused by the body producing less of the factor X deficiency. Acquired factor X clotting factor than it should. This causes deficiency is not inherited and occurs in problems because the clotting reaction individuals with no family history of the that would normally control any bleeding disorder. This is rare, but may be caused is blocked too early. So, your body doesn’t by other diseases, including severe liver make the blood clots it needs to stop disease, amyloidosis, cancer and infections. bleeding. Factor X needs vitamin K from the liver to be activated. Symptoms of factor X deficiency Factor X deficiency is rare. Doctors estimate Symptoms of factor X deficiency can be that it affects about one in a million people.
    [Show full text]
  • The ICD-10 Classification of Mental and Behavioural Disorders Diagnostic Criteria for Research
    The ICD-10 Classification of Mental and Behavioural Disorders Diagnostic criteria for research World Health Organization Geneva The World Health Organization is a specialized agency of the United Nations with primary responsibility for international health matters and public health. Through this organization, which was created in 1948, the health professions of some 180 countries exchange their knowledge and experience with the aim of making possible the attainment by all citizens of the world by the year 2000 of a level of health that will permit them to lead a socially and economically productive life. By means of direct technical cooperation with its Member States, and by stimulating such cooperation among them, WHO promotes the development of comprehensive health services, the prevention and control of diseases, the improvement of environmental conditions, the development of human resources for health, the coordination and development of biomedical and health services research, and the planning and implementation of health programmes. These broad fields of endeavour encompass a wide variety of activities, such as developing systems of primary health care that reach the whole population of Member countries; promoting the health of mothers and children; combating malnutrition; controlling malaria and other communicable diseases including tuberculosis and leprosy; coordinating the global strategy for the prevention and control of AIDS; having achieved the eradication of smallpox, promoting mass immunization against a number of other
    [Show full text]
  • Direct Oral Anticoagulants in Factor VII Deficiency Patient
    Internal and Emergency Medicine (2019) 14:1353–1356 https://doi.org/10.1007/s11739-019-02186-1 CE - RESEARCH LETTER TO THE EDITOR Direct oral anticoagulants in factor VII defciency patient Fulvio Pomero1 · Laura Spadafora2 · Salvatore D’Agnano3 · Francesco Dentali4 · Luigi Maria Fenoglio5 Received: 27 June 2019 / Accepted: 26 August 2019 / Published online: 16 September 2019 © Società Italiana di Medicina Interna (SIMI) 2019 Dear Sir, thrombotic events have been reported in 3–4% of patients with FVII defciency. Thus, in some cases, “antithrombotic Factor VII (FVII) is a vitamin K-dependent coagulation efect” of FVII defciency seems to be overwhelmed by the factor synthesized in the liver which plays a major role in presence of thrombotic risk factors underlying the need of the coagulation extrinsic pathway which is initiated at tis- an antithrombotic prophylaxis even in these patients [5]. sue damage sites, following the formation of a complex However, it is not well established how to manage the anti- between activated FVII (FVIIa) and tissue factor. Plasma coagulation therapy and the available evidences are based levels range around 0.35–0.60 mg/L (for a normal coagulant only on few case reports. Here, we describe a case of FVII activity comprised between 70 and 140%), which is 10 times defciency patient afected by atrial fbrillation (AF) treated less than other vitamin K-dependent factors. Its half-life is with a direct oral anticoagulant (DOAC). In October 2017, extremely short (4–6 h) [1]. Inherited FVII defciency, with an 89-year-old woman presented to the emergency depart- an estimated prevalence of 1:300,000 population in Euro- ment complaining of acute post-prandial pain in peri-umbil- pean countries, is the most common among the rare congeni- ical region.
    [Show full text]
  • Driving Factors Behind the Purchase of Paint Products : a Case of Indian Paint Shop Presented By: Bala Yogesh S Academic Mentor: Dr
    Driving Factors behind the Purchase of Paint Products : A Case of Indian Paint Shop Presented by: Bala Yogesh S Academic Mentor: Dr. Suresh M OBJECTIVE Identified Factors For Paint Buying Behavior Initial Reachability matrix . The customers who visit the dealer shops are • Product Variance (F1) F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 predominantly painters and a few direct consumers. • Service Quality (F2) F1 1 0 0 0 1 1 1 1 0 0 . This paper primarily focus upon identifying the key • Perceived Quality (F3) F2 0 1 0 0 1 0 0 0 1 1 factors that will influence paint buying behavior in a • Perceived Value(F4) F3 0 0 1 1 1 0 0 0 0 0 dealer shop. • Brand Image(F5) F4 0 1 0 1 1 0 0 0 0 0 . In this paper a conceptual model has been developed • Compatible Price (F6) F5 0 0 1 0 1 0 1 0 0 0 using interpretative structural modelling(ISM) • Store Environment (F7) F6 0 0 1 1 0 1 0 0 0 1 approach. This study results indicates product variance • Product Reliability (F8) F7 0 1 0 0 0 0 1 0 1 0 is the key influencing factor, followed by compatible • Customer Value (F9) F8 0 0 1 1 1 0 0 1 0 1 price and product reliability for the purchase decision • Customer Loyalty (F10) F9 0 0 0 0 0 0 0 0 1 1 of paint products by customer. F10 0 0 0 0 0 0 0 0 0 1 Paint Industry WORKING MODEL Final Reachability Matrix Drivin F1 F2 F3 F4 F5 F6 F7 F8 F9 F10 g Power F1 1 1 1 1 1 1 1 1 1 1 10 Identification of Factors F2 0 1 1 1 1 0 1 0 1 1 7 from literature review F3 0 1 1 1 1 0 1 0 1 1 7 F4 0 1 1 1 1 0 1 0 1 1 7 F5 0 1 1 1 1 0 1 0 1 1 7 F6 0 1 1 1 1 1 1 0 1 1 8 F7 0 1 1 1 1 0 1 0 1 1 7 Application of ISM F8 0 1 1 1 1 0 1 1 1 1 8 approach F9 0 0 0 0 0 0 0 0 1 1 2 F10 0 0 0 0 0 0 0 0 0 1 1 .
    [Show full text]