US009351507 B2
(12) United States Patent (10) Patent No.: US 9,351,507 B2 Zaplin et al. (45) Date of Patent: May 31, 2016
(54) METHOD OF PREPARING FOOD USING 7,045,326 B2 5, 2006 Cases et al. RCE OL 7,109,392 B1 9/2006 Broglie et al. 7,135,617 B2 11/2006 Lardizabal et al. 7,244,599 B2 7/2007 Tanner et al. (71) Applicants: Ella Zaplin, Wagga Wagga (AU); 7,417, 176 B2 8/2008 Lardizabal et al. Sadequr Rahman, Nicholls (AU); 7,521,593 B2 4/2009 Regina et al. Zhongyi Li, Kaleen (AU); Qing Liu, 7,589,253 B2 9, 2009 Green et al. Girralang (AU); Surinder Pal Singh, 7,619, 105 B2 11/2009 Green et al. 7,667,114 B2 2/2010 Morell et al. Downer (AU); Robert Charles de 7,700,139 B2 4/2010 Bird et al. Feyter, Monash (AU) 7,700,826 B2 4/2010 Morell et al. 7,741,532 B2 6/2010 Lardizabal et al. (72) Inventors: Ella Zaplin, Wagga Wagga (AU); 7,790,955 B2 9/2010 Li et al. Sadequr Rahman, Nicholls (AU); 7,807,849 B2 10/2010 Singh et al. 7,812,221 B2 10/2010 Morell et al. Zhongyi Li, Kaleen (AU); Qing Liu, 7,834,248 B2 11/2010 Green et al. Girralang (AU); Surinder Pal Singh, 7,834,250 B2 11/2010 Singh et al. Downer (AU); Robert Charles de 7,888.499 B2 2/2011 Morell et al. Feyter, Monash (AU) 7,892,803 B2 2/2011 Tanner et al. 7.919, 132 B2 4/2011 Regina et al. 7,932.438 B2 4/2011 Singh et al. (73) Assignee: COMMONWEALTH SCIENTIFIC 7,932.440 B2 4/2011 Reid et al. AND INDUSTRIAL RESEARCH 7.993,686 B2 8, 2011 Bird et al. ORGANISATION, Campbell (AU) 8,049,069 B2 11/2011 Wu et al. 8,071,341 B2 12/2011 Singh et al. (*) Notice: Subject to any disclaimer, the term of this 8, 106,226 B2 1/2012 Singh et al. patent is extended or adjusted under 35 8, 115,087 B2 2/2012 Regina et al. 8, 158,392 B1 4/2012 Singh et al. U.S.C. 154(b) by 187 days. 8, 178,759 B2 5, 2012 Morell et al. 8, 188,336 B2 5, 2012 Li et al. (21) Appl. No.: 14/021,173 8,269,082 B2 9/2012 Millar et al. 8,288,572 B2 10/2012 Singh et al. (22) Filed: Sep. 9, 2013 8,501,262 B2 8, 2013 Bird et al. 8,530,724 B2 9, 2013 Whitelaw et al. (65) Prior Publication Data 8,535,917 B2 9/2013 Singh et al. 8,716,555 B2 5, 2014 Liu et al. US 2014/O12O225A1 May 1, 2014 8,735,111 B2 5, 2014 Vanhercke et al. 8,809,026 B2 8/2014 Vanhercke et al. 8,921,652 B2 12/2014 Liu et al. Related U.S. Application Data 9,057,075 B2 6, 2015 Liu et al. (62) Division of application No. 12/309.276, filed as (Continued) application No. PCT/AU2007/000977 on Jul. 13, 2007. FOREIGN PATENT DOCUMENTS (30) Foreign Application Priority Data EP 1806398 7/2007 EP 1837397 9, 2007 Jul. 14, 2006 (AU) ...... 2OO6903810 (Continued)
(51) Int. Cl. OTHER PUBLICATIONS CI2N 15/82 (2006.01) A2.3L I/OI (2006.01) Greenwell et al. (2010) “Placing microalgae on the biofuels priority A23D 9/00 (2006.01) list: a review of the technological challenges' J. R. Soc. Interface CIIB I/O (2006.01) 7:7O3-726. (52) U.S. Cl. CPC ...... A23L I/0107 (2013.01); A23D 9/00 (Continued) (2013.01); CIIB I/10 (2013.01); C12N 15/8218 (2013.01); C12N 15/8247 (2013.01) (58) Field of Classification Search Primary Examiner — Elizabeth McElwain None (74) Attorney, Agent, or Firm — John P. White; Gary J. See application file for complete search history. Gershik; Cooper & Dunham LLP (56) References Cited (57) ABSTRACT U.S. PATENT DOCUMENTS The present invention relates to methods of preparing food 4,948,811 A 8/1990 Spinner et al. using rice oil which has increased levels of oleic acid and 5,500,361 A 3/1996 Kinney et al. 6,100,077 A 8/2000 Sturley et al. decreased palmitic and linoleic acids, for increased Stability 6,344.548 B1 2/2002 Farese et al. to oxidation and health benefits. 6,432,684 B1 8/2002 Mukerji et al. 6,998,516 B2 2/2006 Brar et al. 7,001,771 B1 2/2006 Morell et al. 7 Claims, 38 Drawing Sheets US 9,351,507 B2 Page 2
(56) References Cited Jain et al., (2000) “Enhancement of seed oil content by expression of glycerol-3-phosphate acyltransferase genes' Biochemical Society U.S. PATENT DOCUMENTS Transactions 28(6): 958-961. Jako et al., Seed-Specific Over-Expression of an Arabidopsis cDNA 2002/0104124 A1 8, 2002 Green et al. Encoding a Diacylglycerol Acyltransferase Enhances Seed Oil Con 2004/0221335 A1 11/2004 Shewmaker et al. tent and Seed Weight. Plant Physiology, 2001, 126:861-874. 2005/01066.97 A1 5, 2005 Cases et al. 2005, O262.588 A1 11/2005 Dehesh et al. James et al (2010) “Disruption of the Arabidopsis CGI-58 2006.0053512 A1 3, 2006 Bao et al. homologue produces Chanarin-Dorfman-like lipid droplet accumu 2006/0094.088 A1 5/2006 Picataggio et al. lation in plants.” 107(41):17832-17838 and supporting information 2006/0206963 A1 9, 2006 Voelker et al. pp. 1-3. 2008/0268539 A1 10/2008 Singh et al. Kargiotidou et al., (2008) “Low temperature and light regulate delta 2008/0311580 A1 12/2008 Abrahams et al. 12 fatty acid desaturases (FAD2) at a transcriptional level in cotton 2009 OO61492 A1 3/2009 Benning et al. (Gossypiumhirsutum)” Journal of Experimental Botany 2008 59(8): 2009,0308041 A1 12/2009 Whitelaw et al. 2043-2056. 2010, O184130 A1 7/2010 Koprowski et al. Karmakar et al. (2010) “Properties of various plants and animals 2010, 0221400 A1 9/2010 Chapman et al. feedstocks for biodiesel production” Bioresource Technology 2011 OO15415 A1 1/2011 Singh et al. 101:72O1-7210. 2011/0045127 A1 2/2011 Ralet al. Kelly et al. (2012) “Suppression of the Sugar-DEPENDENT1 2011/0054198 A1 3/2011 Singh et al. 2011/O190521 A1 8/2011 Damcevski et al. triacylglycerol lipase family during seed development enhances oil 2011/02O1065 A1 8/2011 Singh et al. yield in oilseed rape (Brassica napus L.) Plant Biotechnology Jour 2011/0218348 A1 9, 2011 Zhou et al. nal, pp. 1-7. 2011/02233.11 A1 9, 2011 Liu et al. Kelly et al., (2011) “Seed Storage Oil Mobilization Is Important But 2011/0229623 A1 9, 2011 Liu et al. Not Essential for Germination or Seedling Establishment in 2011/0281.818 A1 11/2011 Jenkins et al. Arabidopsis' Plant Physiology, vol. 157, pp. 866-875. 2011/0314725 A1 12/2011 Petrie et al. Kozell et al. (1996) "Optimizing expression of transgenes with an 2012fOO16144 A1 1/2012 Petrie et al. emphasis on post-transcriptional events.” Plant Molecular Biology, 2012/0041218 A1 2/2012 Singh et al. 32:393-405. 2012/0114770 A1 5/2012 Regina et al. Lardizabal et al. (2001) “DGAT2 Is a New Diacylglycerol 2012/0129805 A1 5, 2012 Li et al. Acyltransferase Gene Family” J. Biol. Chem. 276:38862-38869. 2012/0208198 A1 8/2012 Bogs et al. 2013, O115362 A1 5/2013 Regina et al. Lardizabal et al. (2008) “Expression of Umbellopsis ramanniana 2013,0164.798 A1 6, 2013 Vanhercke et al. DGAT2A in Seed Increases Oil in Soybean” Plant Physiol. 148: 2013,0247451 A1 9, 2013 Vanhercke et al. 89-96. 2014/0256006 A1 9, 2014 Vanhercke et al. Liu etal. (2010) “Producing biodiesel from high free fatty acids waste 2015,0176017 A1 6/2015 Liu et al. cooking oil assisted by radio frequency heating” Fuel 89:2735-2740. Liu et al., Genetic modification of cotton seed oil using inverted FOREIGN PATENT DOCUMENTS repeat gene-silencing techniques. Biochemical Society Transations, 2000, 28(6):927-929. EP 1944375 T 2008 Liu et al., (1999) “Cloning and Sequence Analysis of a Novel Mem WO WO98,55631 12/1998 ber (Accession No. Y 101 12) of the Microsomal w-6 Fatty Acid WO WO99/49050 9, 1999 Desaturase Family from Cotton” Plant Physiol. (PGR 99-063) WO WO99.67268 12/1999 120:339. WO WO99,67403 12/1999 Luetal. (2011) “New frontiers in oilseed biotechnology: meeting the WO WOOO/O1713 1, 2000 global demand for vegetable oils for food, feed, biofuel, and indus WO WOOOf 11176 3, 2000 trial applications' Current Opinion in Biotechnology, 22:252-259. WO WOOO,32756 6, 2000 WO WOOO,32793 6, 2000 Maher and Bressler (2007) “Pyrolysis of triglyceride materials for WO WOOO,361.14 6, 2000 the production of renewable fuels and chemicals' Bioresource Tech WO WOOOf 60.095 10, 2000 nology 98:2351-2368. WO WOOOf 66750 10, 2000 O'Brien, (2002) Cottonseed Oil. In: F.D. Gunstone (Ed.) Vegetable WO WOOOf 66749 11, 2000 Oils in Food Technology: Composition, Properties and Uses. WO WOO3,O78639 9, 2003 Blackwell Publishing, Oxford, pp. 203-223. WO WO 03/080802 10, 2003 Okuley et al. Arabidopsis FAD2 Gene Encodes the Enzyme that is WO WO 04/001001 12/2003 Essential for Polyunsaturated Lipid Synthesis. Plant Cell, 1994, WO WO 2004/O11671 2, 2004 6:147-158. WO WO 2005/003322 1, 2005 Parthibane etal. (2012) "Oleosin Isa Bifunctional Enzyme That Has WO WO 2005/063988 7/2005 Both Monoacylglycerol Acyltransferase and Phospholipase Activi WO WO 2005,103253 11, 2005 ties J. Biol. Chem. 287: 1946-19541. WO WO 2007/103.738 9, 2007 WO WO 2008/O25068 6, 2008 Perez-Vich et al. (1998) “Determination of Seed Oil Content and WO WO 2008/130248 10, 2008 Fatty Acid Composition in Sunflower Through the Analysis of Intact WO WO 2008/157226 12/2008 Seeds, Husked Seeds, Meal and Oil by Near-Infrared Reflectance WO WO 2008, 157827 12/2008 Spectroscopy” JAOCS 75:547-555. WO WO 2009/027335 3, 2009 Petrie et al. (2012) “Recruiting a New Substrate for Triacylglycerol WO WO 2009/129582 10/2009 Synthesis in Plants: The Monoacylglycerol Acyltransferase Path WO WO 2009/143397 11, 2009 way”. PLoS ONE 7:e35214. WO WO 2010/OO9499 1, 2010 Pirtle et al., (2001) "Molecular cloning and functional expression of WO WO 2010/009:500 1, 2010 the gene for a cotton V-12 fatty acid desaturase (FAD2)” Biochim. WO WO 2010/057246 5, 2010 Biophys, Acta 1522: 122-129. WO WO 2012/OOOO26 1, 2012 Pokharkar et al., (2008) "Synthesis and Characterizationof Fatty Acid Methyl Ester by In-Situ Transesterification in Capparis OTHER PUBLICATIONS Deciduas Seed' Leonardo Electronic Journal of Practices and Tech nologies 13:12-18. Hutchins et al., (1968) “A New Process for the Selective Hydroge Rajasekharan et al., (2006) "Monoacylglycerol as an intermediate in nation Cyclopropenoids in Cottonseed Oil' Journal of American Oil triacylglycerol biosynthesis in plants' International Symposium on Chemists Society 45: 397-399. Plant Lipids, Abstract. US 9,351,507 B2 Page 3
(56) References Cited Xu et al., (2005) “Mutation of the TGD1 Chloroplast Envelope Pro tein Affects Phosphatidate Metabolism in Arabidopsis' The Plant OTHER PUBLICATIONS Cell, vol. 17, 3094-3 110. Xu et al., (2010) “Lipid Transport Mediated by Arabidopsis TGD Roston et al., (2012) “TGD1, -2, and -3 Proteins Involved in Lipid Proteins is Unidirectional from the Endoplasmic Reticulum to the Trafficking Form ATP-binding Cassette (ABC) Transporter with Plastid’ Plant Cell Physiol, 51(6): 1019-1028. Multiple Substrate-binding Proteins' The Journal of Biological Yang et al. (2010) “A distinct type of glycerol-3-phosphate Chemistry vol. 287, No. 25, pp. 21406-21415. acyltransferase with Sn-2 preference and phosphatase activity pro Sanjaya et al. (2011) “Increasing the energy density of vegetative ducing 2-monoacylglycerol” PNAS 107: 12040-12045. tissues by diverting carbon from starch to oil biosynthesis in Yang & Ohlrogge (2009) "Turnover of Fatty Acids during Natural transgenic Arabidopsis' Plant Biotech. J.9:874-883. Senescence of Arabidopsis, Bracnypodium, and Switchgrass and in Sanjaya et al (2013) “Altered Lipid Composition and Enhanced Arabidopsis b-Oxidation Mutants' Plant Physiology, 150, 1981 Nutritional Value of Arabidopsis Leaves following Introduction of an 1989. Algal Diacylglycerol Acyltransferase 2' Plant Cell, 1-17. Yen et al., Identification of a gene encoding MGAT1, a Semwal et al. (2011) “Biodiesel production using heterogeneous monoacylglycerol acyltransferase. PNAS, 2002, 99(13):8512-8517. catalysts’ Bioresource Technology 102:2151-2161. Liu et al., (2005) GenBank Accession No. AY574036. Sheikh etal (2002)“Fatty Acids Composition in Germinating Cotton Liu et al., (2005) GenBank Accession No. AY574037. Seedlings Affected by High Temperature Stress' Pakistan Journal of Liu et al., (2005) GenBank Accession No. AY574038. Applied Sciences 2:1 p. 97-99. Sasaki et al., (2002) GenBank Accession No. BAC45173.1. Shenstone and Vickery, (1961) “Occurrence of Cyclo-Propene Acids Sasaki et al., (2002) GenBank Accession No. BAC45170.1. in Some Plants of the Order Malvales’ Nature 190: 68-169. Feb. 21, 2014 Office Action, issued in connection with Canadian Shiina et al. (1997)“Identification of Promoter Elements Involved in Patent Application No. 2,693,630. Cytosolic Ca2+-Mediated Photoregulation of Maize cab-ml Expres Aug. 21, 2014 Response, filed in connection with Canadian Patent sion” Plant Physiol. 115:477-483. Application No. 2,693,630. Singh et al. (2012) 'Accumulating Triacylglycerol in leaves via the Nov. 15, 2013 Office Action, issued in connection with Australian Monoacylglycerol Acyltransferase Pathway' 20th International Patent Application No. 2007272316. Symposium on Plant Lipids. Dec. 6, 2013 Response, filed in connection with Australian Patent Smith et al. (2000) "Total silencing by intron-spliced hairpin RNAs.” Application No. 2007272316. Nature 407:319-320. International Preliminary Report on Patentability issued on Jan. 14. Slocombe etal (2009)"Oil accumulation in leaves directed by modi fication of fatty acid breakdown and lipid synthesis pathways' Plant 2009 in connection with PCT International Patent Application No. Biotechnology Journal, 7, 694-703. PCT/AU2007/OOO977. Srinivasan et al. (2007) “Heterologous expression of the BABY International Search Report issued on Sep. 8, 2009 in Connection BOOM AP2/ERF transcription factor enhances the regeneration with International Application No. PCT/AU2009/000929. capacity of tobacco (Nicotiana tabacum L.)" Planta 225:341-51. Written Opinion of the International Search Authority, issued on Sep. Stalberg et al., (1993) "Deletion Analysis of a 2S Seed Storage 8, 2009 in Connection with International Application No. PCT/ Protein Promoter of Brassica napes in Transgenic Tobacco.” Plant AU2009,000929. Molecular Biology, 23(4): 671-683. International Search Report issued on Sep. 8, 2009 by the Interna Takeyama, H., et al., (1997) “Expression of the Eicosapentaenoic tional Searching Authority (ISA/US) in connection with Interna Acid Synthesis Gene Cluster From Shewanella sp. in a Transgenic tional Application No. PCT/AU2006/000930. Marine Cyanobacterium, Synechococcus sp.” Microbiology, 143(Pt Written Opinion issued on Aug. 18, 2009 by the International Search 8): 2725-2731. ing Authority (ISA/US) in connection with International Application To et al., (2012) “WRINKLED Transcription Factors Orchestrate No. PCTAU2006,000930. Tissue-Specific Regulation of Fatty Acid Biosynthesis in Dec. 9, 2013 Response, filed in connection with U.S. Appl. No. Arabidopsis” The Plant Cell, vol. 24: 5007-5023. 13/011,779. Vanhercke et al. (2012) “Maximizing lipid accumulation in vegeta Dec. 20, 2013 Notice of Allowance, including Examiner Interview tive plant tissues' 8th International Symposium on Biocatalysis and Summary, issued in connection with U.S. Appl. No. 13/011,773. Agricultural Biotechnology. Apr. 16, 2013 Chinese Notice of Rejection, issued in connection with Vanhercke et al. (2013) “Synergistic effect of WRI1 and DGAT1 Chinese Patent Application No. 2007800339714, including English coexpression on triacylglycerol biosynthesis in plants' FEBS Letters Language Translation. 587:364-369. Aug. 1, 2013 Request for Re-Examination, filed in connection with Vanhercke et al (2013) "Metabolic engineering of biomass for high Chinese Patent Application No. 2007800339714. energy density: oilseed-like triacylglycerol yields from plant leaves' May 16, 2013 Response to Japanese Office Action, filed in connec Plant Biotechnol. J., doi:10.1111/pbi. 12131. tion with Japanese Patent Application No. 2009-519744. Weselake et al. (2009) “Increasing the flow of carbon into seed oil” English Language Translation of May 21, 2013 Second Japanese Biotechnology Advances 27:866-878. Office Action, issued in connection with Japanese Patent Application Wood etal. (2009) “A leaf-based assay using interchangeable design No. 2009-519744. principles to rapidly assemble multistep recombinant pathways' Aug. 27, 2013 Response to European Examination Report, filed in Plant Biotech. J. 7: 914-924. connection with European Patent Application No. 07763775.9. Wu et al. (1994) "A Mutant Arabidopsis Deficient in the Elongation Oct. 9, 2013 European Examination Report, issued in connection of Palmitic Acid' Plant Physiol. 106: 143-150. with European Patent Application No. 07763775.9. Wu et al. (1997)“Low-Temperature Damage and Subsequent Mutant Andrianov et al. (2010) “Tobacco as a production platform for Arabidopsis Exposed to Recovery of fabl 20O" Plant Physiol. 113: biofuel: overexpression of Arabidopsis DGAT and LEC2 genes 347-356. increases accumulation and shifts the composition of lipids in green Xu et al. (2008) “Cloning and characterization of an acyl-CoA biomass Plant Biotech. J. 8:277-287. dependent diacylglycerol acyltransferase 1 (DGAT1) gene from Aghoram, K., Wilson, R.F., Burton, J.W., Dewey, R.E. 2006. A muta Tropaeolum majus, and a study of the functional motifs of the DGAT tion in a 3-keto-acyl-acp synthase ii gene is associated with elevated protein using site-directed mutagenesis to modify enzyme activity palmitic acid levels in soybean seeds. CropSci. 46:2453-2459. and oil content” Plant Biotechnology Journal 6, pp. 799-818. Alemanno et al. (2008) "Characterization of leafy cotyledonl-like Xu et al., (2008) “Lipid Trafficking between the Endoplasmic during embryogenesis in Theobroma cacao L.” Planta 227:853-866. Reticulum and the Plastid in Arabidopsis Requires the Extraplastidic Alonso et al. (2010) “Catalytic conversion of biomass to biofuels' TGD4 Protein' The Plant Cell, vol. 20: 2190-2204. Green Chem. 12:1493-1513. US 9,351,507 B2 Page 4
(56) References Cited Gong and Jiang (2011) “Biodiesel production with microalgae as feedstock: from strains to biodiesel’ Biotechnol. Lett. 33: 1269-1284. OTHER PUBLICATIONS International Search Report issued by the International Searching Authority (ISAAU) on Oct. 25, 2007 in connection with Interna Awai et al., (2006) “A phosphatidic acid-binding protein of the tional Application No. PCT/AU2007/000977. chloroplast inner envelope membrane involved in lipid trafficking” Third Office Action which issued on Nov. 16, 2011 in connection PNAS 103(28): 10817-22. with Chinese Patent Application No. 2007800339714, including Bao and Ohlrogge, Supply of Fatty Acid is One Limiting Factor in the English language translation. Accumulation of Triacylglycerol in Developing Embryos. Plant Physiology, 1999, 120:1057-1062. Response filed to the third Office Action filed on Apr. 5, 2012 in Barthole et al. (2011) “Controlling lipid accumulation in cereal connection with Chinese Patent Application No. 2007800339714, grains” Plant Sci. 105-186:33-39. including English language the claims. Benning, (2008) “A role for lipid trafficking in chloroplast Fourth Office Action which issued on Aug. 3, 2012 in connection with biogenesis' Progress in Lipid Research 47.381-389. Chinese Patent Application No. 2007800339714, including English Benning, (2009) “Mechanisms of Lipid Transport Involved in language translation. Organelle Biogenesis in Plant Cells' Annu. Rev. Cell Dev. Biol. Examination Report which issued on Jun. 8, 2012 in connection with 25:71-91. Australian Patent Application No. 2007272316. Bligh and Dyer (1959) “A Rapid Method of Total Lipid Extraction English language translation of First Office Action which issued on and Purification' Canadian Journal of Biochemistry and Physiology Oct. 16, 2012 in connection with Japanese Patent Application No. 37:911-917. 2009-519744. Bouvier-Naveetal. (2000) “Expression in yeast and tobacco of plant English translation of Office Action issued Aug. 27, 2010 in connec cDNAS encoding acyl CoA:diacylglycerol acyltransferase” Euro tion with corresponding Chinese Patent Application No. pean Journal of Biochemistry/FEBS 267:85-96. 2007800339714. Broun et al. (1998) "A bifunctional oleate 12-hydroxylase: Response to First Office Action filed with the Chinese Patent Office desaturase from Lesquerella fenleri.” The Pant Journal. 13(2): 201 on Jan. 11, 2011 in connection with Chinese Patent Application No. 210. 2007800339714, and an English Translation of the Claims. Burgal et al., (2008) "Metabolic engineering of hydroxy fatty acid Response to Second Office Action and English Translation ofClaims, production in plants: RcDGAT2 drives dramatic increases in filed with the Chinese Patent Office on Aug. 3, 2011 in connection ricinoleate levels in seed oil” Plant Biotechnology Journal 6(8):819 with Chinese Patent Application No. 200780033971.4, and an 831. English Translation of the Claims. Cases et al., Identification of a gene encoding an acyl CoA:di European Examination Report issued Jun. 8, 2010 by the European acylglycerol acyltransferase, a key enzyme in triacylglycerol synthe Patent Office in connection with European Patent Application No. sis, PNAS (1998) 95: 13018-13023. 0776.37759. Cases et al., Cloning of DGAT2, a second mammalian diacylglycerol Response to European Examination Report, filed with the European acyltransferase, and related family members, J. Biol. Chem. (2001) Patent Office in Connection on Dec. 16, 2010 in connection with 276(42):38870-38876. European Patent Application No. 07763775.9. Cao et al., Properties of the Mouse Intestinal Acyl European Examination Report issued Apr. 1, 2011 by the European CoA:Monoacylglycerol Acyltransferase, MGAT2. The Journal of Patent Office in connection with European Patent Application No. Biological Chemistry, 2003, 278(28)25657-25669. 0776.37759. Cernac and Benning (2004) “WRINKLED1 encodes an AP2/EREB Response to European Examination Report, filed with the European domain protein involved in the control of storage compound Patent Office in Connection on Oct. 3, 2011 in connection with biosynthesis in Arabidopsis” Plant J. 40:575-585. European Patent Application No. 07763775.9 Chappell et al (1998) “Vegetable Oil Production: Industry Profile” Supplementary European Search Report issued Feb. 23, 2010 in Preliminary Final Report, EPA contract 68-D4-0099, TRU Project # connection with corresponding European Patent Application No. 7018-54, 1-1-5-26. 0776.37759. Cheng et al., Identification of Acyl Coenzyme A:Monoacylglycerol Feb. 6, 2012 European Examination Report issued in connection with Acyltransferase 3, an Intestinal Specific Enzyme Implicated in European Patent Application No. 07763775.9 Dietary Fat Absorption. The Journal of Biological Chemistry, 2403, Dec. 4, 2012 Request for Further Processing and Response to Feb. 6. 278(126): 13611-13614. 2012 European Examination Report filed in connection with Euro Cherry, (1983) “Cottonseed Oil' J. Am. Oil Chem. Soc. 60: 360-367. pean Patent Application No. 07763775.9. Dowd et al., (2004) "Gene Expression Profile Changes in Cotton Dec. 18, 2012 Response to Aug. 3, 2012 Chinese Office Action filed Root and HypocotylTissues in Response to Infection with Fusarium in connection with Chinese Patent Application No. 2007800339714. oxysporum f. sp. vasinfectum” Molecular Plant-Microbe Interac File History of U.S. Patent Publication No. 2011-0314725, Petrie et tions. 17:654-667. al., published Dec. 29, 2011 (U.S. Appl. No. 13/171,032, filed Jun. Dulermo and Nicaud (2011) “Involvement of the G3P shuttle and 28, 2011). (3-oxidation pathway in the control of TAG synthesis and lipid accu File History of U.S. Patent Publication No. 2011-0223311, Liu et al., mulation in Yarrowia lipolytica' Metab. Eng. 13:482-491. published Sep. 15, 2011 (U.S. Appl. No. 13/011,773, filed Jan. 21, Durrett et al. (2008) "Plant triacylglycerols as feedstocks for the 2011). production of biofuels' Plant J. 54: 593-607. File History for U.S. Patent Publication No. 2009-0308041, Eastmond, (2006) “SUGAR-DEPENDENT1 Encodes a Patatin Whitelaw et al., Dec. 17, 2009 (U.S. Appl. No. 12/309.276, filed Jul. Domain Triacylglycerol Lipase That Initiates Storage Oil Breakdown 6, 2009). in Germinating Arabidopsis Seeds' The Plant Cell, vol. 18, 665-675. File History of U.S. Patent Publication No. 2011-0229623, Liu et al., Endalew et al. (2011) “Inorganic heterogeneous catalysts for Sep. 22, 2011 (U.S. Appl. No. 13/011,779, filed Jan. 21, 2011). biodiesel production from vegetable oils' Biomass and Bioenergy Feb. 20, 2013 Examination Report issued in connection with Euro 35:3787-3809. pean Patent Application No. 07763775.9. Folchet al., (1957) “A Simple Method for the Isolation and Purifi Jan. 9, 2013 Office Action issued in connection with U.S. Appl. No. cation oftotal Lipides From AnimalTissues' J. Biol. Chem. 226: 497. 13/011,773. Fuller et al., (1966) “A Gas Chromatographic Method for Continuous Feb. 11, 2013 Response filed in connection with U.S. Appl. No. Accelerated Study of O2 Uptake in Fats’ JAOCS. 43:477-478. 13/011,773. Ghosal et al. (2007) "Sacchmaromyces cerevisiae phospholipid: Apr. 9, 2013 Office Action issued in connection with U.S. Appl. No. diacylglycerol acyl transferase (PDAT) devoid of its membrane 13/011,773. anchor region is a soluble and active enzyme retaining its substrate Dec. 6, 2012 Office Action issued in connection with U.S. Appl. No. specificities' Biochimica et Biophysica Acta 1771:1457-1463. 13/011,779. US 9,351,507 B2 Page 5
(56) References Cited Dougherty et al. (1995) Effects of diets containing high or low amounts of stearic acid on plasma lipoprotein fractions and fecal fatty OTHER PUBLICATIONS acid excretion of men. Am. J. Clin. Nutr. 61:1120-1128. Dubois et al. (2007) Fatty acid profiles of 80 vegetable oils with Jan. 4, 2013 Response filed in connection with U.S. Appl. No. regard to their nutritional potential. European Journal of Lipid Sci 13/011,779. ence Technology 109(7):710-732. Mar. 13, 2013 Office Action issued in connection with U.S. Appl. No. Goffman et al. (2003) Genetic Diversity for Lipid Content and Fatty 13/011,779. Acid Profile in Rice Bran. Journal of the American Oil Chemists’ U.S. Appl. No. 13/001.779, Liu et al., filed Jan. 21, 2011. Society 80:485-490. U.S. Appl. No. 12/989,405, Zhou et al., filed May 16, 2011. Ha (2005) Bioactive components in rice bran oil improve lipid pro U.S. Appl. No. 13/129,940, Petrie et al., filed May 18, 2011. files in rats fed on high-cholesterol diet. Nutrition research 25, 597 U.S. Appl. No. 13/011,773, Liu et al., filed Jan. 21, 2011. 606. U.S. Appl. No. 13/243,747, Singh et al., filed Sep. 23, 2011. Haseloff and Gerlach, (1988) Simple RNA enzymes with new and U.S. Appl. No. 13/171,032, Petrie et al., filed Jun. 28, 2011. highly specific endoribonuclease activities. Nature, 334:585-591. Abdullah et al., (1983) Efficient Plant Regeneration from Rice Henikoff et al., (2004) TILLING. Traditional Mutagenesis Meets Protoplasts Through Somatic Embryogenesis. Biotechnology, Functional Genomics. Plant Physiology, 135:630-636. 4:1087-1090. Hu et al. (1997) Dietary Fat Intake and the Rist of Coronary Heart Agarwal et al. (2003) “Cottonseed Oil Quality, Utilization and Pro Disease in Women. N. Engl. J. Med. 337: 1491-1499. cessing” CICRTechnical Bulletin No. 25, pp. 1-16. Jennings and Akoh (2000) Lipase-Catalyzed Modification of Rice Almeida and Allshire, (2005) RNA silencing and genome regulation. Bran Oil to Incorporate Capric Acid. Journal of Agricultural and Trends in Cell Biology, 15:251-258. Food Chemistry, 48:4439-4443. Akagi et al. (1995) Nucleotide Sequence of a Stearoyl-Acel carrier Jones et al. (1995) Palmitoyl-Acyl Carrier Protein (ACP) Protein Desaturase cDNA from Developing Seeds of Rice. Plant Thioesterase and the Evolutionary Origin of Plant Acyl-ACP Physiol. 108,845-846. Thioesterases. Plant Cell 7:359-371. Anal et al. (2003) Improvement of rice (Oryza sativa L.) seed oil Klahre et al. (2002) High molecular weight RNAS and Small inter quality through introduction of a soybean microsomal omega-3 fatty fering RNAS induce systemic posttranscriptional gene silencing in acid desaturase gene. Plant Cell Rep. 21.988-992. plants. PNAS 99(18): 11981-1 1986. Ascherio and Willett (1997) Health effects of trans fatty acids. Am. J. Kinney (1996) Development of Genetically Engineered Soybean Clin, Nutr. 66: 1006S-1010S. Bäumlein, H., et al., (1991) “A Novel Seed Protein Gene From Vicia Oils for Food Applications. J. Food Lipids 3:273-292. faba Is Developmentally Regulated in Transgenic Tobacco and Kozell et al., (1996) Optimizing expression of transgenes with an Arabidopsis Plants.” Molecular and General Genetics, 225(3): 459 emphasis on post-transcriptional events. Plant Molecular Biology, 467. 32:393-405. Bligh and Dyer, (1959) Orange-red Flesh in Cod and Haddock. J. Kodama et al. (1997) Structure, chromosomal location and expres Fish. Res. Bd. Canada, 16(4):449-452. sion of a rice gene encoding the microsome (D-3 fatty acid desaturase. Boggs etal. (1964) Relation of Hexanal in Vapor Above Stored Potato Plant Molecular Biology 33:493-502. Granules to Subjective Flavor Extimates. J. Food Sci. 29:487-489. Kohno-Murase et al. (2006) Production of trans-10, cis-12 conju Bonanome and Grundy (1988) Effect of Dietary Stearic Acid on gated linoleic acid in rice. Transgenic Research 15:95-100. Plasma Cholesterol and Lipoprotein Levels. N. Engl. Med. 318: Langridge et al., (2001) Trends in genetic and genome analysis in 1244-1248. wheat: a review. Aust. J. Agric. Res., 52: 1043-1077. Brandt et al., (1985) Primary Structure of a B1 Hordein Gene from Lee, M., et al., (1998) Identification of Non-Heme Diiron Proteins Barley. Carlsberg Res. Commun., 50:333-345. That Catalyze Triple Bond and Epoxy Group Formation. Science, Broun et al., (1998) a bifunctional oleate 12-hydroxylase: desaturase 280(5365): 915-918. from Lesquerella fendleri. The Plant Journal. 13(2):201-210. Lemieux B. (2000) High Throughput Single Nucleotide Buhr et al. (2002) Ribozyme termination of RNA transcripts down Polymorphism Genotyping Technology. Current Genomics, 1:301 regulate seed fatty acid genes in transgenic soybean. Plant J. 30: 3.11. 155-163. Leonard etal. (1997) Cuphea wrightiithioesterases have unexpected Champagne etal. (1995) Stabilization of Brown Rice Products. Using broad specificities on saturated fatty acids. Plant Molecular Biology, Ethanol Vapors as an Antioxidant Delivery System. Cereal Chem vol. 34, Issue 4: 669-679. 72:255-258. Li et al., (1997) Comparison of promoters and selectable marker Chang et al., (1978) Chemical Reactions Involved in the Deep-Fat genes for use in Indica rice transformation. Molecular Breeding, Frying of Foods. Journal of American Oil Chemists' Society, 55:718 3:1-14. 727. Liu et al. (1999) Molecular cloning and expression of a cDNA encod Chapman et al. (2001) Transgenic Cotton Plants with Increased Seed ing a microsomal (D-6 fatty acid desaturase from cotton (Gossypium Oleic Acid Content. Journal of American Chemists' Chemistry; vol. hirsutum) Aust. J. Plant Physiol. 26:101-106. 78 No. 9,941-947. Liu et al. (2002) High-Oleic and High-Stearic Cottonseed Oils: Choudhury et al. (1980) Lipids in Developing and Mature Rice Nutritionally Improved Cooking Oils Developed Using Gene Silenc Grain. Phytochemistry 19: 1063-1069. ing. J. Am. Coll. Nutr. 21: 205S-211S. Cicero et al. (2001) Rice bran oil and gamma-oryZanol in the Liu et al. (2002) High-Stearic and High-Oleic Cottonseed Oils Pro treatment of hyperlipoproteinaemias and other conditions. duced by Hairpin RNA-Mediated Post-Transcriptional Gene Silenc Phytotherapy Research; vol. 15 No. 4, 277-289. ing. Plant Physiol. 129: 1732-1743. Clapp et al., (1993) The 16-Kilodalton N-Terminal Fragment of Lu et al., (1993) High Efficiency Retroviral Mediated Gene Human Prolactin is a Potent Inhibitor of Angiogenesis. Endocrinol Transduction into Single Isolated Immature and Replatable CD34" ogy, 133(3): 1292-1299. Hematopoietic Stem/Progenitor Cells from Human Umbilical Cord Colot et al., (1987) Localization of sequences in wheat endosperm Blood. J. Exp. Med., 178:2089-2096. protein genes which confertissue-specific expression in tobacco. The Mensink and Katan (1990) Effect of Dietary Trans Fatty Acids on EMBO Journal, 6(12):3559-3564. High-Density and Low-Density Lipoprotein Cholesterol Levels in Comai et al., (2004) Efficient discovery of DNA polymorphisms in Healthy Subjects. N. Engl. J. Med. 323: 439-445. natural populations by Ecotilling. The Plant Journal, 37.778-786. Miquel et al. (1992) Arabidopsis mutants deficient in polyunsatu Domergue et al., (2005) In vivo characterization of the first acyl-CoA rated fatty acid synthesis: Biochemical and genetic characterization A6-desaturase from a member of the plant kingdom, the microalga of a plant oleoyl-phosphatidylcholine desaturase. Journal of Biologi Ostreococcus tauri. Biochem J. 389, 483-490. cal Chemistry; vol. 267 No. 3, 1502-1509. US 9,351,507 B2 Page 6
(56) References Cited Plant Physiology, American Society of Plant Physiologists, Rockville, MD, US; vol. 129, 1723-31. OTHER PUBLICATIONS Suzuki et al. (1999) Volatile Components in Stored Rice Oryza sativa (L.) of Varieties with and without Lipoxygenase-3 in Seeds. J. Mikkilineni and Rocheford (2003) Sequence variation and genomic Agric. Food Chem. 47: 1119-1124. organization of fatty acid desaturase-2 (fad2) and fatty acid Taira et al. (1989) Fatty Acid Composition of Indica-Types and desaturase-6 (fado) cDNAs in maize. Theor. Applied Genetics, 106. Japonica-Types of Rice Bran and Milled Rice. Journal of the Ameri 1326-1332. can Oil Chemists’ Society; vol. 66 No. 9, 1326-1329. Millar and Waterhouse, (2005) Plant and animal microRNAs: simi Taira et al. (1988) Fatty Acid Composition of Indica Sinica Javanica larities and differences. Funot Integr Genomics, 5:129-135. Moghadasian and Frohlich (1999) Effects of Dietary Phytosterols on and Japonica Groups of Nonglutinous Brown Rice. Journal of Agri Cholesterol Metabolism and Atherosclerosis: Clinical and Experi cultural and Food Chemistry; vol. 36 No. 1, 45-47. mental Evidence. Am. J. Med. 107:588-94. Taira et al. (1986) Lipid Content and Fatty-Acid Composition of Morrison (1988) Lipids in Cereal Starches: A Review. J Cereal Sci. Indica and Japonica Types of Nonglutinous Brown Rice. Journal of 8:1-15. Agriculture and Food Chemistry; vol. 34 No. 3, 542-545. Most et al. (2005) Rice bran oil, not fiber, lowers cholesterol in Thelen and Ohlrogge (2002) Metabolic Engineering of Fatty Acid humans. Am J Clin Nutr 81:64-8. Biosynthesis in Plants. Metabolic Engineering 4: 12-21. Needleman and Wunsch, (1970) A General Method Applicable to the Theriault et al. (1999) Tocotrienol: A Review of its Therapeutic Search of Similarities in the Amino Acid Sequence of Two Proteins. Potential. Clin. Biochem. 32: 309-19. J. Mol. Biol. 48:443-453. Tholstrup et al. (1994) Fathigh in stearic acid favorably affects blood Nielsen et al. (2004) Formation of Volatile Compounds in Model lipids and factor VII coagulant activity in comparison with fats high Experiments with Crude Leek (Allium ampeloprasum Var. Lancelot) in palmitic acid or high in myristic and lauric acids. Am. J. Clin. Nutr. Enzyme Extract and Linoleic Acid or Linolenic Acid. Journal of 59: 371-377. Agricultural and Food Chemistry 52:2315-2321. Toriyama et al., (1986) Haploid and diploid plant regeneration from Noakes and Clifton (1998) Oil blends containing partially hydroge protoplasts of anther callus in rice. Theor Appl Genet, 73:16-19. nated or interesterified fats: differential effects on plasma lipids. Am. Trautwein, E.A. (2001) n-3 Fatty Acids—Physiological and Tech J. Clin. Nutr. 98: 242-247. nical Aspects for Their Use in Food. European Journal of Lipid O’Brien (2005) “Cottonseed Oil’ Bailey’s Industrial Oil and Fat Science and Technology, 103(1): 45-55. Products, 6th Edition, edited by Fereidoon Shahidi. Tsugitaetal (1983) Cooking Flavor and Texture of Rice Stored under Ohlrogge and Jaworski (1997) Regulation of Fatty Acid Synthesis. Different Conditions. Agricultural and Biological Chemistry 47: Annu Rev Plant Physiol Plant Mol Biol. 48:109-136. 543-549. Pasquinelli et al., (2005) MicroRNAs: a developing story. Current Tsuzuki etal (2004) Oxidation Rate of Conjugated Linoleic Acid and Opinion in Genetics & Development, 15:200-205. Conjugated Linolenic Acid is Slowed by Triacylglycerol Esterifica Perriman et al., (1992) Extended target-site specificity for a hammer tion and O-Tocopherol. Lipids 39:475-480. head ribozyme. Gene, 113:157-163. Valvekens, D., et al., (1988) Agrobacterium tumefaciens-Mediated Pirtle et al. (1999) Characterization of a Palmitoyl-Acyl Carrier Pro Transformation of Arabidopsis thaliana Root Explants by Using tein Thioesterase (FatB1) in Cotton. Plant Cell Physiology 40:2 p. Kanamycin Selection. Proceedings of the National Academy of Sci 155-163. ences of the United States of America, 85(15) 5536-5540. Radcliffe et al. (1997) Serum Lipids in Rats Fed Diets Containing van de Loo, F. J. Braun, P., Turner, S., & Somerville, C. (Jul. 1995). Rice Bran Oil or High-Linolenic Acid Safflower Oil. Biochemical An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl Archives 13:87-95. desaturase homolog. Proc. Natl. Acad. Sci. USA. 92, 6743-6747. Resurreccion etal (1979) Nutrient Content and Distribution in Mill Voelker et al. (1996) Genetic engineering of a quantitative trait: ing Fractions of Rice Grain. Journal of the Science of Food and metabolic and genetic parameters influencing the accumulation of Agriculture, 30: 475-481. laurate in rapeseed. Plant J.9: 229-241. Roche and Gibney (2000) Effect of long-chain n-3 polyunsaturated Wagner et al., (1992) Coupling of adenovirus to transferring fatty acids on fasting and postprandial triacylglycerol metabolism. polylysine/DNA complexes greatly enhances receptor-mediated Am. J. Clin. Nutr. 71: 232S-237S. gene delivery and expression of transfected genes. Proc. Natl. Acad. Rukmini and Raghuram (1991) Nutritional and Biochemical Aspects Sci USA, 89:6099-6103. of the Hypolipidemic Review. Journal of the American College of Wang et al., (1998) Improved Vectors for Agrobacterium Nutrition 10(6):593-601. tumefaciens-Mediated Transformation of Monocot Plants. Acta Senior I.J., (1998) Uses of Plant Gene Silencing. Biotechnology & Hort, 461:401-407. Genetic Engineering Reviews, Ed. Tombs, M.P., 15:79-119. Waterhouse, (1998) Virus resistance and gene silencing in plants can Slade and Knauf (2005) TILLING moves beyond functional genom be induced by simultaneous expression of sense and antisense RNA. ics into crop improvement. Transgenic Research, 14:109-115. Proc. Natl. Acad. Sci. USA, 95:13959-13964. Smith et al., (2000) Total silencing by intron-spliced hairpin RNAs. Whitelaw, E. S. Li, Z. Singh, S. Liu, Q., Upadhyaya, N., Morell, Nature, 407:319-320. M., ... Rahman, S. (Sep. 2004). Investigation of lipid synthesis in the Shin et al. (1986) Correlation Between Oxidative Deterioration of rice grain: modification offatty acids in rice bran oil. In C. K. Black, Unsaturated Lipid and n-Hexanal during Storage of Brown Rice. J. J. F. Panozzo, & G. J. Rebetzke (Eds.), Cereals 2004. Proceedings of Food Sci. 51:460-463. the 54" Australian Cereal Chemistry Conference and 11" Wheat Shippy et al., (1999)The Hairpin Ribozyme. Molecular Biotechnol Breeders Assembly, Sep. 21-24, 2004, Canberra ACT, North ogy, 12:117-129. Melbourne VIC: Cereal Chemistry Division, Royal Australian Sivaraman et al. (2004) Development of high oleic and low linoleic Chemical Institute, AU (pp. 418-420). acid transgenics in a Zero erucic acid Brassica juncea L. (Indian Whitelaw et al. (1986) A Rice FATB Insertional Mutant Exhibits mustard) line by antisense Suppression of the fad2 gene. Molecular Improved Growth and Reduced Photoinhibition at High Tempera Breeding, Kluwer Academic Publishers, DO; vol. 13 No. 1,365-375. tures. Proceedings of the 55th Australian Cereal Chemistry Confer St Angelo et al. (1980) Identification of Lipoxygenase-Linoleate ence, 55th Australian Cereal Chemistry Conference, Jul. 3-7, 2008, Decomposition Products by Direct Gas Chromatography-Mass Sydney Australia, Jul. 3, 2005, pates 101-104. Spectrometry. J Lipids 1:45-49. Williams et al. (1999) Impaired Endothelial Function Following a Stoutesdijk et al., (2000) High-oleic acid Australian Brassica napus Meal Rich in Used Cooking Fat. J. Am. Coll. Cardiol. 33:1050-1055. and B. juncea varieties produced by co-suppression of endogenous Yasumatsu et al. (1966) Studies on Cereals Part V Stale Flavor of A12-desaturases. Biochem. Soc. Trans. 28: 938-940. Stored Rice. Agric. Biol. Chem. 30:483-486. Stoutesdijk et al. (2002) hpRNA-mediated targeting of the Zhou et al. (2002) Ageing of Stored Rice: Changes in Chemical and Arabidopsis FAD2 gene gives highly efficient and stable silencing. Physical Attributes. Journal of Cereal Science 35:65-78. US 9,351,507 B2 Page 7
(56) References Cited May 6, 2013 Notice of Allowance, issued in connection with U.S. Appl. No. 12/309.276, internationally filed Jul. 13, 2007. OTHER PUBLICATIONS Jul. 5, 2013 Notice, issued in connection with U.S. Appl. No. 12/309.276, internationally filed Jul. 13, 2007. Zock et al. (1994) Impace of myristic acid versus palmitic acid on Jul. 29, 2013 Response to Notice, filed in connection with U.S. Appl. serum lipid and piloprotein levels in healthy women and men. No. 12/309.276, internationally filed Jul. 13, 2007. Arterioscler Thromb. 14:567-575. Jul. 31, 2013 Declaration, filed in connection with Chinese Patent Connolly et al. (1998) GenBank Accession No. AC0.04236, NCBI, Application No. 2007800339714. pp. 1-11. Aug. 1, 2013 Response, filed in connection with Chinese Patent Sharma et al., (2003) GenBank Accesion No. AC108870, NCBI, pp. Application No. 2007800339714, including English Language of 1-27. pending claims. Kim et al., (1999) GenBank Accesion No. AF213480, NCBI, p. 1. English Language Translation of Apr. 16, 2013 Grounds of Rejection, Liu et al. (1997) EMBL Nucleotide Sequence Database as X97016. issued in connection with Chinese Patent Application No. Sasaki et al., (2001) GenBank Accession No. AP004.047. NCBI, pp. 2007800339714. 1-36. English Language translation of May 21, 2013 Office Action, issued Sasaki et al., (1999) GenBank Accession No. AP000399, NCBI, pp. in connection with Japanese Patent Application No. 2009-519744. 1-33. Apr. 16, 2013 Response, filed in connection with Japanese Patent Sasaki et al., (2001) Genbank Accession No. AP004236, NCBI, pp. Application No. 2009-519744. 1-37. Aug. 27, 2013 Response, filed in connection with European Patent Sasaki et al., (2002) GenBank Accession No. AP005168, NCBI, pp. Application No. 07763775.9. 1-31. Aug. 8, 2013 Response, filed in connection with U.S. Appl. No. Sasaki et al., (2002) GenBank Accession No. AP005291, NCBI, pp. 13/011,773. 1-38. Jul. 15, 2013 Response, filed in connection with U.S. Appl. No. Sasaki et al. (2002) GenBank Accession No. BAC45170.1. 13/011,779. Sasaki et al. (2002) GenBank Accession No. BAC45173.1. Aug. 8, 2013 Final Office Action, issued in connection with U.S. Jul. 1, 2011 Office Action, issued in connection with U.S. Appl. No. Appl. No. 13/011,779. 12/309.276, internationally filed Jul. 13, 2007. Sheikh etal (2002) Fatty Acids Composition in Germinating Cotton Sep. 1, 2011 Response, filed in connection with U.S. Appl. No. Seedlings Affected by High Temperature Stress. Pakistan Journal of 12/309.276, internationally filed Jul. 13, 2007. Applied Sciences 2(1):97-99. Nov. 4, 2011 Office Communication, issued in connection with U.S. Sep. 9, 2015 Response to Examination Report, filed in connection Appl. No. 12/309.276, internationally filed Jul. 13, 2007. with Canadian Patent Application No. 2,693,630. Dec. 5, 2011 Response, filed in connection with U.S. Appl. No. Dec. 2, 2014 Fifth Chinese Office Action, issued in connection with 12/309.276, internationally filed Jul. 13, 2007. Chinese Patent Application No. 2007800339714, including English Jan. 12, 2012 Office Action, issued in connection with U.S. Appl. No. Language Translation. 12/309.276, internationally filed Jul. 13, 2007. Mar. 20, 2015 Response to Jan. 14, 2015 Communication, filed in Feb. 6, 2012 Petition, filed in connection with U.S. Appl. No. connection with European Patent Application No. EP 07763775.9. 12/309.276, internationally filed Jul. 13, 2007. Sep. 25, 2015 Summons to Oral Proceedings, issued in connection Mar. 26, 2012 Decision on Petition, issued in connection with U.S. with European Patent Application No. EP 07763775.9. Appl. No. 12/309.276, internationally filed Jul. 13, 2007. Jan. 28, 2016 Response to the Summons to Oral Proceedings, filed in Aug. 3, 2012 Office Action, issued in connection with U.S. Appl. No. connection with European Patent Application No. 07763775.9. 12/309.276, internationally filed Jul. 13, 2007. Feb. 23, 2016 Proposed Amendments, filed in connection with Euro Dec. 3, 2012 Response, filed in connection with U.S. Appl. No. pean Patent Application No. 07763775.9. 12/309.276, internationally filed Jul. 13, 2007. Jan. 12, 2016 Office Action, issued in connection with Japanese Jan. 17, 2013 Final Office Action, issued in connection with U.S. Patent Application No. 2013-240977, including English Language Appl. No. 12/309.276, internationally filed Jul. 13, 2007. Translation. Apr. 17, 2013 Response, filed in connection with U.S. Appl. No, Mar. 17, 2016 Decision, issued in connection with European Patent 12/309.276, internationally filed Jul. 13, 2007. Application No. 07763755.9. U.S. Patent May 31, 2016 Sheet 1 of 38 US 9,351,507 B2
Acetyl-CoA ------PLASTD SS Fatty acid KAS SAD1 C4:0-ACP synthase 16:0-ACP 18:0-ACP iii) 18:1-ACP . . . . . Fats a fiFatBIFatA . FatA Acyl-CoA Pool : . U.S. Patent May 31, 2016 Sheet 2 of 38 US 9,351,507 B2
VZ(61-) U.S. Patent May 31, 2016 Sheet 3 of 38 US 9,351,507 B2
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~„?tº SZfil U.S. Patent May 31, 2016 Sheet 4 of 38 US 9,351,507 B2
Syd?JOSue]]eJouOMAL 'p??Jode) OZ8896||SO9u90–No.rg------&-----No.…) U.S. Patent May 31, 2016 Sheet 5 of 38 US 9,351,507 B2
Icicos(2ge caTac.A.caroccaccircarGCTA AGAT Locos 11g Locoso Sgt locos05g3 19e 993 2) 2. 22. 23. Locoso2g carragagakaArcAdiAcrggaaaarcalaAgTGccAAAfcfarraTTTTGA Locoslig Locos06go Locoso.6g3 241. 205 21 21 208 2s locos02gd AAAAAATAAAAAATCAAccAATArc'AccATAGTAcccArcArcrcc. locoslig Locos06g Locoso sg3 2. 2. 22 2.3 24l 2s locos (24 ArTAAGAccArcAAcrecciarcTAAAccorcorrecrecccCATT Locosig 4 Locos 06go rocosoeg3 26. 27 28 2191 2263. 22 Locos 02g4 ccTAAccoacArcrccTTccecacacacArcAAAcGcAAAcaggrgA Locosliiga Locoso sigo Locost 63 222 23. 224 225. 2s 22 Locos02.g4 AAAAAAAAAscAAAAAAAA Locoslig4 Locoso Sgo Eccos06g3 22 229. 23. 231. 232 233 Locoso2.g4 AAA ceasTACTAATAAAAAAAAAccAACCAacecraea locoslig4 Locososgo Locos06g3 gal 23S 23 si 2371 238 23s Locoso2.g4 scAggccccAAccc.ccc.ccascacAccca AAAccorrectacTAAAT Locos.11g4 Locos06go locosoeig3 24 2. 2. 23 244. 2s. Locos (2g4 AAATAAAccasAcaccAAcaragra Aag Locoslig4 Locosoegg Locososg3 246 24. 248 249 250 25i Locos 02g4 AAAccAAGATATATTCATAAAAAAAATTATAATAAAcaarga Locoalig4 Locososgo Locoso.6g3 252. 253, 2S 255 2ss 25 Locos 02.g4 TAAAAATTAGAGAGTTGAATAaaaaaccess GCCATAccescAA Locoslig4 Locos06go Locos 0.63 Fig. 4A U.S. Patent May 31, 2016 Sheet 6 of 38 US 9,351,507 B2
2ss 259 25s 251 262 23 Locos 02g4 AATAATGGAGTAGAAcAgcraccAAAGAAATTCAACAATTCccAAgegaala Locos 11g4 Locost 5go isocoso 5.g3 264 265 2s6 2s. 263 2S Locoso2.g4 AAAccoa AcroccAAAAAAAcreascalaccaccAccra AAAAAcc locoslig4 focososgo to dasg3 21 27. 22 31 2A 2. cose2.g4 GetAccreccATAAgraagaaaaracter cosig.wan tecosgsgo Locossg3 276 2.71. 23. 273 280 28 Locoso2.g4 TorcTcCrAAcirraacrapercarecretract recTactacrccc.ccgrricaegirr Locosilgai Locososgo- locososg3 282 233 284 28S 286 28 Locos 02g4 ATAAAcGTTTTGAcTTggrecaaacAAActrict'AAgrosacraggies Locosig4-
occas)6soa occasg3
288 28S s 2s. 292 23. Locos 02g4 AAAAAATAAcArecacccaccalatracAAAAAgrica arrarer locoslig4 Locoso go Locoat 5g3 2.si 295 29s 297 298. 2.99. Locoso2.g4 TAATGAAACTAATTTGGTAATAAATATATATArrayTATATAAAcTAGAA Laocosilg4 Locos 06go Locost 5g3 31 30 32 303 34. 35 Locoso2.g4 TAAAGAGTAAGTrgATcAAAercaaaargirt’ATAAccTGAAAgggggaeta Locos11g4.M Locos06go
Locosogg3-- 30 3.07. 38. 3031. 3. 3. locoso2.g4 AGAAGAAAcGAAGAAGAAAATAAAAACTAGAAAcccs.Access: locoslig4 to sigo loc oscig3 31.21 33. 34 35. 36 37 focos02.g4 cTAGTCATTGArcgrgacargraeccTTerrAGATcccAAAAAATTAcccaaaac locosl1- g4 Locoso.6go Locoso.6g3 38. 3.191 320i 32 3221 323. Locoso2.g4 Locosilg4 CTCACATCAAATATTTGGACACATGCACCCCTAccAGTGTGTGGAGGCATTGcAracACG locoso Sgo
Locososg3- Fig. 4B U.S. Patent May 31, 2016 Sheet 7 of 38 US 9,351,507 B2
3.24. 323. 32 32 28 32s1 Locos 24 AAACATessaac ActrackassoccaccTAccretrarc Localiga Locosoeg
Locososg3-- 33. 331 332 333. 334 335i Locoso2.g4 GrcArecar"rgAAAAAAccacgc.cscAAGccessacAccCTcAAccorates Locosilga Locosoégo Locososg3 3.35 s 33. 3.391 34. Locos 2g4 CAAccArcticaraatargcAAAAccGAgasagaatasac.AcoccAAAccAAA 0x --- sliga Locoso.6go Locososg3 342. 343 344 345 346 Locoso2.g4 GGGGiggestgccATACAAAGGCAGAAAGGAAcassesscirca AAAAAA locoslig4 locoswa 60 locoso sig3 343 3s 35 35 352. 353 Locoso2g4 CGCegie essage:GGCGGAsgacACAAAGAegeae.CGATGGreece 10C sliga Locosogo-- Locossg3 354. 355 3s. 3s s 359 cos 24 AAccorrectaretarrcacasarecretaccasigaciccaceae oc sig4 Locososgo Locoac6g3 CeCece 3601. 3 sil 352 363 364 365 toxoso2.g4 CCAATCATAAAAAAAATGAgaRAAGGGATAcaccCCTTCCT.cccs ckosig4 locossgo AessagAGAAeciesocacAAcAccc.ccces Locosses 36. 3es 368 389. so 31.
Locost2g4- Accessaaaa-AAAGCT.ccelescGCCSNGcGaACACACAAAGArses Locoslig4 ---
Locos-- 0-60 CGGaesarieselecacAAAGAAAetersee AAGAGAegeaegagicTrcia--GA
Locos- 63 32 sts 34 37s. sta 377 locoso2.g4 ccTcsoccaccAATccCAAATAAAaaaTAAF"Arctic Locosilgai Locos osgo occGcacciccacaoccacarcerGccAccAgascarcate Locos Osg3 378 sts 380 38. 382 383 Locos 02g4 TATAGAegccATGcogcoccAccAArcAATCGAAAAAAAAAAAGTreate Locoslig4 Locoso.6go TGRETccTecrecrescrgcc.carrisscGTGATT cereggcATTFrgic Locosoeig3 384 8. 38s 38. ss. 389. Locoa G2g4 AAAAccessacTCTCC ccTTTGGAAAAAAAAccacces locosliga Locos06go TTTracesacagage-raccGTAGAC’reseccArcCAGeraac Locos06g3
U.S. Patent May 31, 2016 Sheet 9 Of 38 US 9,351,507 B2
s sis s e
costagea areaseseccacceaeacaceaetersease too slg4 areasecrecciaccalatastecsarcaca to rax cases cacascaissaarears accorrecacians. ...a
costsg3aea accre-escalaterarc---area cacartress rear se s as st cos(2g4 Gretcarcic socca sea-terrorcorerracerriccaragraries cosigaam recargo-crea-Jarre-rrrrreccrerreraserticcAAcaccacare costs arease-carcica-aesacarassacrease-acc costs AAacargcrecciscarciseacres 4s. s 2. s
costgan AAge creassicacces es researcaeciscaceaecce a
locosig.as saccatascisscirass-ra locoso.sys Assassiccessee-saccacca t s 3. e s
locoso24ax accessesses accessicaacscocacterscree assigs escapacaaatsrecoccasiocarcaccescareece catége - Kaas -accias recacoleaiacacascastecsecreascetics
costsor Agacgcaagaawaaracecraecesses accescapes se i. le 3. 3. 8. sagascaccescarcisca Locosse 2gs locosliga Geciscarcsecreccacccsec.gc.caccisaacsiccaacs locosogo soccacccs.cccsec.cccaccaccescacaccreas ocess.g3 accessage--- wasaccessees assas a s as is se to oso2.g4 secticestorescocessagesaceae cosig.rada Access accescapreoccasArsaccess.css. Osog cells -careecease Locososg3 st-cc-aalso assos occacciaccaccreascacces se 9. s s s cost2g4 sea was normaticAacascacacecaccc. icosiga eaeace Accieaeacea--, as iocoetsgo ccaccestercassocc-aa- - releases re cososg3 costscescorecoccaccGAccacccsec.cccs s3. ass s s se S3 locoso2.g4 scalesiaascaceaecessessesseeings sliga acticaceaeacecraciselectica assosgo - Cagascacascaceaeacacascaccacea Locossg3 Acoccascaccessessiccaccessiccaccessic s iss sos so s icos (24 Accrew one occacascoccascarcerateracascarcascar locosiga AceclareovcacAggarcacascaaacaaacgccessagasca locososge AAAww.wrccaccrecciasPRARAccAAcciagaragasca locoso.63 cocccsec.coccococcaccaccicosiccaccacciceccaccess.ca sic . s se s sa s Loosd2g. eccacaccaccescoccasiaecesselectra to silge scc.ccc.cccc.gcaa.gcaesacaccessa Locossgo sccescaccess.cscsaccarecciaccaccessaaccessacrcces costsg3 occaccacciaccaccioeccescosaecialsTeacecracca s 57. s s 52 s2. Locoso2.g4 gaeccisaasaaceticActreacacascarcica locosilg4 seascacascacarcissacrescoastacca locosoeigo caccessagascarcacascagecoacacarciscaragascarcacca Ecc Osog3 Acceecccs.egccaccaccocteacA Fig. 4E U.S. Patent May 31, 2016 Sheet 10 of 38 US 9,351,507 B2
s22 s2. s24. 525 526 527
Locos02.g4-as saccaraggerAGGCAcAacTCATArcGGrcCTAcciagargo.cccTeace
to e sig4 coacGAAGGCAGAccAGAcaccAcGAccrossaces occasigoaac acciggcigarcacArctica Tcaccoracasastercoraceae cost 63 Assoccascacascaceaecca Acccs'Aragacecogcces 52. 52 53e S3 s32 S33.
Locos- 0.2g4 acaccircraasagacAreargaaTCATAcaecTAAGTGGraccac--Aircrger Ocosig. AccTcAAAGAAAgaaTCATTAcAGAAGrcGegacrocrer Locoa-- C6 go racascicagigacArtAAAATCATAcReggaracAAAAccric Locosana 06g3 sacGGccacci'ssacArcAgaaaasai"Treas 33 53s. S3 s 538. S39 Locoso2.g4 reagercarcercarricaccATTTerraracarceractercercaaacg. Locoslig4 erraGerarcicarrcaccArrTTGirrasagascaragicTccAAccrg locos Osgo arragctercercccTarrrrrrcacaragaracas-a---Arcticaraccaracra iocos Osg3 ceccGATGciscac-----escarawake casa w w - a s 4. 42 543 S4 ss.
to ro s02.g4 ccarTArraartacaceaaacgc.ccaccArgAAGaucracGGrcticT locosig4 getATAAAAGCAegeacAGCCAAccAGTGAggaecrec.gc.c Locos d6go AcTcTAAirgalaccaccaccAAACAGCircrgaaccATGTGAAAAcrocroscTCC
Locosre 0.63 os-a-a-a-Tees---- GcAges accecaceacAGGAAAcecceece st s S48 Sas ss. SSL Locos (2g4 getAcAgorasaccAccessagArgAccAaacggAActresaaccesTracAg locoslig4 see AGAG (seactic AccCeese Areact acceAAC eacefeca?es Locos 0630 Age ArsecCACecceeAGATGACAAACGGAACAAAGGGTGcAe Locososg3 AgacargottresecrCAAccocacAGATGAGTAAAccAGACTGcGGGarresTec S2. s.s3. ss. 33s. 5ss SS7. locos 0294 AAccaccorrecapacecoccygear-escacces Locoslig4 capaccaccariccaraccc.cccArgosacca-Tccaccacci Locost 6go caaacAecies"AcceasaccCATCA's ActreetcaacA---e. Locos 06g3 CCAAASCAccaccircaccess acceeceasa- Ascar - 55 SS9. S60 56. SS2 S53. Locoso2.g4 ccTCGAAAActriccicca-coATAAGA occasig4 ccecarciccaricca--TCAccoragercar Locoso Sgo AcaccACAAcrocargcaaacrcc.--Terraccarcaraac Locosoeg3 --ARTACAccACree"Trcea ATGAcccasAAGates 564 sess 556. 567 S63 5691 locos 02g4 raircacATAAAActricaragriccircracacaracgrrr Locs.lg4 r-wargarcacarazaaractercerattracter racAGaArcGee Locos digo ww.cricTAAGAAcr'TcscoccacecracAracACAA
Locosoeig3ma crTCraccorTAcArsacAAww-AggaggcAcAracartarggrges 51 s 572 5731 Sl 57s Locos 02g4 ArgicTACTTAcaecTGGTGT.ccgcaa.g. TATAAAAAGA Locosigk--- agacTAcTargcrgrgrgecircGcAragic Arror AAAGAAA Locos 06go Acme war-tracan-G---gacsiggAAAAAcActraalaccaccidgia Locos (693 circus AAcaceam''Accessagaac AccaccTrce TcacAccAges Sites s77 578 579. S80 581 Locoso2.g4 TCTTACACAAccAacAGTAGTATTAGCTCAAATTACTTAAcArcGTTATCATAT Locoslig4 CAccAGGCAacherActa AgcCAAAACTTAAAgrarca'aar
Locos 06go stro- -TAG--AACAAccreas Aca Locos06g3 -AAAcAG-'AscAAAcce--accroscock s sas 584 S85 586 seT Locoso2.g4 Gerg'GGAccrgarcTGAccCATAcAegTrcoragaaaacAAgrea Locosilg4 grgagiccArctic.cgTCTGATTCTCCAAAcrggaggarsagaaaarCAAGaga Locos 06go Cretc.TcasticcirritcCTrecccAgrgocre-escarcer-rea Locos 06g3 gaa-TAGAAAAA--monwrwg Accalagasasawgramm-ArcARTTTTAAAge Fig. 4F
U.S. Patent May 31, 2016 Sheet 16 of 38 US 9,351,507 B2
se sis 2. 22. 2. escost2g 4 Locsi.g4 tecos sig saaaaatsgalaccaccessagccascalata to is asg3 catasaaccepccessaraiser--asawwar - or- orww.x. s s2. es se e 92
Ocsora occasig occasgo caceaeacaccessesses Locososg3 s 3. sa s35 s2. sliga Locostsgo carcicaragrariarcaccCraces careerrocarcTTTriciarrara Liccostigs ses st ess se 4. sal close rocosliga Locossgo-- AccereasAessee
locos-- 063 t sal s locos 024 Locosig4 Locosogo ARA's Locosoeigs
Fig. 4L U.S. Patent May 31, 2016 Sheet 17 of 38 US 9,351,507 B2
1. ... ATGGCTGGTTCTCTTGcGGCGTCTGCATCTTCCCTsiccCAGGGTct 48 s TcAGGCTGGCTCTTGcGGCGrcGCATTCTCCCGTCCCAGGGTCT 1200 Tccc.cccAccTTCGGCTAGAAGCTAAGAACACAAccGGGAATTGCC 9s 2O TCCCCTGcAGCTCGGCTAGAAGCTCTAAAACACAAccGGTGAATTGCC 125 99 AGAGAATTGACGTCCGCGGAATCGTCGCGAAGCCTAATCCGTCTCCAG 48 25 AGAGAATTTGAGCCGCGGAATCGTCGCGAAGCCTAATCCGTCTCCAG 3. s GGGAGCAGcAAcGcGCAGGCGCAAccc.cCAAcer AAGA 198 130 GGCCATGcAAGTAAGGCGCAGGcGcAAGCCCTTCCTAAGGTAATGGA 3s 39 ACCAAGGTTAACCTGAAGACTACAAGCCCAGACAAGGAGGAATAATACC 248 Ill 35 ACCAAGGTAACGAAGACACAAccCAGACAAGGAGGAAAATACC CO 29 GTAACTGCTCCGAAGACATTCTATAAccAATTGCCAcACTGGAGCATGc 29 4. GAcACTGcccGAAGACATTCTATAACCAATTGcCAGAcTGGAGCATGC s 299 TTCTTGCAGCGCACGACCATTTCCTGGCAGCTGAGAAGCAGTGGAC 343 451. TTCGCACCACGACCATCCGGCAGCTGAGAAGCAGGGACT 50 349 CTGc(ACGAAGCCGAAGAAccCGACATGCTGGCTGAACATCGG 398 SC1 CGCGACGACCAAGAAccoacAGCTGGCACACATCGG 550 399 CTTGGTAGGATCATCCAAGACGGGCTGGGTTTAGGCAAAACTTCTTGA 448 55. CTTGGTAGGAcATCCAAGACGGGcGGTGTTTAGGCAAAACTCTTGA 16) 449 TCSGCCAcecaccACTACACTCATGAACAA 498 so cGGTCCTAccAGATTGGTGCTGAcGTACAGCTTCATGAGACATTA ess 99 ATGAATCATTTA ...... 51 65. AGAATCATACAGGTGATACAATGAGCTAGCGCTAGCTTTTC O
Fig. 5A U.S. Patent May 31, 2016 Sheet 18 of 38 US 9,351,507 B2
51 ...... CAGGAAACAGCTCTGAACCATGTGAAAACTGCTGGTCT s s GAssociaccaccaccagogic S 9 CTTAGGTGATGGrrr'TGGTGCTACGCCGGAGATGAGCAAACGGAACTTAA s O cGAggrococcasArcacalaccGAAcAA 18s s TAGGGCAAAAAAGCT crascGAAccCATCAT. . 54 e. 85. AcGrcaca CAGCCGGAGCGATAccoacG s
s • 4 & 8 8 w a w 8 is a w x w w w a t t w ...... eggages SS so AccatacaragrgaTTAGGGAGAAGGT 3S s caGreeceigaagigascaceaG g 35 ccAAGAAccTaggcGCAAAAAGGAGCCA 320 AegocaccaccTAACAcegoecca 59 2 AccessacraccaccaceaeacA 32so
is . . . eggsgescacasa.Asiaca es 335 Tricciags TTGGGATGAGAAAAAACAcAGAAGACTTTCAAAAA 3. 80 ceasaceaecCCAAAggelic 8ss 34 cascalescCAAAGGce 3 SO 856 CAAcAAGGAcAGGGGAAAAGCCAAcCAGGGACCACAF 90s 345. GCTATATCAAGGAcAGGGAAAAgTeccAAGCAGGGACCACAT 3500 ses GAGGCGCCAccAAAAACACAAAAAAGGGTTACT...... 98 350 GATGGCGCTGcraccAAACAATTACAAGAAAAGGctTAcTGAAGTC 35.50 8
Fig. 5B U.S. Patent May 31, 2016 Sheet 19 of 38 US 9,351,507 B2
949 a v - a a w w y in n ...... CCGAAGTGGAGTGA 952 360 TAAAATTrcTCATAGGGATccTTTgica's TCAGCCGAAGTGGAGTGA 3550 963 CCTTGATGTcAACCAGCAGTGAAcAAEGTGAAGTATATGGTTGGATAC O2 365 CCTTGATGTCAACCAGCATGGAAcAAGTGAAGTATATTGGTTGGATAC 3700
O3 TFG...... s a a s - - - - s s s as a e p r u o a p 10.5 370 GAggaac TrcrTTccr'I'rcircTATCCGAACAAgCATCTCTAGA 350
Ol6 - - - ...... AGAGGCTCCAATTCGATAC O37 385 crgAGTACGTTTTTTTTTTTTTCCTcAGAgrgcTecCAATTCGATACT 39CO 1038 GSAGAAGCACGAGcGCAAGCATGACCTGGAACAGAAGGAGGG O87 390 GeagAAccACGAescGCAAGCAGACCTTGGATTACAGGAAGGAGGG 3950 088 GccGTGACAGTGGCTTCACGCTTACCGCTGTCATGAAGCGA 137 395. gccGTGACAGiggo TCAGcGcaccGCTGTTTCAGGTGAATGcGA OOO 138 GATGGCAACACAAAICCCCATCCAGTGGACCACCTTCAGCTGGA 8. 4001 gaGGCAACACAGAACCTCCACCAGTGTGACCACGCTCAGCTGGA O50 188 GCCGGAGCAGAcATTGTGAAGGCTCACACAGAGTGcGAccGAAGcGAG 237 405 CCGGAGCAGAAAAGGCTACACAGAGGGGAccacces OC) 1.238 CCAGGGCGAGGGGAACATGGGCTTTCCCAGCTGAGAGGCATGA. 1284 40 CCAGGGCGAGGGGAACATGGGCTTTCCCAGCTGAGAGGCATGAGCG 450
Fig. 5C U.S. Patent May 31, 2016 Sheet 20 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 21 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 22 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 23 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 24 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 25 Of 38 US 9,351,507 B2
G9-61
No.s U.S. Patent May 31, 2016 Sheet 26 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 27 Of 38 US 9,351,507 B2
VOL'6|-
zozdºaspo »Tozowsspo Iozolvaspo £Tozawaspo U.S. Patent May 31, 2016 Sheet 28 of 38 US 9,351,507 B2 U.S. Patent May 31, 2016 Sheet 29 of 38 US 9,351,507 B2
19T99II?T01169189I U.S. Patent May 31, 2016 Sheet 30 of 38 US 9,351,507 B2 taettTzTITIITTO?I?601180T U.S. Patent May 31, 2016 Sheet 31 of 38 US 9,351,507 B2
Palmitic SRO) Grainu GC AnalysisO E332Oleic (C18:
9. C e SS
FATB ToS 17 FATB RNA FAD2 RNA
Figure 11 U.S. Patent May 31, 2016 Sheet 32 of 38 US 9,351,507 B2
Grain 96 Fatty Acid
FATB TOS 17 FATB RNA FAD2 RNA
Oleic (C18:1)
FATES Tos17 FATB RNA FAD2 RNA
Figure 12 U.S. Patent May 31, 2016 Sheet 33 of 38 US 9,351,507 B2
Grain % Fatty Acid
FATB ToS 17 FATB RNAi FAD2 RNA WD
Figure 13 U.S. Patent May 31, 2016 Sheet 34 of 38 US 9,351,507 B2
.9 5 s (V) É O a - R M - es xx s .S. SY O
s B r se Linoleic U.S. Patent May 31, 2016 Sheet 35. Of 38 US 9,351,507 B2
x
Linoleic U.S. Patent May 31, 2016 Sheet 36 of 38 US 9,351,507 B2
Oleic U.S. Patent May 31, 2016 Sheet 37 of 38 US 9,351,507 B2
oniuneaGOEDvzgovo U.S. Patent May 31, 2016 Sheet 38 of 38 US 9,351,507 B2
OXOg—?
ZNÅL|M}}
zwiwº
? .| .| | | |
9|-61 US 9,351,507 B2 1. 2 METHOD OF PREPARING FOOD USING acids, such as the monounsaturate oleic acid (18:1) and the RCE OIL polyunsaturates linoleic acid (18:2) and O-linolenic acid (ALA, 18:3), have the beneficial property of lowering LDL This application is a divisional of U.S. Ser. No. 12/309.276, cholesterol (Mensink and Katan, 1989: Roche and Gibney, a S371 national stage of PCT International Application No. 2000), thus reducing the risk of cardiovascular disease. PCT/AU2007/000977, filed Jul 13, 2007, and claims priority Although nutritionally desirable, highly unsaturated oils of Australian Patent Application No. 2006903810, filed Jul. are too unstable for use in many food applications, particu 14, 2006, the contents of all of which are hereby incorporated larly for commercial deep-frying where they are exposed to by reference into this application. high temperatures and oxidative conditions for long periods 10 of time. Under such conditions, the oxidative breakdown of FIELD OF THE INVENTION the numerous carbon double bonds present in unsaturated oils results in the development of short-chain aldehyde, hydrop The present invention relates to rice oil, rice bran and rice eroxide and keto derivatives, imparting undesirable flavours seeds which have altered levels of oleic acid, palmitic acid and reducing the frying performance of the oil by raising the and/or linoleic acid. The present invention also provides 15 level of polar compounds (Changet al., 1978; Williams et al., methods for genetically modifying rice plants such that rice 1999). oil, rice bran and rice seeds produced therefrom have altered Oil processors and food manufacturers have traditionally levels of oleic acid, palmitic acid and/or linoleic acid. relied on hydrogenation to reduce the level of unsaturated fatty acids in oils, thereby increasing their oxidative stability BACKGROUND OF THE INVENTION in frying applications and also providing Solid fats for use in margarine and shortenings. Hydrogenation is a chemical pro Plant oils are an important source of dietary fat for humans, cess that reduces the degree of unsaturation of oils by con representing about 25% of caloric intake in developed coun Verting carbon double bonds into carbon single bonds. Com tries (Broun et al., 1999). The current world production of plete hydrogenation produces a fully Saturated fat. However, plant oils is about 110 million tones per year, of which 86% is 25 the process of partial hydrogenation results in increased lev used for human consumption. Almost all of these oils are els of both saturated fatty acids and monounsaturated fatty obtained from oilseed crops such as Soybean, canola, Sun acids. Some of the monounsaturates formed during partial flower, cottonseed and groundnut, or plantation trees such as hydrogenation are in the trans isomer form (such as elaidic palm, olive and coconut (Gunstone, 2001: Oil World Annual, acid, a trans isomer of oleic acid) rather than the naturally 2004). The growing scientific understanding and community 30 occurring cis isomer (Sebedio et at, 1994: Fernandez San recognition of the impact of the individual fatty acid compo Juan, 1995). In contrast to cis-unsaturated fatty acids, trans nents of food oils on various aspects of human health is fatty acids are now known to be as potent as palmitic acid in motivating the development of modified vegetable oils that raising serum LDL cholesterol levels (Mensink and Katan, have improved nutritional value while retaining the required 1990; Noakes and Clifton, 1998) and lowering serum HDL functionality for various food applications. These modifica 35 cholesterol (Zock and Katan, 1992), and thus contribute to tions require knowledge about the metabolic pathways for increased risk of cardiovascular disease (Ascherio and Wil plant fatty acid synthesis and genes encoding the enzymes for lett, 1997). As a result of increased awareness of the anti these pathways (Liu et al., 2002a: Thelen and Ohlrogge, nutritional effects of trans-fatty acids, there is now a growing 2002). trend away from the use of hydrogenated oils in the food Considerable attention is being given to the nutritional 40 industry, in favour of fats and oils that are both nutritionally impact of various fats and oils, in particular the influence of beneficial and can provide the required functionality without the constituents of fats and oils on cardiovascular disease, hydrogenation, in particular those that are rich in either oleic cancer and various inflammatory conditions. High levels of acid where liquid oils are required or Stearic acid where a cholesterol and saturated fatty acids in the diet are thought to solid or semi-solid fat is preferred. increase the risk of heart disease and this has led to nutritional 45 Plant oils are composed almost entirely of triacylglycerols advice to reduce the consumption of cholesterol-rich Satu (TAG) molecules, which consist of three fatty acid (acyl) rated animal fats in favour of cholesterol-free unsaturated chains esterified to a glycerol backbone and are deposited in plant oils (Liu et al., 2002a). While dietary intake of choles specialised oil body structures called oleosomes (Stymne and terol present in animal fats can significantly increase the Stobart, 1987). These storage lipids serve as an energy source levels of total cholesterol in the blood, it has also been found 50 for the germinating seedling until it is able to photosynthe that the fatty acids that comprise the fats and oils can them sise. Edible plant oils in common use are generally comprised selves have significant effects on blood serum cholesterol of five main fatty acids—the Saturated palmitic and Stearic levels. Of particular interest is the effect of dietary fatty acids acids, the monounsaturated oleic acid, and the polyunsatu on the undesirable low density lipoprotein (LDL) and desir rated linoleic and C-linolenic acids. In addition to fatty acids, able high density lipoprotein (HDL) forms of cholesterol in 55 plant oils also contain some important minor components the blood. In general, Saturated fatty acids, particularly myris Such as tocopherols, phytosterols, terpenes and mixed iso tic acid (14:0) and palmitic acid (16:0), the principal saturates prenoids. These minor constituents are of increasing interest present in plant oils, have the undesirable property of raising because some have been shown to exert beneficial effects on serum LDL-cholesterol levels and consequently increasing skin health, aging, eyesight and blood cholesterol or prevent the risk of cardiovascular disease (Zocket al., 1994; Hu et al., 60 ing breast cancer or cardiovascular disease (Theriault et al., 1997). However, it has become well established that stearic 1999; Moghadasian and Frohlich, 1999). acid (18:0), the other main Saturate present in plant oils, does Fatty Acid and TAG Synthesis in Seeds not raise LDL-cholesterol, and may actually lower total cho A diagrammatic overview of the metabolic pathways for lesterol (Bonanome and Grundy, 1988; Dougherty et al., fatty acids synthesis in developing seeds is shown in FIG. 1. 1995). Stearic acid is therefore generally considered to be at 65 The initial stages of fatty acid synthesis occur in the plastid least neutral with respect to risk of cardiovascular disease compartments of the cell, where synthesis offatty acid carbon (Tholstrup, et al., 1994). On the other hand, unsaturated fatty chains is initiated with a C2 molecule and extended through a US 9,351,507 B2 3 4 stepwise condensation process whereby additional C2 carbon Fatty Acids in Cereals units are donated from malonyl-ACP to the elongating acyl In contrast to the considerable work done on fatty acid chains. The first step in this sequence involves acetyl-CoA biosynthesis and modification in oilseeds, oil modification in condensing with malonyl-ACP and is catalysed by the B-ke cereals is relatively unexplored. This is probably due to the toacyl synthase III (KASIII) enzyme. The subsequent con much lower levels of oils (about 1.5-6% by weight) in cereal densation rounds are catalysed by B-ketoacyl synthase I grains and consequently the perceived lower importance of (KASI) and result in the eventual formation of a saturated oils from cereals in the human diet. C16 acyl chain joined to acyl carrier protein (ACP), palmi Rice (Oryza sativa L.) is the most important cereal crop in toyl-ACP. The final elongation within the plastid is catalysed the developing world and is grown widely, particularly in by B-ketoacyl synthase II (KASII) to form the saturated C18 10 acyl chain, stearoyl-ACP. When desaturation occurs, the first Asia which produces about 90% of the world total. The vast double bond is introduced into the A9 position of the C18 majority of rice in the world is eaten as “white rice' which is chain by a soluble enzyme in the plastid, stearoyl-ACPA9-de essentially the endosperm of the rice grain, having been pro saturase, to yield the monounsaturated C18:1 oleoyl-ACP. duced by milling of harvested grain to remove the outer bran Fatty acids thus synthesised are either retained in the plas 15 layer and germ (embryo and Scutellum). This is done prima tid for further modification and incorporation into plastidic rily because “brown rice' does not keep well on storage, lipids, or are released from their ACPs by acyl-thioesterases particularly under hot tropical conditions. to produce free fatty acids which are exported into the cytosol The oil content of cereal grains such as rice (4%) is quite for further modification and eventual incorporation into TAG low relative to oilseeds where oil can make up to 60% of the molecules. Higher plants have been found to have at least two weight of the grain (Ohlrogge and Jaworski, 1997). However, types of acyl-thioesterase, Fat A with substrate specificity lipids may still comprise up to 37% of the dry weight of the towards oleoyl-ACP, an unsaturated acyl-ACP, and FatB with cereal embryo (Choudhury and Juliano 1980). Most of the preference for saturated acyl-ACPs (Jones et al., 1995; lipid content in the rice grain is found in the outer bran layer Voelker et al., 1996). (Resurreccion et al., 1979) but some is also present in the On exiting the plastids, free fatty acids become esterified to 25 endosperm, at least some associated with the starch (Tables 1 Co-enzyme A (CoA) and are then available for transfer to and 2). The main fatty acids in rice oil are palmitic (16:0) glycerol 3-phosphate (G-3-P) backbones to form lysophos (about 20% of total fatty acids in the TAG), oleic (18:1) (about phatidic acid (LPA), phosphatidic acid (PA) and phosphati 40%), and linoleic acids (18:2) (about 34%) (Radcliffe et at, dyl-choline (PC). Additionally, in some plants, notably the 1997). There is a range of levels naturally occurring in differ Brassica species, oleic acid esterified to CoA is able to be 30 elongated to form eicosenoic acid (C20:1) and erucic acid ent rice cultivars, for example for oleic acid, from 37.9% to (C22:1). Oleic acid esterified to PC is available for further 47.5% and for linoleic (18:2), from 38.2% to 30.4% (Taira et modification before incorporation into TAG. In edible oils, al., 1988). the principal modifications on PC are the sequential desatu TABLE 1 rations of oleic acid to form linoleic and O-linolenic acids by 35 the microsomal A12-desaturase (Fad2) and A15-desaturase Typical fatty acid composition (wt % of total fatty acids) (Fad3) enzymes respectively. for selected fatty acids of various plant oils. Modification of Existing Fatty Acid Biosynthetic Enzymes Gene inactivation approaches Such as post transcriptional Plant 16:O 18:1 18:2 gene silencing (PTGS) have been successfully applied to 40 Barley 18 22 S4 inactivate fatty acid biosynthetic genes and develop nutrition Soybean 11 23 51 Peanut 8 50 36 ally improved plant oils in oilseed crops. For example, Soy Canola 4 63 2O bean lines with 80% oleic acid in their seed oil were created Olive 15 75 9 by coSuppression of the Fad2 encoded microsomal A12-de Rice bran 22 38 34 saturase (Kinney, 1996). This reduced the level of A12-de 45 saturation and resulted in accumulation of high amounts of While the FatB gene has been shown to have a high affinity oleic acid. Using a similar approach, coSuppression-based to catalysing the production of free palmitic acid which is silencing of the Fad2 gene was used to raise oleic acid levels Subsequently converted to palmitoyl-CoA in oilseed plants in Brassica napus and B. juncea (Stoutesdijk et al., 2000). and dicot plants, no information is reported on the role of FatB Likewise, transgenic expression in cottonseed of a mutant 50 in rice or other cereals. allele of the Fad2 gene obtained from rapeseed was found to be able to suppress the expression of the endogenous cotton Fad2 gene and resulted in elevated oleic acid content in about TABLE 2 half of the primary transgenic cotton lines (Chapman et al., Fatty acid composition (wt % of total fatty acids) for selected 2001). In another variation, transgenic expression in Soybean 55 fatty acids of plant lipids associated with starch. of a Fad2 gene terminated by a self-cleaving ribozyme was able to inactivate the endogenous Fad2 gene resulting in Plant 16:O 18:1 18:2 increased oleic acid levels (Buhr et al., 2002). RNAi-medi Wheat 35-44 6-14 42-52 ated gene silencing techniques have also been employed to Barley 55 4 36 Rye 23 41 35 develop oilseeds with nutritionally-improved fatty acid com 60 Oat 40 22 35 position. In cottonseed, transgenic expression of a hairpin Maize 37 11 46 RNA (hpRNA) gene silencing construct targeted against Maize- High amylose 36 2O 38 ghFad2-1, a seed-specific member of cotton Fad2 gene fam Maize-waxy 36 23 36 Millet 36 28 29 ily, resulted in the increase of oleic acid from normal levels of Rice 37-48 9-18 29-46 15%up to 77% of total fatty acids in the oil (Liu et al., 2002b). 65 This increase was mainly at the expense of linoleic acid which Data adapted from: Morrison (1988). was reduced from normal levels of 60% downto as low as 4%. US 9,351,507 B2 5 6 Some of the fatty acid desaturases have been characterized There is still a need for cereal, such as rice, varieties that in rice but not Fad2. Akagaietal, (1995) published the nucle produce grain with an improved oil composition for health otide sequence of a gene on rice chromosome 4 encoding benefits, which at the same time is more stable on storage, Stearoyl-acyl carrier protein desaturase from developing allowing greater use of for example, brown rice in the human seeds. The gene product participates in the production of 5 diet. oleoyl ACP from stearoyl ACP. Kodama et al. (1997) reported the structure, chromosomal location and expression of Fad3 SUMMARY OF THE INVENTION in rice. The proportion of linolenic acid (18:3) in rice seed oil has In one aspect, the present invention provides rice oil having been increased ten-fold by using Soybean Fad3 expression 10 a fatty acid composition comprising greater than about 48% (Anal et al., 2003). More recently, there have been reports of oleic acid, less than about 17% palmitic acid, less than about the production of conjugated linoleic acid in rice by introduc 30% linoleic acid and/or any combination thereof. tion of a linoleate isomerase gene from bacteria (Kohno In an embodiment, the ratio of oleic acid to linoleic acid is Murase et al., 2006); conjugated linoleic acid is reported to greater than 1.5:1, preferably greater than 2:1, more prefer have anti-carcinogenic activity. In a similar vein, in vitro 15 modification of rice bran oil to incorporate capric acid, which ably greater than 3:1, and even more preferably greater than may improve dietary lipid utilisation in Some diseases, using 4:1. immobilized microbial enzymes has also been reported (Jen In another embodiment, the rice oil has a fatty acid com nings and Akoh, 2000). In maize, Fad2 and FA-6 desaturase position comprising greater than about 48% oleic acid, less genes have been sequenced and mapped to chromosomes than about 17% palmitic acid, and less than about 30% (Mikkilinen and Rocheford, 2003). The Fad2 and Fadé clones linoleic acid. could not be mapped to any QTLS for oleic/linoliec acid ratios In a further embodiment, the rice oil has a fatty acid com in the maize grain. There are no published reports of other position comprising greater than about 40% oleic acid, pref Fad2 or FatB genes characterized from rice, maize or wheat. erably greater than about 50% oleic acid, and even more Storage of Rice 25 preferably greater than about 60% oleic acid. In an embodi Storage of rice for prolonged times at high temperatures ment, the fatty acid composition of the rice oil is in the range impairs grain quality due to hydrolytic and oxidative deterio 48-80% oleic acid, 6-16% palmitic acid and 10-25% linoleic ration of bran oil. Dehulling the outer husk during harvest to acid. produce brown rice disturbs the outer bran layers, which In yet another embodiment, the rice oil has a fatty acid allows the oil to diffuse to the outer layers. Endogenous and 30 composition comprising less than about 16% palmitic acid, microbial lipases then catalyse the hydrolysis of triglycerides preferably less than about 15% palmitic acid, more preferably to free fatty acids (FFA) which are then oxidised to produce an less than about 14% palmitic acid, more preferably less than off-flavour (Yasumatsu et al., 1966, Tsuzuki et al., 2004, Thou about 13% palmitic acid, and even more preferably less than et al., 2002 Champagne and Grimm, 1995). about 12% palmitic acid. Hexanal is the major component increased in the head 35 In another embodiment, the rice oil has a fatty acid com space of raw and cooked brown rice stored at high tempera position comprising less than about 25% linoleic acid, pref tures (Boggs et al., 1964, Shibuya et al., 1974, Tsugita et al., erably less than about 20% linoleic acid, even more prefer 1983). However, hexanal itself is not the main cause of the ably less than about 15% linoleic acid. off smell; the unattractive smell and flavour of deteriorated In another aspect the present invention provides rice bran rice is probably due to a mixture of the volatiles that are 40 having a fatty acid composition comprising greater than about increased after storage. These include alkanals, alkenals, aro 48% oleic acid, less than about 17% palmitic acid, less than matic aldehydes, ketones, 2-pentylfuran, 4-vinylphenol and about 30% linoleic acid and/or any combination thereof. others (Tsugita et al., 1983). Nevertheless, hexanal levels In an embodiment, the ratio of oleic acid to linoleic acid is during storage have been shown to be associated with the greater than 1.5:1, preferably greater than 2:1, more prefer oxidation of linoleic acid (18:2) in brown rice and therefore 45 ably greater than 3:1, and even more preferably greater than are a good indicator of oxidative deterioration (Shin et al., 4:1. 1986). In another embodiment, the rice bran has a fatty acid com The production of hexanal from linoleic acid can be cataly position comprising greater than about 48% oleic acid, less sed by the enzyme lipoxygenase (LOX) (St Angelo et al., than about 17% palmitic acid, and less than about 30% 1980). Suzuki et al. (1999) identified rice varieties lacking 50 linoleic acid. Lox3 and found that on storage of the mutant grain at 35°C. In a further embodiment, the rice bran has a fatty acid for 8 weeks, less hexanal was formed in the headspace composition comprising greater than about 40% oleic acid, vapour, both for raw and cooked brown rice grain. They also preferably greater than about 50% oleic acid, and even more found that mutant rice formed less pentanal and pentanol. preferably greater than about 60% oleic acid. In an embodi The nutrient-rich outer rice bran layer obtained through 55 ment, the fatty acid composition of the rice bran is in the range polishing the outer layers of the rice grain is an excellent food 48-80% oleic acid, 6-16% palmitic acid and 10-25% linoleic Source, containing antioxidant compounds such as tocot acid. rienols and gamma-oryZanol which is also a phytoestrogen In yet another embodiment, the rice bran has a fatty acid (Rukmini and Raghuram, 1991). The bioactive compounds composition comprising less than about 16% palmitic acid, present in rice bran oil have been found to lower cholesterol in 60 preferably less than about 15% palmitic acid, more preferably humans (Most et al., 2005). These bioactive components have less than about 14% palmitic acid, more preferably less than also been shown to improve lipid profiles in rats fed a high about 13% palmitic acid, and even more preferably less than cholesterol diet (Ha et al., 2005). Another important compo about 12% palmitic acid. nent found primarily in the bran is vitamin A precursors. In another embodiment, the rice bran has a fatty acid com However, these nutritional and health benefits are lost 65 position comprising less than about 25% linoleic acid, pref through the polishing of rice and the consumption of white erably less than about 20% linoleic acid, even more prefer 1C. ably less than about 15% linoleic acid. US 9,351,507 B2 7 8 In a further aspect, the present invention provides a rice otide which comprises at least 19 contiguous nucleotides of seed having a fatty acid composition comprising greater than any one or more of the sequence of nucleotides provided as about 48% oleic acid, less than about 17% palmitic acid, leas SEQID NOs 5 to 8, 11 to 14 or 19 to 25, wherein the portion than about 30% linoleic acid and/or any combination thereof. of the molecule that is double stranded is at least 19 basepairs In an embodiment, the ratio of oleic acid to linoleic acid is in length and comprises said oligonucleotide. greater than 1.5:1, preferably greater than 2:1, more prefer Preferably, the dsRNA is expressed from a single promoter, ably greater than 3:1, and even more preferably greater than wherein the strands of the double stranded portion are linked 4:1. by a single stranded portion. Examples of the construction of In another embodiment, the rice seed has a fatty acid com vectors to produce such dsRNA molecules is provided in position comprising greater than about 48% oleic acid, less 10 Example 5. than about 17% palmitic acid, and less than about 30% In a preferred embodiment, the polynucleotide, or a strand linoleic acid. thereof, is capable of hybridising to a polynucleotide com In a further embodiment, the rice seed has a fatty acid prising any one or more of the sequence of nucleotides pro composition (i.e. of the oil inside the seed) comprising greater vided as SEQ ID NOs 5 to 8, 11 to 14 or 19 to 25 under than about 40% oleic acid, preferably greater than about 50% 15 stringent conditions. oleic acid, and even more preferably greater than about 60% In a further aspect, the present invention provides a method oleic acid. of identifying a polynucleotide which, when present in a cell In an embodiment, the fatty acid composition of the rice of a rice plant, down-regulates the level of activity of a Fad2 seed is in the range 48-80% oleic acid, 6-16% palmitic acid and/or FatB polypeptide in the cell when compared to a cell and 10-25% linoleic acid. that lacks said polynucleotide, the method comprising In yet another embodiment, the rice seed has a fatty acid i) determining the ability of a candidate polynucleotide to composition comprising less than about 16% palmitic acid, down-regulate the level of activity of a Fad2 and/or FatB preferably less than about 15% palmitic acid, more preferably polypeptide in a cell, and less than about 14% palmitic acid, more preferably less than ii) selecting a polynucleotide which down-regulated the about 13% palmitic acid, and even more preferably less than 25 level of activity of a Fad2 and/or FatB polypeptide in the cell. about 12% palmitic acid. Step i) can rely on, for example, analysing the amount or In another embodiment, the rice seed has a fatty acid com enzymatic activity of a Fad2 and/or FatB polypeptide, or the position comprising less than about 25% linoleic acid, pref amount of mRNA encoding a Fad2 and/or FatB polypeptide erably less than about 20% linoleic acid, even more prefer in the cell. Alternatively, step i) may comprise analysing the ably less than about 15% linoleic acid. 30 fatty acid content of the cell, or a seed or plant comprising said In any of the embodiments described above for rice bran or cell. Preferably, step i) comprises the introduction of the rice seed, the fatty acid composition is typically determined candidate polynucleotide or a chimeric DNA including a by extraction of the oil and analysis by FAME/GC as promoter operably linked to the candidate polynucleotide described in Example 1. Compositions for individual fatty into a plant cell, more preferably into a rice cell, and even acids are expressed as percent (w/w) of the total fatty acids in 35 more preferably comprises the step of regenerating a trans the oil. genic plant from the plant cell and the production of seed from In a further aspect, provided is a rice plant which produces the transgenic plant. The candidate gene may be one of a rice oil of the invention, rice bran of the invention, and/or a collection of candidate genes, at least 2 or 3 in number. The rice seed of the invention. invention therefore provides for the use of the polynucle In another aspect, the present invention provides an iso 40 otides of the invention in a screening method. lated polynucleotide which, when present in a cell of a rice The polynucleotide can be, but not limited to, an antisense plant, down-regulates the level of activity of a Fad2 and/or polynucleotide, a sense polynucleotide, a catalytic polynucle FatB polypeptide in the cell when compared to a cell that otide, a microRNA, a polynucleotide which encodes a lacks said polynucleotide. polypeptide which binds a Fad2 or FatB polypeptide and a Preferably, the polynucleotide is operably linked to a pro 45 double stranded RNA. moter capable of directing expression of the polynucleotide In an embodiment, the antisense polynucleotide hybridises in a cell of a rice plant. under physiological conditions to a polynucleotide compris In an embodiment, the polynucleotide down-regulates ing any one or more of the sequence of nucleotides provided mRNA levels expressed from at least one Fad2 and/or FatB as SEQ II) NOs 5 to 8, 11 to 14 or 19 to 25. gene. 50 In another embodiment, the catalytic polynucleotide is Examples of suitable polynucleotides include, but are not capable of cleaving a polynucleotide comprising any one or limited to, a polynucleotide selected from: an antisense poly more of the sequence of nucleotides provided as SEQID NOS nucleotide, a sense polynucleotide, a catalytic polynucle 5 to 8, 11 to 14 or 19 to 25. otide, a microRNA, a polynucleotide which encodes a In a further embodiment, the double stranded RNA polypeptide which binds a Fad2 or FatB polypeptide and a 55 (dsRNA) molecule comprises an oligonucleotide which com double stranded RNA. prises at least 19 contiguous nucleotides of any one or more of In an embodiment, the polynucleotide is an antisense poly the sequence of nucleotides provided as SEQID NOs 5 to 8, nucleotide which hybridises under physiological conditions 11 to 14 or 19 to 25, wherein the portion of the molecule that to a polynucleotide comprising any one or more of the is double stranded is at least 19 basepairs in length and com sequence of nucleotides provided as SEQNOs 5 to 8, 11 to 14 60 prises said oligonucleotide. or 19 to 25. Also provided is an isolated polynucleotide identified In a further embodiment, the polynucleotide is a catalytic using a method of the invention. polynucleotide capable of cleaving a polynucleotide com In a further aspect the present invention provides a vector prising any one or more of the sequence of nucleotides pro comprising or encoding a polynucleotide of the invention. vided as SEQID NOs 5 to 8, 11 to 14 or 19 to 25. 65 Preferably, the polynucleotide, or sequence encoding the In another embodiment, the polynucleotide is a double polynucleotide, is operably linked to a promoter. Preferably, stranded RNA (dsRNA) molecule comprising an oligonucle the promoter confers expression of the polynucleotide pref US 9,351,507 B2 10 erentially in the embryo, endosperm, bran layer and/or seed In a further embodiment, step i) comprises analysing the of a rice plant relative to at least one other tissue or organ of fatty acid composition of the oil, bran and/or seed of the said plant. mutagenized seed and/or plant. Also provided is a cell comprising the vector of the inven In a further aspect, the present invention provides a method tion, and/or the polynucleotide of the invention. of selecting a rice plant which can be used to produce rice oil In an embodiment, the polynucleotide or vector was intro of the invention, rice bran of the invention and/or rice seed of duced into the cell or a progenitor of the cell. the invention, the method comprising In a further embodiment, the cell is a rice cell or an Agro i) analysing the fatty acid content of said rice oil, rice bran bacterium cell. and/or seed obtained from a candidate rice plant, and Preferably, the polynucleotide is integrated into the 10 genome of the cell. ii) selecting a rice plant which can be used to produce rice In another aspect, the present invention provides a rice oil of the invention, rice bran of the invention and/or rice seed plant comprising a cell of the invention. of the invention. In yet another aspect, the present invention provides a In yet a further aspect, the present invention provides a method of producing the cell of the invention, the method 15 method of selecting a rice plant which can be used to produce comprising the step of introducing the polynucleotide of the rice oil of the invention, rice bran of the invention and/or rice invention, or a vector of the invention, into a cell. seed of the invention, the method comprising Preferably the method further comprises the step of regen i) analysing a sample from a candidate plant for a polypep erating a transgenic plant from the cell. tide which has Fad2 or FatB activity, and Also provided is the use of the polynucleotide of the inven ii) selecting a rice plant which can be used to produce rice tion or a vector of the invention to produce a recombinant cell. oil of the invention, rice bran of the invention and/or rice seed In yet another aspect, the present invention provides a of the invention based on the sequence, level of production genetically modified rice plant, wherein the plant has and/or activity of said polypeptide. decreased expression of a polypeptide having Fad2 and/or In another aspect, the present invention provides a method FatB activity relative to a corresponding non-modified plant. 25 of selecting a rice plant which can be used to produce rice oil Preferably, the plant has been transformed such that it of the invention, rice bran of the invention and/or rice seed of comprises a polynucleotide of the invention, or a progeny the invention, the method comprising plant thereof which comprises said polynucleotide. i) analysing the sequence and/or expression levels of a In a further aspect the present invention provides a method Fad2 or FatB gene of a candidate plant, and of producing rice oil of the invention, rice bran of the inven 30 ii) selecting a rice plant which can be used to produce rice tion and/or rice seed of the invention, the method comprising oil of the invention rice bran of the invention and/or rice seed exposing a rice plant to an antagonist of a Fad2 or FatB of the invention based on the sequence and/or expression polypeptide. levels of said gene. In another aspect, the present invention provides a method In yet another aspect the present invention provides a of obtaining a genetically modified rice plant which can be 35 method of identifying a rice plant which can be used to used to produce brown rice seed with an increased storage life produce rice oil of the invention, rice bran of the invention when compared to unmodified brown rice seed, the method and/or rice seed of the invention, the method comprising comprising genetically manipulating the plant Such that the detecting a nucleic acid molecule of the plant, wherein the activity and/or level of production of a Fad2 and/or FatB nucleic acid molecule is linked to, and/or comprises at least a polypeptide is reduced in the rice seed when compared to a 40 part of a Fad2 gene and/or FatB gene in the plant. corresponding plant which produces unmodified brown rice In a further aspect, the present invention provides a method seed. of identifying a rice plant which can be used to produce brown Preferably, the activity and/or level of production of a Fad2 rice seed with an increased storage life, the method compris and/or FatB polypeptide is only reduced in the seed of the ing detecting a nucleic acid molecule of the plant, wherein the plant. 45 nucleic acid molecule is linked to, and/or comprises at least a In an embodiment, the activity and/or level of production part of a Fad2 gene and/or FatB gene in the plant. of a Fad2 polypeptide is reduced. In an embodiment, the above two methods comprise: In a further embodiment, the transgenic plant comprises a i) hybridising a second nucleic acid molecule to said nucleic polynucleotide of the invention or a vector of the invention. acid molecule which is obtained from said plant, In a further aspect, the present invention provides a geneti 50 ii) optionally hybridising at least one other nucleic acid mol cally modified rice plant produced using a method of the ecule to said nucleic acid molecule which is obtained from invention, or progeny thereof. said plant; and In a further aspect, the present invention provides a method iii) detecting a product of said hybridising step(s) or the of selecting a rice plant which can be used to produce rice oil absence of a product from said hybridising step(s). of the invention, rice bran according to the invention and/or 55 In an embodiment, the second nucleic acid molecule is rice seed of the invention, the method comprising: used as a primer to reverse transcribe or replicate at least a i) screening a mutagenized population of rice seeds or rice portion of the nucleic acid molecule. plants, and The nucleic acid can be detected using any technique Such ii) selecting a seed or plant which is capable of producing as, but not limited to, restriction fragment length polymor rice oil of the invention, rice bran of the invention and/or rice 60 phism analysis, amplification fragment length polymorphism seed of the invention. analysis, microsatellite amplification and/or nucleic acid In one embodiment, step i) comprises analysing a sequencing. mutagenized seed and/or plant for a polypeptide which has In an embodiment, the method comprises nucleic acid Fad2 or FatB activity. amplification. In another embodiment, the method analyses In another embodiment, step i) comprises analysing the 65 expression levels of the gene. sequence and/or expression levels of a Fad2 or FatB gene of Also provided is a method of obtaining a rice plant or seed, the mutagenized seed and/or plant. the method comprising: US 9,351,507 B2 11 12 i) crossing a first parental rice plant which comprises a Fad2 As will be apparent, preferred features and characteristics allele which confers an increased proportion of oleic acid in of one aspect of the invention are applicable to many other oil of the grain of the plant with a second parental rice plant aspects of the invention. which comprises a FatB allele which confers a decreased Throughout this specification the word “comprise', or proportion of palmitic acid in oil of the grain of the plant; variations such as "comprises' or “comprising, will be ii) screening progeny plants or grain from the cross for the understood to imply the inclusion of a stated element, integer presence of both alleles; and or step, or group of elements, integers or steps, but not the iv) selecting a progeny plant or grain comprising both alleles exclusion of any other element, integer or step, or group of and having an increased proportion of oleic acid and a elements, integers or steps. decreased proportion of palmitic acid in oil of the grain of the 10 plant. The invention is hereinafter described by way of the fol In another aspect, the present invention provides a method lowing non-limiting Examples and with reference to the of introducing a Fad2 allele into a rice plant, the method accompanying figures. comprising BRIEF DESCRIPTION OF THE i) crossing a first parental rice plant with a second parental 15 rice plant, wherein the second plant comprises said allele, and ACCOMPANYING DRAWINGS ii) backcrossing the progeny of the cross of step i) with plants of the same genotype as the first parent plant for a sufficient FIG.1—Principal fatty acid biosynthetic pathways in plas number of times to produce a plant with a majority of the tid and cytosol of higher plants. genotype of the first parent but comprising said allele FIGS. 2(A)-(B)—Alignment of rice FatB proteins. iii) selecting a plant with the majority of the genotype of the ProteinFA1B2=SEQ ID NO:1, proteinFATB3=SEQ ID first plant and comprising said allele; NO:2, proteinFATB1=SEQ ID NO:3 and wherein said allele confers an increased proportion of oleic proteinFATB4=SEQ ID NO:4. acid in oil, bran and/or seed of the plant FIG. 3 Rice FatB gene structures. LOC Os02.g4=SEQ In yet another aspect, the present invention provides a 25 ID NO:5, LOC Os11.g4=SEQID NO:6, LOC Os06g.0=SEQ method of introducing a FatB allele into a rice plant, the ID NO:7 and LOC Os06g3=SEQID NO:8. method comprising FIGS. 4(A)-(L)—Alignment of FatB gene sequences by i) crossing a first parental rice plant with a second parental ClustalW. Default parameters were used and note that the rice plant, wherein the second plant comprises said allele, and genes are of different lengths. ii) backcrossing the progeny of the cross of step i) with plants 30 FIGS. 5(A)-(C). The exon-intron structures of the FatB of the same genotype as the first parent plant for a sufficient gene corresponding to LOC Os6g05.130. The top line corre number of times to produce a plant with a majority of the sponds to the start of the coding sequence in mRNA (SEQID genotype of the first parent but comprising said allele NO:9) and the second line of the pair corresponds to the gene iii) selecting a plant with the majority of the genotype of the (SEQID NO:10). first plant and comprising said allele; 35 FIGS. 6(A)-(B)—Alignment of coding sequence of four wherein said allele confers a decreased proportion of palmitic FatB isoforms showing consecutive exons in alternating acid in oil, bran and/or seed of the plant. lower case and upper case respectively and location of prim Further, provided is a method of increasing the proportion ers (underlined) used to distinguish the isoforms by RT-PCR. of oleic acid in oil, branand/or seed of a rice plant, the method The initiating codon (start position 1) is in bold. comprising genetically manipulating said plant such that the 40 ACI08870-SEQ ID NO:1 I, AP005291=SEQ ID NO:12, production of a Fad2 polypeptide is decreased when com AP000399–SEQID NO:13 and AP004236=SEQID NO: 14. pared to a wild-type plant, wherein the polypeptide has A12 FIGS. 7(A)-(B) ClustalW alignment of deduced polypep desaturase activity. tide sequence of Fad2 isoforms. Note that line F 1 corre In yet another aspect, the present invention provides a sponds to Os02.g48S60, F 2 corresponds to Os07g23410, method of decreasing the proportion of palmitic acid in oil, 45 F 3 to Os07g23430 and O 4 to Os07g23390. The program bran and/or seed of a rice plant, the method comprising ClustalW (Fast) with default parameters was used. genetically manipulating said plant such that the production ProteinF_1=SEQ ID NO:15, ProteinF_3=SEQ ID NO:16, of a FatB polypeptide is decreased when compared to a wild ProteinF_2=SEQID NO:17 and ProteinF 4=SEQID NO:18, type plant, wherein the polypeptide has (FatB) activity. FIGS. 8(A)-(B)—Alignment of Fad2 sequences showing Also provided is a rice plant obtained using a method of the 50 location of 5' UTR in isoform AP004.047 (lowercase) and invention, or progeny plant thereof. location of primers used for amplification by RT-PCR (under In a further aspect, the present invention provides rice oil lined). The location of the stop codon is indicated by a box obtained from a plant of the invention. and untranslated regions downstream of the stop codon are in In a further aspect, the present invention provides rice bran lower case. AP005168=SEQID NO:19, AP004.047=SEQID obtained from a plant of the invention. 55 NO:20 and Contig2654=SEQID NO:21. In a further aspect, the present invention provides rice seed FIG.9—Rice Fad2 gene structures. obtained from a plant of the invention. FIGS. 10(A)-(D)—Alignment of the nucleotide sequences Further, provided is a method of producing seed, the of the protein coding regions for rice Fad2 genes. Line 0 2 method comprising: corresponds to Os07g23410, 0 4 to Os07g23390, 0 1 to a) growing a plant of the invention, and 60 Os02.g48560 and 0 3 to Os07g23410. The program ClustalW b) harvesting the seed. with default parameters was used. CdsFAD20 2=SEQ ID In yet another aspect, the present invention provides a food NO:22, CdsFAD20 4=SEQID NO:23, CdsFAD20 1=SEQ product comprising rice oil of the invention, rice bran of the ID NO:24 and CdsFAD203=SEQID NO:25. invention and/or rice seed of the invention. FIG. 11—Graphical representation of the relative percent In another aspect, the present invention provides a method 65 ages of palmitic, oleic and linoleic acid as determined by GC of preparing food, the method comprising cooking an edible analysis of total oil fraction from grains of indicated geno substance in rice oil of the invention. types. US 9,351,507 B2 13 14 FIG. 12 Graphical representation of the relative percent SEQID NO:26—FatB consensus sequence. ages of palmitic and oleic acid in a GC total lipid analysis SEQID NOS 27 to 33—Fad2 consensus sequences. from grains of the genotypes indicated. SEQ ID NOS 34 to 55 and 60 to 63 Oligonucleotide FIG. 13 Graphical representation of the relative percent SEQ ID NOS 56 to 59 Antigenic rice FatB peptides. ages of linoleic and oleic acid in a GC total lipid analysis from SEQID NOS 64 to 83—Sequence of one strand of molecules grains of the genotypes indicated. that can be used for RNAi. FIG. 14 Scatterplot showing the percentage of linoleic Versus oleic acid in the grain of rice plants of the indicated DETAILED DESCRIPTION OF THE INVENTION genotypes. Note that the relationship (reflected in the slope of the line) between the amounts of these two fatty acids is 10 General Techniques essentially the same in all of the lines analysed but the pool size capacity appears to be different (as reflected in the dis Unless specifically defined otherwise, all technical and placements of the different lines along the space analysed. scientific terms used herein shall be taken to have the same FIG. 15 Scatterplot of the percentage of linoleic versus meaning as commonly understood by one of ordinary skill in palmitic acid among different genotypes. Note the different 15 slopes of the lines affected in FatB compared to those affected the art (e.g., in cell culture, plant molecular biology, molecu in Fad2. This suggests the relationship between these com lar genetics, immunology, immunohistochemistry, protein ponents is different in the different genotypes, probably chemistry, and biochemistry). reflecting the differences in the steps affected. Unless otherwise indicated, the recombinant protein, cell FIG. 16—Scatterplot of the percentage of oleic versus culture, and immunological techniques utilized in the present palmitic acid for various genotypes. Note the differences in invention are standard procedures, well known to those slopes. skilled in the art. Such techniques are described and explained FIG. 17 Graphical representation of Principal Compo throughout the literature in sources such as, J. Perbal, A nent Analysis of variation in oil composition for Fad2 RNAi Practical Guide to Molecular Cloning, John Wiley and Sons plants and FatB RNAi plants. The results show that Principal 25 (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Component 2 is Linoleic versus Oleic and Principal Compo Manual, Cold Spring Harbour Laboratory Press (1989), T. A. nent 2 is Palmitic versus Linoleic plus Oleic. Brown (editor), Essential Molecular Biology: A Practical FIG. 18 Western blot showing the reaction of antisera Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover raised against peptide. FatB-99 against total leaf protein and S. D. Flames (editors), DNA Cloning: A Practical extracts analysed by SDS-PAGE. A peptide of approx 20 kDa 30 Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. is missing in the Tos-17 line. The reaction with preimmune M. Ausubel et al. (editors), Current Protocols in Molecular sera is indicated. R refers to FatB RNAi lines and T is the Biology, Greene Pub. Associates and Wiley-Interscience Tos-17 line. W and W2 are wildtype. (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold KEY TO SEQUENCE LISTING 35 Spring Harbour Laboratory, (1988), and J. E. Coligan et al. SEQ ID NO:1-Rice FatB2 protein. (editors) Current Protocols in Immunology, John Wiley & SEQ ID NO:2 Rice FatB3 protein. Sons (including all updates until present). SEQ ID NO:3—Rice FatB1 protein. SELECTED DEFINITIONS SEQ ID NO.4 Rice FatB4 protein. 40 SEQ ID NO:5—Rice FatB3 gene. SEQ ID NO:6—Rice FatB2 gene. As used herein, the term “Fad2 polypeptide' refers to a SEQ ID NO:7 Rice FatB1 gene. protein which performs a desaturase reaction converting oleic SEQ ID NO:8 Rice FatB4 gene. acid to linoleic acid. Thus, the term “Fad2 activity” refers to SEQ ID NO:9-eDNA encoding rice FatB1 protein. 45 the conversion of oleic acid to linoleic acid. These fatty acids SEQID NO:10 Gene encoding rice FatB1 protein (partial may be in an esterified form, such as, for example, as part of sequence only, see FIG. 5 includes all exon sequences and a phospholipid. Examples of rice Fad2 polypeptides include Some flanking and intron sequence). proteins comprising an amino acid sequence provided in FIG. SEQID NO: 11—Open reading frame encoding rice FatB2 7 and SEQID NOS 15 to 18, as well as variants and/or mutants protein. 50 thereof. Such variants and/or mutants may be at least 80% SEQ ID NO:12—Open reading frame encoding rice FatB3 identical, more preferably at least 90% identical, more pref protein. erably at least 95% identical, and even more preferably at SEQID NO: 13 Open reading frame encoding rice FatB1 least 99% identical to any one of the polypeptides provided in protein. FIG. 7 and SEQID NOs 15 to 18. SEQ ID NO: 14 Open reading frame encoding rice FatB4 55 A “Fad2 polynucleotide' or “Fad2 gene' encodes a Fad2 protein. polypeptide. Examples of Fad2 polynucleotides include SEQ ID NO:15 Rice Fad2 isoform 1. nucleic acids comprising a nucleotide sequence provided in SEQ ID NO:16 Rice Fad2 isoform 3. FIG. 8 or 10 and SEQ ID NOS 19 to 25, as well as allelic SEQ ID NO:17 Rice Fad2 isoform 2. variants and/or mutants thereof. Examples of Fad2 genes SEQ ID NO:18 Rice Fad2 isoform 4. 60 include nucleic acids comprising a nucleotide sequence pro SEQID NO:19 Rice Fad2-3 cDNA. vided in FIG. 8 and SEQID NOs 19 to 21, as well as allelic SEQID NO:20 Rice Fad2-1 clDNA. variants and/or mutants thereof. Such allelic variants and/or SEQID NO:21 Rice Fad2-2 clDNA. mutants may be at least 80% identical, more preferably at SEQID NO:22—Open reading frame encoding rice Fad2-2. least 90% identical, more preferably at least 95% identical, SEQID NO:23—Open reading frame encoding rice Fad2-4. 65 and even more preferably at least 99% identical to any one of SEQID NO:24 Open reading frame encoding rice Fad2-1. the polynucleotides provided in FIG. 8 and/or 10, and/or SEQ SEQID NO:25 Open reading frame encoding rice Fad2-3. ID NOS 19 to 25. US 9,351,507 B2 15 16 As used herein, the term “FatB polypeptide' refers to a itic acid to oleic acid and/or palmitic acid to linoleic acid protein which hydrolyses palmitoyl-ACP to produce free when compared to the ratio in the intact seed/grain or bran. palmitic acid. Thus, the term “FatB activity” refers to the Rice oil of the invention may further comprise non-fatty acid hydrolysis of palmitoyl-ACP to produce free palmitic acid. molecules Such as, but not limited to, Y-oryZanols and sterols. Examples of rice FatB polypeptides include proteins com Rice oil may be extracted from rice seed or bran by any prising an amino acid sequence provided FIG. 2 SEQID NOS method known in the art. This typically involves extraction 1 to 4, as well as variants and/or mutants thereof. Such vari with nonpolar solvents such as diethyl ether, petroleum ether, ants and/or mutants may be at least 80% identical, more chloroform/methanol or butanol mixtures. Lipids associated preferably at least 90% identical, more preferably at least with the starch in the grain may be extracted with water 95% identical, and even more preferably at least 99% identi 10 saturated butanol. The rice oil may be "de-gummed by meth cal to any one of the polypeptides provided in FIG.2 and SEQ ods known in the art to remove polysaccharides or treated in ID NOS 1 to 4. other ways to remove contaminants or improve purity, Stabil A “FatB polynucleotide' or “FatB gene' encodes a FatB ity or colour. The triacylglycerols and other esters in the oil polypeptide. Examples of FatB polynucleotides include may be hydrolysed to release free fatty acids, or the oilhydro nucleic acids comprising a nucleotide sequence provided in 15 genated or treated chemically or enzymatically as known in FIGS. 4 and 6 and SEQID NOs 5 to 8 and 11 to 14, as well as the art. allelic variants and/or mutants thereof. Examples of FatB Rice oil after extraction from rice seed or bran typically genes include nucleic acids comprising a nucleotide sequence comprises the group of lipids called Y-oryZanols. As used provided in FIG. 4 and SEQID NOs 5 to 8, as well as allelic herein, "comprises Y-oryzanol refers to the presence of at variants and/or mutants thereof. Such allelic variants and/or least 0.1% (w/w) Y-oryzanol compounds in the oil. The levels mutants may be at least 80% identical, more preferably at of Y-oryZanol in rice oil after extraction and before removal least 90% identical, more preferably at least 95% identical, from the TAG is typically 1.5-3.5% (w/w). The compounds and even more preferably at least 99% identical to any one of are typically a mixture of steryl and other triterpenyl esters of the polynucleotides provided in FIG. 4 and/or 6, and/or SEQ ferulic acid (4-hydroxy-3-methoxy cinnamic acid). ID NOS 5 to 8 and 11 to 14. 25 Cycloartenyl ferulate, 24-methylene cycloartanyl fendate and As used herein, the term “rice' refers to any species of the campesteryl ferulate are the predominant ferulates in oryza Genus Oryza, including progenitors thereof, as well as prog nol, with lower levels of B-sitosteryl ferulate and stigmasteryl eny thereof produced by crosses with other species. It is ferulate. The presence of Y-oryZanols is thought to help pro preferred that the plant is of a Oryza species which is com tect consumers of rice oil against chronic diseases such as mercially cultivated Such as, for example, a strain or cultivar 30 heart disease and cancer and therefore the presence of or variety of Oryza saliva or suitable for commercial produc Y-ory Zanol is advantageous. tion of grain. As used herein, the term “rice bran” refers to the layer As used herein, the term “rice oil” refers to a composition (aleurone layer) between the inner white rice grain and the obtained from the seed/grain, or a portion thereof Such as the outer hull of a rice seed/grain as well as the embryo/scutellum bran layer, of a rice plant which comprises at least 60% (w/w) 35 of the grain. The rice bran is the primary by product of the lipid. Rice oil is typically a liquid at room temperature. Pref polishing of brown rice to produce white rice. erably, the lipid comprises fatty acids that are at least 6 car As used herein, the term “increased storage life” refers to a bons in length. The fatty acids are typically in an esterified method of the invention producing a seed/grain, which upon form, such as for example as triacylglycerols, phospholipid. harvesting, can be stored as brown rice for an enhanced period Rice oil of the invention comprises oleic acid. Rice oil of the 40 of time when compared to, for example, brown rice harvested invention may also comprise at least Some other fatty acids from a wild type (non-genetically modified) rice plant. As Such as palmitic acid, linoleic acid, myristic acid, Stearic acid described herein, one measure for “increased storage life of and/or linolenic acid. The fatty acids may be free fatty acids brown rice is hexanal production following storage for at least and/or be found as triacylglycerols (TAGs). In an embodi 8 weeks at 40°C. (see Example 8). ment, at least 50%, more preferably at least 70%, more pref 45 The term “plant' includes whole plants, vegetative struc erably at least 80% of the fatty acids in rice oil of the invention tures (for example, leaves, stems), roots, floral organs/struc be found as TAGs. Rice oil of the invention can form part of tures, seed (including embryo, endosperm, and seed coat), the rice grain/seed or portion thereof Such as the aleurone plant tissue (for example, vascular tissue, ground tissue, and layer or embryo/scutellum, which together are referred to as the like), cells and progeny of the same. “rice bran”. Alternatively, rice oil of the invention has been 50 A “transgenic plant”, “genetically modified plant’ or varia extracted from rice grain/seed or rice bran. An example of tions thereof refers to a plant that contains a gene construct Such an extraction procedure is provided in Example 1. Thus, (“transgene') not found in a wild-type plant of the same in an embodiment, “rice oil of the invention is “substantially species, variety or cultivar. A “transgene' as referred to herein purified’ or “purified’ rice oil that has been separated from has the normal meaning in the art of biotechnology and one or more other lipids, nucleic acids, polypeptides, or other 55 includes a genetic sequence which has been produced or contaminating molecules with which it is associated in its altered by recombinant DNA or RNA technology and which native state. It is preferred that the substantially purified rice has been introduced into the plant cell. The transgene may oil is at least 60% free, more preferably at least 75% free, and include genetic sequences derived from a plant cell. Typi more preferably at least 90% free from other components cally, the transgene has been introduced into the plant by with which it is naturally associated. In a preferred embodi 60 human manipulation Such as, for example, by transformation ment, upon extraction the ratio of oleic acid to linoleic acid, but any method can be used as one of skill in the art recog palmitic acid to oleic acid and/or palmitic acid to linoleic acid nizes. has not been significantly altered (for example, no greater The terms “seed' and “grain” are used interchangeably than a 5% alteration) when compared to the ratio in the intact herein. “Grain generally refers to mature, harvested grain seed/grain or bran. In a further embodiment, the rice oil has 65 but can also refer to grain after imbibition or germination, not been exposed to a procedure. Such as hydrogenation, according to the context. Mature grain commonly has a mois which may alter the ratio of oleic acid to linoleic acid, palm ture content of less than about 18-20%. US 9,351,507 B2 17 18 As used herein, the term “corresponding non-modified either end and which are involved in expression of the gene. plant” refers to a wild-type plant. “Wild type', as used herein, The sequences which are located 5' of the coding region and refers to a cell, tissue or plant that has not been modified which are present on the mRNA are referred to as 5' non according to the invention. Wild-type cells, tissue or plants translated sequences. The sequences which are located 3' or may be used as controls to compare levels of expression of an downstream of the coding region and which are present on the exogenous nucleic acid or the extent and nature of trait modi mRNA are referred to as 3' non-translated sequences. The fication with cells, tissue or plants modified as described term “gene' encompasses both cDNA and genomic forms of herein. Wild-type rice varieties that are suitable as a reference a gene. A genomic form or clone of agene contains the coding standard include Nipponbare. region which may be interrupted with non-coding sequences “Nucleic acid molecule' refers to a oligonucleotide, poly 10 termed “introns' or “intervening regions” or “intervening nucleotide or any fragment thereof. It may be DNA or RNA of sequences.” Introns are segments of a gene which are tran genomic or synthetic origin, double-stranded or single scribed into nuclear RNA (hnRNA); introns may contain Stranded, and combined with carbohydrate, lipids, protein, or regulatory elements such as enhancers. Introns are removed other materials to perform a particular activity defined herein. or “spliced out from the nuclear or primary transcript: The terms “nucleic acid molecule' and “polynucleotide' are 15 introns therefore are absent in the messenger RNA (mRNA) used herein interchangeably. transcript. The mRNA functions during translation to specify The % identity of a polynucleotide is determined by GAP the sequence or order of amino acids in a nascent polypeptide. (Needleman and Wunsch, 1970) analysis (GCG program) The term “gene' includes a synthetic or fusion molecule with a gap creation penalty-5, and a gap extension pen encoding all or part of the proteins of the invention described alty=0.3. Unless stated otherwise, the query sequence is at herein and a complementary nucleotide sequence to any one least 45 nucleotides in length, and the GAP analysis aligns the of the above. two sequences over a region of at least 45 nucleotides. Pref As used herein, the term “genetically linked' or similar erably, the query sequence is at least 150 nucleotides in refers to a marker locus and a second locus being Sufficiently length, and the GAP analysis aligns the two sequences over a close on a chromosome that they will be inherited together in region of at least 150 nucleotides. More preferably, the query 25 more than 50% of meioses, e.g., not randomly. This definition sequence is at least 300 nucleotides in length and the GAP includes the situation where the marker locus and second analysis aligns the two sequences over a region of at least 300 locus form part of the same gene. Furthermore, this definition nucleotides. Even more preferably, the GAP analysis aligns includes the embodiment where the marker locus comprises a the two sequences over their entire length. polymorphism that is responsible for the trait of interest (in “Oligonucleotides’ can be RNA, DNA, or derivatives of 30 other words the marker locus is directly “linked' or “perfectly either. Although the terms polynucleotide and oligonucle linked to the phenotype). In another embodiment, the otide have overlapping meaning, oligonucleotide are typi marker locus and a second locus are different, yet sufficiently cally relatively short single stranded molecules. The mini close on a chromosome that they will be inherited together in mum size of such oligonucleotides is the size required for the more than 50% of meioses. The percent of recombination formation of a stable hybrid between an oligonucleotide and 35 observed between genetically linked lociper generation (cen a complementary sequence on a target nucleic acid molecule. timorgans (cM)), will be less than 50. In particular embodi Preferably, the oligonucleotides are at least 15 nucleotides, ments of the invention, genetically linked loci may be 45, 35, more preferably at least 18 nucleotides, more preferably at 25, 15, 10, 5, 4, 3, 2, or I or less cMapart on a chromosome. least 19 nucleotides, more preferably at least 20 nucleotides, Preferably, the markers are less than 5 cM apart and most even more preferably at least 25 nucleotides in length. 40 preferably about OcM apart. As used herein, the term “nucleic acid amplification” refers An “allele refers to one specific form of a genetic to any in vitro method for increasing the number of copies of sequence (Such as a gene) within a cell, an individual plant or a nucleic acid molecule with the use of a DNA polymerase. within a population, the specific form differing from other Nucleic acid amplification results in the incorporation of forms of the same gene in the sequence of at least one, and nucleotides into a DNA molecule or primer thereby forming 45 frequently more than one, variant sites within the sequence of a new DNA molecule complementary to a DNA template. the gene. The sequences at these variant sites that differ The newly formed DNA molecule can be used a template to between different alleles are termed “variances”, “polymor synthesize additional DNA molecules. phisms”, or “mutations”. “Operably linked as used herein refers to a functional A "polymorphism' as used herein denotes a variation in the relationship between two or more nucleic acid (e.g., DNA) 50 nucleotide sequence between alleles of the loci of the inven segments. Typically, it refers to the functional relationship of tion, of different species, cultivars, strains or individuals of a transcriptional regulatory element (promoter) to a transcribed plant. A "polymorphic position' is a preselected nucleotide sequence. For example, a promoter is operably linked to a position within the sequence of the gene. In some cases, coding sequence. Such as a polynucleotide defined herein, if it genetic polymorphisms are reflected by an amino acid stimulates or modulates the transcription of the coding 55 sequence variation, and thus a polymorphic position can sequence in an appropriate cell. Generally, promoter tran result in location of a polymorphism in the amino acid Scriptional regulatory elements that are operably linked to a sequence at a predetermined position in the sequence of a transcribed sequence are physically contiguous to the tran polypeptide. In other instances, the polymorphic region may scribed sequence, i.e., they are cis-acting. However, some be in a non-polypeptide encoding region of the gene, for transcriptional regulatory elements, such as enhancers, need 60 example in the promoter region Such may influence expres not be physically contiguous or located in close proximity to sion levels of the gene. Typical polymorphisms are deletions, the coding sequences whose transcription they enhance. insertions or Substitutions. These can involve a single nucle As used herein, the term “gene' is to be taken in its broadest otide (single nucleotide polymorphism or SNP) or two or context and includes the deoxyribonucleotide sequences more nucleotides. comprising the protein coding region of a structural gene and 65 The terms “polypeptide' and “protein’ are generally used including sequences located adjacent to the coding region on interchangeably and refer to a single polypeptide chain which both the 5' and 3' ends for a distance of at least about 2kb on may or may not be modified by addition of non-amino acid US 9,351,507 B2 19 20 groups. It would be understood that such polypeptide chains more preferably 95-100%. The antisense RNA molecule may may associate with other polypeptides or proteins or other of course comprise unrelated sequences which may function molecules such as co-factors. The terms “proteins” and to stabilize the molecule. "polypeptides' as used herein also include variants, mutants, Catalytic Polynucleotides modifications, analogous and/or derivatives of the polypep 5 The term catalytic polynucleotide/nucleic acid refers to a tides of the invention as described herein. DNA molecule or DNA-containing molecule (also known in The % identity of a polypeptide is determined by GAP the art as a “deoxyribozyme’) or an RNA or RNA-containing (Needleman and Wunsch, 1970) analysis (GCG program) molecule (also known as a “ribozyme’) which specifically with a gap creation penalty 5, and a gap extension pen recognizes a distinct Substrate and catalyzes the chemical alty 0.3. The query sequence is at least 25 amino acids in 10 modification of this substrate. The nucleic acid bases in the length, and the GAP analysis aligns the two sequences over a catalytic nucleic acid can be bases A, C, G, T (and U for region of at least 25 amino acids. More preferably, the query RNA). sequence is at least 50 amino acids in length, and the GAP Typically, the catalytic nucleic acid contains an antisense analysis aligns the two sequences over a region of at least 50 sequence for specific recognition of a target nucleic acid, and amino acids. More preferably, the query sequence is at least 15 a nucleic acid cleaving enzymatic activity (also referred to 100 amino acids in length and the GAP analysis aligns the two hereinas the “catalytic domain'). The types of ribozymes that sequences over a region of at least 100 amino acids. Even are particularly useful in this invention are the hammerhead more preferably, the query sequence is at least 250 amino ribozyme (Haseloff and Gerlach, 1988: Perriman et al., 1992) acids in length and the GAP analysis aligns the two sequences and the hairpin ribozyme (Shippy et al., 1999). over a region of at least 250 amino acids. Even more prefer The ribozymes of this invention and DNA encoding the ably, the GAP analysis aligns the two sequences over their ribozymes can be chemically synthesized using methods well entire length. known in the art. The ribozymes can also be prepared from a Antisense Polynucleotides DNA molecule (that upon transcription, yields an RNA mol The term “antisense polynucleotide' shall be taken to ecule) operably linked to an RNA polymerase promoter, e.g., mean a DNA or RNA, or combination thereof, molecule that 25 the promoter for 17 RNA polymerase or SP6 RNA poly is complementary to at least a portion of a specific mRNA merase. Accordingly, also provided by this invention is a molecule encoding a FatB or Fad2 polypeptide and capable of nucleic acid molecule, i.e., DNA or cDNA, coding for a interfering with a post-transcriptional event Such as mRNA catalytic polynucleotide of the invention. When the vector translation. The use of antisense methods is well known in the also contains an RNA polymerase promoter operably linked art (see for example, G. Hartmann and S. Endres, Manual of 30 to the DNA molecule, the ribozyme can be produced in vitro Antisense Methodology, Kluwer (1999)). The use of anti upon incubation with RNA polymerase and nucleotides. In a sense techniques in plants has been reviewed by Bourque, separate embodiment, the DNA can be inserted into an 1995 and Senior, 1998. Bourque, 1995 lists a large number of expression cassette or transcription cassette. After synthesis, examples of how antisense sequences have been utilized in the RNA molecule can be modified by ligation to a DNA plant systems as a method of gene inactivation. She also states 35 molecule having the ability to stabilize the ribozyme and that attaining 100% inhibition of any enzyme activity may not make it resistant to RNase. be necessary as partial inhibition will more than likely result As with antisense polynucleotides described herein, cata in measurable change in the system. Senior (1998) states that lytic polynucleotides of the invention should also be capable antisense methods are now a very well established technique of hybridizing a target nucleic acid molecule (for example an for manipulating gene expression. 40 mRNA encoding any polypeptide provided in FIG. 2 or 7 or An antisense polynucleotide of the invention will hybridize SEQID NOS 1 to 4 or 15 to 18) under “physiological condi to a target polynucleotide under physiological conditions. As tions', namely those conditions within a cell (especially con used herein, the term “an antisense polynucleotide which ditions in a plant cell Such as a rice cell). hybridises under physiological conditions' means that the RNA Interference polynucleotide (which is fully or partially single stranded) is 45 RNA interference (RNAi) is particularly useful for specifi at least capable of forming a double stranded polynucleotide cally inhibiting the production of a particular protein. with mRNA encoding a protein, Such as those provided in Although not wishing to be limited by theory. Waterhouse et FIG. 2 or 7 or SEQID NOs 1 to 4 or 15 to 18 under normal al. (1998) have provided a model for the mechanism by which conditions in a cell, preferably a rice cell. dsRNA (duplex RNA) can be used to reduce protein produc Antisense molecules may include sequences that corre 50 tion. This technology relies on the presence of dsRNA mol spond to the structural genes or for sequences that effect ecules that contain a sequence that is essentially identical to control over the gene expression or splicing event. For the mRNA of the gene of interest or part thereof in this case an example, the antisense sequence may correspond to the tar mRNA encoding a polypeptide according to the invention. geted coding region of the genes of the invention, or the Conveniently, the dsRNA can be produced from a single 5'-untranslated region (UTR) or the 3'-UTR or combination 55 promoterina recombinant vector or host cell, where the sense of these. It may be complementary in part to intron sequences, and antisense sequences are linked by an unrelated sequence which may be spliced out during or after transcription, pref which enables the sense and antisense sequences to hybridize erably only to exon sequences of the target gene. In view of to form the dsRNA molecule with the unrelated sequence the generally greater divergence of the UTRS, targeting these forming a loop structure. The design and production of Suit regions provides greater specificity of gene inhibition. 60 able dsRNA molecules for the present invention is well within The length of the antisense sequence should be at least 19 the capacity of a person skilled in the art, particularly consid contiguous nucleotides, preferably at least 50 nucleotides, ering Waterhouse et al. (1998), Smith et al. (2000), WO and more preferably at least 100, 200, 500 or 1000 nucle 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815. otides. The full-length sequence complementary to the entire In one example, a DNA is introduced that directs the syn gene transcript may be used. The length is most preferably 65 thesis of an at least partly double stranded RNA product(s) 100-2000 nucleotides. The degree of identity of the antisense with homology to the target gene to be inactivated. The DNA sequence to the targeted transcript should be at least 90% and therefore comprises both sense and antisense sequences that, US 9,351,507 B2 21 22 when transcribed into RNA, can hybridize to form the double gene sequence interferes with the expression of the target stranded RNA region. In a preferred embodiment, the sense plant gene. Reference is made to WO 9720936 and EP and antisense sequences are separated by a spacer region that 0465572 for methods of implementing co-suppression comprises an intron which, when transcribed into RNA, is approaches. spliced out. This arrangement has been shown to result in a 5 Nucleic Acid Hybridization higher efficiency of gene silencing. The double-stranded In an embodiment, polynucleotides of the invention, or a region may comprise one or two RNA molecules, transcribed Strand thereof, hybridize under physiological conditions to a from either one DNA region or two. The presence of the polynucleotide comprising any one or more of the sequence double stranded molecule is thought to trigger a response of nucleotides provided as SEQID NOs 5 to 8, 11 to 14 or 19 from an endogenous plant system that destroys both the 10 to 25. In a further embodiment, polynucleotides of the inven double stranded RNA and also the homologous RNA tran tion, or a strand thereof, also hybridize to a polynucleotide Script from the target plant gene, efficiently reducing or elimi comprising any one or more of the sequence of nucleotides nating the activity of the target gene. provided as SEQID NOs 5 to 8, 11 to 14 or 19 to 25 under The length of the sense and antisense sequences that hybri stringent conditions. dise should each be at least 19 contiguous nucleotides, pref 15 As used herein, the phrase “stringent conditions” refers to erably at least 30 or 50 nucleotides, and more preferably at conditions under which a polynucleotide, probe, primer and/ least 100, 200, 500 or 1000 nucleotides. The full-length or oligonucleotide will hybridize to its target sequence(s), but sequence corresponding to the entire gene transcript may be to no other sequences. Stringent conditions are sequence used. The lengths are most preferably 100-2000 nucleotides. dependent and will be different in different circumstances. The degree of identity of the sense and antisense sequences to Longer sequences hybridize specifically at higher tempera the targeted transcript should be at least 85%, preferably at tures than shorter sequences. Generally, Stringent conditions least 90% and more preferably 95-100%. The RNA molecule are selected to be about 5°C. lower than the thermal melting may of course comprise unrelated sequences which may point (Tm) for the specific sequence at a defined ionic function to stabilize the molecule. The RNA molecule may be strength and pH. The Tm is the temperature (under defined expressed under the control of a RNA polymerase II or RNA 25 ionic strength, pH and nucleic acid concentration) at which polymerase III promoter. Examples of the latter include 50% of the probes complementary to the target sequence tRNA or snRNA promoters. hybridize to the target sequence at equilibrium. Since the Preferred small interfering RNA (siRNA) molecules target sequences are generally present at excess, at Tm, 50% comprise a nucleotide sequence that is identical to about of the probes are occupied at equilibrium. Typically, stringent 19-21 contiguous nucleotides of the target mRNA. Prefer 30 conditions will be those in which the salt concentration is less ably, the target mRNA sequence commences with the than about 1.0 M sodium ion, typically about 0.01 to 1.0 M dinucleotide AA, comprises a GC-content of about 30-70% sodium ion (or other salts) at pH 7.0 to 8.3 and the tempera (preferably, 30-60%, more preferably 40-60% and more pref ture is at least about 30° C. for short probes, primers or erably about 45%-55%), and does not have a high percentage oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60° C. identity to any nucleotide sequence other than the target in the 35 for longer probes, primers and oligonucleotides. Stringent genome of the plant (preferably rice) in which it is to be conditions may also be achieved with the addition of desta introduced, e.g., as determined by standard BLAST search. bilizing agents, such as formamide. Examples of dsRNA molecules of the invention are pro Stringent conditions are known to those skilled in the art vided in Example 5. Further examples include those which and can be found in Ausubel et al (supra), Current Protocols comprise a sequence as provided in one or more of SEQID 40 In Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1- NOs 64 to 73 (for Fad2) and SEQID NOS 74 to 83 (for FatB). 6.3.6, as well as the Examples described herein. Preferably, microRNA the conditions are Such that sequences at least about 65%, MicroRNA regulation is a clearly specialized branch of the 70%, 75%, 85%, 90%. 95%, 98%, or 99% homologous to RNA silencing pathway that evolved towards gene regula each other typically remain hybridized to each other. A non tion, diverging from conventional RNAi/PTGS. MicroRNAs 45 limiting example of stringent hybridization conditions are are a specific class of Small RNAS that are encoded in gene hybridization in a high salt buffer comprising 6xSSC, 50 mM like elements organized in a characteristic inverted repeat. Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, When transcribed, microRNA genes give rise to stem-looped 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at precursor RNAs from which the microRNAs are subse 65° C., followed by one or more washes in 0.2xSSC, 0.01% quently processed. MicroRNAs are typically about 21 nucle 50 BSA at 50° C. In another embodiment, a nucleic acid otides in length. The released miRNAs are incorporated into sequence that is hybridizable to the nucleic acid molecule RISC-like complexes containing a particular Subset of Argo comprising the nucleotide sequence of SEQID NOs 5 to 8, 11 naute proteins that exert sequence-specific gene repression to 14 or 19 to 25, under conditions of moderate stringency is (see, for example, Millar and Waterhouse, 2005; Pasquinelli provided. A non-limiting example of moderate stringency et al., 2005: Almeida and Allshire, 2005). 55 hybridization conditions are hybridization in 6xSSC, 5xDen CoSuppression hardt’s solution, 0.5% SDS and 100 mg/ml denatured salmon Another molecular biological approach that may be used is sperm DNA at 55° C., followed by one or more washes in co-Suppression. The mechanism of co-suppression is not well 1xSSC, 0.1% SDS at 37° C. Other conditions of moderate understood but is thought to involve post-transcriptional gene stringency that may be used are well-known within the art, silencing (PTGS) and in that regard may be very similar to 60 see, e.g., Ausubel et al. (Supra), and Kriegler, 1990; Gene many examples of antisense Suppression. It involves intro Transfer And Expression, A Laboratory Manual, Stockton ducing an extra copy of a gene or a fragment thereof into a Press, NY. In yet another embodiment, a nucleic acid that is plant in the sense orientation with respect to a promoter for its hybridizable to the nucleic acid molecule comprising the expression. The size of the sense fragment, its correspon nucleotide sequences SEQID NOs 5 to 8, 11 to 14 or 19 to 25, dence to target gene regions, and its degree of sequence 65 under conditions of low stringency, is provided. A non-limit identity to the target gene are as for the antisense sequences ing example of low stringency hybridization conditions are described above. In some instances the additional copy of the hybridization in 35% formamide, 5xSSC, 50 mM Tris-HCl US 9,351,507 B2 23 24 (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, The promoter may be modulated by factors such as tem 100 mg/ml denatured salmon sperm DNA, 10% (wt/vol) dex perature, light or stress. Ordinarily, the regulatory elements tran sulfate at 40° C., followed by one or more washes in will be provided 5' of the genetic sequence to be expressed. 2xSSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% The construct may also contain other elements that enhance SDS at 50°C. Other conditions of low stringency that may be transcription Such as the nos 3' or the ocs 3' polyadenylation used are well known in the art, see, e.g., Ausubeletal. (Supra) regions or transcription terminators. and Kriegler, 1990, Gene Transfer And Expression, A Labo The 5' non-translated leader sequence can be derived from ratory Manual, Stockton Press, NY, as well as the Examples the promoter selected to express the heterologous gene provided herein. sequence of the polynucleotide of the present invention, and 10 can be specifically modified if desired so as to increase trans Nucleic Acid Constructs, Vectors and Host Cells lation of mRNA. For a review of optimizing expression of The present invention includes the production of geneti transgenes, see Koziel et al. (1996). The 5 non-translated cally modified rice plants, wherein the plant has decreased regions can also be obtained from plant viral RNAs (Tobacco expression of a polypeptide having Fad2 and/or FatBactivity mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, relative to a corresponding non-modified plant. 15 Alfalfa mosaic virus, among others) from Suitable eukaryotic Nucleic acid constructs useful for producing the above genes, plant genes (wheat and maize chlorophyll afb binding mentioned transgenic plants can readily be produced using protein gene leader), or from a synthetic gene sequence. The standard techniques. present invention not limited to constructs wherein the non When inserting a region encoding an mRNA the construct translated region is derived from the 5' non-translated may comprise intron sequences. These intron sequences may sequence that accompanies the promoter sequence. The aid expression of the transgene in the plant. The term “intron' leader sequence could also be derived from an unrelated is used in its normal sense as meaning a genetic segment that promoter or coding sequence. Leader sequences useful in is transcribed but does not encode protein and which is context of the present invention comprise the maize Hsp70 spliced out of an RNA before translation. Introns may be leader (U.S. Pat. No. 5,362,865 and U.S. Pat. No. 5,859,347), incorporated in a 5'-UTR or a coding region if the transgene 25 and the TMV omega element. encodes a translated product, or anywhere in the transcribed The termination of transcription is accomplished by a 3' region if it does not. However, in a preferred embodiment, any non-translated DNA sequence operably linked in the chi polypeptide encoding region is provided as a single open meric vector to the polynucleotide of interest. The 3' non reading frame. As the skilled addressee would be aware, Such translated region of a recombinant DNA molecule contains a open reading frames can be obtained by reverse transcribing 30 polyadenylation signal that functions in plants to cause the mRNA encoding the polypeptide. addition of adenylate nucleotides to the 3' end of the RNA. To ensure appropriate expression of the gene encoding an The 3' non-translated region can be obtained from various mRNA of interest, the nucleic acid construct typically com genes that are expressed in plant cells. The nopaline synthase prises one or more regulatory elements such as promoters, 3' translated region, the 3' untranslated region from pea Small enhancers, as well as transcription termination or polyadeny 35 Subunit Rubisco gene, the 3' untranslated region from Soy lation sequences. Such elements are well known in the art. bean 75 seed storage protein gene are commonly used in this The transcriptional initiation region comprising the regu capacity. The 3' transcribed, non-translated regions contain latory element(s) may provide for regulated or constitutive ing the polyadenylate signal of Agrobacterium tumor-induc expression in the plant. Preferably, expression at least occurs ing (Ti) plasmid genes are also suitable. in cells of the embryo, endosperm, bran layer developing seed 40 Typically, the nucleic acid construct comprises a selectable and/or mature seed (grain). In an alternate embodiment, the marker. Selectable markers aid in the identification and regulatory elements may be promoters not specific for seed screening of plants or cells that have been transformed with cells (such as ubiquitin promoter or CaMV35S or enhanced the exogenous nucleic acid molecule. The selectable marker 35S promoters). gene may provide antibiotic or herbicide resistance to the rice Examples of seed specific promoters useful for the present 45 cells, or allow the utilization of Substrates such as mannose. invention include, but are not limited to, the wheat low The selectable marker preferably confers hygromycin resis molecular weight glutenin promoter (Colot et al., 1987), the tance to the rice cells. promoter expressing C.-amylase in wheat seeds (Stefanov et Preferably, the nucleic acid construct is stably incorporated al., 1991), and the hordein promoter (Brandt et al., 1985). into the genome of the plant. Accordingly, the nucleic acid A number of constitutive promoters that are active in plant 50 comprises appropriate elements which allow the molecule to cells have been described. Suitable promoters for constitutive be incorporated into the genome, or the construct is placed in expression in plants include, but are not limited to, the cauli an appropriate vector which can be incorporated into a chro flower mosaic virus (CaMV) 35S promoter, the Figwort mosome of a plant cell. mosaic virus (FMV) 35S, the sugarcane bacilliform virus One embodiment of the present invention includes a promoter, the commelina yellow mottle virus promoter, the 55 recombinant vector, which includes at least one polynucle light-inducible promoter from the small subunit of the ribu otide molecule of the present invention, inserted into any lose-1,5-bis-phosphate carboxylase, the rice cytosolic triose vector capable of delivering the nucleic acid molecule into a phosphate isomerase promoter, the adenine phosphoribosyl host cell. Such a vector contains heterologous nucleic acid transferase promoter of Arabidopsis, the rice actin 1 gene sequences, that is nucleic acid sequences that are not naturally promoter, the mannopine synthase and octopine synthase 60 found adjacent to nucleic acid molecules of the present inven promoters, the Adh promoter, the Sucrose synthase promoter, tion and that preferably are derived from a species other than the R gene complex promoter, and the chlorophyll C/B bind the species from which the nucleic acid molecule(s) are ing protein gene promoter. These promoters have been used to derived. The vector can be either RNA or DNA, either create DNA vectors that have been expressed in plants; see, prokaryotic or eukaryotic, and typically is a virus or a plas e.g., PCT publication WO 8402913. All of these promoters 65 mid. have been used to create various types of plant-expressible A number of vectors suitable for stable transfection of plant recombinant DNA vectors. cells or for the establishment of transgenic plants have been US 9,351,507 B2 25 26 described in, e.g., Pouwels et al. Cloning Vectors: A Labora like. A particular advantage of microprojectile bombardment, tory Manual, 1985, Supp. 1987; Weissbach and Weissbach, in addition to it being an effective means of reproducibly Methods for Plant Molecular Biology, Academic Press, 1989; transforming monocots, is that neither the isolation of proto and Gelvin et al. Plant Molecular Biology Manual, Kluwer plasts, nor the Susceptibility of Agrobacterium infection are Academic Publishers, 1990. Typically, plant expression vec required. An illustrative embodiment of a method for deliv tors include, for example, one or more cloned plant genes ering DNA into Zea mays cells by acceleration is a biolistics under the transcriptional control of 5' and 3' regulatory C-particle delivery system, that can be used to propel particles sequences and a dominant selectable marker. Such plant coated with DNA through a screen, Such as a stainless steel or expression vectors also can contain a promoter regulatory Nytex screen, onto a filter surface covered with corn cells region (e.g., a regulatory region controlling inducible or con 10 cultured in Suspension. A particle delivery system Suitable for stitutive, environmentally- or developmentally-regulated, or use with the present invention is the helium acceleration cell- or tissue-specific expression), a transcription initiation PDS-1000/He gun is available from Bio-Rad Laboratories. start site, a ribosome binding site, an RNA processing signal, For the bombardment, cells in Suspension may be concen a transcription termination site, and/or a polyadenylation sig trated on filters. Filters containing the cells to be bombarded nal. 15 are positioned at an appropriate distance below the micro Another embodiment of the present invention includes a projectile stopping plate. If desired, one or more screens are recombinant cell comprising a host cell transformed with one also positioned between the gun and the cells to be bom or more recombinant molecules of the present invention. barded. Transformation of a nucleic acid molecule into a cell can be Alternatively, immature embryos or other target cells may accomplished by any method by which a nucleic acid mol be arranged on solid culture medium. The cells to be bom ecule can be inserted into the cell. Transformation techniques barded are positioned at an appropriate distance below the include, but are not limited to, transfection, electroporation, microprojectile stopping plate. If desired, one or more microinjection, lipofection, adsorption, and protoplast screens are also positioned between the acceleration device fusion. A recombinant cell may remain unicellular or may and the cells to be bombarded. Through the use of techniques grow into a tissue, organ or a multicellular organism. Trans 25 set forth herein one may obtain up to 1000 or more foci of formed nucleic acid molecules of the present invention can cells transiently expressing a marker gene. The number of remain extrachromosomal or can integrate into one or more cells in a focus that express the exogenous gene product 48 sites within a chromosome of the transformed (i.e., recombi hours post-bombardment often range from one to ten and nant) cell in such a manner that their ability to be expressed is average one to three. retained. Preferred host cells are plant cells, more preferably 30 In bombardment transformation, one may optimize the cells of a cereal plant, and even more preferably a rice cell. pre-bombardment culturing conditions and the bombardment Transgenic Plants parameters to yield the maximum numbers of stable transfor Transgenic rice (also referred to herein as genetically mants. Both the physical and biological parameters for bom modified rice) can be produced using techniques known in the bardment are important in this technology. Physical factors art, such as those generally described in A. Slater et al., Plant 35 are those that involve manipulating the DNA/microprojectile Biotechnology. The Genetic Manipulation of Plants, precipitate or those that affect the flight and velocity of either Oxford University Press (2003), and P. Christou and H. Klee, the macro- or microprojectiles. Biological factors include all Handbook of Plant Biotechnology, John Wiley and Sons steps involved in manipulation of cells before and immedi (2004). ately after bombardment, the osmotic adjustment of target In a preferred embodiment, the transgenic plants are 40 cells to help alleviate the trauma associated with bombard homozygous for each and every polynucleotide that has been ment, and also the nature of the transforming DNA, such as introduced (transgene) so that their progeny do not segregate linearized DNA or intact supercoiled plasmids. It is believed for the desired phenotype. The transgenic plants may also be that pre-bombardment manipulations are especially impor heterozygous for the introduced transgene(s). Such as, for tant for Successful transformation of immature embryos. example, in F1 progeny which have been grown from hybrid 45 In another alternative embodiment, plastids can be stably seed. Such plants may provide advantages such as hybrid transformed. Method disclosed for plastid transformation in vigour, well known in the art. higher plants include particle gun delivery of DNA contain Four general methods for direct delivery of a gene into cells ing a selectable marker and targeting of the DNA to the plastid have been described: (1) chemical methods (Graham et al., genome through homologous recombination (U.S. Pat. No. 1973); (2) physical methods such as microinjection (Capec 50 5,451,513, U.S. Pat. No. 5,545,818, U.S. Pat. No. 5,877,402, chi, 1980); electroporation (see, for example, WO 87/06614, U.S. Pat. No. 5,932,479, and WO99/05265. U.S. Pat. No. 5,472,869, 5,384,253, WO92/09696 and WO Accordingly, it is contemplated that one may wish to adjust 93/21335); and the gene gun (see, for example, U.S. Pat. No. various aspects of the bombardment parameters in Small scale 4.945,050 and U.S. Pat. No. 5,141,131); (3) viral vectors studies to fully optimize the conditions. One may particularly (Clapp, 1993: Lu et al., 1993; Eglitis et al., 1988); and (4) 55 wish to adjust physical parameters such as gap distance, flight receptor-mediated mechanisms (Curiel et al., 1992; Wagner distance, tissue distance, and helium pressure. One may also et al., 1992). minimize the trauma reduction factors by modifying condi Acceleration methods that may be used include, for tions that influence the physiological state of the recipient example, microprojectile bombardment and the like. One cells and that may therefore influence transformation and example of a method for delivering transforming nucleic acid 60 integration efficiencies. For example, the osmotic state, tissue molecules to plant cells is microprojectile bombardment. hydration and the subculture stage or cell cycle of the recipi This method has been reviewed by Yang et al., Particle Bom ent cells may be adjusted for optimum transformation. The bardment Technology for Gene Transfer, Oxford Press, execution of other routine adjustments will be known to those Oxford, England (1994). Non-biological particles (micro of skill in the art in light of the present disclosure. projectiles) that may be coated with nucleic acids and deliv 65 Agrobacterium-mediated transfer is a widely applicable ered into cells by a propelling force. Exemplary particles system for introducing genes into plant cells because the include those comprised oftungsten, gold, platinum, and the DNA can be introduced into whole plant tissues, thereby US 9,351,507 B2 27 28 bypassing the need for regeneration of an intact plant from a The regeneration, development, and cultivation of plants protoplast. The use of Agrobacterium-mediated plant inte from single plant protoplast transformants or from various grating vectors to introduce DNA into plant cells is well transformed explants is well known in the art (Weissbach et known in the art (see, for example, U.S. Pat. No. 5,177,010, al., In: Methods for Plant Molecular Biology, Academic U.S. Pat. No. 5,104,310, U.S. Pat. No. 5,004,863, U.S. Pat. 5 Press, San Diego, Calif., (1988). This regeneration and No. 5,159,135). Further, the integration of the T-DNA is a growth process typically includes the steps of selection of relatively precise process resulting in few rearrangements. transformed cells, culturing those individualized stages of The region of DNA to be transferred is defined by the border embryonic development through the rooted plantlet stage. sequences, and intervening DNA is usually inserted into the Transgenic embryos and seeds are similarly regenerated. The plant genome. 10 resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil. Modern Agrobacterium transformation vectors are capable The development or regeneration of plants containing the of replication in E. coli as well as Agrobacterium, allowing foreign, exogenous gene is well known in the art. Preferably, for convenient manipulations as described (Klee et al., In: the regenerated plants are self-pollinated to provide homozy Plant DNA Infectious Agents, Hohn and Schell, eds., 15 gous transgenic plants. Otherwise, pollen obtained from the Springer-Verlag, New York, pp. 179-203 (1985). Moreover, regenerated plants is crossed to seed-grown plants of agro technological advances in vectors for Agrobacterium-medi nomically important lines. Conversely, pollen from plants of ated gene transfer have improved the arrangement of genes these importantlines is used to pollinate regenerated plants. A and restriction sites in the vectors to facilitate construction of transgenic plant of the present invention containing a desired vectors capable of expressing various polypeptide coding exogenous nucleic acid is cultivated using methods well genes. The vectors described have convenient multi-linker known to one skilled in the art. regions flanked by a promoter and a polyadenylation site for Methods for transformation of cereal plants such as rice for direct expression of inserted polypeptide coding genes and introducing genetic variation into the plant by introduction of are suitable for present purposes. In addition, Agrobacterium an exogenous nucleic acid and for regeneration of plants from containing both armed and disarmed Tigenes can be used for 25 protoplasts or immature plant embryos are well known in the the transformations. In those plant varieties where Agrobac art, see for example, Canadian Patent Application No. 2,092, terium-mediated transformation is efficient, it is the method 588, Australian Patent Application No. 61781/94, Australian of choice because of the facile and defined nature of the gene Patent No 667939, U.S. Pat. No. 6,100,447, International transfer. Patent Application PCT/US97/10621, U.S. Pat. No. 5,589, A transgenic plant formed using Agrobacterium transfor 30 617, U.S. Pat. No. 6,541,257, and other methods are set out in mation methods typically contains a single genetic locus on Patent specification WO99/14314. Preferably, transgenic rice one chromosome. Such transgenic plants can be referred to as plants are produced by Agrobacterium tumefaciens mediated being hemizygous for the added gene. More preferred is a transformation procedures. An example of Agrobacterium transgenic plant that is homozygous for the added structural mediated transformation of rice is provided herein in gene; i.e., a transgenic plant that contains two added genes, 35 Example 5. Vectors carrying the desired nucleic acid con one gene at the same locus on each chromosome of a chro struct may be introduced into regenerable rice cells of tissue mosome pair. Ahomozygous transgenic plant can be obtained cultured plants or explants, or Suitable plant systems such as by sexually mating (selfing) an independent segregant trans protoplasts. genic plant that contains a single added gene, germinating The regenerable rice cells are preferably from the scutel Some of the seed produced and analyzing the resulting plants 40 lum of immature embryos, mature embryos, callus derived for the gene of interest. from these, or the meristematic tissue. It is also to be understood that two different transgenic To confirm the presence of the transgenes in transgenic plants can also be mated to produce offspring that contain two cells and plants, a polymerase chain reaction (PCR) amplifi independently segregating exogenous genes. Selfing of cation or Southern blot analysis can be performed using appropriate progeny can produce plants that are homozygous 45 methods known to those skilled in the art. Expression prod for both exogenous genes. Back-crossing to a parental plant ucts of the transgenes can be detected in any of a variety of and out-crossing with a non-transgenic plant are also contem ways, depending upon the nature of the product, and include plated, as is vegetative propagation. Descriptions of other Western blot and enzyme assay. One particularly useful way breeding methods that are commonly used for different traits to quantitate protein expression and to detect replication in and crops can be found in Fehr, In: Breeding Methods for 50 different plant tissues is to use a reporter gene, such as GUS. Cultivar Development, Wilcox J. ed., American Society of Once transgenic plants have been obtained, they may be Agronomy, Madison Wis. (1987). grown to produce plant tissues or parts having the desired Transformation of plant protoplasts can be achieved using phenotype. The plant tissue or plant parts, may be harvested, methods based on calcium phosphate precipitation, polyeth and/or the seed collected. The seed may serve as a source for ylene glycol treatment, electroporation, and combinations of 55 growing additional plants with tissues or parts having the these treatments. Application of these systems to different desired characteristics. plant varieties depends upon the ability to regenerate that Marker Assisted Selection particular plant strain from protoplasts. Illustrative methods Marker assisted selection is a well recognised method of for the regeneration of cereals from protoplasts are described selecting for heterozygous plants required when backcross (Fujimura et al., 1985; Toriyarna et al., 1986; Abdullah et al., 60 ing with a recurrent parent in a classical breeding program. 1986). The population of plants in each backcross generation will be Other methods of cell transformation can also be used and heterozygous for the gene of interest normally present in a 1:1 include but are not limited to introduction of DNA into plants ratio in a backcross population, and the molecular marker can by direct DNA transfer into pollen, by direct injection of be used to distinguish the two alleles of the gene. By extract DNA into reproductive organs of a plant, or by direct injection 65 ing DNA from, for example, young shoots and testing with a of DNA into the cells of immature embryos followed by the specific marker for the introgressed desirable trait, early rehydration of desiccated embryos. selection of plants for further backcrossing is made whilst US 9,351,507 B2 29 30 energy and resources are concentrated on fewer plants. To tions thereof. Direct sequencing has the advantage of deter further speed up the backcrossing program, the embryo from mining variation in any base pair of a particular sequence. immature seeds (25 days post anthesis) may be excised and Hybridization based detection systems include, but are not grown up on nutrient media under sterile conditions, rather limited to, the TaqMan assay and molecular beacons. The than allowing full seed maturity. This process, termed TaqMan assay (U.S. Pat. No. 5,962.233) uses allele specific "embryo rescue', used in combination with DNA extraction (ASO) probes with a donor dye on one end and an acceptor at the three leaf stage and analysis for the desired genotype dye on the other end such that the dye pair interact via fluo allows rapid selection of plants carrying the desired trait, rescence resonance energy transfer (FRET). A target which may be nurtured to maturity in the greenhouse or field sequence is amplified by PCR modified to include the addi for Subsequent further backcrossing to the recurrent parent. 10 Any molecular biological technique known in the art which tion of the labeled ASO probe. The PCR conditions are is capable of detecting a Fad2 or FatB gene can be used in the adjusted so that a single nucleotide difference will effect methods of the present invention. Such methods include, but binding of the probe. Due to the 5 nuclease activity of the Taq are not limited to, the use of nucleic acid amplification, polymerase enzyme, a perfectly complementary probe is nucleic acid sequencing, nucleic acid hybridization with Suit 15 cleaved during PCR while a probe with a single mismatched ably labeled probes, single-strand conformational analysis base is not cleaved. Cleavage of the probe dissociates the (SSCA), denaturing gradient gel electrophoresis (DOGE). donor dye from the quenching acceptor dye, greatly increas heteroduplex analysis (HET), chemical cleavage analysis ing the donor fluorescence. (CCM), catalytic nucleic acid cleavage or a combination An alternative to the TaqManassay is the molecular beacon thereof (see, for example, Lemieux, 2000; Langridge et al., assay (U.S. Pat. No. 5,925.517). In the molecular beacon 2001). The invention also includes the use of molecular assay, the ASO probes contain complementary sequences marker techniques to detect polymorphisms linked to alleles flanking the target specific species so that a hairpin structure of (for example) a Fad2 or FatB gene which confer the desired is formed. The loop of the hairpin is complimentary to the phenotype. Such methods include the detection or analysis of target sequence while each arm of the hairpin contains either restriction fragment length polymorphisms (RFLP), RAPD, 25 donor or acceptor dyes. When not hybridized to a donor amplified fragment length polymorphisms (AFLP) and mic sequence, the hairpin structure brings the donor and acceptor rosatellite (simple sequence repeat, SSR) polymorphisms. dye close together thereby extinguishing the donor fluores The closely linked markers can be obtained readily by meth cence. When hybridized to the specific target sequence, how ods well known in the art, Such as Bulked Segregant Analysis, ever, the donor and acceptor dyes are separated with an as reviewed by Langridge et al. (2001). 30 increase in fluorescence of up to 900 fold. Molecular beacons The “polymerase chain reaction” (“PCR) is a reaction in can be used in conjunction with amplification of the target which replicate copies are made of a target polynucleotide sequence by PCR and provide a method for real time detec using a "pair of primers' or “set of primers' consisting of tion of the presence of target sequences or can be used after “upstream” and a “downstream primer, and a catalyst of amplification. polymerization, such as a DNA polymerase, and typically a 35 Tilling thermally-stable polymerase enzyme. Methods for PCR are Plants of the invention can be produced using the process known in the art, and are taught, for example, in “PCR (Ed. known as TILLING (Targeting Induced Local Lesions IN M. J. McPherson and S. G Moller (2000) BIOS Scientific Genomes). In a first step, introduced mutations such as novel Publishers Ltd, Oxford). PCR can be performed on cDNA single base pair changes are induced in a population of plants obtained from reverse transcribing mRNA isolated from plant 40 by treating seeds (or pollen) with a chemical mutagen, and cells. However, it will generally be easier if PCR is performed then advancing plants to a generation where mutations will be on genomic DNA isolated from a plant. stably inherited. DNA is extracted, and seeds are stored from A primer is an oligonucleotide sequence that is capable of all members of the population to create a resource that can be hybridising in a sequence specific fashion to the target accessed repeatedly over time. sequence and being extended during the PCR. Amplicons or 45 For a TILLING assay, PCR primers are designed to spe PCR products or PCR fragments or amplification products cifically amplify a single gene target of interest. Specificity is are extension products that comprise the primer and the newly especially important if a target is a member of a gene family synthesized copies of the target sequences. Multiplex PCR or part of a polyploid genome. Next, dye-labeled primers can systems contain multiple sets of primers that result in simul be used to amplify PCR products from pooled DNA of mul taneous production of more than one amplicon. Primers may 50 tiple individuals. These PCR products are denatured and be perfectly matched to the target sequence or they may reannealed to allow the formation of mismatched base pairs. contain internal mismatched bases that can result in the intro Mismatches, or heteroduplexes, represent both naturally duction of restriction enzyme or catalytic nucleic acid recog occurring single nucleotide polymorphisms (SNPs) (i.e., sev nition/cleavage sites in specific target sequences. Primers eral plants from the population are likely to carry the same may also contain additional sequences and/or contain modi 55 polymorphism) and induced SNPs (i.e., only rare individual fied or labelled nucleotides to facilitate capture or detection of plants are likely to display the mutation). After heteroduplex amplicons. Repeated cycles of heat denaturation of the DNA, formation, the use of an endonuclease, such as Cel I, that annealing of primers to their complementary sequences and recognizes and cleaves mismatched DNA is the key to dis extension of the annealed primers with polymerase result in covering novel SNPs within a TELLING population. exponential amplification of the target sequence. The terms 60 Using this approach, many thousands of plants can be target or target sequence or template refer to nucleic acid screened to identify any individual with a single base change sequences which are amplified. as well as Small insertions or deletions (1-30 bp) in any gene Methods for direct sequencing of nucleotide sequences are or specific region of the genome. Genomic fragments being well known to those skilled in the art and can be found for assayed can range in size anywhere from 0.3 to 1.6 kb. At example in Ausubel et al. (Supra) and Sambrook et at (Supra). 65 8-fold pooling, 1.4 kb fragments (discounting the ends of Sequencing can be carried out by any Suitable method, for fragments where SNP detection is problematic due to noise) example, dideoxy sequencing, chemical sequencing or varia and 96 lanes per assay, this combinationallows up to a million US 9,351,507 B2 31 32 base pairs of genomic DNA to be screened per single assay, The term “binds specifically” refers to the ability of the making TILLING a high-throughput technique. antibody to bind to a FatB or Fad2 polypeptide but not other TILLING is further described in Slade and Knauf (2005) proteins of rice, especially proteins of rice seeds. and Henikoffet al. (2004). As used herein, the term “epitope” refers to a region of a In addition to allowing efficient detection of mutations, FatB or Fad2 polypeptide which is bound by the antibody. An high-throughput TILLING technology is ideal for the detec epitope can be administered to an animal to generate antibod tion of natural polymorphisms. Therefore, interrogating an ies against the epitope, however, antibodies useful for the unknown homologous DNA by heteroduplexing to a known methods described herein preferably specifically bind the sequence reveals the number and position of polymorphic epitope region in the context of the entire polypeptide. 10 If polyclonal antibodies are desired, a selected mammal sites. Both nucleotide changes and Small insertions and dele (e.g., mouse, rabbit, goat, horse, etc.) is immunised with an tions are identified, including at least Some repeat number immunogenic polypeptide Such as those provided in FIG. 2 or polymorphisms. This has been called Ecotilling (Comai et al., 7 or SEQ NOs 1 to 4 or 15 to 18. Serum from the immunised 2004). animal is collected and treated according to known proce Each SNP is recorded by its approximate position within a 15 dures. If serum containing polyclonal antibodies contains few nucleotides. Thus, each haplotype can be archived based antibodies to other antigens, the polyclonal antibodies can be on its mobility. Sequence data can be obtained with a rela purified by immunoaffinity chromatography. Techniques for tively small incremental effort using aliquots of the same producing and processing polyclonal antisera are known in amplified DNA that is used for the mismatch-cleavage assay. the art. In order that such antibodies may be made, the inven The left or right sequencing primer for a single reaction is tion also provides peptides of the invention or fragments chosen by its proximity to the polymorphism. Sequencher thereofhaptenised to another peptide for use as immunogens Software performs a multiple alignment and discovers the in animals. base change, which in each case confirmed the gel band. Monoclonal antibodies directed against polypeptides of Ecotilling can be performed more cheaply than full the invention can also be readily produced by one skilled in sequencing, the method currently used for most SNP discov 25 the art. The general methodology for making monoclonal ery. Plates containing arrayed ecotypic DNA can be screened antibodies by hybridomas is well known. Immortal antibody rather than pools of DNA from mutagenized plants. Because producing cell lines can be created by cell fusion, and also by detection is on gels with nearly base pair resolution and other techniques such as direct transformation of B lympho background patterns are uniform across lanes, bands that are cytes with oncogenic DNA, or transfection with Epstein-Barr of identical size can be matched, thus discovering and geno 30 virus. Panels of monoclonal antibodies produced can be typing SNPs in a single step. In this way, ultimate sequencing screened for various properties; i.e., for isotype and epitope of the SNP is simple and efficient, made more so by the fact affinity. that the aliquots of the same PCR products used for screening An alternative technique involves screening phage display can be subjected to DNA sequencing. libraries where, for example the phage express ScFv frag Mutagenesis Procedures 35 ments on the surface of their coat with a large variety of Techniques for generating mutant rice plant lines are complementarity determining regions (CDRS). This tech known in the art. Examples of mutagens that can be used for nique is well known in the art. generating mutant rice plants include irradiation and chemi For the purposes of this invention, the term “antibody’. cal mutagenesis. Mutants may also be produced by tech unless specified to the contrary, includes fragments of whole niques such as T-DNA insertion and transposon-induced 40 antibodies which retain their binding activity for a target mutagenesis. The mutagenesis procedure may be performed antigen. Such fragments include Fv, F(ab') and F(ab')2 frag on any parental cell of a rice plant, for example a seed or a ments, as well as single chainantibodies (scFV). Furthermore, parental cell in tissue culture. the antibodies and fragments thereof may be humanised anti Chemical mutagens are classifiable by chemical proper bodies, for example as described in EP-A-2394.00. ties, e.g., alkylating agents, cross-linking agents, etc. Useful 45 Antibodies may be bound to a solid Support and/or pack chemical mutagens include, but are not limited to, N-ethyl aged into kits in a Suitable container along with Suitable N-nitrosourea (ENU); N-methyl-N-nitrosourea (MNU); pro reagents, controls, instructions and the like. carbazine hydrochloride; chlorambucil; cyclophosphamide; Preferably, the antibodies are delectably labeled. Exem methyl methanesulfonate (MMS): ethyl methanesulfonate plary detectable labels that allow for direct measurement of (EMS); diethyl sulfate; acrylamide monomer, triethylene 50 antibody binding include radiolabels, fluorophores, dyes, melamine (TEM); melphalan; nitrogen mustard; Vincristine; magnetic beads, chemiluminescers, colloidal particles, and dimethylnitrosamine; N-methyl-N'-nitro-Nitrosoguani-dine the like. Examples of labels which permit indirect measure (MNNG): 7.12 dimethylbenzanthracene (DMBA); ethylene ment of binding include enzymes where the Substrate may oxide; hexamethylphosphoramide; and bisulfan. provide for a coloured or fluorescent product. Additional An example of Suitable irradiation to induce mutations is 55 exemplary detectable labels include covalently bound by gamma radiation, such as that Supplied by a Cesium 137 enzymes capable of providing a detectable product signal Source. The gamma radiation preferably is Supplied to the after addition of suitable substrate. Examples of suitable plant cells in a dosage of approximately 60 to 200 Krad., and enzymes for use in conjugates include horseradish peroxi most preferably in a dosage of approximately 60 to 90 Krad. dase, alkaline phosphatase, malate dehydrogenase and the Plants are typically exposed to a mutagen for a sufficient 60 like. Where not commercially available, such antibody-en duration to accomplish the desired genetic modification but Zyme conjugates are readily produced by techniques known insufficient to completely destroy the viability of the cells and to those skilled in the art. Further exemplary detectable labels their ability to be regenerated into a plant. include biotin, which binds with high affinity to avidin or Antibodies streptavidin; fluorochromes (e.g., phycobiliproteins, phyco Monoclonal or polyclonal antibodies which bind specifi 65 erythrin and allophycocyanins; fluorescein and Texas red), cally to FatB or Fad2 polypeptides can be useful for some of which can be used with a fluorescence activated cell sorter; the methods of the invention. haptens; and the like. Preferably, the detectable label allows US 9,351,507 B2 33 34 for direct measurement in a plate luminometer, e.g., biotin. and 2 mL of hexane. After Vortexing and phase separation, the Such labeled antibodies can be used in techniques known in upper hexane layer containing the fatty acid methyl esters was the art to detect polypeptides of the invention. transferred to a microvial. Fatty acid methyl esters were analysed by gas-liquid chromatography as previously EXAMPLES 5 described (Stoutesdijk et al., 2002). Transformation of Rice Example 1 Rice (cv. Nipponbare) was transformed as follows. Materials and Methods i) Induction and Culture 10 Husks were removed from mature grain, which were then Extraction of Oil with Sodium Methoxide soaked in 70% EtOH for 30 sec to remove any outer layer of For fatty acid and other analyses, total lipid was extracted wax. The cleaned grains were washed 3 times with sterile H.0 from rice grains as follows unless stated otherwise. In some and soaked in a solution of 25% bleach (with 2 drops Tween cases, samples each consisting of a half grain were used for 20 detergent added) for 20 minutes with shaking to surface the extraction, with the second half-grain containing the 15 sterilize them. Under asceptic conditions, the grains were embryo being used for embryo rescue. The technique can also rinsed briefly with 70% EtOH, washed thoroughly with ster be used with other cereals. ile H-08-10 times and plated onto ND medium. Plates were A single developing seed or half-seed was squashed sealed with Micropore-tape and incubated under full light at between filter papers and placed in a tube. 2 ml 0.5M sodium 28° C. Calli were produced after 6-8 weeks and then trans methoxide was added, the tube sealed tightly and then incu- 20 ferred to NB media. They were sealed with paraffin paper and bated at 80° C. for 10 min. After the tube was cooled, 0.1 ml left in the at 28°C. with sub-culturing every 4 weeks onto glacial acetic acid was added followed by 2 ml of distilled fresh NB plates. Calli were not used for transformation after water and 2 ml of petroleum spirit. The mixtures were Vor more then 5 subcultures. texed for 10 sec and, after the phases had separated, the upper ii) Transformation petroleum layer was transferred to a small test tube. Approxi- 25 Healthy looking calli were picked from subculture plates mately 1 g of potassium bicarbonate/sodium Sulphate mixture and transferred onto fresh NB plates at a density of 25-30 was added to the test tubes and the mixture vortexed. The calli/plate. Two days later, a fresh culture was established of sample solutions were transferred to autosampler vials and the Agrobacterium strain containing the construct to be used, stored in a freezer at -20°C. until GCanalysis was performed and incubated at 28°C. The culture medium was NB medium as described by Soutjesdic et al. (2002). 30 supplemented with 100 uM acetosyringone. Calli were Extraction of Lipids from Tissues with High Water Content immersed in a suspension of the cells for 10 minutes. After (Bligh-Dyer Method) draining off excess suspension, calli were placed on NB This method was adapted from Bligh and Dyer (1959). 1.5 medium Supplemented with 100 LM acetosyringone and ml of CHCl/MeOH (1:2) was added to a tissue sample in 0.4 incubated in the dark at 25° C. for 3 days (co-cultivation). ml of buffer and the sample vortexed vigorously. A further 0.5 35 After the co-cultivation step, calli were washed gently three ml of CHC1 was added and the sample vortexed again. 0.5 ml times in a tube with sterile H0 containing 150 mg/ml Time of HO was added and the sample vortexed again. The tube tin. Calli were blotted dry on filter paper and plated well was centrifuged briefly at 3000 rpm to separate phases; a spaced onto NBCT plates (containing 100 ug/ml kanamycin white precipitate appeared at the interface. The organic if a kanamycin selectable marker gene was used or other (lower) phase was transferred to a new tube and concentrated 40 selection agent as appropriate, 150 ug/ml Timentin and 200 under vacuum. If acidic lipids were to be extracted, 0.5 ml of ug/ml Claroforan). The plates were incubated in the dark for 1% HClO was added instead of 0.5 ml of H.O.The volumes 3-4 weeks at 26-28°C. Resistant calli were observed after in the above procedure could be modified as long as the ratios about 10 days and transferred to NBCT+selection plates and of CHC1/MeoH/HO were maintained. incubated in the dark for a further 14-21 days. Healthy call Preparation of Fatty Acid Methyl Esters (FAME) for Quan- 45 were transferred onto PRCT+selection plates and incubated titative Determination of Fatty Acid Content in the dark for 8-12 days, then transferred onto RCT+selec To prepare FAME directly from grain, 10-15 seed were tion plates and incubated in full light at 28°C. for 30 days. weighed accurately and transferred to a glass tube. An inter After this time, plantlets that had developed were transferred nal standard of 10 ul of 1 mg/ml 17:0-methyl ester was added to /2MS medium in tissue culture pots and incubated under to each seed sample. 0.75 ml 1 N methanolic-HCl (Supelco) 50 light for 10-14 days for further growth before transfer to soil. was added to each tube which was capped tightly and refluxed iii) Media Composition and Components for Rice Tissue at 80°C. for at least 2-3 hrs or overnight Samples were cooled, Culture 0.5 ml NaCl (0.9% w/v) added followed by 300 ul hexane. N6 macro-elements (20x) (g/l): (NH4)2SO 9.3; KNO, The tubes were capped again and Vortexed vigorously. The 56.6; KHPO 8: MgSO.7HO, 3.7: CaCl2HO, 3.3. upper hexane phase (200-250 ul) was carefully transferred to 55 N6 micro (1000x) (mg/100 ml): MnSO4H2O, 440; an eppendorf tube. The sample was dried down completely ZnSO.7HO, 150; HBO, 160; KI, 80. under nitrogen. The dried FAME samples were dissolved in N6 Vitamins (100x) (mg/100 ml): Glycine, 20; Thiamine 20ll of hexane and transferred to conical glass inserts in vials HCl, 10; Pyridoxine-HCl, 5; Nicotinic acid, 5. for GC analysis. B5 micro-elements (100x) (mg/1000 ml): MnSO4HO, FA Analysis by Gas Chromatography 60 1000; NaMoO2HO, 25; HBO,300; ZnSO.7HO, 200: Fatty acid methyl esters were prepared by alkaline trans CuSO4.5HO, 3.87; CoC1.6HO, 2.5; KI, 75. methylation as follows. Single seed samples were squashed B5 vitamins (100x) and Gamborg's vitamin solution between filter paper disks. The fatty acids in the lipid trans (1000x) from Sigma cell culture. ferred to the filter paper disks were then methylated in 2 mL FeEDTA (200x) (g/200 ml): Ferric-sodium salt, 1.47. of 0.02 M sodium methoxide for 10 minutes at 80° C., fol- 65 2,4-D (1 mg/ml): Dissolve 100 mg of 2,4-dichloro-phenoxy lowed by cooling for 30 minutes. 0.1 mL of glacial acetic acid acetic acid in 1 ml absolute ethanol, add 3 ml of 1N KOH, was then added, followed in order by 2 mL of distilled water adjust to pH 6 with 1N HC1. US 9,351,507 B2 35 36 BAP (1 mg/ml): 6-benzyl amino purine from Sigma cell sequences were identified using homology based searches culture. using the sequence for the Genbank accession Arabidopsis NAA (1 mg/ml): Naphthalene acetic acid from Sigma cell locus AtACPTE32 and Iris locus AF213480. The program culture. used was Megablast available at NCBI (www.ncbi.nlm.nih ABA (2.5 mg/ml): Dissolve 250 mg of Abscisic acid in 2 .gov/). Default parameters used by NCBI were used and the ml of 1M NaOH, make up to 100 ml with sterile distilled databases used were both non-redundant (nr) and high water. Final background concentration to be 20 mM NaOH. throughput gene sequences (htgs) for rice, Oryza sativa. The Hygromycin (50 mg/ml): Hygromycin solution from most similar sequences from rice selected by the Megablast Roche. program were then translated and examined for the presence Timetin (150 mg/ml): Dissolve 3100 mg of Timetin in 10 of the conserved sequence NQHVNN (SEQID NO:26) found 20.66 ml of sterile water. Final concentration to be 150 in all FatB sequences. A further amino acid residue believed mg/ml. to be essential in Arabidopsis is cysteine 264 and along with Claforan (200 mg/ml): Dissolve 4 gm of Claforan in 20 ml asparagine 227 and histidine 229 (which are both present in of sterile water. the conserved sequence NQHVNN) comprise the proposed 15 catalytic triad. The Chinese Rice Database (current Website MS Salts: Murashige-Skoog minimal organic medium. address rise.genomics.org.cn/rice/index2.jsp) was also used N6D medium (amount per liter): to a limited extent and default parameters for BLAST search ing were used with the Arabidopsis sequence and Iris N6 macro (10X) 100 ml sequences. The translated sequences are aligned in FIG. 2. N6 micro (1000X) 1 ml An overview of the structures of all the FatB genes is shown N6 vitamins (1000X) 1 ml as in FIG.3. The genes described correspond as follows to the MS iron. EDTA 5 ml protein sequences discussed—AC108870 corresponds to Myoinositol 100 mg Casamino acid 300 mg Os11g43820, AP005291 corresponds to Os02.g43090, Proline 2.9 g, AP000399 corresponds to Os06g,5130 and AP004236 corre 2,4-D (1 mg/ml) 2 ml 25 sponds to Os06g,39520. Note the possibility of multiple tran Sucrose 30 g Scripts from one gene as indicated on the diagram. FIG. 4 shows a CLUSTAL W (fast) alignment of the gene’ pH adjusted to 5.8 with 1M KOH, add 3 g phytogel/liter, sequences using default parameters-note that the genes are autoclave. of different lengths. 30 The genes comprise 6 exons. The structure of the gene NB medium (amount per liter): described by Os06g,5130 is shown in detail FIG. 5, FIG. 6 shows an alignment of the coding sequences of the N6 macro-elements (20X) 50 ml FatB cDNAs indicating the different primers used for selec B5 micro-elements (100) 10 ml tive PCR amplification. B5 vitamins (100X) 10 ml 35 The sequence identity between the translated peptide FeEDTA (200X) 5 ml 2,4-D (1 mg/ml) 2 ml sequence of Os06g5130 and Os06g,39520 (corresponding to Sucrose 30 g sequence ap000399 and ap004236 in FIG. 2) was 74% over Proline 500 mg all, and the identity at the nucleotide level over the entire Glutamine 500 mg coding sequence was 69%. In both cases the program BEST Casein enzymatic hydrolysate (CEH) 300 mg 40 FIT with default parameters was used. The polypeptides deduced from Os02.g43090 (one transcript). Os06g,05130, NBO: NB media, plus 30 gll mannitol and 30 g/l sorbitol, Os06g,39520 and Os011g43820 correspond to 298, 427, 423 added before pH adjustment. and 425 amino acids respectively. NBCT+selection (Hygromycin-H30): NB media plus 30 Activity of the encoded proteins was surmised from the mg/l hygromycin, Timentin 1S0 mg/ml. Claforan 200 mg/l. 45 high degree of sequence identity with known polypeptides NBCT+selection (Hygromycin-HSO); NB media plus selec shown to have this activity. Furthermore, the observed effect tion 50 mg/l hygromycin, 200 mg/l Claforan and Timentin on palmitic acid levels of gene inactivating constructs based 150 mg/ml. on these sequences was also consistent with this conclusion PRCT+Selection:NB media with no 2,4-D, plus following (see below). added after autoclave: BAP 2 mg/l; NAA, 1 mg/l; ABA, 5 50 Expression of the gene family was complex, with at least mg/l. Claforan, 100 g/l. Timetin: 150 mg/ml+selection. seven transcripts predicted from these four genes. On the RCT+Selection: NB media with no 2,4-D, plus following basis of RT-PCR experiments that were performed and rela added after autoclave: BAP; 3 mg/l; NAA, 0.5 mg/l; Timetin, tive numbers of clones recovered from EST libraries, it 150 mg/ml. Claforan, 100 mg/1+selection. appeared that RNA from Os06g,5130 was relatively abundant /2 MS media: MS salts and vitamin mixture, 2.21 g; 55 in the grain, while Os11.g43820 was expressed at a moderate Sucrose, 109 per liter, add 2.5g phytogel/l. after autoclaving levels in that tissue and the other genes were only expressed at add 0.05 mg/l NAA and Timentin 150 mg/ml. a low level. Example 2 Example 3 60 Identification and Isolation of FutB Genes from Rice Identification and Isolation of Fad2 Genes from Rice FutEB genes encode the enzyme palmitoyl-ACP Proteins encoded by Fad2 genes (Fatty acid desaturase 2) thioesterase which have the activity preferentially transfer are responsible for the introduction of a double bond into 18:1 ring fatty acids that have a length of 16 carbons or less from 65 fatty acids—they are A12 desaturases. The Genbank acyl carrier protein to acyl-CoA and thus prevent further sequence from the Arabiodopsis locus athd12aaa was used to elongation of the fatty acid carbon chain. Putative rice FatB search the orandhtgs databases for Oryza sativa using Mega US 9,351,507 B2 37 38 blast at default settings. The most similar sequences retrieved with data from the relative frequencies of clones for this gene from rice were translated and examined for the presence of in EST libraries where cognate sequences were recovered conserved hydrophobic motifs FSYVVHDLVIVAALL from grain cDNA libraries. Sequences corresponding to two FALVMI (SEQ ID NO:27). AWPLYIAQGCVLTGVWVIA of the isoforms encoded on chromosome 7 (Os07g23430, 23410) have been recovered from a leaf EST library but the (SEQID NO:28), ISDVGVSAGLALFKLSSAFGF (SEQID sequence corresponding to the other gene (Os07g23390) has NO:29), VVRVYGVPLLIVNAWLVLITYLQ (SEQ ID not yet been reported; we concluded it may be expressed at NO:30) and the histidine rice sequences HECGHH (SEQ ID low levels if at all. NO:31), HRRHHA (SEQID NO:32) and HVAHH (SEQ ID In conclusion, the rice Fad2 gene family was also a com NO:33). The translated amino acid sequences of the isoforms plex gene family. The two transcripts deduced from obtained are shown in FIG. 7. 10 Os02.g485.60 were indistinguishable by sequence. The FIG. 8 provides an alignment of Fad2 sequences showing sequence deduced from Os02g485.60 was clearly expressed location of 5' UTR in isoform AP004.047 (lowercase) and in the grain. location of primers used for amplification by RT-PCR (under lined). The location of the stop codon is indicated by a box Example 4 and untranslated regions downstream of the stop codon are in 15 lower case. Expression of FatB and Fad2 Genes in Rice Four gene sequences are recovered as being highly similar from the rice genome when the nucleotide sequence encoding To determine which, if any, of the 4 putative FatB and 3 the protein with the amino acid sequence of AP004.047 was Fad2 genes identified in rice as described in Examples 2 and used to search the rice genome using the program BLAST 3 might be expressed in developing rice grain, reverse tran with the default parameters. The overall structure of these scription polymerase chain reaction (RT-PCR) assays were genes are shown in FIG. 9. The genes correspond to the carried out. Since the genes were closely related in sequence, protein sequences as follows. The protein sequence primers had to be designed that were specific for each of the AP004.047 (also called FAD2-1 herein) corresponded to the genes, to assay transcripts for each gene specifically. Regions gene Os02.g48560, the sequence AP0050168 (also called 25 of sequence divergence were identified from the alignments FAD2-2 herein) corresponded to Os07g23410, and the (FIGS. 6 and 8) and several primer pairs were designed and sequence contig2654 corresponded to Os07g23430. In addi tested. Primer sequences for detecting expression of the puta tion there was a sequence that shared an intriguing extent of tive FatB genes are given in Tables 3 and 4. As an internal sequence identity but was clearly different to these sequences standard against which to compare expression levels, RT and may be a pseudo-gene. This sequence was OsO7g23390. 30 PCR was also carried out on the RNA for expression oldie rice Unlike the FatB genes, the Fad2 genes did not contain any gene encoding alpha-tubulin, OsTubA1. This gene was introns. An alignment of all the protein coding sequences is known to be expressed in all actively dividing tissues and was shown in FIG. 10. The sequence identity over the entire not affected by the hormone ABA and so was suitable as a coding region for Os02.g48560 to Os07g23410 was 79%. constitutively expressed control for leaf and grain analysis. The molecular weight of the polypeptide encoded by 35 RNA was prepared from rice grains approx 15 days after Os02.g48560 (ie AP004.047) was 44.35 kDa before process flowering using the Qiagen RNeasy kit following protocols ing and contained 388 amino acids. The molecular weight of supplied by the manufacturer. DNAse treatment (DNA-free the polypeptide encoded by Os07g23410 was 44.9 kDa and kit, Ambion) was then used to remove contaminating DNA contained 390 amino acids. These deduced polypeptides had from the RNA preparation. The RT-PCR mix contained 5ul of 77% sequence identity as determined by the program BEST 40 5x Qiagen OneStep RT-PCR buffer, 1 ul of dNTP mix (con FIT using default parameters. The deduced polypeptide from taining 10 mM of each dNTP), 15 pmol of each primer and Os07g23430 had a molecular weight of 41 kDa (363 amino approximately 20 pg of RNA to a final volume of 25ul. The acids) and from Os07g23390 was 24 kDa (223 amino acids). following RT-PCR cycling program was used for the RT-PCR An alignment of all the deduced polypeptide sequences is amplifications: 30 min at 50° C. (reverse transcription), 15 shown in FIG. 7. 45 min at 95° C. PCR activation), 30 cycles of (1 min at 94° C., The sequence corresponding to Os02.g48560 was 1 min at 57°C., 1 min at 72°C.) (PCR amplification), then a expressed in the grain and this observation was consistent final extension of 10 min at 72° C. TABLE 3
Primers designed to amplify and discriminate relative expression of the putative FatB transcripts using one-step RT-PCR.
Genbank IDA Chinese Gene Contig no. Amplified ID Primer name Primer Sequence
FatB-1 APOOO399 pO399 F2 CGCTGCTACCAAACAATTCA (SEQ ID NO: 34) pO399R2 TTCTGTGTTGCCATCATCG (SEO ID NO : 35)
FatB-2 AC10887 O p5291 F2 CAGGAAATAAAGTTGGTGATGATG (SEQ ID NO: 36) p887 OR CTTCACAATATCAGCTCCTGACTC (SEO ID NO : 37) US 9,351,507 B2 39 40 TABLE 3 - C Ontinued Primers designed to amplify and discriminate relative expression of the putative FatB transcripts using one-step RT-PCR.
Genbank IDA Chinese Gene Contig no. Amplified ID Primer name Primer Sequence FatB-3 APOO5291 p5291 F2 CAGGAAATAAAGTTGGTGATGATG (SEQ ID NO: 38) p5291R CTTCACAATGTCAGCCTTCAC (SEO ID NO. 39)
FatB-4 APOO 4236 p4236F2 ACAGGCCTGACTCCACGAT (SEQ ID NO: 40) p4236R2 GTCCAGAGTGCTTGTTGCAG (SEQ ID NO: 41) OsTuba.1 AF182523 OSTUBA1 F TACCCACTCCCTCCTTGAGC (SEQ ID NO: 42) OSTUBA1, R AGGCACTGTTGGTGATCTCG (SEQ ID NO : 43)
TABLE 4 Primers designed to amplify and discriminate relative expression of the putative Fact2 transcripts using one-step RT-PCR. Genbank IDA Gene Chinese Amplified Contig no. ID Primer name Primer Sequence Fad2-1 APOO4047 pFad2-1F CACAAAGAGGGAGGGAACAA (SEQ ID NO: 44) pFad2-1R GAAGGACTTGAT CACCGAGC (SEQ ID NO: 45) Fad2-2 Contig2654 UTR 2654 F CACAACATCACGGACACACA (SEQ ID NO: 46) UTR 2654 R GCAAGACCGACATGGCTAAT (SEO ID NO: 47) Fad2-3 APOO51.68 UTR 5168 F ACGTCCTCCACCACCTCTT (SEQ ID NO: 48) UTR 5168 R. CAGAAGCAGTGACATACCCAAG (SEQ ID NO: 49) OsTuba.1 AF182523 OSTUBA1 F TACCCACTCCCTCCTTGAGC (SEO ID NO : 50) OSTUBA1, R AGGCACTGTTGGTGATCTCG (SEQ ID NO: 51)
Results from the RT-PCR experiments demonstrated that abundant in rice grain, all the FatB and Fad2 mRNAs accu the sequence Fad2-1 gene (TIGR rice database identifier mulated to low levels as determined by RT-PCR. However, LOC Os02.g48560) was highly expressed in both grain and 50 this conclusion was based on the assumption that the primers, leaf relative to the genes encoding the other isoforms. The for each of the genes tested, hybridized to the target tran other two Fad2 genes (LOC Os07g23410 and scripts with similar efficiency to the tubulin primers/tran LOC Os07g23430) appeared to be expressed at low levels Script. and primarily in the leaf. The analysis of genes encoding the This conclusion is corroborated by EST database search FatB isoforms showed that FatB-1 (Genbank identifier 55 ing. When the Fad2-1 (TIGR Os02.g48560) sequence was AP000399, Tigr LOC Os06g05130) and FatB-2 (Genbank used to search rice EST sequences, transcript sequences were identifier AC108870, TIGR identifier Os11g43820) were present in panicle, root and whole plant clNA libraries. In more highly expressed in the grain than the other two genes. contrast, Fad2-2 (TIGR Os07g23410) and Fad2-3 (TIGR The ToS-17 transpositional insertion mutant had an insertion Os07g23430) sequences were present only in leaf, shoot or in the gene encoding AP000399. 60 whole plant libraries. The sequence for Os07g23390, the In leaf tissue, FatB-1 (Genbank identifier AP000399, Fad2-like gene considered to be a pseudogene, was not TIGR LOC Os06g05130) and FatB-4 (AP004236, TIGR present in any of the EST libraries. Similarly, FatB-1 (TIGR LOC Os06g39520) were more highly expressed, referring to Os06g05130) sequences were present in both leafand panicle the relative abundance of mRNA transcripts from the genes. EST libraries, whereas FatB-2 sequences (TIGR When compared to the abundance of the tubulin gene tran 65 Os11.g43820) were present only in panicle or whole plant Scripts as a standard, which was a moderately abundant EST libraries and FatB-1 (TIGR Os06g,39520) only in a leaf mRNA in wheatgrain and was therefore expected to similarly library. FatB-3 (AP005291, Os02.g430900) sequences US 9,351,507 B2 41 42 although expressed at a relatively low level to the others in one copy of the fragment in the sense orientation and a second both leaf and grain as judged by RT-PCR, were present in copy in the antisense orientation, separated by the intron panicle and whole plant EST libraries. These searches used sequence from the 5' UTR of the cotton microsomsal (O6-de the BLAST program on the NCBI website (www.ncbi.nlm saturase GhPad 2-1 gene (Liu et al., 1999). The inverted repeat .nih.gov/BLAST/Blast.cgi) using the EST database and lim construct was Subsequently inserted into the SacI site iting the search to sequences from rice. between the Ubil promoter and Nos terminator of pubilcas Based on these data, Fad2-1 and FatB-2 were considered to NOT (from Zhongyi Li based on sequence described in Liet be the genes that should be down-regulated for alteration of al., 1997). The inverted repeat portion of rice FatB with the grain lipid. FatB-3 was also thought be important in this pUbil promoter was then inserted in the NotI site of the binary regard. 10 vector pWBVec8 and introduced into Agrobacterium as for Example 5 the Fad2 construct described above. The duplex RNA con struct was designated dsRNA-FatB-1. Construction of Gene Silencing Constructs and Analysis of Fatty Acid Composition in Transformed Rice Transformation of Rice 15 Ten independent fertile transgenic plants obtained with dsRNA-Fad2-1 were tested for the presence of the dRNA Creation of duplexRNA Construct for Inhibition of Fad2 gene by PCR using one primer corresponding to a site within Expression the promoter region and a second primer for the end of the A construct was designed to express a duplex RNA (hairpin Fad2 sequence. Nine of the ten plants were found to be RNA) in developing rice grain in order to reduce expression positive in the PCR reaction and therefore contained the Fad2 of Fad2-1. By targeting common regions of the three Fad2 RNAi construct. Similarly, 23 fertile transgenic lines were gene sequences, the construct was designed so that it would tested for the FatB RNAi construct and 20 lines were found to be effective for all three of the identified Fad2 genes in rice be PCR positive. grain in order to potentially To analyse the effect of the transgenes on fatty acid com maximize the effect on fatty acid composition. To improve 25 position, total lipid was isolated from grain and leaf samples silencing efficiency, the construct contained an intron of the transformed rice plants. This was also done for a rice between the sense and antisense portions of the inverted mutant line containing a ToS 17 insertional sequence in the repeat sequences as described by Smith et al. (2000). gene for FatB-1 (TIGR locus OsO6g5130 corresponding to A505 basepairfragment was amplified by PCR from the 5' the protein identified by the Accession No. AP000399) to end of the Fad2-1 gene using the oligonucleotides pFad2-F 30 compare the effect of specifically inactivating this gene. Fatty 5'AAAGGATCCTCTAGAGGGAGGAGCAGCAGAAGC 3' (SEQ ID NO:52) and pFad2-R 5'-AAAACTAGTGAAT acid composition was determined for each lipid extract by TCTACACGTACGGGGTGTACCA-3' (SEQ ID NO:53). GC-FAME as described in Example 1. The data are presented The PCR product was ligated into pGEM-Teasy, transformed in Tables 5 to 7 and some of that data is presented graphically into E. coli and colonies containing the insert identified. The 35 in FIGS. 11 to 13. The proportion of each fatty acid was Xbal/EcoRI fragment from the plasmid expressed as a percentage of the total fatty acid in the seed oil designated pCEM-T-Fad2, containing the 505 bp Fad2 frag of the grain as determined by HPLC as described in Example ment, was then ligated in the sense direction into the vector 1. ZLRint9 BC3895 (obtained from Zhongyi Li, CSIRO Plant The most striking and Surprising aspect of the results was Industry) containing the intron Rint9. A BamHI/Spel frag 40 the extent of the change in grain oleic acid and linoleic acid ment from pCEM-T-Fad2 was then ligated (in the antisense composition in the Fad2 dsRNA plants. The proportion of orientation) into the resultant plasmid so that an intron con oleic acid in some lines increased from 36% to at least 65% taining hairpin construct was formed. The BamHI/KpnI frag (w/w) and that of linoleic acid decreased from 37% to about ment containing the Fad2-1 intron containing hairpin was 13% in the rice line most affected (Line 22A). Surprisingly, then inserted into the same restriction sites of the 45 the proportion of palmitic acid in the Fad2 lines was also pBx17casNOT vector (Zhongyi Li, personal communica decreased, for example in Line 22A to less than 14% as tion), containing the BX17 seed specific promoter containing compared to the control (18%). a Nosterminator/polyadenylation sequence so that the silenc In the FatB dsRNA lines, the reduction in the proportion of ing gene would be expressed in developing seed in the order palmitic acid in the grain was correlated with an increase in (promoter) sense-intron-antisense (terminator). The HindIII/ 50 the linoleic acid content while the proportions of oleic acid NotI fragment containing the BX17 promoter and Fad2-1 and linolenic acids were essentially unchanged. It was noted inverted repeat region was then inserted into the same restric that the extent, of the decrease in the proportion of palmitic tion sites of the binary vector pWBvec8 (Wang et al., 1998) acid in both Fad2 and FatB transgenic lines was similar, but that combined a selectable maker gene conferring hygromy the extent of increase in the linoleic acid level in the FatBlines cin resistance. This vector was then introduced into Agrobac 55 was much less than the extent of the decrease observed in the terium and used for rice transformation as described in Fad2 lines. That is, the extent of the change in levels of Example 1. The duplex RNA construct was designated linoleic was greater with the Fad2 construct. dsRNA-Fad2-1. An interesting insight into the FatB catalysed step of the Creation of duplexRNA Construct for Inhibition of FatB pathway is provided by analysis of the Tos-17 insertional Expression 60 knockout of one isoform of FatB, FatB-1. In the Tos-17 A 665-basepair fragment of the rice palmitoyl-ACP mutant, the extent of the change in the proportions of palmitic thioesterase FatB-1 gene (Tigr LOC Os06g05130) was acid and oleic acid was reduced compared to the FatB dsRNA amplified by PCR using primers with the following lines. These results indicated that genes encoding the FatB Sequences: Rte-s1, 5'-AGTCATGGCTGGTTCTCT isoforms differed in their function. TGCGGC-3' (SEQ ID NO:54) and Rite-a1, 5'-ACCATCAC 65 When the results of the proportions of linoleic acid versus CTAAGAGACCAGCAGT-3' (SEQ ID NO:55). This PCR oleic acid were plotted as a scatter plot (FIG. 14), it was clear fragment was used to make an inverted repeat construct with that the relationship between these two fatty acids in the Fad2 US 9,351,507 B2 43 44 knockouts was the same as in wildtype rice, although the shifted by a constant. This meant that there was more linoleic proportion of linoleic acid was vastly reduced. In contrast, acid in the FatB knockout plants for a given amount of oleic with the FatB knockout and acid than in wild-type or Fad2 knockout plants. This was consistent with the idea that knockout of FatB influenced the TABLE 5 pathways controlling the amounts of oleic and linoleic acid GC analysis of fatty acid composition but not the step directly linking oleic acid and linoleic acid in rice grain of FatB and Fad2 mutants which was controlled by Fad2. The results of the proportion of linoleic acid versus palm Lino- Lino itic were also plotted for all of the rice lines analysed. A Myristic Palmitic Stearic Oleic leic lenic 10 Grain-Mutant (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) positive linear relationship was observed for the Fad2 knock out lines, inverse of what was observed for linoleic versus Wild type O.70 8.83 1.64 38.41 36.42 29 (WH12) oleic acid. For the FatB lines, however, a different relation FatB ToS17 0.72 S.13 2.33 37.15 38.61 87 ship is observed (FIG. 15). A difference in the relationship insertional 15 between oleic and palmitin acid was also observed when the mutant FatB dsRNA O.S8 1.43 1.81 34.92 46.60 91 Fad2 dsRNA plants and FatB dsRNA plants were plotted as a transformed scatter plot (FIG. 16). These results confirmed that the rela line tionship between palmitic and linoleic acid (and oleic acid) Fad2 dsRNA O.S8 4.26 2.11 64.94 12.62 23 was different for the two perturbations of the pathway. transformed line Principal component analysis of the proportions of the Control for O.85 7.91 2.60 33.23 39.84 .76 various fatty acids under different perturbations of the path ToS17 way confirm that principal component 1 (which indicates the Control for 1.03 8.86 1.84 34.08 39.63 .75 FatB dsRNA axes that contribute the greatest variation) was composed of Control for 1.02 747 2.38 36.03 37.42 SO the proportions of linoleic versus oleic whereas the principal Fad2 dsRNA 25 component 2 (the second most important set of axes) was composed of proportions of linoleic and oleic acid versus palmitin acid). This is illustrated in FIG. 17. TABLE 6 GC analysis of fatty acid composition in rice leaves of FatB and Fad2 mutants Lauric Myristic Palmitic Stearic Oleic Linoleic Linolenic Leaf-mutant (C12:0) (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) Wild-type (WF2) O.80 14.43 1.90 2.32 8.99 68.96 FatB ToS17 O.34 11.55 1.84 2.24 15.04 67.70 insertional mutant FatB dsRNA O.S6 1.01 1439 2.09 2.07 1321 64.56 transformed line Fad2 dsRNA transformed line Control for Tos17 O.39 10.52 18O 2.30 15.61 67.65 Control for FatB 0.72 1.15 13.30 2.03 4.04 24.62 52.28 dsRNA
TABLE 7 Relative amounts of grain fatty acids in mutant lines compared to corresponding control lines (% in mutant/96 in corresponding control Myristic Palmitic Stearic Oleic Linoleic Linolenic (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) Grain fatty acids FatB ToS17 O.85 0.8451 * O.899 1.118 * 0.9691 1.06 insertional mutant FatB dsRNA 0.57 * 0.6060 * O.980 1.025 1176 : 1.09 transformed line Fad2 dsRNA O.570 * 0.8167 * 0.887 * 1802 * 0.3373 * 0.822* transformed line Leaf fatty acids FatB ToS17 ind 0.911 * 0.977 1.03 1.037 O.9992 insertional mutant FatB dsRNA ind O.92.47 O.969 1958 1864 * 0.8098: transformed line * Statistically significant change
65 to a lesser extent in the FatB Tos-17 line, although the rela We also concluded from the results presented in this tionship between linoleic acid and oleic was similar, it is Example that crossing the dsRNA Fad2 plants with the US 9,351,507 B2 45 dsRNA FatB plants or Tos-17 FatB plants to combine the - Continued mutations would further increase the relative proportion of (SEQ ID NO : 61) oleic acid and further decrease palmitin and linoleic acid GCCGACGATGTCGTCGAGCAC (reverse complement of levels. positions 379-398 in the alignment shown in Example 6 FIG. 10) Set 8 Production and Use of Antibodies (SEQ ID NO: 62) TGCCTTCTCCGACTACTCGG (positions 360-379 in FIG. Antibodies were raised by synthesizing 15 or 16-mer pep 10 tides that were present in the deduced sequence of FatB. The 10) peptides used to raise antibodies against FatB were: (SEQ ID NO: 63) FatB-U1 Ac-CGMNKNTRRLSKMPDE (SEQ ID NO:56). CCTCGCGCCATGTCGCCTTGG (reverse complement of This corresponds to the translated sequence of FatB (Acces sion No. AP000399) from amino acid position number 259 15 positions 1099-1118 in FIG. 10). and was also found in sequences translated from AP005291, The annealed products will then be subjected to melting in ACI08870 and AC004236. However, the sequence was only a Rotorgene 6000 instrument (Corbett Life Science) or a identical between the four isoforms in the sequence TRRL comparable instrument where differences in melting of het SKMPDE (SEQ ID NO:57). eroduplexes can be sensitively detected by means of alter FatB-U2. Ac-CGEKQWTLLDWKPKKPD (SEQ ID NO:58). This sequence was found in the translated sequence ation of fluorescence of a dye LC Green. Hundreds and pos of all four FatB isoforms. sibly thousands of rice lines can be screened daily by this FatB-99. Ac-CGAQGEGNMGFFPAES (SEQ ID NO:59). technique. This sequence was found only in AP00399 and was at the very The PCR products from samples showing an altered ther C terminus of the deduced polypeptide. 25 mal profile will be sequenced and the mutations in Fad2 After synthesis the peptides were coupled to either Oval identified. Selected mutations which inactivate Fad2 can then buminor Keyhole Limpet Haemocyanin protein (KLH) using be crossed into elite rice lines to produce rice lines with the cross-linker MBS (maleimidobenzoic acid N-hydroxyl reduced Fad2 activity and therefore high oleic acid. If two or Succinimide ester) using standard techniques. The cross all of the Fad2 isoforms need to be eliminated then this can be linked peptide was dialysed and lyophilized and injected into 30 achieved by identifying lines with the required mutations in rabbits at two weekly intervals for two months with Friends incomplete adjuvant at a concentration of approx Antisera different isoforms and combining the mutations in an elite raised against FatB-99 detected a clear difference between rice line through marker assisted breeding. At least the Fad2-1 FatB isoforms in that a polypeptide of 20 kDa present in gene needs to be inactive for Substantial increases in oleic wild-type rice was missing in the ToS-17 mutant line having acid content or decreased linoleic acid content. Inactivation of an insertion in the gene corresponding to TIGR identifier 35 one or more of the additional Fad2genes will further increase Os06g5130, the product corresponds to FatB-1, the sequence oleic acid content and decrease linoleic acid content Mutants is represented by accession No. AP000399 (FIG. 18). having mutations in additional Fad2 genes may be identified Although this was different to the expected size of approx 40 in the same way as for Fad2-1, using specific primers for the kDa, such a discrepancy had been noticed before with FatB additional Fad genes. isoforms Different size of FatB products have been observed 40 in developing and mature Cuphea Wrightii seeds showing five Example 8 different FatB isoforms, longer size in mature seeds and shorter product in mature seeds (Leonard et al., 1997). Stability Analysis—Detection of Hexanal Production The antisera can be used to detect FatB protein in the in Storage transgenic or mutant plant samples and confirm the extent of 45 gene inactivation. Experiments are underway with FSA, Werribee to detect the production of hexanal on Storage in wildtype rice. This Example 7 involves GC using a sampler to detect the volatiles in the Identification of Mutants in Rice Fad2 headspace of grain stored at high temperature (40°C.). Once 50 the system is optimized (and also we have sufficient quantity PCR products spanning the active sites (essentially posi of grain) we will undertake a comparison of the production of tions 330 to 1020 if the initiating ATG is taken as the start of Volatiles, particularly hexanal, upon storage of wildtype and the numbering in TIGR Loc Os2.g48560) of Fad2-1 (coding Fad2 RNAi and FatB RNAi rice lines and suitable combina sequence corresponding to AP00 4047 in NCBI database, tions of genotypes. This is an important quality issue in the TIGR locus identifier LOC Os02.g48560) will be produced 55 rice industry for storage of grain and also of storage of bran. from rice DNA extracted from a large number of different rice The production and detection of other volatiles, which could accessions. The size of the products will be up to 800 bp have a role in affecting grain quality, is also being investi depending on the primers used. Two sets of overlapping gated, both with FSA, Werribee and CSIRO Entomology. primer pairs may need to be used. One possible set of primers Around 10 g of raw brown rice is required for headspace 1S 60 analysis. The brown rice is stored at 4°C. (control) and 35°C. for 8 weeks. The gas sample released from brown rice can be obtained in the headspace of a vial by either heating at 80°C. Set A. or by natural diffusion. The volatile components in the head (SEQ ID NO: 6O) GTGCCGGCGGCAGGATGACGG (positions 5-20 in the space can then be analysed by direct injection into a GC or 65 GC-MS machine and analysis of the gas chromatographic alignment shown in FIG. 10 profiles (Suzuki et al., 1999). Another method for analysis of Volatiles in the headspace is through the trapping of volatiles US 9,351,507 B2 47 48 onto a suitable matrix (eg 250 mg Tenax GR) as described by Fujimura et al. (1985) Plant Tissue Culture Letters 2:74. Nielsen et al. (2004) using nitrogen as a purge gas. The Graham et al. (1973) Virology 54:536-539. desorption of the aroma compounds is then done thermally Gunstone (2001) Inform 11: 1287-1289. and the trapped molecules are analysed by GC and identified Ha (2005) Nutrition research 25,597-606. using standards. Haseloff and Gerlach (1988) Nature 334:585-591. The expectation that storage of rice would be improved in Henikoffet al. (2004) Plant Physiol 135: 630-636. rice lines with low linoleic acid is based on a number of Hu et al. (1997). N. Engl. J. Med. 337: 1491-1499. observations. Suzuki et al. (1999). have presented data that Jennings and Akoh (2000) Journal of Agricultural and Food the amount of free linoleic acid increases during storage and Chemistry, 48:4439-4443. that the amount of Volatile aldehydes such as pentanal, hexa 10 Jones et al. (1995) Plant Cell 7: 359-371. nal and pentanol increase three fold at 35C. The correlation of Kinney (1996).J. Food Lipids 3:273-292. hexanal and volatile aldehydes with odour has been noted by Kodama et al. (1997) Plant Molecular Biology 33:493-502. other authors as well. On the other hand, Zhou et al. (2002) Kohno-Murase etal. (2006). Transgenic Research 15:95-100. found a reduction of total linoleic acid upon storage and Koziel et al. (1996) Plant Mol. Biol. 32:393-405. related this to the decomposition of linoleic acid to other 15 Langridge et al. (2001) Aust J Agric Res 52: 1043-1077. products, including volatiles responsible for off-odours. The Lemieux (2000) Current Genomics 1:301-311. differences in the results may be due to differences in the Leonard et al. (1997) Plant Molecular Biology, Volume 34, extraction and analytical methods. ISSue 4: 669-679. The production of hexanal for linoleic acid in vitro has Liet al. (1997) Molec Breeding 3:1-14. been demonstrated by Nielsen et al. (2004). Lu et al. (1993) J. Exp. Med. 178:2089-2096. It will be appreciated by persons skilled in the art that Liu et al. (1999) Aust. J. Plant Physiol. 26:101-106. numerous variations and/or modifications may be made to the Liu et al. (2002a). J. Am. Coll. Nutr. 21: 205S-211S. invention as shown in the specific embodiments without Liu et al. (2002b). Plant Physiol. 129: 1732-1743. departing from the spirit or scope of the invention as broadly Mensink and Katan (1990). N. Engl. J. Med. 323: 439-445. described. The present embodiments are, therefore, to be 25 Mikkilineni and Rocheford (2003) Theor. Applied Genetics, considered in all respects as illustrative and not restrictive. 106, 1326-1332. All publications discussed and/or referenced herein are Millar and Waterhouse (2005) Funct Integr Genomics 5:129 incorporated herein in their entirety. 135. This application claims priority from AU 2006903810, the Moghadasian and Frohlich (1999) Am. J. Med. 107:588-94. entire contents of which are incorporated herein by reference. 30 Morrison (1988) 1 Cereal Sci 8:1-15. Any discussion of documents, acts, materials, devices, Most et al. (2005) Am J Clin Nutr 81:64-8. articles or the like which has been included in the present Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453. specification is solely for the purpose of providing a context Nielsen et al. (2004) Journal of Agricultural and Food Chem for the present invention. It is not to be taken as an admission istry 52:2315-2321. that any or all of these matters form part of the prior art base 35 Noakes and Clifton (1998) Am. J. Clin. Nutr. 98: 242-247. or were common general knowledge in the field relevant to Ohlrogge and Jaworski (1997) Annu Rev Plant Physiol Plant the present invention as it existed before the priority date of Mol Biol. 48:109-136. each claim of this application. Oil World Annual (2004) International Seed Testing Associa tion (ISTA) Mielke GmbH, Hamburg, Germany REFERENCES 40 Pasquinelli et al. (2005) Curr Opin Genet Develop 15: 200 205. Abdullah et al. (1986) Biotechnology 4: 1087. Perriman et al. (1992) Gene 113: 157-16. Akagi et al. (1995) Plant Physiol. 108,845-846 Radcliffe et al (1997) Biochem Arch 13: 87-95. Almeida and AlILshire (2005) TRENDS Cell Biol 15: 251 Resurreccion etal (1979) Journal of the Science of Food and 258. 45 Agriculture, 30: 475-481. Anal et al. (2003) Plant Cell Rep. 21,988-992. Roche and Gibney (2000) Am. J. Clin. Nutr. 71: 232S-237S. Ascherio and Willett (1997) Am. J. Clin. Nutr. 66: 10065 Rukmini et al. (1991). Journal of The American College of 101OS. Nutrition 10:593-601. Bligh and Dyer Canadian J. Biochem. (1959) 37: 911-917. Sebedio et al. (1994) Fett. Wiss. Technol. 96: 235-239. Boggs et al. (1964) J. Food Sci. 29:487-489. 50 Senior (1998) Biotech. Genet. Engin. Revs. 15:79-119. Bonanome and Grundy (1988). N. Engl. Med. 318: 1244 Shibuya et al. (1974) Journal of the Japanese Society of Food 1248. Science and Technology 21:597-603. Brandt et al. (1985) Carlsberg Res. Commun. 50: 333-345. Shin et al. (1986) J. Food Sci. 51:460-463. Broun et al., (1999) Annu. Rev. Nutr. 19: 197-216. Shippy et al. (1999) Mol. Biotech. 12: 117-129. Buhr et al. (2002). Plant J.30: 155-163. 55 Slade and Knauf (2005) Transgenic Res 14: 109-115. Capecchi (1980) Cell 22:479-488. Smith et al. (2000) Nature 407:319-320. Champagne et al. (1995) Cereal Chem 72:255-258. St Angelo et al. (1980) J Lipids 1:45-49. Changet al., (1978). J. Am. Oil Chem. Soc. 55: 718–727. Stefanov et al. (1991) Acta Biologics Hungarica 42:323-330. Chapman et al., (2001). J. Am. Oil Chem. Soc. 78:941-947. Stoutjesdijket al., (2000). Biochem. Soc. Trans. 28:938-940. Choudry et al. (1980) Phytochemistry 19: 1063-1069. 60 Stoutjesdijk et al. (2002) Plant Physiology 129: 1723-1731. Clapp (1993) Clin. Perinatol. 20:155-168. Stymne and Stobart (1987) Lipids, Vol. 9: 175-214. Colotet al. (1987) EMBOJ 6:3559-3564. Suzuki et al. (1999) T. Agric. Food Chem. 47: 1119-1124. Comai et al. (2004) Plant J 37: 778-786. Taira et al. (1988).J. Agric. Food Chem. 34:542-545. Curiel et al. (1992) Hum. Geo. Ther. 3:147-154. Thelen and Ohlrogge (2002) Metabolic Engineering 4: 12-21 Dougherty et al. (1995). Am. J. Clin. Nutr. 61:1120-1128. 65 Theriault et al. (1999). Clin. Biochem. 32: 309-19. Eglitis et al. (1988) Biotechniques 6:608-614. Tholstrup et al. (1994) Am. J. Clin. Nutr. 59:371-377. Fenandez San Juan (1995). Alimentaria 33:93-98. Toriyarna et al. (1986) Theor. Appl. Genet. 205:34. US 9,351,507 B2 49 50 Tsugita et al (1983) Agricultural and Biological Chemistry Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: 47: 543-549. 13959-13964. Tsuzuki etal (2004) Lipids 39:475-480. Williams et al. (1999).J. Am. Coll. Cardiol. 33:1050-1055. Voelker et al. (1996). Plant J. 9: 229-241. Wagner et al. (1992) Proc. Natl. Acad. Sci. USA 89:6099- 5 Yasumatsu et al. (1966) Agric. Biol. Chem. 30:483-486. 6103. Zhou et al. (2002) Journal of Cereal Science 35:65-78. Wang et al. (1998) ACTA Hort. 461:401-407. Zocket al. (1994) Arterioscler Thromb. 14: 567-575
SEQUENCE LISTING
NUMBER OF SEO ID NOS: 83
SEO ID NO 1 LENGTH: 425 TYPE PRT ORGANISM: Oryza sativa
<4 OOs SEQUENCE: 1.
Met Ala Gly Ser Luell Ala Ala Ser Ala Phe Phe Pro Gly Pro Gly Ser 1. 5 15
Ser Pro Ala Ala Ser Ala Arg Ser Ser Asn Ala Ala Val Thr Gly 25 3 O
Glu Lell Pro Glu Asn Luell Ser Wall Arg Gly Ile Wall Ala Llys Pro Asn 35 4 O 45
Pro Pro Pro Ala Ala Met Glin Wall Ala Glin Ala Glin Thir Lieu. Pro SO 55 60
Lys Wall Asn Gly Thir Lys Wall Asn Lell Thir Wall Pro Asp Met 65 70 8O
Glu Glu Thir Wall Pro Ser Ala Pro Lys Thir Phe ASn Gln Lieu. 85 90 95
Pro Asp Trp Ser Met Luell Luell Ala Ala Ile Thir Thir Ile Phe Lieu. Ala 105 110
Ala Glu Lys Glin Trp Thir Luell Lell Asp Trp Pro Lys Llys Pro Asp 115 12O 125
Met Lell Wall Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Met 13 O 135 14 O
Wall Phe Arg Glin Asn Phe Met Ile Arg Ser Tyr Glu Ile Gly Ala Asp 145 15 O 155 16 O
Arg Thir Ala Ser Ile Glu Thir Lell Met Asn His Luell Glin Glu Thir Ala 1.65 17 O 17s
Luell Asn His Wall Arg Thir Ala Gly Lell Lell Gly Asp Gly Phe Gly Ala 18O 185 190
Thir Pro Glu Met Ser Arg Asn Lell Ile Trp Wall Wall Ser Lys Ile 195 2 OO
Glin Lell Lell Wall Glu Glin Tyr Pro Ala Trp Gly Asp Thir Wall Glin Wall 210 215 22 O
Asp Thir Trp Wall Ala Ala Ala Gly Asn Gly Met Arg 225 23 O 235 24 O
His Wall Arg Asp Tyr Asn Ser Gly Arg Thir Ile Luell Arg Ala Thir Ser 245 25 O 255
Wall Trp Wall Met Met His Thir Arg Arg Luell Ser Lys Met Pro 26 O 265 27 O
Asp Glu Wall Arg Ala Glu Ile Gly Pro Phe Asn Asp Arg Ser Ala 28O 285
Ile Thir Glu Glu Glin Ser Glu Lell Ala Thir Gly Asn Llys Val 290 295
Gly Asp Asp Ala Thir Glu Glin Phe Ile Arg Lys Gly Luell Thr Pro Arg 305 31 O 315 32O US 9,351,507 B2 51 52 - Continued
Trp Gly Asp Luell Asp Wall Asn Glin His Wall ASn Asn Wall Lys Tyr Ile 3.25 330 335
Gly Trp Ile Luell Glu Ser Ala Pro Ile Ser Wall Lell Glu Lys His Glu 34 O 345 35. O
Lell Ala Ser Met Thir Lell Asp Tyr Arg Glu Gly Arg Asp Ser 355 360 365
Wall Luell Glin Ser Lell Thir Thir Wall Ser Glu Cys Thir Ser Ile Gly 37 O 375 38O
Ala Asp Glin Ala Ser Ala Ile Glin Asp His Lell Luell Glin Luell 385 390 395 4 OO
Glu Ser Gly Ala Asp Ile Wall Ala His Thir Glu Trp Arg Pro 4 OS 41O 415
Arg Ser His Ala Ala Ala Glu Asn Ala 42O 425
<210s, SEQ ID NO 2 &211s LENGTH: 298 212. TYPE : PRT &213s ORGANISM: Oryza sativa
<4 OOs, SEQUENCE: 2
Met Ala Gly Ser Lell Ala Ala Ser Ala Phe Phe Pro Gly Pro Gly Ser 1. 15
Ser Pro Ala Ala Ser Ala Arg Ser Ser ASn Ala Ala Wall Thir Gly 25
Glu Luell Pro Glu Asn Lell Ser Wall Gly Ile Wall Ala Pro Asn 35 4 O 45
Pro Pro Pro Ala Ala Met Glin Wall Ala Glin Ala Glin Thir Luell Pro SO 55 6 O
Lys Wall Asn Gly Thir Lys Wall Asn Luell Thir Wall Pro Asp Met 65 70
Glu Glu Thir Wall Pro His Ser Ala Pro Lys Thir Phe Asn Glin Luell 85 90 95
Pro Asp Trp Ser Met Lell Lell Ala Ala Ile Thir Thir Ile Phe Luell Ala 105 11 O
Ala Glu Lys Glin Trp Thir Lell Luell Asp Trp Pro Lys Pro Asp 115 12 O 125
Met Luell Wall Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Met 13 O 135 14 O
Wall Phe Arg Glin Asn Phe Met Ile Arg Ser Tyr Glu Ile Gly Ala Asp 145 150 155 160
Arg Thir Ala Ser Ile Glu Thir Luell Met Asn His Lell Glin Glu Thir Ala 1.65 17O 17s
Lell Asn His Wall Arg Thir Ala Gly Luell Luell Gly Asp Gly Phe Gly Ala 18O 185 19 O
Thir Pro Glu Met Ser Arg Asn Luell Ile Trp Wall Wall Ser Ile 195 2OO
Glin Luell Luell Wall Glu Glin Tyr Pro Ala Trp Gly Asp Met Wall Glin Wall 21 O 215 22O
Asp Thir Trp Wall Ala Ala Ala Gly Asn Gly Met Arg Arg Asp Trp 225 23 O 235 24 O
His Wall Arg Asp Tyr Asn Ser Gly Arg Thir Ile Lell Arg Ala Thir Ser 245 250 255
Wall Trp Wall Met Met His Thir Arg Arg Lell Ser Lys Met Pro 26 O 265 27 O US 9,351,507 B2 53 - Continued Asp Glu Val Arg Ala Glu Ile Gly Pro Tyr Phe Asn Asp Arg Ser Ala 27s 28O 285 Ile Thr Glu Glu Glin Ser Glu Lys Lieu Ala 29 O 295
<210s, SEQ ID NO 3 &211s LENGTH: 427 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 3 Met Ala Gly Ser Leu Ala Ala Ser Ala Phe Phe Pro Val Pro Gly Ser 1. 5 1O 15 Ser Pro Ala Ala Ser Ala Arg Ser Ser Lys Asn. Thir Thr Gly Glu Lieu. 2O 25 3O Pro Glu Asn Lieu. Ser Val Arg Gly Ile Val Ala Lys Pro Asn Pro Ser 35 4 O 45 Pro Gly Ala Met Glin Val Lys Ala Glin Ala Glin Ala Lieu Pro Llys Val SO 55 6 O Asn Gly. Thir Lys Val Asn Lieu Lys Thir Thir Ser Pro Asp Llys Glu Asp 65 70 7s 8O Ile Ile Pro Tyr Thr Ala Pro Llys Thr Phe Tyr Asn Gln Leu Pro Asp 85 90 95 Trp Ser Met Lieu. Lieu Ala Ala Val Thir Thir Ile Phe Lieu Ala Ala Glu 1OO 105 11 O Lys Glin Trp Thir Lieu. Lieu. Asp Trp Llys Pro Llys Llys Pro Asp Met Lieu. 115 120 125 Ala Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Lieu Val Phe 13 O 135 14 O Arg Glin Asn. Phe Lieu. Ile Arg Ser Tyr Glu Ile Gly Ala Asp Arg Thr 145 150 155 160
Ala Ser Ile Glu Thir Lieu Met Asn His Lieu. Glin Glu Thir Ala Lieu. Asn 1.65 17O 17s His Val Lys Thr Ala Gly Lieu. Lieu. Gly Asp Gly Phe Gly Ala Thr Pro 18O 185 19 O Glu Met Ser Lys Arg Asn Lieu. Ile Trp Val Val Ser Lys Ile Glin Lieu. 195 2OO 2O5 Lieu Val Glu Arg Tyr Pro Ser Trp Gly Asp Met Val Glin Val Asp Thr 21 O 215 22O Trp Val Ala Ala Ala Gly Lys Asn Gly Met Arg Arg Asp Trp His Val 225 23 O 235 24 O Arg Asp Tyr Asn. Ser Gly Glin Thir Ile Lieu. Arg Ala Thir Ser Val Trip 245 250 255 Val Met Met Asn Lys Asn. Thir Arg Arg Lieu. Ser Llys Met Pro Asp Glu 26 O 265 27 O
Val Arg Ala Glu Ile Gly Pro Tyr Phe Asin Gly Arg Ser Ala Ile Ser 27s 28O 285
Glu Glu Gln Gly Glu Lys Lieu Pro Llys Pro Gly Thr Thr Phe Asp Gly 29 O 295 3 OO
Ala Ala Thr Lys Glin Phe Thr Arg Lys Gly Lieu. Thr Pro Llys Trp Ser 3. OS 310 315 32O Asp Lieu. Asp Val Asn Gln His Val Asn. Asn Val Llys Tyr Ile Gly Trip 3.25 330 335
Ile Lieu. Glu Ser Ala Pro Ile Ser Ile Lieu. Glu Lys His Glu Lieu Ala 34 O 345 35. O US 9,351,507 B2 55 56 - Continued
Ser Met Thir Luell Asp Arg Lys Glu Gly Arg Asp Ser Wall Luell 355 360 365
Glin Ser Luell Thir Ala Wall Ser Gly Glu Asp Asp Gly Asn Thir Glu 37 O 375 38O
Ser Ser Ile Glin Asp His Luell Luell Glin Luell Glu Ser Gly Ala Asp 385 390 395 4 OO
Ile Wall Ala His Thir Glu Trp Arg Pro Arg Ala Glin Gly Glu 4 OS 41O 415
Gly Asn Met Gly Phe Phe Pro Ala Glu Ser Ala 42O 425
<210s, SEQ ID NO 4 &211s LENGTH: 423 212. TYPE : PRT &213s ORGANISM: Oryza sativa
<4 OOs, SEQUENCE: 4.
Met Ala Gly Ser Ala Ala Ser Ala Phe Luell Pro Gly Ser Pro Ala 1. 15
Ala Ala Pro Pro Ser Wall Luell Gly Glu Arg Pro Asp Ser Luell Asp 25 3O
Wall Arg Gly Ile Ala Ala Pro Gly Ser Ser Ser Ser Ala Ala Ala 35 4 O 45
Lell Arg Ala Gly Thir Arg Thir His Ala Ala Ile Pro Wall Asn SO 55 6 O
Gly Gly Ser Ser Ala Lell Ala Asp Pro Glu His Asp Thir Met Ser Ser 65 70 75
Ser Ser Ser Ser Ala Ala Pro Arg Thir Phe Asn Glin Luell Pro Asp 85 90 95
Trp Ser Met Luell Lell Ala Ala Ile Thir Thir Ile Phe Lell Ala Ala Glu 105 11 O
Glin Trp Thir Lell Lell Asp Trp Pro Arg Pro Asp Met Luell 115 12 O 125
Thir Asp Thir Phe Gly Phe Gly Arg Met Ile His Glu Gly Luell Met Phe 13 O 135 14 O
Arg Glin Asn Phe Ser Ile Arg Ser Glu Ile Gly Ala Asp Arg Thir 145 150 155 160
Ala Ser Ile Glu Thir Lell Met Asn His Luell Glin Glu Thir Ala Luell Asn 1.65 17O 17s
His Wall Ser Ala Gly Lell Luell Gly Asp Gly Phe Gly Ser Thir Pro 18O 185 19 O
Glu Met Ser Asp Lell Phe Trp Wall Wall Ser Glin Met Glin Ala 195
Ile Wall Glu Arg Tyr Pro Cys Trp Gly Asp Thir Wall Glu Wall Asp Thir 21 O 215 22O
Trp Wall Gly Ala His Gly Lys Asn Gly Met Arg Arg Asp Trp His Ile 225 23 O 235 24 O
Arg Asp Ser Wall Thir Gly His Thir Ile Luell Lys Ala Thir Ser Lys Trp 245 250 255
Wall Met Met His Lys Lell Thir Arg Arg Luell Ala Arg Ile Pro Asp Glu 26 O 265 27 O
Wall Arg Thir Glu Ile Glu Pro Tyr Phe Phe Glu His Ala Ser Ile Wall 27s 285
Asp Glu Asp Asn Glin Lell Pro Luell Pro Asp Ile Glu Gly Ala 29 O 295 3 OO US 9,351,507 B2 57 58 - Continued Asn Val Ala Lys Tyr Val Arg Thr Gly Lieu. Thr Pro Arg Trp Ala Asp 3. OS 310 315 32O
Lieu. Asp Ile ASn Gln His Wall Asn Asn. Wall Lys Tyr Ile Gly Trp Ile 3.25 330 335
Lieu. Glu Ser Ala Pro Ile Ser Ile Lieu. Glu Lys His Glu Lieu. Ala Ser 34 O 345 35. O
Ile Wall Lieu Asp Tyr Lys Arg Glu Asp Ser Val Lieu. Glin 355 360 365
Ser His Thr Thr Val Tyr Thr Asp Cys Asn Lys His Ser Gly Gn. Thir 37 O 375 38O
Thir Lieu. His Cys Glu. His Lieu. Lieu Ser Lieu. Glu Ser Gly Pro Thir Ile 385 390 395 4 OO
Val Lys Ala Arg Thr Met Trp Arg Pro Lys Gly Thr Arg Pro Glin Glu 4 OS 41O 415
Ser Ile Ile Pro Ser Ser Ser
<210s, SEQ I D NO 5 &211s LENGT H: 6943 212. TYPE : DNA &213s ORGAN ISM: Oryza sativa
<4 OOs, SEQUENCE: 5 c catatgtgc agcataaaag gcaaatcagc cctgtttgac atggctic caa tgcttaaatt 6 O ctittagagaa aaaacagact ttgtagatta aatcaaagtg gcataatctt tittattittga 12 O taaaaatatt agaaaatat c at accctaat att cittagca tag tact coa tet catect cac 18O ttattalaggt acgatcaaac ttggCatagt cittcaaaggc tgttgttctitt cc cc catttit 24 O
CCtaac Coat citat ct cqtt titcc.gc.gcac acatttitt.ca aactgctaaa cggtgttgatt 3OO tatgcaaaaa cittctatatg aaagttgttt aaaaaaatca tattaatcca tttitt taaaa. 360 aaat cagtta at acttaatt aat catgcaa taaaacgaac tt cattttgc gtgctgggga ggaggggctic CCaaCCCCtc. citc.cgaacac agccaaaagc tacttittgga Ctttalaattit gtcatatatt ataatgtttic tag taacaaa accatagt ca tatgaaagta aatttaaatg 54 O ataatcCaat gat attattt toatcaaata gaatttaatt tataataaac tatttattga taaaatatto agagagttga at attaaaat acctgttgttgc Cttagtgagt gggccalaatt 660 aattaatgga gtagta acag Ctttalaccala agaaattitca acaattt CCC aagctagaaa 72 O aaac Coaact CCaaaataaa. Cttgagttag aactgtgtta agcacctaaa ttgtaat acc tgttact citc tcqttct cat t citat atttg tcc taagtta aatatat Cta cott t t t t ta. 84 O tctgtc.ctaa gttaactato tgitatgtcta tottt to tact tactic cc to c gttt Caggitt 9 OO ataagacgtt ttgactittgg tcaaagttcaa actgctittaa gtttgactaa gtttgtagaa 96.O aaaataataa. Cattitt Caac c caagacaaa titt attatga aaatatgttc aattattgat ttaatgaaac taatttggta ttataaat at tattatattt atatataaac ttagttaaat ttaaagtagt ttaagtttga tcaaagttcaa aatgtttitat aacct galaat ggagggagta 14 O agtaatttga aacgaagaga gCagacaaat aataaac tag taaagcc tdt gacttgggitt 2OO c tagt cattg atcgtgtaca tgtaggtott gtttagatcc Caaaaaattit tagccaaaac 26 O
Ctca catcaa. at atttggac acatgcaccc ctaccagtgt gtggaggcat tgcatacacg 32O aaac atggaa aaggaatcaa Cttgagaggit tag acctgct agctic tact a ggtctggatg gtcatgcatt ttitttittgaa aaaaaccacg ctgcaa.gctic gacagcctica acct caatgg 44 O
US 9,351, 507 B2 83 - Contin lued tgggttgtca gcc aaatgca ggcaatcgtt gag.cgittatc cgtgctgggg tgatactgtc 660 gaagtagata Catgggttgg tgct catggit aaaaatggaa tgcgcagaga ctggcatata 72 O cgtgattctg talacaggc.ca tacaatattg aaggctacaa gtaaatgggit tatgatgcac aagcttacaa ggaggctago aagaattic ct gatgaagitac gtactgaaat agagc catac 84 O tttitttgagc atgcttctat tgtagatgaa gacaaccaga aact tccaaa. actgccagat 9 OO attgaaggtg ctaatgtagc caaatatgtc cggacaggcc tgact coacg atgggc.cgac 96.O cittgatat ca atcago atgt taataacgtt aaatacatag ggtggat.cct agaga.gc.gca
CCaatcto Ca ttctggagaa acatgagctg gcaagtattg tcc tiggatta Caagagggag 108 O tgttggcc.gag acagcgtgct gcaat cacac act accqtgt acactgactg caacaag cac 114 O tctgga caaa c cactittgca Ctgtgagcat ttgctgagcc tggaatcagg acctaccatc. 12 OO gtcaaggc.ca ggaccatgtg gaggccaaaa ggalaccaggc Cccaa.gaga.g tat catt cog 126 O tott cqtcgt. ga 1272
SEO ID NO 15 LENGTH: 388 TYPE : PRT ORGANISM: Oryza sativa
< 4 OOs SEQUENCE: 15 Met Gly Ala Gly Gly Arg Met Thr Glu Lys Glu Arg Glu Glu Glin Glin 1. 5 1O 15
Lys Luell Luell Gly Arg Ala Gly Asn Gly Ala Ala Val Glin Arg Ser Pro 25 30
Thir Asp Lys Pro Pro Phe Thir Lieu. Gly Glin Ile Llys Lys Ala Ile Pro 35 4 O 45
Pro His Phe Glin Arg Ser Val Ile Llys Ser Phe Ser Tyr Wall Wall SO 55 6 O
His Asp Luell Wall Ile Wall Ala Ala Lieu. Lieu. Tyr Phe Ala Lieu. Wal Met 65 70 7s 8O
Ile Pro Wall Leu Pro Ser Gly Met Glu Phe Ala Ala Trp Pro Leu Tyr 85 90 95
Trp Ile Ala Glin Gly Cys Val Lieu. Thr Gly Val Trp Val Ile Ala His 105 11 O
Glu Gly His His Ala Phe Ser Asp Tyr Ser Val Lieu. Asp Asp Ile 115 12 O 125
Wall Gly Luell Wall Lieu. His Ser Ser Lieu. Lieu Wall Pro Tyr Phe Ser Trp 13 O 135 14 O
Lys Ser His Arg Arg His His Ser Asn. Thir Gly Ser Lieu. Glu Arg 145 150 155 160
Asp Glu Wall Phe Val Pro Lys Glin Llys Ser Ala Met Ala Trp Tyr Thr 1.65 17O 17s
Pro Wall Tyr His Asn Pro Ile Gly Arg Lieu. Wal His Ile Phe Wall 18O 185 19 O
Glin Luell Thir Lieu. Gly Trp Pro Lieu Tyr Lieu Ala Phe Asn. Wall Ser Gly 195 2O5
Arg Pro Pro Arg Phe Ala Cys His Phe Asp Pro Tyr Gly Pro Ile 21 O 215 22O
Tyr Asn Asp Arg Glu Arg Val Glin Ile Phe Ile Ser Asp Wall Gly Val 225 23 O 235 24 O
Wall Ser Ala Gly Lieu Ala Lieu. Phe Llys Lieu. Ser Ser Ala Phe Gly Phe 245 250 255 US 9,351,507 B2 86 - Continued
Trp Trp Wall Wall Arg Wall Gly Wall Pro Luell Lell Ile Wall Asn Ala 26 O 265 27 O
Trp Luell Wall Luell Ile Thir Luell Glin His Thir His Pro Ala Luell Pro 285
His Tyr Asp Ser Ser Glu Trp Asp Trp Luell Arg Gly Ala Luell Ala Thir 29 O 295 3 OO
Wall Asp Arg Asp Tyr Gly Ile Luell Asn Wall Phe His Asn Ile Thir 3. OS 310 315
Asp Thir His Wall Ala His His Luell Phe Ser Thir Met Pro His Tyr His 3.25 330 335
Ala Met Glu Ala Thir Ala Ile Arg Pro Ile Lell Gly Glu 34 O 345 35. O
Glin Phe Asp Pro Thir Pro Wall Ala Ala Thir Trp Arg Glu Ala 355 360 365
Glu Cys Ile Tyr Wall Glu Pro Glu Asp Asn Lys Gly Wall Phe Trp 37 O 375 38O
Asn Asn Phe 385
<210s, SEQ ID NO 16 &211s LENGTH: 362 212. TYPE : PRT &213s ORGANISM: Oryza sativa
<4 OOs, SEQUENCE: 16
Met Glin Arg Ser Pro Wall Asp Pro Pro Phe Thir Lell Gly Asp Ile 1. 5 15
Lys Lys Ala Ile Pro Pro His Phe His Arg Ser Wall Ile Ser 25
Phe Ser Tyr Luell Lell His Asp Luell Ala Ile Ala Ala Gly Luell Luell Tyr 35 4 O 45
Phe Ala Luell Wall Gly Ile Pro Ala Luell Pro Ser Ile Lell Arg Luell Wall SO 55 6 O
Ala Trp Pro Luell Tyr Trp Ala Ala Glin Gly Ser Wall Lell Thir Gly Wall 65 70
Trp Wall Ile Gly His Glu Gly His His Ala Phe Ser Asp Tyr Luell 85 90 95
Lell Luell Asp Asn Lell Wall Luell Wall Luell His Ser Ala Luell Luell Thir 105 11 O
Pro Phe Phe Ser Trp Ser His Arg Arg His His Ala Asn Thir 115 12 O 125
Gly Ser Met Glu Asp Glu Wall Wall Ala Lys Ser Ala 13 O 135 14 O
Lell Pro Trp Thir Pro Wall Phe Gly ASn Pro Wall Gly Arg Luell 145 150 155 160
Wall Ile Ala Lell Glin Lell Thir Luell Ala Trp Pro Lell Tyr Luell Ala 1.65 17O 17s
Phe Asn Luell Ser Gly Glin Pro Pro Arg Luell Wall Thir Cys His 18O 185 19 O
Asp Pro Tyr Ser Pro Lell Phe Ser Asp Glin Glu Arg Wall Glin Wall Luell 195 2OO
Wall Ser Asp Ala Ala Ile Lell Ala Wall Luell Luell Ala Lell His Arg Luell 21 O 215
Thir Ala Ala Tyr Gly Lell Trp Trp Wall Wall Arg Wall Gly Wall Pro 225 23 O 235 24 O US 9,351,507 B2 87 - Continued Val Met Ile Val Gly Ala Leu Phe Val Lieu. Ile Thr Tyr Lieu. His His 245 250 255 Thr His Arg Ala Lieu Pro His Tyr Asp Ser Ser Glu Trp Glu Trp Leu 26 O 265 27 O Arg Gly Ser Lieu Ala Thr Val Asp Arg Asp Tyr Gly Val Lieu. Asn Arg 27s 28O 285 Val Lieu. His Asn Val Thr Asp Thr His Val Lieu. His His Leu Phe Pro 29 O 295 3 OO Ser Met Pro His Tyr His Ala Met Glu Ala Thr Arg Ala Ala Arg Pro 3. OS 310 315 32O Val Lieu. Gly Glu Tyr Tyr Llys Phe Asp Arg Thr Pro Ile Ile Glu Ala 3.25 330 335 Thir Trp Arg Glu Ala Lys Glu. Cys Met Tyr Val Glu Pro Arg Glu Arg 34 O 345 35. O Asp Gly Ile Tyr Trp Tyr Asn. Asn Llys Phe 355 360
<210s, SEQ ID NO 17 &211s LENGTH: 390 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 17 Met Gly. Thir Ser Ser Arg Pro Thr Thr Val Lys Glu Gly Lys Llys Lieu. 1. 5 1O 15 Glu Ala Pro Arg Arg Ala Gly Ser His Ala Ala Val Lys Arg Ser Pro 2O 25 30 Val Asp Llys Pro Pro Phe Thr Lieu. Gly Asp Ile Arg Lys Ala Ile Pro 35 4 O 45 Pro His Cys Phe His Arg Ser Val Ile Llys Ser Phe Ser Tyr Lieu. Leu SO 55 6 O His Asp Lieu Ala Ile Ala Ala Gly Lieu. Lieu. Tyr Phe Ala Lieu Val Val 65 70 7s 8O Ile Pro Ala Leu Pro Gly Val Lieu. Arg Lieu Val Ala Trp Pro Phe Tyr 85 90 95 Trp Ala Ala Glin Gly Cys Phe Leu Phe Gly Val Trp Ile Ile Ala His 1OO 105 11 O Glu Cys Gly His His Ala Phe Ser Gly. His Ala Lieu. Lieu. Asp Asp Thr 115 12 O 125 Lieu. Gly Lieu Val Lieu. His Ser Trp Lieu. Lieu Ala Pro Tyr Phe Ser Trp 13 O 135 14 O Lys Tyr Thr His Glin Arg His His Ser Asn Thr Ser Ser Glin Glu Arg 145 150 155 160 Asp Glu Val Phe Val Pro Arg Phe Llys Ser Asp Leu Pro Trp Tyr Ser 1.65 17O 17s
Pro Tyr Val Tyr Llys Tyr Asn. Asn Pro Val Ala Arg Lieu. Lieu. Lieu. Lieu. 18O 185 19 O
Val Val Glin Lieu. Thr Val Gly Trp Pro Met Tyr Lieu Val Phe Asn Thr 195 2OO 2O5 Trp Gly Arg Glin Tyr Pro Arg Phe Ala Ser His Phe Asp Pro Ser Gly 21 O 215 22O
Pro Ile Tyr Lys Gly Arg Glu Arg Val Phe Ile Ala Ile Ser Asp Ile 225 23 O 235 24 O
Gly Met Lieu Ala Val Ser Lieu Ala Lieu. Tyr Arg Lieu Ala Glu Gly Tyr 245 250 255 US 9,351,507 B2 89 90 - Continued
Gly Phe Trp Trp Wall Wall Arg Wall Tyr Gly Wall Pro Lell Luell Wall Wall 26 O 265 27 O
Asn Ala Trp Luell Wall Wall Wall Thir Luell His His Thir His Arg Ala 28O 285
Ile Pro His Asp Ser Ser Glu Trp Asp Trp Lell Arg Gly Ala Luell 29 O 295 3 OO
Ala Thir Wall Asp Arg Asp Ser Phe Luell ASn Arg Wall Phe His Asn 3. OS 310 315 32O
Ile Thir Asp Thir His Wall Wall His His Luell Phe Pro Thir Ile Pro His 3.25 330 335
His Ala Wall Glu Ala Thir Ala Ile Arg Pro Ile Luell Gly Glu 34 O 345 35. O
Glin Phe Asp Pro Thir Pro Ile Wall Lys Ala Ile Trp Arg Glu 355 360 365
Ala Lys Glu Cys Ile Ile Glin Ser Glu Asp His Gly Wall Phe 37 O 375 38O
Trp Ser Asn Lys Phe 385 390
<210s, SEQ ID NO 18 &211s LENGTH: 223 212. TYPE : PRT <213> ORGANISM: Oryza sativa
<4 OOs, SEQUENCE: 18
Met Ala Gly Gly Arg Arg Trp Gly Gly Trp Arg Glu Glin Glu Pro Pro 1. 5 15
Arg Arg Ala Gly Ser Ser Ala Ala Wall Glin Arg Phe His Arg Ser Wall 25
Ile Ser Phe Ser Lell Luell Arg Asp Wall Ala Ile Ala Ala Gly 35 4 O 45
Lell Luell Asn Phe Ala Lell Wall Gly Ile Pro Wall Lell Pro Ala Gly Wall SO 55 6 O
Lell Arg Pro Pro Arg Arg Lell Ala Wall Luell Luell Gly Arg Ala Gly Luell 65 70
Lell Pro Wall Arg Gly Wall Asp His Arg Ala Arg Wall Arg Ala Pro Arg 85 90 95
Ala Pro Arg Arg His Pro Arg Ser Gly Pro Ala Lell Wall Ala Ser Gly 105 11 O
Thir Ile Luell Luell Wall Glu Ile Glin Pro Pro Ala Ala Pro Luell Glin His 115 12 O 125
Glin Luell Thir Gly Ala Arg Arg Gly Wall Arg Pro Glin Wall Glin Wall Arg 13 O 135 14 O
Ser Ala Wall Glu Lell Pro Wall Arg Wall Glin Wall Glin Glin Arg Pro Wall 145 150 155 160
Ala Arg Luell Luell Lell Lell Gly Met Glin Luell Thir Wall Gly Trp Pro Met 1.65 17O 17s
Luell Wall Phe Asn Thir Trp Gly Arg Trp Tyr Pro Arg Phe Ala Ser 18O 185 19 O
His Phe Asp Pro Ser Gly Ala Ile Met Arg Arg Glu Arg Wall Phe 195
Ile Ala Ile Ser Asp Ile Gly Met Luell Ala Wall Ser Lell Ala Luell 21 O 215 22O
US 9,351,507 B2 99 100 - Continued gacCaggagc gcgt.ccaagt cct cqtct Co gacgc.cgc.ca toctggc.cgit gctgct cqcg 660
Ctgcac aggc tigacgg.cggc gtacgggctic tigtgggtgg togcgtgta C9g.cgt.gc.cg 72 O gtgatgat cq togcgc.gct gttcgtgctic at Cacgt acc ticaccacac ccaccgggcg
Ctc.ccgcact acgacticcag cagtgggag tectgcgtg gct cqct cqc caccgt.cgac 84 O cgcgactacg gcgt.cct caa cc.gcgtgctg. cacaacgt.ca C9gacacgca C9tcCtccac 9 OO
Cacct Ctt CC C Cagdatgcc acactaccac gcc atggagg ccaccagggc agc gaggcc C 96.O gtcCtcggtgagtact acaa gtttgaccgc acgcc catca togaggcaac atggcgtgag gccalaggagt gcatgitacgt tagcc.cagg gagcgcgatg gtatic tact g g tacaacaac 108 O aagttt tag 1089
<210s, SEQ ID NO 26 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: FatB consensus sequence <4 OOs, SEQUENCE: 26
ASn Gln His Val Asn. Asn 1. 5
<210s, SEQ ID NO 27 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial 220s. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence
<4 OOs, SEQUENCE: 27 Phe Ser Tyr Val Val His Asp Lieu Val Ile Val Ala Ala Lieu. Lieu. Phe 1. 5 1O 15
Ala Lieu Wal Met Ile 2O
<210s, SEQ ID NO 28 &211s LENGTH: 19 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence
<4 OOs, SEQUENCE: 28 Ala Trp Pro Leu Tyr Ile Ala Glin Gly Cys Val Lieu. Thr Gly Val Trp 1. 5 1O 15
Wall Ile Ala
<210s, SEQ ID NO 29 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence
<4 OOs, SEQUENCE: 29 Ile Ser Asp Val Gly Val Ser Ala Gly Lieu Ala Lieu. Phe Llys Lieu. Ser 1. 5 1O 15
Ser Ala Phe Gly Phe 2O US 9,351,507 B2 101 102 - Continued
<210s, SEQ ID NO 3 O &211s LENGTH: 23 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 30 Val Val Arg Val Tyr Gly Val Pro Lieu. Lieu. Ile Val Asn Ala Trp Lieu 1. 5 1O 15 Val Lieu. Ile Thr Tyr Lieu Gln 2O
<210s, SEQ ID NO 31 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 31 His Glu. Cys Gly His His 1. 5
<210s, SEQ ID NO 32 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence
<4 OO > SEQUENCE: 32 His Arg Arg His His Ala 1. 5
<210s, SEQ ID NO 33 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence
<4 OOs, SEQUENCE: 33
His Wall Ala His His 1. 5
<210s, SEQ ID NO 34 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 34 cgctgctaccaaacaattica 2O
<210s, SEQ ID NO 35 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 35 ttctgttgttg ccatcatcg 19 US 9,351,507 B2 103 104 - Continued
<210s, SEQ ID NO 36 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 36
Caggaaataa agttggtgat gatg 24
<210s, SEQ ID NO 37 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OO > SEQUENCE: 37 citt cacaata t cagotcc td actic 24
<210s, SEQ ID NO 38 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 38
Caggaaataa agttggtgat gatg 24
<210 SEQ ID NO 39 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 39 citt cacaatgtcagoctt.ca c 21
<210s, SEQ ID NO 4 O &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 4 O acaggcctga citccacgat 19
<210s, SEQ ID NO 41 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 41 gtccagagtg Cttgttgcag
<210s, SEQ ID NO 42 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer US 9,351,507 B2 105 106 - Continued
<4 OOs, SEQUENCE: 42 tacc cact co ctic ctitgagc
<210s, SEQ ID NO 43 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 43 aggcactgtt ggtgat ct cq
<210s, SEQ ID NO 44 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 44
Cacaaagagg gagggaacaa
<210s, SEQ ID NO 45 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 45 gaaggactitg at Caccgagc
<210s, SEQ ID NO 46 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 46
Cacaa.cat Ca cggacacaca
<210s, SEQ ID NO 47 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 47 gcaa.gaccga catggctaat
<210s, SEQ ID NO 48 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 48 acgt.cct c ca ccacct citt 19 US 9,351,507 B2 107 108 - Continued
<210s, SEQ ID NO 49 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 49
Cagaag cagt gaCataccca ag 22
<210s, SEQ ID NO 50 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 50 tacc cact co ctic ctitgagc
<210s, SEQ ID NO 51 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 51 aggcactgtt ggtgat ct cq
<210 SEQ ID NO 52 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 52 aaaggat.cct Ctagagggag gag cagoaga agc 33
<210s, SEQ ID NO 53 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 53 aaaact agtgaattct acac gitacggggtg tacca 35
<210s, SEQ ID NO 54 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 54 agt catggct ggttct Cttg cggc 24
<210s, SEQ ID NO 55 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer US 9,351,507 B2 109 110 - Continued
<4 OO > SEQUENCE: 55 accatcacct aagagaccag cagt 24
<210s, SEQ ID NO 56 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 56 Cys Gly Met Asn Lys Asn. Thir Arg Arg Lieu. Ser Lys Met Pro Asp Glu 1. 5 1O 15
<210s, SEQ ID NO 57 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OO > SEQUENCE: 57 Thir Arg Arg Lieu. Ser Lys Met Pro Asp Glu 1. 5 1O
<210s, SEQ ID NO 58 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 58 Cys Gly Glu Lys Glin Trp Thr Lieu. Lieu. Asp Trp Llys Pro Llys Llys Pro 1. 5 1O 15 Asp
<210s, SEQ ID NO 59 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OO > SEQUENCE: 59 Cys Gly Ala Glin Gly Glu Gly Asn Met Gly Phe Phe Pro Ala Glu Ser 1. 5 1O 15
<210s, SEQ ID NO 60 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 60 gtgc.cggcgg Caggatgacg g 21
<210s, SEQ ID NO 61 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer
<4 OOs, SEQUENCE: 61 gcc.gacgatgtcgt.cgagca C 21
<210s, SEQ ID NO 62 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial