DOCSLIB.ORG

Polymerase Chain Reaction Assay Identifies

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Polymerase Chain Reaction Assay Identifies Journal of the American Mosquito Control Association, l9(2):ll5-120,20O3 Copyright @ 2003 by the American Mosquito Control Association, Inc. POLYMERASE CHAIN REACTION ASSAY IDENTIFIES CULEX NIGRIPALPUS: PART OF AN ASSAY FOR MOLECULAR IDENTIFICATION OF THE COMMON CULEX (CULEN MOSQUITOES OF THE EASTERN UNITED STATES STEPHEN ASPEN, MARY B. CRABTREE AND HARRY M. SAVAGE Division of Vector-Borne Infectious Disease, Centers for Disease Control and Prevention, Fort Collins, CO 80522 ABSTRACT, Nucleotide sequence information on intemal transcribed spacer (ITS) 1 and ITS 2 regions of the nuclear ribosomal DNA multigene family was used to develop a polymerase chain reaction assay that identifies Culer nigripeilpas Theobald. The assay uses species-specific forward and reverse primers for C.x. nigripalpus and can be used along with previously described primers to distinguish among 4 common taxa of Culex (Culex) of the eastern USA with a single thermal cycler program. The assay distinguishes among the 4 taxa Cx. nigripalpus, Cx. restuans Theobald, Cx. salinarius Coquillett, and members of the Cx. pipiens Linnaeus complex. This assay may be used to verify the morphological identification of individual specimens of Culex or to confirm the species composition of mosquito pools. KEY WORDS Culex (Culex), Culex nigripalpzs, internal transcribed spacers, ribosomal DNA, molecular species identification INTRODUCTION within the adult mosquito genome (in Aedes aegyp- ri see Park and Fallon [l990l) means that a small In North America, mosquitoes of the subgenus fraction of extracted DNA supplies a sufficient tem- Culex (Culex) are the primary enzootic vectors of plate for PCR. Second, rDNA contains highly con- West Nile virus (Nasci et al. 2001b) and the pri- served coding regions, ideal as annealing sites for mary enzootic and epidemic vectors of St. Louis sequencing primers, separated by less conserved encephalitis virus (Mitchell et al. 1980). Adult fe- spacers, which are the source of interspecific se- males of these mosquitoes are frequently collected quence variation. in gravid traps (Reiter 1983), Cor-baited Centers Crabtree et al. (1995) describe a PCR assay for for Disease Control light traps, or with aspirators the identiflcation of Cx. restuans, Cx. salinarius, part (Nasci as of arbovirus surveillance programs and members of the C-r. pipiens complex. This as- et al. 2001a), blood host studies (Apperson et al. say makes use of interspecific nucleotide sequence 2OO2), or other mosquito investigations. Morpho- differences in the noncoding internal transcribed logical characters are used to identify specimens spacers (ITS) I and ITS 2 of rDNA. Different PCR and sort field-collected mosquitoes into species primers anneal to taxon-specific ITS sequences, pools. Mosquito pools can be tested for virus as producing a uniquely sized amplicon in the pres- part of surveillance programs and to assess the vec- ence of the appropriate template DNA. Subtractive tor status of particular species. However, adult fe- hybridization was used to design primers that males of some Culex common in the eastern USA would further distinguish among the sibling taxa (Cx. pipiens Linnaeus, Cx. quinquefosciatus Say, Cx. pipiens and Cx. quinquefasciatus (Crabtree et Cx. nigripalpas Theobald, Cx. restuans Theobald, al. 1991): however, only Cx. pipiens-specific prim- and Cx. salinarius Coquillett) are difficult to distin- ers could be designed. Recently, a PCR assay that guish morphologically if specimens are worn or identifles Cx. pipiens, Cx. quinquefasciatus, and damaged during the trapping process. The correct their F, hybrids based on nucleotide sequence dif- identification of mosquito species is essential in de- ferences in the acetylcholinesterase gene Ace.2 has termining the roles of vector species and for the been developed (Aspen and Savage, personal com- development of effective arbovirus control and pre- munication). vention strategies. The appearance of West Nile virus (WN) in Flor- Polymerase chain reaction (PCR)-based assays ida and the isolation of WN from Cx. nigripalpus that use species-specific primers based on differ- during the sunnner of 2001 (CDC 2OO2) imposed ences in ribosomal DNA (rDNA) nucleotide se- the need to add Cx. nigripalpus to the list of taxa quence are useful in distinguishing among closely that can be distinguished by the assay of Crabtree related anopheline (Paskewitz and Collins 1990, et al. (1995). Within the eastern USA, Cx. nigri- Porter and Collins 1991, Scott et al. 1993, Townson palpus is found in the southernmost latitudes, and Onapa 1994, Cornel et al. 1996) and culicine where it may be collected along with Cx. restuans, (Crabtree et al. 1995, Toma et al. 2000) mosquito Cx. quinquefasciatus, and the morphologically srm- taxa. Ribosomal DNA makes an ideal template for ilar species Cx. salinarius. For this study, the ITS species-diagnostic PCR for at least 2 important rea- regions of Cx. nigripalpus were sequenced and sons. First, the high copy number of rDNA arrays compared with the ITS sequences from 7 other taxa 115 116 JounNar- oF THE AMERTcIN Mosquno CoNrnol AssocrATroN VoL. 19,No.2 lations of Culex used in this study. Taxa Geographic origin Source Culex pipiens complex Alleghany County, NC B. Harrison Los Angeles County, CA M. Madden Cx. pipiens Ft. Collins, CO H. Savage Queens, NY C. Apperson Cx. quinquejbsciatus Monroe, LA H. Savage Jefferson County, FL M. Godsey Cx. nigripalpus Jefferson County, FL M. Godsey Vero Beach, FL R. Rutledge Gainesville, FL J. Reinert Cx. restuans Burlington, VT H. Savage Alleghany County, NC B. Harrison Cx. salinarius Monroe, LA H. Savage Jefferson County, FL M. Godsey Cx. tarsalis Los Angeles County, CA M. Madden of Culex (Culex). Based upon the results of this coli strain XL-l Blue (Stratagene) by heat shock. comparison, species-specific PCR primers were de- Recombinant clones were selected on agar plates signed for the identification of Cx. nigripalpus. with tetracycline and ampicillin. Clones were se- quenced with 3 different primers in each direction (the 2 PCR primers, 2 plasmid primers, and 2 prim- MATERIALS AND METHODS ers complementary to the 5.8S gene) in an ABI Mosquitoes: The geographic origin and source Prism 377 sequencer (Applied Biosystems, Foster of each mosquito population used for this study are City, CA), by using the BigDye Terminator version given in Table 1. 3 reaction mix (Applied Biosystems). Mosquito genomic DNA prepararlon.' Mosquito Species-specffic PCR primer design: The rDNA genomic DNA was extracted by using the Qiagen nucleotide sequences of Cx. nigripalpus from the DNeasy Tissue Kit (Qiagen Inc., St. Clarita, CA) Jefferson County, FL, and Vero Beach, FL, speci- with the following modifications. Individual or mens were aligned with rDNA sequences from 49 pooled mosquitoes were ground in BA-l medium clones from 7 other taxa of Culexby using PILEUP (lX M199-H, 0.05 M Tris, pH 7.6, l%o bovine se- in the Wisconsin Package, ver. 7O.2 (Devereux et rum albumin, 0.35 g/liter of sodium bicarbonate, al. 1984). Other taxa included in the alignment 100 units/ml of penicillin, 100 pg/ml of strepto- were Cx. pipiens, Cx. quinquefasciatus, Cx. pi- mycin, 1 pg/ml of fungizone). The DNA was eluted piens-Cx, quinquefasciarus hybrids, Cx. restuans, twice in 200 pl of warm (40"C) nuclease-free water Cx, salinarius, Cx. tarsalis Coq. and Cx. erythro- (Amresco, Solon, OH) for a total eluate volume of thorax Dyar (Genbank acquisition numbers 400 pl. The DNA concentration was determined by u22114-U22144, U330r8, U33022-U33024, using the ultraviolet absorbance at 260-nm wave- U33030-U33A3D.A pairof PCRprimers comple- length on a spectrophotometer. mentary to Cx. nigripalpus-specific sequences in Cloning and sequencing.' A region of Cx. nigri- ITS I (primer N90l) and ITS 2 (primer NR1080) palpus rDNA (including part of the 18S gene, the was designed by using the PrimerSelect module of ITS 1, the 5.8S gene, the ITS 2, and part of the Lasergene version 5.03 (DNAStar, Inc., Madison, 28S gene) was amplified as described by Crabtree WI). The nucleotide sequences of these primers are et al. (1995). The PCR product was purified by us- included in Table 2. ing the Qiaquick PCR Purification Kit (Qiagen) and Species-diagnostic PCR: The species-diagnostic ligated into the plasmid pGEM-T Easy (Stratagene, PCR described by Crabtree et al. (1995) was mod- La Jolla. CA) before transformins the Escherichia ified as follows. Separate reaction mixtures, con- Table 2. Polymerase chain reaction primers, complementary to Culex rDNA, used for molecular identification. Amplicon Primer Sequence (5' to 3') Specificity Sense Pairswith size (bpr) CPI 6 GCGGGTACCATGCTTAAATTTAGGGGGTAConsensus Reverse Seebelow PQIO CCTATGTCCGCGTATACTA Culex pipiens complex Forward cPl6 698 R6 CCAAACACCGGTACCCAA Cx. restuans Forward cPl6 506 S2O TGAGAATACATACCACTGCT Cx. salinarius Forward CPI6 175 N9OI ATACCCATGCGAAAGCATAC Cx. nigripalpus Forward NRl080 404 NRIO8O GTACCGCGACCACACGACTT Cx. nigripalpus Reverse N90l 404 rbp, basepairs JUNE2003 PCR IopNrmcATroN oF CuzEX MoseurroEs ll9 698-bp amplicon resulting from a reaction contain- bers of the Cx. pipiens complex: Cx. pipiens, Cx. ing PQIO and CPl6 is diagnostic of members of quinquefasciatus, and their hybrids. Nucleotide se- the Cx. pipiens complex. When DNA from a mos- quence comparison among members of the Cx. pi- quito pool containing all 5 taxa was tested (Fig. 2), piens complex reveals insufficient fixed differences each of the diagnostic amplicons was observed. in the ITS I and ITS 2 regions to allow PCR prim- When DNA from each of the Cx. nigripalpus pop- ers to be designed that will distinguish among these ulations was tested with each of the non-Cx. nigri- mosquitoes. Recently, a PCR assay that identifies palpus-specific primers, no amplicon was observed Cx. pipiens, Cx. quinquefasciatus, and their F, hy- (not shown), indicating that no cross-reactions oc- brids based on nucleotide sequence differences in cur that could lead to false-positive identification. the acetylcholinesterase gene Ace.2 has been de- veloped (Aspen and Savage, personal communica- tion).
Load more

Recommended publications
  • Phenotypic Diversity in Culex Vishnui Theobald (Culicidae: Diptera)
    International Journal of Mosquito Research 2017; 4(4): 95-100 ISSN: 2348-5906 CODEN: IJMRK2 IJMR 2017; 4(4): 95-100 Phenotypic diversity in Culex vishnui Theobald © 2017 IJMR Received: 03-05-2017 (Culicidae: Diptera) Accepted: 04-06-2017 Monika Airi Monika Airi Assistant Professor, Department of Zoology, Sri Guru Granth Abstract Sahib World University, Samples of Culex vishnui Theobald randomly collected from different water bodies in Chandigarh and Fatehgarh Sahib, Punjab, India surrounding parts of Punjab and Haryana states reveal significant morphological differences which may be minor or quite apparent. These differences relate to the distribution and colouration of scales on different parts of body including head, legs and abdomen. The scales present on proboscis and maxillary palp are arranged in a few bands or some of them are scattered on general surface. Their colour varies from pale to dark brown. The shape of such bands on abdominal terga also varies from transverse to triangular bands. The male genitalia is also highly variable presenting difference in number of finger like processes on phallosome along with the length of mesal spine and sternal spine. Possible causes for the appearance of alternate phenotypes have been discussed. Keywords: Mosquito, Culex vishnui, taxonomy, Intraspecific variations. 1. Introduction Culex vishui Theobald 1901 belongs to subgenus Culex of Genus Culex. In India this genus is represented by seven subgenera i.e. Barraudius, Culex, Culiciomyia, Eumelanomyia, Lophoceraomyia, Oculeomyia and Maillotia [1]. Among these, the members of subgenus Culex are most dominant and are the vectors of various diseases like filariasis, elephantiasis and Japanese encephalitis [2, 3].
    [Show full text]
  • Data-Driven Identification of Potential Zika Virus Vectors Michelle V Evans1,2*, Tad a Dallas1,3, Barbara a Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8
    RESEARCH ARTICLE Data-driven identification of potential Zika virus vectors Michelle V Evans1,2*, Tad A Dallas1,3, Barbara A Han4, Courtney C Murdock1,2,5,6,7,8, John M Drake1,2,8 1Odum School of Ecology, University of Georgia, Athens, United States; 2Center for the Ecology of Infectious Diseases, University of Georgia, Athens, United States; 3Department of Environmental Science and Policy, University of California-Davis, Davis, United States; 4Cary Institute of Ecosystem Studies, Millbrook, United States; 5Department of Infectious Disease, University of Georgia, Athens, United States; 6Center for Tropical Emerging Global Diseases, University of Georgia, Athens, United States; 7Center for Vaccines and Immunology, University of Georgia, Athens, United States; 8River Basin Center, University of Georgia, Athens, United States Abstract Zika is an emerging virus whose rapid spread is of great public health concern. Knowledge about transmission remains incomplete, especially concerning potential transmission in geographic areas in which it has not yet been introduced. To identify unknown vectors of Zika, we developed a data-driven model linking vector species and the Zika virus via vector-virus trait combinations that confer a propensity toward associations in an ecological network connecting flaviviruses and their mosquito vectors. Our model predicts that thirty-five species may be able to transmit the virus, seven of which are found in the continental United States, including Culex quinquefasciatus and Cx. pipiens. We suggest that empirical studies prioritize these species to confirm predictions of vector competence, enabling the correct identification of populations at risk for transmission within the United States. *For correspondence: mvevans@ DOI: 10.7554/eLife.22053.001 uga.edu Competing interests: The authors declare that no competing interests exist.
    [Show full text]
  • Establishment of a Multiplex RT-PCR for the Sensitive and Differential Detection of Japanese Encephalitis Virus Genotype 1 and 3
    Journal of Bacteriology and Virology 2016. Vol. 46, No. 4 p.231 – 238 http://dx.doi.org/10.4167/jbv.2016.46.4.231 Original Article Establishment of a Multiplex RT-PCR for the Sensitive and Differential Detection of Japanese Encephalitis Virus Genotype 1 and 3 * Dong-Kun Yang , Ha-Hyun Kim, Hyun-Ye Jo, Sung-Suk Choi and In-Soo Cho Viral Disease Division, Animal and Plant Quarantine Agency, Gyeongsangbuk-do, Korea Japanese encephalitis (JE) is a zoonosis that affects the nervous system of humans and other animals. The genotype of JE virus (JEV) has shifted recently from genotype 3 (G3) to genotype 1 (G1) in Asia, including Korea. Thus, a rapid differential assay is required to make an accurate diagnosis of JEV genotype. In this study, we designed common and differential primer sets for JEV G1 and G3 to detect the JEV envelope (E) gene. The specific primer sets for JEV G1 and 1.0 2.0 2.0 G3 specifically amplified the target gene. The detection limits of the three primer sets were 10 , 10 , and 10 TCID50/ reaction, respectively. No cross-reactivity was detected with non-JEV reference viruses. The multiplex reverse transcription- polymerase chain reaction (RT-PCR) assay specifically differentiated JEV G1 from G3. Thus, a one-step multiplex RT-PCR assay was established to rapidly and differentially detect JEV. This assay will be useful for confirming JEV infections in animals and checking the JEV genotype in veterinary biological products. Key Words: Japanese encephalitis virus, Multiplex RT-PCR, Genotype infected mosquito bites. JE cases are traditionally identified INTRODUCTION in Asian countries, but 1.3% of blood donors in French Polynesia were seropositive for JEV between 2011 and 2013 Japanese encephalitis (JE) is a reemerging zoonosis (3), and JEV RNA was detected in C.
    [Show full text]
  • Host-Feeding Patterns of Culex Tritaeniorhynchus and Anopheles Sinensis (Diptera: Culicidae) in a Ricefield Agroecosystem
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Kanazawa University Repository for Academic Resources Host-feeding patterns of Culex tritaeniorhynchus and Anopheles sinensis (Diptera: Culicidae) in a ricefield agroecosystem. 著者 Mwandawiro Charles, Tsuda Yoshio, Tuno Nobuko, Higa Yukiko, Urakawa Emiko, Sugiyama Akira, Yanagi Tetsuo, Takagi Masahiro journal or Medical Entomology and Zoology = 衛生動物 publication title volume 50 number 3 page range 267-273 year 1999-09-15 URL http://hdl.handle.net/2297/12381 TRANSACTIONSOFTHEROYALSOCIETYOFTROPICALMEDICINEANDHYGIENE(2000)94,238-242 Heterogeneity in the host preference of Japanese encephalitis vectors in Chiang Mai, northern Thailand Charles Mwandawiro’ , Michael Boots’, Nobuko Tuna’ , Wannapa Suwonkerd’, Yoshio Tsuda’ and Masahiro Takagi’* ‘Department of Medical Entomology, Institute of Tropical Medicine, 1-12-4 Sakamoto, 852-8523 Nagasaki, Japan; 20fice of Vector Borne Diseases Control No. 2, 18 Boonruangrit Road, Muang District, Chiang Mai 50200 Thailand Abstract Experiments, using the capture-mark-release-recapture technique inside large nets, were carried out in Chiang Mai, northern Thailand, to examine heterogeneity in the host preference of Japanese encephalitis w) vectors. A significantly higher proportion of the vector species that were initially attracted to a cow fed when released into a net with a cow than when released into a net containing a pig. However, Culex vishnui individuals that had been attracted to a pig had a higher feeding rate in a net containing a pig rather than a cow. When mosquitoes were given a choice by being released into a net containing both animals, they exhibited a tendency to feed on the host to which they had originally been attracted.
    [Show full text]
  • Deciphering the Virome of Culex Vishnui Subgroup Mosquitoes, the Major Vectors of Japanese Encephalitis, in Japan
    viruses Article Deciphering the Virome of Culex vishnui Subgroup Mosquitoes, the Major Vectors of Japanese Encephalitis, in Japan Astri Nur Faizah 1,2 , Daisuke Kobayashi 2,3, Haruhiko Isawa 2,*, Michael Amoa-Bosompem 2,4, Katsunori Murota 2,5, Yukiko Higa 2, Kyoko Futami 6, Satoshi Shimada 7, Kyeong Soon Kim 8, Kentaro Itokawa 9, Mamoru Watanabe 2, Yoshio Tsuda 2, Noboru Minakawa 6, Kozue Miura 1, Kazuhiro Hirayama 1,* and Kyoko Sawabe 2 1 Laboratory of Veterinary Public Health, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan; [email protected] (A.N.F.); [email protected] (K.M.) 2 Department of Medical Entomology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan; [email protected] (D.K.); [email protected] (M.A.-B.); k.murota@affrc.go.jp (K.M.); [email protected] (Y.H.); [email protected] (M.W.); [email protected] (Y.T.); [email protected] (K.S.) 3 Department of Research Promotion, Japan Agency for Medical Research and Development, 20F Yomiuri Shimbun Bldg. 1-7-1 Otemachi, Chiyoda-ku, Tokyo 100-0004, Japan 4 Department of Environmental Parasitology, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113-8510, Japan 5 Kyushu Research Station, National Institute of Animal Health, NARO, 2702 Chuzan, Kagoshima 891-0105, Japan 6 Department of Vector Ecology and Environment, Institute of Tropical Medicine, Nagasaki University, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan; [email protected]
    [Show full text]
  • Biting Behavior of Malaysian Mosquitoes, Aedes Albopictus
    Asian Biomedicine Vol. 8 No. 3 June 2014; 315 - 321 DOI: 10.5372/1905-7415.0803.295 Original article Biting behavior of Malaysian mosquitoes, Aedes albopictus Skuse, Armigeres kesseli Ramalingam, Culex quinquefasciatus Say, and Culex vishnui Theobald obtained from urban residential areas in Kuala Lumpur Chee Dhang Chena, Han Lim Leeb, Koon Weng Laua, Abdul Ghani Abdullahb, Swee Beng Tanb, Ibrahim Sa’diyahb, Yusoff Norma-Rashida, Pei Fen Oha, Chi Kian Chanb, Mohd Sofian-Aziruna aInstitute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur 50603, bMedical Entomology Unit, WHO Collaborating Center for Vectors, Institute for Medical Research, Jalan Pahang, Kuala Lumpur 50588, Malaysia Background: There are several species of mosquitoes that readily attack people, and some are capable of transmitting microbial organisms that cause human diseases including dengue, malaria, and Japanese encephalitis. The mosquitoes of major concern in Malaysia belong to the genera Culex, Aedes, and Armigeres. Objective: To study the host-seeking behavior of four Malaysian mosquitoes commonly found in urban residential areas in Kuala Lumpur. Methods: The host-seeking behavior of Aedes albopictus, Armigeres kesseli, Culex quinquefasciatus, and Culex vishnui was conducted in four urban residential areas in Fletcher Road, Kampung Baru, Taman Melati, and University of Malaya student hostel. The mosquito biting frequency was determined by using a bare leg catch (BLC) technique throughout the day (24 hours). The study was triplicated for each site. Results: Biting activity of Ae. albopictus in urban residential areas in Kuala Lumpur was detected throughout the day, but the biting peaked between 0600–0900 and 1500–2000, and had low biting activity from late night until the next morning (2000–0500) with biting rate ≤1 mosquito/man/hour.
    [Show full text]
  • Culex Tritaeniorhynchus: an Assessment of Its Taxonomic Status
    J Vector Borne Dis 52, March 2015, pp. 40–51 Morphological and molecular characterization of the ecological, biological and behavioural variants of the JE vector Culex tritaeniorhynchus: An assessment of its taxonomic status A.R. Rajavel, N. Pradeep Kumar, R. Natarajan, P. Vanamail, A. Rathinakumar & P. Jambulingam Vector Control Research Centre (ICMR), Indira Nagar, Puducherry, India ABSTRACT Background & objectives: Culex tritaeniorhynchus (Diptera: Culicidae), an important vector of Japanese encephalitis belongs to the Culex vishnui subgroup which includes two other vector species namely, Cx. vishnui and Cx. pseudovishnui. Many varieties and types of Cx. tritaeniorhynchus have been reported, besides populations that exhibit behavioural and biological differences. This study was undertaken to find out whether Cx. tritaeniorhynchus populations exhibiting behavioural and biological variations, and those from different geographical areas, are comprised of more than one taxon or belong to a single taxon. Methods: Morphological characterization was done by examining 153 morphological and morphometric characters in the larval (75), pupal (60) and adult stages (18) of five geographical populations of Cx. tritaeniorhynchus. Molecular characterization was done by PCR amplification of mitochondrial cytochrome c oxidase (COI) gene sequences (DNA barcodes) and another hypervariable genetic marker, the ribosomal DNA (16S). One-way ANOVA, principal component analysis (PCA) and discriminant factor analysis (DFA) were done for statistical analyses using the statistical package SPSS IBM version 19.0. Results: Morphological characterization showed that no intraspecific differentiation can be made among the five geographical populations of Cx. tritaeniorhynchus. Molecular characterization done by DNA barcoding also showed that the COI sequences of all the five populations of Cx. tritaeniorhynchus grouped into a single taxonomic clade plus the genetic differentiation among these was non-significant and the overall gene flow among the populations was very high.
    [Show full text]
  • BCIL Vector Biology PDF.Pdf
    Vector Biology and Control An Update for Malaria Elimination Initiative in India Edited by Vas Dev M.Sc. (Hons.), Ph.D (Notre Dame), FNASc The National Academy of Sciences, India 2020 Vector Biology and Control: An Update for Malaria Elimination Initiative in India Edited by Vas Dev Contributors Sylvie Manguin, Vas Dev, Surya Kant Sharma, Rajpal Singh Yadav, Kamaraju Raghavendra, Poonam Sharma Velamuri, Vaishali Verma, Sreehari Uragayala, Susanta Kumar Ghosh, Khageswar Pradhan, Vijay Veer, Varun Tyagi, Manoj Kumar Das, Pradyumna Kishore Mohapatra, Ashwani Kumar, K. Hari Krishan Raju, Anupkumar Anvikar, Chazhoor John Babu, Virendra Kumar Dua, Tapan Kumar Barik, Usha Rani Acharya, Debojit Kumar Sarma, Dibya Ranjan Bhattacharyya, Anil Prakash, Nilanju Pran Sarmah Copyright © 2020 NASI Individual chapters of this book are open access under the terms of the Creative Commons Attribution 3.0 Licence (http://creativecommons.org/licenses/by/3.0) which permits users download, build upon published article, distribution, reproduction in any medium so long as the author(s) and publisher are properly credited. The author(s) have the right to reproduce their contribution in toto or part thereof for wider dissemination provided they explicitly identify the original source. All rights to the book are reserved by the National Academy of Sciences (NASI), India. The book as a whole (compilation) cannot be reproduced, distributed, or used for commercial purposes without NASI written permission. Enquiries concerning the use of the book be directed to NASI ([email protected]). Violations are liable to be prosecution under the governing Copyright law. Notice Statement and opinions expressed in the chapter are those of the contributor(s) and not necessarily those of the Editor or Publisher or the Organization.
    [Show full text]
  • TRIP REPORT Richard F. Darsie, Jr., Ph.D. and Shreedhar P. Pradhan
    Vector Biology & Control Proiect Telex 248812 (MSCi UR) 1611 North Kent Street, Suite 503 Cable MSCI Washington, D.C. Arlington, Virginia 22209 (703) 527-6500 & VECTOR BIOLOGY & CONTROL TRIP REPORT A VISIT TZ- USAID/NEPAL TO STUDY AND IDENTIFY CULICINE FAUNA NOVEMBER 1'i - DECEMBER 27, 1987 by Richard F. Darsie, Jr., Ph.D. and Shreedhar P. Pradhan, H.F.P. AR-061 Managed by Medical Service Corporation International under contract to the US. Ager.cy for International Development Authors Richard F. Darsie, Jr., Ph.D., is a Research Entomologist at The International Center for Public Health Research, University of South Carolina, McClellanville, South Carolina. Shreedhar P. Pradhan, H.F.P., is a Long-Term Malaria Advisor for USAID/Kathmandu. Acknowledgements Preparation of this document was sponsored by the Vector Biology & Control Project under Contract No. DPE-5948-C-00-5044­ 00 to Medical Service Corporation International, Arlington, Virginia, U.S.A., for the Agency for International Development, Office of Health, Bureau of Science and Technology. The authors are indebted to Dr. David Calder for his foresight in fostering the study and his encouragement, to Dr. K.M. Dixit, Chief, NMEO, and R.G. Baidya, Chief, Entomology Section, NMEO, for assigning the entomological team, K. Kadaka, H.P. Poudyal and N.P. Shrestha, for their assistance and diligence in searching for mosquitoes; to P. Xarna and A. Singh for providing accommodations for the study; to N.K. Gurung for assistance in the use of the piggeries, and to M. Chamlin for logistical support. TABLE OF CONTENTS I. INTRODUCTION 1 A.
    [Show full text]
  • A Synopsis of the Philippine Mosquitoes
    A SYNOPSIS OF THE PHILIPPINE MOSQUITOES Richard M. Bohart, Lieutenant Cjg), H(S), USER U. S. NAVAL MEDICAL RESEARCH UNIT # 2 NAVMED 580 \ L : .; Page 7 “&~< Key to‘ tie genera of Phil ippirremosquitoes ..,.............................. 3 ,,:._q$y&_.q_&-,$++~g‘ * Genus Anophek-~.................................................................... 6 , *fl&‘ - -<+:_?s!; -6 cienu,sl$&2g~s . ..*...*......**.*.~..**..*._ 24 _, ,~-:5fz.ggj‘ ..~..+*t~*..~ir~~...****...*..~*~...*.~-*~~‘ ,Gepw Topomyia ....................... &_ _,+g&$y? Gelius Zeugnomyia ................................................................ - _*,:-r-* 2 .. y.,“yg-T??5 rt3agomvia............................................................... <*gf-:$*$ . ..*......*.......................................*.....*.. Genus Hodgesia. ..*..........................................**.*...* * us Uranotaenia . ..*.*................ rrr.....................*.*_ _ _ Genus &thopodomyia . ...*.... Genus Ficalbia, ..................................................................... Mansonia ................................................................... Geng Aedeomyia .................................................................. Genus Heizmannia ................................................................ Genus Armigeres ................................................................. Genus Aedes ........................................................................ Genus Culex . ...*.....*.. 82, _. 2 y-_:,*~ Literat6iZZted. ...*........................*....=.. I . i-I-I
    [Show full text]
  • Establishment of Culex Modestus in Belgium and a Glance Into the Virome of Belgian
    bioRxiv preprint doi: https://doi.org/10.1101/2020.11.27.401372; this version posted February 22, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Establishment of Culex modestus in Belgium and a glance into the virome of Belgian 2 mosquito species 3 4 Lanjiao Wanga*, Ana Lucia Rosales Rosasa*, Lander De Coninck b, Chenyan Shi b, Johanna 5 Bouckaerta, Jelle Matthijnssens b, Leen Delanga# 6 aKU Leuven Department of Microbiology, Immunology and Transplantation, Rega Institute for Medical Research, Laboratory of Virology and Chemotherapy, Leuven, Belgium. bLaboratory of Viral Metagenomics, Rega Institute for Medical Research, KU Leuven, Leuven, Belgium. 7 Running Head: Establishment of Culex modestus in Belgium 8 *Lanjiao Wang and Ana Lucia Rosales Rosas contributed equally to this work. # Address correspondence to Prof. Leen Delang, [email protected] 9 10 Abstract: 11 Culex modestus mosquitoes are known transmission vectors of West Nile virus and Usutu 12 virus. Their presence has been reported across several European countries, including only 13 one larva confirmed in Belgium in 2018. Mosquitoes were collected in the city of Leuven 14 and surroundings in the summer of 2019 and 2020. Species identification was performed 15 based on morphological features and partial sequences of the mitochondrial cytochrome 16 oxidase subunit 1 (COI) gene. The 107 mosquitoes collected in 2019 belonged to eight 17 mosquito species: Cx. pipiens (24.3%), Cx.
    [Show full text]
  • Detection of the Japanese Encephalitis Vector Mosquito Culex Tritaeniorhynchus in Australia Using Molecular Diagnostics and Morphology Bryan D
    Lessard et al. Parasites Vectors (2021) 14:411 https://doi.org/10.1186/s13071-021-04911-2 Parasites & Vectors RESEARCH Open Access Detection of the Japanese encephalitis vector mosquito Culex tritaeniorhynchus in Australia using molecular diagnostics and morphology Bryan D. Lessard1* , Nina Kurucz2, Juanita Rodriguez1, Jane Carter2 and Christopher M. Hardy3 Abstract Background: Culex (Culex) tritaeniorhynchus is an important vector of Japanese encephalitis virus (JEV) afecting feral pigs, native mammals and humans. The mosquito species is widely distributed throughout Southeast Asia, Africa and Europe, and thought to be absent in Australia. Methods: In February and May, 2020 the Medical Entomology unit of the Northern Territory (NT) Top End Health Service collected Cx. tritaeniorhynchus female specimens (n 19) from the Darwin and Katherine regions. Specimens were preliminarily identifed morphologically as the Vishnui =subgroup in subgenus Culex. Molecular identifcation was performed using cytochrome c oxidase subunit 1 (COI) barcoding, including sequence percentage identity using BLAST and tree-based identifcation using maximum likelihood analysis in the IQ-TREE software package. Once identi- fed using COI, specimens were reanalysed for diagnostic morphological characters to inform a new taxonomic key to related species from the NT. Results: Sequence percentage analysis of COI revealed that specimens from the NT shared 99.7% nucleotide identity to a haplotype of Cx. tritaeniorhynchus from Dili, Timor-Leste. The phylogenetic analysis showed that the NT specimens formed a monophyletic clade with other Cx. tritaeniorhynchus from Southeast Asia and the Middle East. We provide COI barcodes for most NT species from the Vishnui subgroup to aid future identifcations, including the frst genetic sequences for Culex (Culex) crinicauda and the undescribed species Culex (Culex) sp.
    [Show full text]