Journal of the American Mosquito Control Association, l9(2):ll5-120,20O3 Copyright @ 2003 by the American Mosquito Control Association, Inc. POLYMERASE CHAIN REACTION ASSAY IDENTIFIES CULEX NIGRIPALPUS: PART OF AN ASSAY FOR MOLECULAR IDENTIFICATION OF THE COMMON CULEX (CULEN MOSQUITOES OF THE EASTERN UNITED STATES STEPHEN ASPEN, MARY B. CRABTREE AND HARRY M. SAVAGE Division of Vector-Borne Infectious Disease, Centers for Disease Control and Prevention, Fort Collins, CO 80522 ABSTRACT, Nucleotide sequence information on intemal transcribed spacer (ITS) 1 and ITS 2 regions of the nuclear ribosomal DNA multigene family was used to develop a polymerase chain reaction assay that identifies Culer nigripeilpas Theobald. The assay uses species-specific forward and reverse primers for C.x. nigripalpus and can be used along with previously described primers to distinguish among 4 common taxa of Culex (Culex) of the eastern USA with a single thermal cycler program. The assay distinguishes among the 4 taxa Cx. nigripalpus, Cx. restuans Theobald, Cx. salinarius Coquillett, and members of the Cx. pipiens Linnaeus complex. This assay may be used to verify the morphological identification of individual specimens of Culex or to confirm the species composition of mosquito pools. KEY WORDS Culex (Culex), Culex nigripalpzs, internal transcribed spacers, ribosomal DNA, molecular species identification INTRODUCTION within the adult mosquito genome (in Aedes aegyp- ri see Park and Fallon [l990l) means that a small In North America, mosquitoes of the subgenus fraction of extracted DNA supplies a sufficient tem- Culex (Culex) are the primary enzootic vectors of plate for PCR. Second, rDNA contains highly con- West Nile virus (Nasci et al. 2001b) and the pri- served coding regions, ideal as annealing sites for mary enzootic and epidemic vectors of St. Louis sequencing primers, separated by less conserved encephalitis virus (Mitchell et al. 1980). Adult fe- spacers, which are the source of interspecific se- males of these mosquitoes are frequently collected quence variation. in gravid traps (Reiter 1983), Cor-baited Centers Crabtree et al. (1995) describe a PCR assay for for Disease Control light traps, or with aspirators the identiflcation of Cx. restuans, Cx. salinarius, part (Nasci as of arbovirus surveillance programs and members of the C-r. pipiens complex. This as- et al. 2001a), blood host studies (Apperson et al. say makes use of interspecific nucleotide sequence 2OO2), or other mosquito investigations. Morpho- differences in the noncoding internal transcribed logical characters are used to identify specimens spacers (ITS) I and ITS 2 of rDNA. Different PCR and sort field-collected mosquitoes into species primers anneal to taxon-specific ITS sequences, pools. Mosquito pools can be tested for virus as producing a uniquely sized amplicon in the pres- part of surveillance programs and to assess the vec- ence of the appropriate template DNA. Subtractive tor status of particular species. However, adult fe- hybridization was used to design primers that males of some Culex common in the eastern USA would further distinguish among the sibling taxa (Cx. pipiens Linnaeus, Cx. quinquefosciatus Say, Cx. pipiens and Cx. quinquefasciatus (Crabtree et Cx. nigripalpas Theobald, Cx. restuans Theobald, al. 1991): however, only Cx. pipiens-specific prim- and Cx. salinarius Coquillett) are difficult to distin- ers could be designed. Recently, a PCR assay that guish morphologically if specimens are worn or identifles Cx. pipiens, Cx. quinquefasciatus, and damaged during the trapping process. The correct their F, hybrids based on nucleotide sequence dif- identification of mosquito species is essential in de- ferences in the acetylcholinesterase gene Ace.2 has termining the roles of vector species and for the been developed (Aspen and Savage, personal com- development of effective arbovirus control and pre- munication). vention strategies. The appearance of West Nile virus (WN) in Flor- Polymerase chain reaction (PCR)-based assays ida and the isolation of WN from Cx. nigripalpus that use species-specific primers based on differ- during the sunnner of 2001 (CDC 2OO2) imposed ences in ribosomal DNA (rDNA) nucleotide se- the need to add Cx. nigripalpus to the list of taxa quence are useful in distinguishing among closely that can be distinguished by the assay of Crabtree related anopheline (Paskewitz and Collins 1990, et al. (1995). Within the eastern USA, Cx. nigri- Porter and Collins 1991, Scott et al. 1993, Townson palpus is found in the southernmost latitudes, and Onapa 1994, Cornel et al. 1996) and culicine where it may be collected along with Cx. restuans, (Crabtree et al. 1995, Toma et al. 2000) mosquito Cx. quinquefasciatus, and the morphologically srm- taxa. Ribosomal DNA makes an ideal template for ilar species Cx. salinarius. For this study, the ITS species-diagnostic PCR for at least 2 important rea- regions of Cx. nigripalpus were sequenced and sons. First, the high copy number of rDNA arrays compared with the ITS sequences from 7 other taxa 115 116 JounNar- oF THE AMERTcIN Mosquno CoNrnol AssocrATroN VoL. 19,No.2 lations of Culex used in this study. Taxa Geographic origin Source Culex pipiens complex Alleghany County, NC B. Harrison Los Angeles County, CA M. Madden Cx. pipiens Ft. Collins, CO H. Savage Queens, NY C. Apperson Cx. quinquejbsciatus Monroe, LA H. Savage Jefferson County, FL M. Godsey Cx. nigripalpus Jefferson County, FL M. Godsey Vero Beach, FL R. Rutledge Gainesville, FL J. Reinert Cx. restuans Burlington, VT H. Savage Alleghany County, NC B. Harrison Cx. salinarius Monroe, LA H. Savage Jefferson County, FL M. Godsey Cx. tarsalis Los Angeles County, CA M. Madden of Culex (Culex). Based upon the results of this coli strain XL-l Blue (Stratagene) by heat shock. comparison, species-specific PCR primers were de- Recombinant clones were selected on agar plates signed for the identification of Cx. nigripalpus. with tetracycline and ampicillin. Clones were se- quenced with 3 different primers in each direction (the 2 PCR primers, 2 plasmid primers, and 2 prim- MATERIALS AND METHODS ers complementary to the 5.8S gene) in an ABI Mosquitoes: The geographic origin and source Prism 377 sequencer (Applied Biosystems, Foster of each mosquito population used for this study are City, CA), by using the BigDye Terminator version given in Table 1. 3 reaction mix (Applied Biosystems). Mosquito genomic DNA prepararlon.' Mosquito Species-specffic PCR primer design: The rDNA genomic DNA was extracted by using the Qiagen nucleotide sequences of Cx. nigripalpus from the DNeasy Tissue Kit (Qiagen Inc., St. Clarita, CA) Jefferson County, FL, and Vero Beach, FL, speci- with the following modifications. Individual or mens were aligned with rDNA sequences from 49 pooled mosquitoes were ground in BA-l medium clones from 7 other taxa of Culexby using PILEUP (lX M199-H, 0.05 M Tris, pH 7.6, l%o bovine se- in the Wisconsin Package, ver. 7O.2 (Devereux et rum albumin, 0.35 g/liter of sodium bicarbonate, al. 1984). Other taxa included in the alignment 100 units/ml of penicillin, 100 pg/ml of strepto- were Cx. pipiens, Cx. quinquefasciatus, Cx. pi- mycin, 1 pg/ml of fungizone). The DNA was eluted piens-Cx, quinquefasciarus hybrids, Cx. restuans, twice in 200 pl of warm (40"C) nuclease-free water Cx, salinarius, Cx. tarsalis Coq. and Cx. erythro- (Amresco, Solon, OH) for a total eluate volume of thorax Dyar (Genbank acquisition numbers 400 pl. The DNA concentration was determined by u22114-U22144, U330r8, U33022-U33024, using the ultraviolet absorbance at 260-nm wave- U33030-U33A3D.A pairof PCRprimers comple- length on a spectrophotometer. mentary to Cx. nigripalpus-specific sequences in Cloning and sequencing.' A region of Cx. nigri- ITS I (primer N90l) and ITS 2 (primer NR1080) palpus rDNA (including part of the 18S gene, the was designed by using the PrimerSelect module of ITS 1, the 5.8S gene, the ITS 2, and part of the Lasergene version 5.03 (DNAStar, Inc., Madison, 28S gene) was amplified as described by Crabtree WI). The nucleotide sequences of these primers are et al. (1995). The PCR product was purified by us- included in Table 2. ing the Qiaquick PCR Purification Kit (Qiagen) and Species-diagnostic PCR: The species-diagnostic ligated into the plasmid pGEM-T Easy (Stratagene, PCR described by Crabtree et al. (1995) was mod- La Jolla. CA) before transformins the Escherichia ified as follows. Separate reaction mixtures, con- Table 2. Polymerase chain reaction primers, complementary to Culex rDNA, used for molecular identification. Amplicon Primer Sequence (5' to 3') Specificity Sense Pairswith size (bpr) CPI 6 GCGGGTACCATGCTTAAATTTAGGGGGTAConsensus Reverse Seebelow PQIO CCTATGTCCGCGTATACTA Culex pipiens complex Forward cPl6 698 R6 CCAAACACCGGTACCCAA Cx. restuans Forward cPl6 506 S2O TGAGAATACATACCACTGCT Cx. salinarius Forward CPI6 175 N9OI ATACCCATGCGAAAGCATAC Cx. nigripalpus Forward NRl080 404 NRIO8O GTACCGCGACCACACGACTT Cx. nigripalpus Reverse N90l 404 rbp, basepairs JUNE2003 PCR IopNrmcATroN oF CuzEX MoseurroEs ll9 698-bp amplicon resulting from a reaction contain- bers of the Cx. pipiens complex: Cx. pipiens, Cx. ing PQIO and CPl6 is diagnostic of members of quinquefasciatus, and their hybrids. Nucleotide se- the Cx. pipiens complex. When DNA from a mos- quence comparison among members of the Cx. pi- quito pool containing all 5 taxa was tested (Fig. 2), piens complex reveals insufficient fixed differences each of the diagnostic amplicons was observed. in the ITS I and ITS 2 regions to allow PCR prim- When DNA from each of the Cx. nigripalpus pop- ers to be designed that will distinguish among these ulations was tested with each of the non-Cx. nigri- mosquitoes. Recently, a PCR assay that identifies palpus-specific primers, no amplicon was observed Cx. pipiens, Cx. quinquefasciatus, and their F, hy- (not shown), indicating that no cross-reactions oc- brids based on nucleotide sequence differences in cur that could lead to false-positive identification. the acetylcholinesterase gene Ace.2 has been de- veloped (Aspen and Savage, personal communica- tion).