US008530724B2

(12) United States Patent (10) Patent No.: US 8,530,724 B2 Whitelaw et al. (45) Date of Patent: Sep. 10, 2013

(54) ALTERING THE FATTY ACID COMPOSITION 2011/0054198 A1 3/2011 Singh et al. OF RICE 2011/O190521 A1 8/2011 Damcevski et al. 2011/02O1065 A1 8/2011 Singh et al. 2011/02233.11 A1 9, 2011 Liu et al. (75) Inventors: Ella Whitelaw, Albury (AU); Sadequr 2011/0229623 A1 9, 2011 Liu et al. Rahman, Nicholls (AU); Zhongyi Li, 2012/0041218 A1 2/2012 Singh et al. Kaleen (AU); Qing Liu, Girralang (AU); Surinder Pal Singh, Downer (AU): FOREIGN PATENT DOCUMENTS WO WO99,049050 9, 1999 Robert Charles de Feyter, Monash WO WOO3,080802 10, 2003 (AU) WO WO 2003/080802 A2 10/2003 WO WO 2004/001001 12/2003 (73) Assignee: Commonwealth Scientific and WO WO 2004/001001 A2 12/2003 Industrial Research Organisation, WO WO 2008/O25068 6, 2008 Campbell (AU) WO WO 2009/12958 10/2009 WO WO 2010/009:500 1, 2010 (*) Notice: Subject to any disclaimer, the term of this WO WO 2010/057246 5, 2010 patent is extended or adjusted under 35 OTHER PUBLICATIONS U.S.C. 154(b) by 772 days. Supplementary European Search Report issued Feb. 23, 2010 in connection with corresponding European Patent Application No. (21) Appl. No.: 12/309.276 0776.37759. Taira et al. (1989) “Fatty Acid Composition of Indica-Types and (22) PCT Filed: Jul. 13, 2007 Japonica-Types of Rice Bran and Milled Rice' Journal of the Ameri can Oil Chemists’ Society; vol. 66 No. 9, 1326-1329. (86). PCT No.: PCT/AU2007/OOO977 Taira et al. (1988)“Fatty Acid Composition of Indica Sinica Javanica and Japonica Groups of Nonglutinous Brown Rice' Journal of Agri S371 (c)(1), cultural and Food Chemistry; vol. 36 No. 1, 45-47. (2), (4) Date: Jul. 6, 2009 Taira et al. (1986) “Lipid Content and Fatty-Acid Composition of Indica and Japonica Types of Nonglutinous Brown Rice' Journal of (87) PCT Pub. No.: WO2008/006171 Agriculture and Food Chemistry; vol. 34 No. 3, 542-545. Whitelaw et al. (1986) “A Rice FATB Insertional Mutant Exhibits PCT Pub. Date: Jan. 17, 2008 Improved Growth and Reduced Photoinhibition at High Tempera tures' Proceedings of the 55th Australian Cereal Chemistry Confer (65) Prior Publication Data ence, 55th Australian Cereal Chemistry Conference, Jul. 3-7, 2008, Sydney Australia, Jul. 3, 2005, pates 101-104. US 2009/0308041 A1 Dec. 17, 2009 Stoutesdijk et al. (2002) “hpRNA-mediated targeting of the Arabidopsis FAD2 gene gives highly efficient and stable silencing (30) Foreign Application Priority Data Plant Physiology, American Society of Plant Physiologists, Rockville, MD, US; vol. 129, 1723-31. Cicero et al. (2001) "Rice bran oil and gamma-oryZanol in the Jul. 14, 2006 (AU) ...... 2OO6903810 treatment of hyperlipoproteinaemias and other conditions' Phytotherapy Research; vol. 15 No. 4, 277-289. (51) Int. Cl. Chapman et al. (2001) "Transgenic Cotton Plants with Increased CI2N 15/82 (2006.01) Seed Oleic Acid Content” Journal of American Chemists' Chemistry; CIIB I/00 (2006.01) vol. 78 No. 9,941-947. A2.3L. I./00 (2006.01) Sivaraman et al. (2004) “Development of high oleic and low linoleic A23D 7700 (2006.01) acid transgenics in a Zero erucic acid Brassica juncea L. (Indian mustard) line by antisense Suppression of the fad2 gene' Molecular (52) U.S. Cl. Breeding, Kluwer Academic Publishers, DO; vol. 13 No. 1,365-375. USPC ...... 800/281: 554/9: 426/601; 426/618 Miquel et al. (1992) “Arabidopsis mutants deficient in polyunsatu (58) Field of Classification Search rated fatty acid synthesis: Biochemical and genetic characterization None of a plant oleoyl-phosphatidylcholine desaturase” Journal of Biologi See application file for complete search history. cal Chemistry; vol. 267 No. 3, 1502-1509. (Continued) (56) References Cited Primary Examiner — Elizabeth McElwain U.S. PATENT DOCUMENTS (74) Attorney, Agent, or Firm — John P. White; Gary J. 4.948,811 A * 8/1990 Spinner et al...... 514,560 Gershik; Cooper & Dunham LLP 5,500,361 A 3/1996 Kinney et al. 6,432,684 B1 8/2002 Mukerji et al. (57) ABSTRACT 7,589,253 B2 9, 2009 Green et al. 7,807,849 B2 10/2010 Singh et al. The present invention relates to rice oil, rice bran and rice 7,834,248 B2 11/2010 Green et al. seeds which have altered levels of oleic acid, palmitic acid 7,834,250 B2 11/2010 Singh et al. and/or linoleic acid. The present invention also provides 7,932.438 B2 4/2011 Singh et al. methods for genetically modifying rice plants such that rice 2004/0221335 A1 11/2004 Shewmaker 2005, O262.588 A1 11/2005 Dehesh oil, rice bran and rice seeds produced therefrom have altered 2006.0053512 A1 3, 2006 Bao et al. levels of oleic acid, palmitic acid and/or linoleic acid. Spe 2006/0094.088 A1 5/2006 Picataggio et al. cifically this is achieved through modulation of Fad2 and/or 2006/0206963 A1 9, 2006 Voelker et al. FatB expression. 2008/0268539 A1 10/2008 Singh et al. 2011 OO15415 A1 1/2011 Singh et al. 8 Claims, 38 Drawing Sheets US 8,530,724 B2 Page 2

(56) References Cited Moghadasian and Frohlich (1999) Effects of Dietary Phytosterols on Cholesterol Metabolism and Athersclerosis: Clinical and Experi OTHER PUBLICATIONS mental Evidence. Am. J. Med. 107:588-94. Chang et al., Chemical Reactions Involved in the Deep-Fat Frying of Morrison (1988) Lipids in Cereal Starches: A Review. J Cereal Sci. Foods. Journal of American Oil Chemists' Society, 1978, 55:718 8:1-15. 727. Most et al. (2005) Rice bran oil, not fiber, lowers cholesterol in Wang et al., Improved Vectors for Agrobacterium tumefaciens— humans. Am J Clin Nutr 81:64-8. Mediated Transformation of Monocot Plants. Acta Hort, 1998, Nielsen et al. (2004) Formation of Volatile Compounds in Model 461:401-407. Experiments with Crude Leek (Allium ampeloprasum Var. Lancelot) Akagi et al. (1995) Nucleotide Sequence of a Stearoyl-Acel carrier Enzyme Extract and Linoleic Acid or Linolenic Acid. Journal of Protein Desaturase cDNA from Developing Seeds of Rice. Plant Agricultural and Food Chemistry 52:2315-2321. Physiol. 108,845-846. Noakes and Clifton (1998) Oil blends containing partially hydroge Anai et al. (2003) Improvement of rice (Oryza sativa L.) seed oil nated or interesterified fats: differential effects on plasma lipids. Am. quality through introduction of a soybean microsomal omega-3 fatty J. Clin. Nutr. 98: 242-247. acid desaturase gene. Plant Cell Rep. 21.988-992. Ohlrogge and Jaworski (1997) Regulation of Fatty Acid Synthesis. Ascherio and Willett (1997) Health effects of trans fatty acids. Am. J. Annu Rev Plant Physiol Plant Mol Biol. 48:109-136. Clin. Nutr. 66: 1006S-1010S. Radcliffe et al. (1997) Serum Lipids in Rats Fed Diets Containing Boggs etal. (1964) Relation of Hexanal in Vapor Above Stored Potato Rice Bran Oil or High-Linolenic Acid Safflower Oil. Biochemical Granules to Subjective Flavor Extimates. J. Food Sci. 29:487-489. Archives 13:87-95. Bonanome and Grundy (1988) Effect of Dietary Stearic Acid on Resurreccion etal (1979) Nutrient Content and Distribution in Mill Plasma Cholesterol and Lipoprotein Levels. N. Engl. Med. 318: ing Fractions of Rice Grain. Journal of the Science of Food and 1244-1248. Agriculture, 30: 475-481. Buhr et al. (2002) Ribozyme termination of RNA transcripts down Roche and Gibney (2000) Effect of long-chain n-3 polyunsaturated regulate seed fatty acid genes in transgenic soybean. Plant J. 30: fatty acids on fasting and postprandial triacylglycerol metabolism. 155-163. Am. J. Clin. Nutr. 71: 232S-237S. Champagne etal. (1995) Stabilization of Brown Rice Products. Using Rukmini and Raghuram (1991) Nutritional and Biochemical Aspects Ethanol Vapors as an Antioxidant Delivery System. Cereal Chem of the Hypolipidemic Action of Rice Bran Oil: A Review. Journal of 72:255-258. the American College of Nutrition 10(6):593-601. Chapman et al., (2001). Transgenic Cotton Plants with Increased Shin et al. (1986) Correlation Between Oxidative Deterioration of Seed Oleic Acid Content. J. Am. Oil Chem. Soc. 78:941-947. Unsaturated Lipid and n-Hexanal during Storage of Brown Rice. J. Choudhury et al. (1980) Lipids in Developing and Mature Rice Food Sci. 51:460-463. Grain. Phytochemistry 19: 1063-1069. St Angelo et al. (1980) Identification of Lipoxygenase-Linoleate Dougherty et al. (1995). Effects of diets containing high or low Decomposition Products by Direct Gas Chromatography-Mass amounts of stearic acid on plasma lipoprotein fractions and fecal fatty Spectrometry. J Lipids 1:45-49. acid excretion of men. Am. J. Clin. Nutr. 61:1120-1128. Stoutesdijket al., (2000). High-oleic acid Australian Brassica napus Ha (2005) Bioactive components in rice bran oil improve lipid pro and B. iuncea varieties produced by co-suppression of endogenous files in rats fed on high-cholesterol diet. Nutrition research 25, 597 A12-desaturases. Biochem. Soc. Trans. 28:938-940. 606. Stoutesdijk et al. (2002) hpRNA-Mediated Targeting of the Hu et al. (1997). Dietary Fat Intake and the Rist of Coronary Heart Arabidopsis FAD2 Gene gives Highly Efficient and Stable Silencing. Disease in Women. N. Engl. J. Med, 337: 1491-1499. Plant Physiology 129: 1723-1731. Jennings and Akoh (2000) Lipase-Catalyzed Modification of Rice Suzuki et al. (1999) Volatile Components in Stored Rice Oryza Bran Oil to Incorporate Capric Acid. Journal of Agricultural and sativa (L.) of Varieties with and without Lipoxygenase-3 in Seeds. J. Food Chemistry, 48:4439-4443. Agric. Food Chem. 47: 1119-1124. Jones et al. (1995) Palmitoyl-Acyl Carrier Protein (ACP) Taira and Chang (1986) Lipid content and fatty acid composition of Thioesterase and the Evolutionary Origin of Plant Acyl-ACP Indica and Japonica types of nonglutinous brown rice. Agric. Food Thioesterases. Plant Cell 7:359-371. Chem. 34:542-545. Kinney (1996) Development of Genetically Engineered Soybean Thelen and Ohlrogge (2002) Metabolic Engineering of Fatty Acid Oils for Food Applications. J. Food Lipids 3:273-292. Biosynthesis in Plants. Metabolic Engineering 4: 12-21. Kodama et al. (1997) Structure, chromosomal location and expres Theriault et al. (1999). Tocotrienol: A Review of its Therapeutic sion of a rice gene encoding the microsome (D-3 fatty acid desaturase. Potential. Clin. Biochem. 32:309-19. Plant Molecular Biology 33:493-502. Tholstrup et al. (1994)Fathigh in stearic acid favorably affects blood Kohno-Murase et al. (2006). Production of trans-10, cis-12 conju lipids and factor VII coagulant activity in comparison with fats high gated linoleic acid in rice. Transgenic Research 15:95-100. in palmitic acid or high in myristic and lauric acids. Am. J. Clin. Nutr. Leonard etal. (1997) Cuphea Wrightii thioesterases have unexpected 59: 371-377. broad specificities on saturated fatty acids. Plant Molecular Biology, Tsugitaetal (1983) Cooking Flavor and Texture of Rice Stored under vol. 34, Issue 4: 669-679. Different Conditions. Agricultural and Biological Chemistry 47: Liu et al. (1999) Molecular cloning and expression of a cDNA encod 543-549. ing a microsomal (D-6 fatty acid desaturase from cotton (Gossypium Tsuzuki etal (2004) Oxidation Rate of Conjugated Linoleic Acid and hirsutism) Aust. J. Plant Physiol. 26:101-106. Conjugated Linolenic Acid is Slowed by Triacylglycerol Esterifica Liu et al. (2002). High-Oleic and High-Stearic Cottonseed Oils : tion and O-Tocopherol. Lipids 39:475-480. Nutritionally Improved Cooking Oils Developed Using Gene Silenc Voelker et al. (1996). Genetic engineering of a quantitative trait: ing. J. Am. Coll. Nutr. 21: 205S-211S. metabolic and genetic parameters influencing the accumulation of Liu et al. (2002). High-Stearic and High-Oleic Cottonseed Oils Pro laurate in rapeseed. Plant J.9: 229-241. duced by Hairpin RNA-Mediated Post-Transcriptional Gene Silenc Williams et al. (1999) Impaired Endothelial Function Following a ing. Plant Physiol. 129: 1732-1743. Meal Rich in Used Cooking Fat. J. Am. Coll. Cardiol. 33:1050-1055. Mensink and Katan (1990). Effect of Dietary Trans Fatty Acids on Yasumatsu et al. (1966) Studies on Cereals Part V Stale Flavor of High-Density and Low-Density Lipoprotein Cholesterol Levels in Stored Rice. Agric. Biol. Chem. 30:483-486. Healthy Subjects. N. Engl. J. Med. 323: 439-445. Zhou et al. (2002) Ageing of Stored Rice: Changes in Chemical and Mikkilineni and Rocheford (2003) Sequence variation and genomic Physical Attributes. Journal of Cereal Science 35:65-78. organization of fatty acid desaturase-2 (fad2) and fatty acid Zock et al. (1994) Impace of myristic acid versus palmitic acid on desaturase-6 (fado) cDNAs in maize. Theor. Applied Genetics, 106. serum lipid and piloprotein levels in healthy women and men. 1326-1332. Arterioscler Thromb. 14:567-575. US 8,530,724 B2 Page 3

Connolly et al. (1998) GenBank Accession No. AC0.04236, NCBI, Needleman and Wunsch, A General Method Applicable to the Search pp. 1-11. of Similarities in the Amino Acid Sequence of Two Proteins. J. Mol. Sharma et al., (2003) GenBank Accesion No. AC108870, NCBI, pp. Biol., 1970, 48:443-453. 1-27. Pasquinelli et al., MicroRNAs: a developing story. Current Opinion Kim et al., (1999) GenBank Accesion No. AF213480, NCBI, p. 1. in Genetics & Development, 2005, 15:200-205. Sasaki et al., (2001) GenBank Accession No. AP004.047. NCBI, pp. Perriman et al., Extended target-site specificity for a hammerhead 1-36. ribozyme. Gene, 1992, 113:157-163. Sasaki et al., (1999) GenBank Accession No. AP000399, NCBI, pp. Senior I.J., Uses of Plant Gene Silencing. Biotechnology & Genetic Engineering Reviews, Ed. Tombs, M.P., 1998, 15:79-119. 1-33. Shippy et al., The Hairpin Ribozyme. Molecular Biotechnology, Sasaki et al., (2001) GenBank Accession No. AP004236, NCBI, pp. 1999, 12:117-129. 1-37. Slade and Knauf, Tilling moves beyond functional genomics into Sasaki et al., (2002) GenBank Accession No. AP005168, NCBI, pp. crop improvement. Transgenic Research, 2005, 14:109-115. 1-31. Smith et al., Total silencing by intron-spliced hairpin RNAS. Nature, Sasaki et al., (2002) GenBank Accession No. AP005291, NCBI, pp. 2000, 407:319-320. 1-38. Toriyama et al., Haploid and diploid plant regeneration from Response to First Office Action filed with the Chinese Patent Office protoplasts of anther callus in rice. Theor Appl Genet, 1986, 73:16 on Jan. 11, 2011 in connection with Chinese Patent Application No. 19. 2007800339714, and an English Translation of the Claims. Wagner et al., Coupling of adenovirus to transferring-polylysine? Response to Second Office Action and English Translation of Claims, DNA complexes greatly enhances receptor-mediated gene delivery filed with the Chinese Patent Office on Aug. 3, 2011 in connection and expression of transfected genes, Proc. Natl. Acad. Sci USA, with Chinese Patent Application No. 2007800339714, and an 1992, 89:6099-6103. English Translation of the Claims. Waterhouse, Virus resistance and gene silencing in plants can be European Examination Report issued Jun. 8, 2010 by the European induced by simultaneous expression of sense and antisense RNA. Patent Office in connection with European Patent Application No. Proc. Natl. Acad. Sci. USA, 1998, 95:13959-13964. 0776.37759. U.S. Appl. No. 13/011,779, filed Jan. 21, 2011, Liu et al. Response to European Examination Report, filed with the European U.S. Appl. No. 12/989,405, filed May 16, 2011, Zhou et al. Patent Office in Connection on Dec. 16, 2010 in connection with U.S. Appl. No. 13/129,940, filed May 18, 2011, Petrie et al. European Patent Application No. 07763775.9. U.S. Appl. No. 13/011,773, filed Jan. 21, 2011, Liu et al. European Examination Report issued Apr. 1, 2011 by the European U.S. Appl. No. 13/243,747, filed Sep. 23, 2011, Singh et al. Patent Office in connection with European Patent Application No. U.S. Appl. No. 13/171,032, filed Jun. 28, 2011, Petrie et al. 0776.37759. English translation of Office Action issued Aug. 27, 2010 in connec Response to European Examination Report, filed with the European tion with corresponding Chinese Patent Application No. Patent Office in Connection on Oct. 3, 2011 in connection with 2007800339714. European Patent Application No. 07763775.9. Goffman et al. (2003)“Genetic Diversity for Lipid Content and Fatty Abdullah et al., Efficient Plant Regeneration from Rice Protoplasts Acid Profile in Rice Bran,” Journal of the American Oil Chemists’ Through Somatic Embryogenesis. Biotechnology, 1983, 4: 1087 Society 80:485-490. 1090. International Search Report issued by the International Searching Almeida and Allshire, RNA silencing and genome regulation. Trends Authority (ISAAU) on Oct. 25, 2007 in connection with Interna in Cell Biology, 2005, 15:251-258. tional Application No. PCT/AU2007/000977. Bligh and Dyer, Orange-red Flesh in Cod and Haddock. J. Fish. Res. WO 2005/063988 A1 (Pioneer Hi-Bred International, Inc.; E.I. Du Bd. Canada, 1959, 16(4):449-452. Pont De Nemours and Company) Jul. 14, 2005. Brandt et al., Primary Structure of a B1 Hordein Gene from Barley. WO 2000/01 1176 A2 (E.I. Du Pont De Nemours and Company) Mar. Carlsberg Res. Commun., 1985, 50:333-345. 2, 2000. Broun et al. A bifunctional oleate 12-hydroxylase: desaturase from Buhr et al., “Ribozyme termination of RNA transcripts down-regu Lesquerella fendleri. The Plant Journal, 1998, 13(2):201-210. late seed fatty acid genes in transgenic soybean'. The Plant Journal, Clapp et al., The 16-Kilodalton N-Terminal Fragment of Human 2002, 30(2): 155-163. Prolactin is a Potent Inhibitor of Angiogenesis. Endocrinology, 1993, Stoutesdijk et al., “High-oleic acid Australian Brassica napus and B. 133(3): 1292-1299. juncea varieties produced by co-suppression of endogenous A 12 Colot et al., Localization of sequences in wheat endosperm protein destaturases'. Biochemical Society Transactions, 2000, 28:938-940. genes which confertissue-specific expression in tobacco. The EMBO WO 2007/103738 A2 (Pioneer Hi-Bred International, Inc; E.I. Du Journal, 1987, 6(12):3559-3564. Pont De Nemours and Company) Sep. 13, 2007. Comaietal. Efficient discovery of DNA polymorphisms in natural Whitelaw, E. S. Li, Z. Singh, S. Liu, Q., Upadhyaya, N., Merell, populations by Ecotilling. The Plant Journal, 2004, 37.778-786. M. Rahman, S. (Sep. 2004), Investigation of lipid synthesis in the Haseloff and Gerlach, Simple RNA enzymes with new and highly rice grain: modification offatty acids in rice bran oil, in C. K. Black, specific endoribonuclease activities. Nature, 1988,334:585-591. J. F. Panozzo, & G. J. Rebetzke (Eds.), Cereals 2004. Proceedings of Henikoff et al., Tilling. Traditional Mutagenesis Meets Functional the 54' Australian Cereal Chemistry Conference and 1 I' Wheat Genomics. Plant Physiology, 2004, 135:630-636. Breeders Assembly, Sep. 21-24, 2004, Canberra ACT, North KOZeil et al., Optimizing expression of transgenes with an emphasis Melbourne VIC: Cereal Chemistry Division, Royal Australian on post-transcriptional events. Plant Molecular Biology, 1996, Chemical Institute, AU (pp. 418-420). 32:393-405. Third Office Action which issued on Nov. 16, 2011 in connection Langridge et al., Trends in genetic and genome analysis in wheat: a with Chinese Patent Application No. 2007800339714, including review. Aust. J. Agric. Res., 2001, 52: 1043-1077. English language translation. Lemieux B. High Throughput Single Nucleotide Polymorphism Response filed to the third Office Action filed on Apr. 5, 2012 in Genotyping Technology. Current Genomics, 2000, 1:301-311. connection with Chinese Patent Application No. 2007800339714, Li et al., Comparison of promoters and selectable marker genes for including English language copy of the claims. use in Indica rice transformation. Molecular Breeding, 1997, 3:1-14. Fourth Office Action which issued on Aug. 3, 2012 in connection with Lu et al., High Efficiency Retroviral Mediated Gene Transduction Chinese Patent Application No. 2007800339714, including English into Single Isolated Immature and Replatable CD34"Hematopoietic language translation. Stem/Progenitor Cells from Human Umbilical Cord Blood, J. Exp. Examination Report which issued on Jun. 8, 2012 in connection with Med., 1993, 178:2089-2096. Australian Patent Application No. 2007272316. Millar and Waterhouse, Plant and animal microRNAs: similarities English language translation of First Office Action which issued on and differences. Funct Integr Genomics, 2005, 5:129-135. Oct. 16, 2012 in connection with Japanese Patent Application No. US 8,530,724 B2 Page 4

GenBank Accession No. BAC45170.1, Sasaki et al. (2002). Feb. 6, 2012 European Examination Report issued in connection with GenBank Accession No. BAC45 173.1, Sasaki et al. (2002). European Patent Application No. 07763775.9. Bäumlein, H., et al., (1991) “A Novel Seed Protein Gene From Vicia Dec. 4, 2012 Request for Further Processing and Response to Feb. 6, faba is Developmentally Regulated in Transgenic Tobacco and 2012 European Report filed in connection with European Patent Arabidopsis Plants.” Molecular and General Genetics, 225(3): 459 Application No. 07763775.9. 467. Dec. 18, 2012 Response to Aug. 3, 2012 Chinese Office Action filed Domergue et al., (2005) “In vivo characterization of the first acyl in connection with Chinese Patent Application No. 2007800339714. CoA A6-desaturase from a member of the plant kingdom, the Jan. 9, 2013 Office Action issued in connection with U.S. Appl. No. microalga Ostreococcus tauri.” Biochem J. 389, 483-490. 13/011,773. Lee, M., et al., (1998) "Identification of Non-Heme Diiron Proteins Feb. 11, 2013 Response filed in connection with U.S. Appl. No. That Catalyze Triple Bond and Epoxy Group Formation.” Science, 13/011,773. 280(5365);915-918. Apr. 9, 2013 Office Action issued in connection with U.S. Appl. No. Trautwein, E.A. (2001) “n-3 Fatty Acids—Physiological and Tech 13/011,773. nical Aspects for Their Use in Food.” European Journal of Lipid Dec. 6, 2012 Office Action issued in connection with U.S. Appl. No. Science and Technology, 103(1): 45-55. 13/011,779. Valvekens, D., et al., (1988) "Agrobacterium tumefaciens-Mediated Jan. 4, 2013 Response filed in connection with U.S. Appl. No. Transformation of Arabidopsis thaliana Root Explants by Using 13/011,779. Kanamycin Selection.” Proceedings of the National Academy of Mar. 13, 2013 Office Action issued in connection with U.S. Appl. No. Sciences of the United States of America, 85(15) 5536-5540. 13/011,779. van de Loo. F. J. Broun, P., Turner, S., & Somerville, C. (Jul 1995). Agarwal et al. (2003) “Cottonseed Oil Quality, Utilization and Pro An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl cessing” CICR Technical Bulletin No. 25, pp. 1-16. desaturase homolog. Proc. Natl. Acad. Sci. USA, 92, 6743-6747. Dubois et al. (2007) "Fatty acid profiles of 80 vegetable oils with File History of U.S. Patent Publication No. 2011-0314725, Petrie et regard to their nutritional potential” European Journal of Lipid Sci al., published Dec. 29, 2011 (U.S. Appl. No. 13/171,032, filed Jun. ence Technology 109(7):710-732. 28, 2011). Klahre et al. (2002) "High molecular weight RNAs and small inter File History of U.S. Patent Publication No. 2011-0223311, Liu et al., fering RNAS induce systemic posttranscriptional gene silencing in published Sep. 15, 2011 (U.S. Appl. No. 13/011,773, filed Jan. 21, plants.” PNAS 99(18): 11981-1 1986. 2011). Liu et al. (1997) EMBL Nucleotide Sequence Database as X97016. File History for U.S. Patent Publication No. 2009-0308041, O'Brien (2005) “Cottonseed Oil’ Bailey’s Industrial Oil and Fat Whitelaw et al., Dec. 17, 2009 (U.S. Appl. No. 12/309,276, filed Jul. Products, 6th Edition, edited by Fereidoon Shahidi. 6, 2009). Pirtle et al. (1999) “Characterization of a Palmitoyl-Acyl Carrier File History of U.S. Patent Publication No. 2011-0229623, Liu et al., Protein Thioesterase (FatB1) in Cotton” Plant Cell Physiology 40:2p Sep. 22, 2011 (U.S. Appl. No. 13/011,779, filed Jan. 21, 2011). 155-163. Feb. 20, 2013 Examination Report issued in connection with Euro pean Patent Application No. 07763775.9. * cited by examiner U.S. Patent Sep. 10, 2013 Sheet 1 of 38 US 8,530,724 B2

Acetyl-CoA PLASTD S Fatty acid KAS SAD1 C4:0-ACP synthase. 16:0-ACP i) 18:0-ACP i) 18:1-ACP

FatB 3. fiFatBIFatA" -i.4s: FatA Acyl-CoA Pool

... 3.- ...... ; ER O). E- 16:018:2, C)fads E 18:3.16:0.

. P. .

U.S. Patent Sep. 10, 2013 Sheet 5 of 38 US 8,530,724 B2

LOCOs 02.g4 CCATATGTGCAGCATAAAAGGCAAATCAGCCCTGTTTGACATGGCTCCAATGCTTAAATT Locoslig4 ------Locos06g0 ------Locos 06g3 ------1981. 1991 2001 2011 2021 2031 LOC OsO2.g4 CTTTAGAGAAAAAACAGACTTTGTAGATTAAATCAAAGTGGCATAATCTTTTTATTTTGA Locosllg4 ------Locos06g0 ------Locos06g3 ------2041 2051 2061 2071 2081 2091 LOC Os02.g4 TAAAAATATTAGAAAATATCATACCCTAATATTCTTAGCATAGTACTCCATTCATCTCAC LOCOsllg4 ------Locos 06g0 ------Locos 06g3 ------2101 2111 221 213 2141 2151 Locos 02.g4 TTATTAAGGTACGATCAAACTTGGCATAGTCTTCAAAGGCTGTGTTCTTTCCCCCATTTT LOCOs11g4 ------Locos 06g0 ------Locos06g3 ------2161 2.71. 218 2191 220 221. Locos 02.g4 CCTAACCCATCTATCTCGTTTTCCGCGCACACATTTTTCAAACTGCTAAACGGTGTGATT Locos 11.g4 ------Locos06g0 ------Locos06g3 ------222 2231. 2241 225 2261 227 Locos 02.g4 TATGCAAAAACTTCTATATGAAAGTTGTTTAAAAAAATCATATTAATCCATTTTTTAAAA LOC Osilg4 ------will duk did adds sw duk v. K...... Locos06g0 ------Locos 06g3 ------2281 2291 230 2311 2321 2331, LOCOs02.g4 AAATCAGTTAATACTTAATTAATCATGCAATAAAACGAACTTCATTTTGCGTGCTGGGGA Locoslig4 ------LOC Os06g0 ------Locos06g3 ------234 2351 2361 2371 238 2391. Locos 02g4 GGAGGGGCTCCCAACCCCTCCTCCGAACACAGCCAAAAGCTACTTTTGGACTTTAAATTT LOCOsllg4 ------Locos 06g0 ------Locos 06g3 ------240 241.1 24.21 243 2441 2451 LOCOs02.g4 GTCATATATTATAATGTTTCTAGTAACAAAACCATAGTCATATGAAAGTAAATTTAAATG Locos.11g4 ------Locos06g0 ------Locos06g3 ------246 24.71 24B) 2491 250 251 LOCOs02.g4 ATAATCCAATGATATTATTTTCATCAAATAGAATTTAATTTATAATAAACTATTTATTGA Locos.11g4 ------LOC Os06g0 ------Locos06g3 ------252. 2531 2541. 2551. 2561. 257.1 LOCOs 02g4 TAAAATATTCAGAGAGTTGAATATTAAAATACCTGTGTGCCTTAGGAGTGGGCCAAATT LOC Osilg4 ------LOC Os06g0 ------LOC Os06g3 ------U.S. Patent Sep. 10, 2013 Sheet 6 of 38 US 8,530,724 B2

258 2591 26O1 2611 2621. 263 LOCOsO2.g4 AATTAATGGAGTAGTAACAGCTTTAACCAAAGAAATTCAACAATCCCAAGCTAGAAA Locos11g4 ------Locos Osg0 ------Locos 06g3 ------264 2651. 2651 2671. 268 269. LOC OsO2.g4 AAACCCAACTCCAAAAAAACTTGAGTTAGAACTGTGTTAAGCACCTAAATGTAATACC Locos11.g4 ------Locos 06go ------LOC Os06g3 ------270 271. 272 2731 24 275 LOC OsO2.g4 TGTTACTCTCTCGTTCTCATTCTATATTTGTCCTAAGTTAAATATATCTACCTTTTTTTA Locoslig4 ------Locos06g0 ------Locos06.g3 ------276 277. 2781 2791 28O1 28.1 Locos 02.g4 TCTGTCCTAAGTTAACTATGTGTATGTCTATCTTTTCTACTACTCCCTCCGTTTCAGGTT Locosllg4 ------Locos06g0 ------Locos 06g3 ------2821 2831 284. 2851. 286 2871 LOC Os02.g4 ATAAGACGTTTTGACTTTGGTCAAAGTCAAACTGCTTTAAGTTGACTAAGTTTGTAGAA Locos 11.g4 ------Locos06go ------Locos06g3 ------288 2891 2901 291 2921 2931 LOC Os02.g4 AAAATAATAACATTCAACCCAAGACAAATTTATTATGAAAATATGTTCAATTATTGAT Locos 11.g4 ------Locos06go ------Locos06g3 ------2.94. 295. 296 297 298. 299 LOCOs 02.g4 TTAATGAAACTAATTTGGTATTATAAATATTATTATATTTATATATAAACTTAGAAAT Locos.11g4 ------Locos 06go ------Locos 06g3 ------3001 3011 3021 303 3O41 305 LOCOs 02.g4 TTAAAGTAGTTAAGTTTGATCAAAGTCAAAATGTTTTATAACCTGAAATGGAGGGAGTA Locos11.g4 ------Locos06g0 ------LOCos06g3 ------3061 307 3O8. 3091 30 3.11 Locos 02.g4 AGTAATTGAAACGAAGAGAGCAGACAAATAATAAACTAGTAAAGCCTGIGACTTGGG Locoslig4 ------Locos06g0 ------Locos06g3 ------3121 313. 3141 35 3.16.1 317 LOCOs 02g4 CTAGTCATTGATCGTGTACATGTAGGTCTTGTTTAGATCCCAAAAAATTTTAGCCAAAAC Locoslig4 ------LOC Os06g0 ------Locos 06g3 ------3.81 3.191 320 321 3221 3231 LOC Os02.g4 CTCACATCAAATATTTGGACACATGCACCCCTACCAGTGTGTGGAGGCATTGCATACACG Locos.11g4 ------Locos06go ------Locos06g3 ------Figure 4b U.S. Patent Sep. 10, 2013 Sheet 7 of 38 US 8,530,724 B2

324l 3251 326 327 3281 329 LOC OsO2g4 AAACATGGAAAAGGAATCAACTTGAGAGGTTAGACCTGCTAGCTCTACTAGGTCTGGATG LOC Osllg4 ------Locos06g0 ------Locos 06g3 ------3301 3311 332 33.31 334 3351 LOCOs 02.g4 GTCATGCATTTTTTTTTGAAAAAAACCACGCTGCAAGCTCGACAGCCTCAACCTCAATGG Locoslig4 ------Locos 06g0 ------Locos 06g3 ------e-A as seas are an an an - - - so muru up ou ou um mum seamerous me as dra- - 3361 33.71 3381 3391 3401 3411 LOC OsO2.g4 CAACCATGACAATAATATGCATGACAATGGTGTAGGAGAAAAGACACGTCGATAACCAAA LOC Osl1 g4 ------LOCOs 06g0 Locos 06g3 ------3421 3431 344 3451 346 34.71 LOC Os02.g4 GGGCGCGGCTGCGCATACAAAGGCGGAGAGAAGGAACGATGGTGGCTCAAAAAGAAAGAG Locos 11.g4 ------Locos 06g0 ------Locos 06g3 ------3481 3491 350l. 351 352. 353 Locos 02.g4 CGTCGGTGGCAGTGGTGCGTGGAGCGACACTAAAGTTAGTGGTTGCTGATGGTCTCACAC LOC Osllg4 ------Locos 06g0 ------Locos 06g3 ------3541. 3551. 356 357 3581 3591 LOCOs 02.g4 AATCCCTAACGAAAATTTATTTTTTTTCACTTAGTATTGCTGATCCGTGGGCCACCAG Locos 11g4 ------Locos 06g0 ------CGCGTCGTG LOC. Os 06g3 ------3601 3611 3521 3631 3641 3651 LOC Os02.g4 CCAATCATAAAGAAAAATGTTGAGATAAAAGGTGGAGTATCTTCCCCTTCCTTCCCTTTT Locos.11g4 ------Locos 06g0 TGAGTTGGCGAGCCCGAGGAGCGGAGGCGGCCACAAGTCTAATCCGCGTCGTCTGCGCGT Locos 06g3 ------3661 3671 3681 3691 3701 371 LOC. Os 02.g4 TGACTCGAAAAAAAAAAGCGTCGGTGGCGGCCGTGCGTGTAACAACACTAAAGTTAGTGG Locos 11.g4 ------LOCOs 06g0 CGTGGGCGAGGAGGAGAAAGAAGAGGAGGAAGAGAGGGAAGGGGGCTTGA--TTTGATE Locos 06g3 ------3721 3731 3741 3751. 3761 3771 LOC os02.g4 TTGCTGGTGGTCTGACACAATCCCTAACAAGTTTGATAATAATAATAATTTATTTCCTC Locos 11.g4 ------Locos 06g0 TGGGCGCGTCTCGTGGAGTATCCGGTGAGTTCTTGGCGATCTGGCGAGGCGAGTGAGAG Locos 06g3 ------up - up out on a uses up 8 to - a to do no o 378 379l 380 3811 3821 3831 Locos 02g4 TTATTAGTATTGCTGATGCGTGGGCCACCAATCAATCGTAAAGAAAAAAAATGTTGAGAT LOC Osilg4 ------LOCOs06g0 TGATTCCTGCTGCTGCTGGGGGATTTTGGCGTGATTTTCGTTGGTTGCATTTTGTTTCTT Locos06g3 ------3841 385. 386 387 3881 389. LOCOs 02.g4 AAAAGGTGGGGGTATCTTCTCCTTCTCTTTTTTTTTGGCTAAAATAAAAGTGGTTTCTGG LOC Osllg4 ------LOCOs 06gO TTTTTTTGTATCGATTTGTTGGAGCT-TTATTCGGTAGATCTGGTCGATTCCATGGTGAG LOCOs 06g3 ------

U.S. Patent Sep. 10, 2013 Sheet 12 of 38 US 8,530,724 B2

6541 655 6561 657. 6581 6591 LOCOs 02.g4 GGAAGCCAGAACGGGCATGACTTACGTTTCCAGCGATAAGCTCCGTTTTAAAAAAA LOCOsllg4 GGAATGCCAGAACGGGCATGTACTTTCGTTTTCCAGCGATAAGCTCCGTTTTAAAAATAA LOCOs 06g0 ---ACCCCTGTTCATGTACTTCTCACTTTTCACCATGGCAGGCAT-GTTTAGAAAATCA Locos 06g3 ----TACAGCAACATGAAGCTACCTATTTGTCCTAATTGTTTGCTCAATGTGCA--GTAA 66O1 6611 662 663 664 665 LOCOs 02.g4 ATTAGCAAGTGATTTATTTGCATTTATAAACAAAAATTTACCACTCGGGTAGTTCATATT LOCOsllg4 ATTAGCAAGTGATTTATTTACATTTACAAACAAAAATTTACCACTCGGGTAGTTCACATT Locos 06go TT------TGATTT-T------ACAGGGCATTACCA------LOC. Os 06g3 AT------GGGTTATG------ATGCACAAGCTTACAAGGAGGCTAGCA ----- 6661 667. 668 669. 6701 67.1 LOCos02.g4 AAAGTTATTGTCTAGCTTTATTACAAGCAGCATGAAAGTTACGATACCCCAAGGCCTGAG LOCOsllg4 AAAATTATTGTCTAGCTTTATTACAAGCAACATGAAAATTTCGATACCCCAAGGCCTGAG LOCOs 06g0 ------TGTGACCCCTTAATAs ACTAACA--AATAT------AT Locos 06g3 ------A--GAATTCCTGATGAAGTACGTACTGAAATAGAGCCATAC------T 672. 6731 6741 675 6761 6771 LOC OsO2.g4 TTTGGCAGCACT-TAACTCTGTTGCCCTGTTTTGTCTTGAAAAGTATAACATCACTTAGC LOCOsllg4 TTTGGCAGCACTATAACTCTGTTGCCCTGTTTTGTCTTGAAAAGTATAATATCACTTAAC LOC OsO6g0 TTTGGGTCCACC--AAATCTGTGG---TGGATGGAAAGGGAAATTA-ATAAACAC--AAA LOC Os06g3 TTTTTGAGCATGCTTCTATTGTAGA-r-TGAAGACAACCAGAAACTTCCAAAACTGCCAGA 678. 6791. 68O 681 68.21 6831 LOCOs 02.g4 AGGACAATGCTCTCCCGAAAACATAACTGATTAGTGGATAGAGGGAG-AGGTTTAG---- LOCOsllg4 AGGACAATGCTCTCCCGAAAACATAACTGATTAGTGGATAGAGAGAG-TGGTTTAGGTGG Locos 06g0 TGGAAAATTCTTCATTGTGAA---ACGTGATAAG------GACAA-ATTTTGTG---- Locos 06g3 TATTGAAGGTGCTAATGTAGCCAAATATGTCCGGACAGGCCTGACTGTAAGTTTTG---- 6841 6851 6861 6871 6881. 6891 Locos02.g4 ------LOC Osllg4 TGTTTGGATCCGGGGACTAAATTTTAGTTCATGTCACATCGGATGTTTGGACACTAATTA LOCOs 06g0 ------Locos06.g3 ------6901 691. 692 693. 6941 6.951 Locos02g4 ------TCCCAATAGATAATTGACTGGTTACT LOC Osllg4 GAAATATTAAACATAGACTAATAATAAAATTTAGTCCCAATAGATAATTGACTGGTTACT LOCOsO6g0 ------AAAAATAA-a-weer-ress ------Locos 06g3 ------TGGAATTATACAAGATTACAGT- - - 696. 6971 6981 699. OO 701. LOCOs 02.g4 TCATATTCATTGCCCAGAGCTGCCTCATTAAATGTT--CTGTCCTGTGCTTTCTTGGATC LOC Osllg4 TCATATTCATTGCCCAGAGCTGCCTCATTAAATGTTGTCTGTTCTGTGCTTTCTTGGATC LOC OsO6g0 ----AGTAA------C---AAAAAATGG---CTAGTATTTGCCTAC------Locos 06g3 TACAAGTAT------ACAAAATGT---GCATGTTTTTCTTTCAT----- 7021 7031 7041 705. 706 707 LOCOs 02.g4 TTGAATAAAAGACGCTGTACAGGGTACCACACCTCAAGGGATCACAATTCAGAAAGT LOCOsllg4 TTGAATTAAAAGACGTCTGTACAGGGTACCACACCTCAAGGGATCACAATTCAGAAAGTT Locos 06go - - - -ATATAGAGT------eas ase-s-s-s-ACACCCAAGAGATCA.------GAAAAGT Locos 06g3 -TTTTTACATCTTCTTCTGTCTCATAATGCAGCCACGATGGGCCGACCTTGATATCAATC 7081 7091 71Ol 7111 72 7131 LOC OsO2.g4 TCCCT-TTATTGGGCTGCAGTAAAT-GATTCCATCGTGTAGAAAAGAACAAAAGCAATTA LOCOs 11.g4 TCCCT-TTATTGGTCTGCAGTAAAT-GATTCCATCGTATAGAAAAGAACAAAAGCAATTA LOC Os06g0 TGCCT-TTATTG--ATGGAGTAATF-GAATTAGTAGT------An on an orAGCAATAA LOCOs06g3 AGCATGTTAATAACGTTAAATACATAGGGTGGATCCTAGAGGTAAAAAAAGTTCCCCT-- 714. 71.51 716. 7171 7181. 71.91 LOC Os02.g4 ATGCTGTGCCATATCATGGGAGAAGCTAAGGACCGATCTAGAACAGTGAACTTTTGTTG LOCOsl1.g4 ATGCTGTGCCATATCATGGGAGAAGCTAAGGACCCATCTAGAACAGTGAACTTTTGTTG LOC Os06g0 ATTCTGTGG-ACCT-AGGGGACATCC------CTGATCTAGATC----GAGTTTTGAT-- LOC Os06g3 ATTATGTTCATCTTTATTGCCCTTGCTAA- - -CACCTCTTGCCTAGATGATTCTTGAGGG

Figure 4h

U.S. Patent Sep. 10, 2013 Sheet 14 of 38 US 8,530,724 B2

786 7871 788. 789. 7901 791 LOCOs02.g4 GTGATGATGCTACAGAGCAATTCATAAGAAAGGGGCTCAC-TGTAAGTCAGCTAGACA LOC Osllg4 GTGATGATGCTACAGAGCAATTCATAAGAAAGGGGCTCAC--GTAAGICAGCTAGACAT LOC OsO6g0 ATGGCGCTGCTACCAAACAATTCACAAGAAAAGGGCTTAC--TGTAAGTCAGA-ATAT Locos 06g3 CAGATTTTACTACATTAGGTTGGTCACCTACGTACCTAACCCTGTACGCTTGTTG-CTTC 792. 931 794 7951. 796. 797. LOC OsO2.g4 GGTTACATACTGAATTATCATTATGCCTCAACTGCTATCATTTATCTAAGAAAAACAGTA LOC Osllg4 AGTTACATACTAAATTATCATTATGCCTCAACTGCAATCATTTATCTAAGAAAAATAGTA Locos 06g0 TGCTTGTTACCG----- TCAT-ses--e-r--arse - - - -CATTTTGCTGG------LOC Os06g3 CGATAAAGAGCTTGGCTGGAATA---CTTATATG----CAATTTGATCACAAG------798 799 800 8O11 802.1 8O31 LOC OsO2.g4 ATAATTGATCTCACCCCTCATATTTTAAATGATATTGATGGACTCTTGTTTACTGCA LOC Osllg4 ATATTGATCTCACCCCTCATTATTTAAATGATCTTTGATGGACTCTTGTTTACTGCA LOC OsO6g0 - - - -TGGTTCTCATGCATAAAATTTCTCA------TGAGGGATCCTTTGTTCATGT LOCOs 06g3 - - - -TCATTCACTTAATTCAATTTTTTTTAGAG----- TGATCAACACCTGCATATAAT 804. 8051 8061 8071 8O8. 809 LOC OsO2.g4 ACAGCCTAGATGGGGTGACCTCGATGTCAATCAGCA-TGTGAACAATGAAAATATTG LOCOslig4 ACAGCCAGAGGGGTGACCTCGATGTCAATCAGCA-TGTGAACAATGTAAATATATTG Locos 06g0 -CAGCCGAAGGGAGTGACCTTGATGCAACCAGCA-TGTGAACAATGGAAGTATATTG Locos 06g3 ---GCATATTG------CCTGGTTGACAATCTGCCGTGTGTA---TGTG---GTTTTG 810 81 82. 813 8.4 85. LOCOs02.g4 GGTGGATCCTTGAGGTGGTTATTCTTGTCCCTTATATTCATTGTTTAGAGAA-AAATAA LOC Osllg4 GGGGACCTTGAGGTGGTTATCTTGTCCCTTTTATTCATTGTTTAGAGAA-AAATAA LOC OsO6g0 GTTGGAACTTGAGGTAAC--TTCTTTTTCCT.------TTCTCTATCCGA-a-ACATGC LOC Os06g3 GAAGAAGGGGAGGGGTAGT-as-CATGTAGAT-a- - - - -TTATCCAGGGACCACATAA 861 81 818 891. 82O1 821 LOCOs 02.g4 TTTGGCTTTATCCTTTTATATGGTACTTCCTTTGTTTCACAATGTAAGCATTTAGCAT LOCOsllg4 TGGCTTTATCCTTTTATATGGTG------a------Locos 06g0 TACCTAGATCAGAAAAGAGAGTG--- Locos 06g3 TGAGGAAAAAGAAATTGTTCAGGTG------822 8231 B24 8251 8261 827 LOC OsO2.g4 TTCCCATATTTATATTATGCTAATGAATCTAAATAGATATATGGCTAGATTCATGG Locoslig4 ------LOCos06g0 a ma map am maha was a us as as a swa w as LOC Os06g3 ------ACCTG------828. 829 8301 8311 832 833. LOCOs 02.g4 CATCAATAGAATGTGAGAAATGCTAAAAIGACTTACATTATGAAACGGAGGGAGTAGTT LOC Os11.g4 ------G------TT Locos 06g0 ------LOCOs06g3 ses -CAACCs ------AGA's esse -----ee------TG B34. 8351 836 83.71 838 839 LOC Os02.g4 GTAGGGAACCATTTTATGTAGTACTTGCAAATTTTCAGAGATTCTGACTGACCAT LOCOsllg4 GAGGGAACCATTTTATGTAGTACTTGCAATTATTCAGAGATTCTGATCTGACCAT Locos 06g0 ------CTGATCGTAATAGTA-- - - -ACCTAGTTCCTAGs -- - - - TCATAGCCAAG LOC OsO6g3 GGCCCAAAACAACCCAAAAATTAGG-GAAATAACACTCAGGre ---- CATTTCCTAAC 84O1 841. 842 843 84.4 B451 LOC OsO2.g4 CTGTATTGTTGATATTGTCATTAGTCACATCTGGCAGTCAGAAGGCTTTCAAACATG LOCOslg4 CGTATTGTGATAGCATAGTCTACACTGGTCAGTCAGAAGGCTTCAAACAG LOC OsO6g0 CTGA----as-a------AAA-ACACTFGCA-CTGTATATTCAAAAGCTATTCAAA-- - - Locos 06g3 ATACA---as-s-s--- - -GAAATATTTATTAC--CAACATGCGCACATGTTGCTTAAC---- 8451 847. 848 849. 850 BS1 LOCOsO2.g4 TTTCTGAGTTCTTTCTAATTTTTTCCCC-CAGAGTGCTCCAATTTCAGTACTGGAGAAGC LOCOs11g4 TTTTTGAGTTCTTTCTAATTTTTTCCCC-CAGAGTGCTCCAATTTCAGTACTGGAGAAGC LOC OsO6g0 TTTCTGAGTACGTTTTGTTTTTTTTTCCTCAGAGTGCTCCAATTTCGATACTGGAGAAGC LOC Os06g3 ---CCTACCTTTTTGTCCTTTTTCCCCTCAGAGCGCACCAATCTCCATTCTGGAGAAAC

Figure 4.j

U.S. Patent Sep. 10, 2013 Sheet 16 of 38 US 8,530,724 B2

98. 99. 92O1 92.1 922 923. Locos 02.g4 ------LOCOsllg4 ------LOCOs 06g0 AAAAGAAAAGGGAAAAGAAGAAGCGTGGATTGAGGCCGGAGCAGCAGAGATATTACAA LOCOs 06g3 CGAAAGCAGATTGCCTGGTCCGAATTGTTTGAAATTTTAAGTT------924 925. 926. 927 928. 929. Locos 02.g4 ------LOC Osillg4 ------LOCOs 06g0 TCGACATAGATAAATAAGATGTAAACAATTTAGCCCAGGGGTTTGTGTGTGGAGATG Locos 06g3 ------930. 931 932 933. 934 9351 Locos 02g4 ------Locos 11g4 ------LOCOs 06g0 CAATCCATTGTAGTAACAGCCTAACTTGTACATTCTTGCCATCTTTTTCTTATTAATTGA Locos 06g3 ------9351 937 9381 939 940 94. LOC OsO2.g4 ------Locos 11.g4 ------LOC OsO6g0 ATGAATGAATCGCAGACCTCCTGCGTTTTCATCAATAATGAAATGACTCTGCTTCATC LOC Os06g3 ------942. 943. 9441 Locos 02.g4 ------LOC Osl1.g4 ------LOC Os06g0 AAGAATTGAATGAATTGTCTGTCTG Locos06g3 ------

Figure 4l U.S. Patent Sep. 10, 2013 Sheet 17 Of 38 US 8,530,724 B2

1 . . ATGGCTGGTTCTCTTGCGGCGTCTGCATTCTTCCCTGTCCCAGGGTCT 48 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 115 TCATGGCTGGTTCTCTTGCGGCGTCTGCATTCTTCCCTGTCCCAGGGTCT 1200 49 TCCCCTGCAGCTTCGGCTAGAAGCTCTAAGAACACAACCGGTGAATTGCC 98 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1201 TCCCCTGCAGCTTCGGCTAGAAGCTCTAAGAACACAACCGGTGAATTGCC 1250 99 AGAGAATTTGAGTGTCCGCGGAATCGTCGCGAAGCCTAATCCGTCTCCAG 148 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1251. AGAGAATTTGAGTGTCCGCGGAATCGTCGCGAAGCCTAATCCGTCTCCAG 1300 149 GGGCCATGCAAGTCAAGGCGCAGGCGCAAGCCCTTCCTAAGGTTAATGGA 1.98 | | | | | | | | | | | | | | | | | | | | | | | | | l301 GGGCCATGCAAGTCAAGGCGCAGGCGCAAGCCCTTCCTAAGGTTAATGGA l350 199 ACCAAGGTTAACCTGAAGACTACAAGCCCAGACAAGGAGGATATAATACC 248 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1351 ACCAAGGTTAACCTGAAGACTACAAGCCCAGACAAGGAGGATATAATACC 1400 249 GTACACTGCTCCGAAGACATTCTATAACCAATTGCCAGACTGGAGCATGC 298 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 401 GTACACTGCTCCGAAGACATTCTATAACCAATTGCCAGACTGGAGCATGC 1450 299 TTCTTGCAGCTGTCACGACCATTTTCCTGGCAGCTGAGAAGCAGTGGACT 348 145 TTCTTGCAGCTGTCACGACCATTTTCCTGGCAGCTGAGAAGCAGTGGACT 15 OO 349 CTGCTTGACTGGAAGCCGAAGAAGCCTGACATGCTGGCTGACACATTCGG 398 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1501 CTGCTTGACTGGAAGCCGAAGAAGCCTGACATGCTGGCTGACACATTCGG 1550 399 CTTTGGTAGGATCATCCAAGACGGGCTGGTGTTTAGGCAAAACTTCTTGA 448 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1551. CTTGGTAGGATCATCCAAGACGGGCTGGTGTTTAGGCAAAACTTCTTGA 16 OO 4 49 TTCGGTCCTACGAGATTGGTGCTGATCGTACAGCTTCTATTGAGACATTA 498 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1601 TTCGGTCCTACGAGATTGGTGCTGATCGTACAGCTTCTATTGAGACATTA 1650 499 ATGAATCATTTA...... 510 l651 ATGAATCATTTACAGGTGATACAATGGAGCTATGCTGCTTTAGCTTTTCT 1700

s

Figure 5a U.S. Patent Sep. 10, 2013 Sheet 18 of 38 US 8,530,724 B2

511 ...... CAGGAAACAGCTCTGAACCATGTGAAAACTGCTGGTCT 548 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1751 TTTGAAGCTTTGCAGGAAACAGCTCTGAACCATGTGAAAACTGCTGGTCT 18 OO 549 CTTAGGTGATGGTTTTGGTGCTACGCCGGAGATGAGCAAACGGAACTTAA 598 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | l801. CTTAGGTGATGGTTTTGGTGCTACGCCGGAGATGAGCAAACGGAACTTAA 1850 599 TATGGGTTGTCAGCAAAATTCAGCTTCTTGTTGAGCGATACCCATCAT, .. 646 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 1851. TATGGGTTGTCAGCAAAATTCAGCTTCTTGTTGAGCGATACCCATCATGG 1900

647 ...... GGGGAGATATGGT 659 3101 ATTTCTCATAGGCTGAAATTTTGGTTGCAAATTTTTAGGGGAGATATGGT 3150 660 CCAAGTTGACACATGGGTAGCTGCTGCTGGCAAAAATGGCATGCGTCGAG 709 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3151 CCAAGTTGACACATGGGTAGCTGCTGCTGGCAAAAATGGCATGCGTCGAG 3200 710 ATTGGCATGTTCGGGACTACAACTCTGGTCAAACAATCTTGAGGGCTACA 759 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3201 ATTGGCATGTTCGGGACTACAACTCTGGTCAAACAATCTTGAGGGCTACA 3250

760 . . . . AGTGTTTGGGTGATGATGAATAAGAACACTAGAAGACTTTCAAAAA 805 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3351 TTGCAGTGTTTGGGTGATGATGAATAAGAACACTAGAAGACTTTCAAAAA 3400 806 TGCCAGATGAAGTTAGAGCTGAAATAGGCCCGTATTTCAATGGCCGTTCT 855 | | | | | | | | | | | | | | | | | | | | | | 3401 TGCCAGATGAAGTTAGAGCTGAAATAGGCCCGTATTTCAATGGCCGTTCT 3450 856 GCTATATCAGAGGAGCAGGGTGAAAAGTTGCCTAAGCCAGGGACCACATT 905 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3451 GCTATATCAGAGGAGCAGGGTGAAAAGTTGCCTAAGCCAGGGACCACATT 3500 906 TGATGGCGCTGCTACCAAACAATTCACAAGAAAAGGGCTTACT...... 948 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 350 TGATGGCGCTGCTACCAAACAATTCACAAGAAAAGGGCTTACTGTAAGTC 3550

Figure 5b U.S. Patent Sep. 10, 2013 Sheet 19 Of 38 US 8,530,724 B2

949 ...... 0 0 d a a s a a CCGAAGTGGAGTGA 962 | | | | | | | | | | | | | | 36O1 TAAAATTTCTCATGAGGGATCCTTTGTTCATGTCAGCCGAAGTGGAGTGA 3650 963 CCTTGATGTCAACCAGCATGTGAACAATGTGAAGTATATTGGTTGGATAC 1012 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 365 CCTTGATGTCAACCAGCATGTGAACAATGTGAAGTATATTGGTTGGATAC 37 OO

1013 TTG...... 1015

3701 TTGAGGTAACTTCTTTTTCCTTTTCTCTATCCGAACATGCTATCTCTAGA 3750

1016 ...... AGAGTGCTCCAATTTCGATACT 1037 | | | | | | | | | | | | | | | | | | | | | 3851. TCTGAGTACGTTTTGTTTTTTTTTCCTCAGAGTGCTCCAATTTCGATACT 3900

1038 GGAGAAGCACGAGCTTGCAAGCATGACCTTGGATTACAGGAAGGAGTGTG 1087 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3901 GGAGAAGCACGAGCTTGCAAGCATGACCTTGGATTACAGGAAGGAGTGTG 395 O

1088 GCCGTGACAGTGTGCTTCAGTCGCTTACCGCTGTTTCAGGTGAATGCGAT 11.37 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 3951 GCCGTGACAGTGTGCTTCAGTCGCTTACCGCTGTTTCAGGTGAAIGCGAT 4 OOO

1138 GATGGCAACACAGAATCCTCCATCCAGTGTGACCATCTGCTTCAGCTGGA 1187 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 4 OO1 GATGGCAACACAGAATCCTCCATCCAGTGTGACCATCTGCTTCAGCTGGA 4.050 1188 GTCCGGAGCAGACATTGTGAAGGCTCACACAGAGTGGCGACCGAAGCGAG 1237 405 GTCCGGAGCAGACATTGTGAAGGCTCACACAGAGTGGCGACCGAAGCGAG 4100

1238 CTCAGGGCGAGGGGAACATGGGCTTTTTCCCAGCTGAGAGTGCATGA. . . 1284 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | 401 CTCAGGGCGAGGGGAACATGGGCTTTTTCCCAGCTGAGAGTGCATGAGCG 4150

Figure 5c U.S. Patent Sep. 10, 2013 Sheet 20 of 38 US 8,530,724 B2

e99InáH

U.S. Patent Sep. 10, 2013 Sheet 26 of 38 US 8,530,724 B2

U.S. Patent Sep. 10, 2013 Sheet 31 of 38 US 8,530,724 B2

w O Palmitic SEO)8:1 Grain GC Analysis O LinoleicOleic (C (C18:2)

FATB Tos17 FATB RNAi FAD2 RNA

Figure 11 U.S. Patent Sep. 10, 2013 Sheet 32 of 38 US 8,530,724 B2

Grain% Fatty Acid

FATB TOS17 FATB RNA FAD2 RNA

s C

ey SS

FATB. ToS 17 FATB RNAi FAD2 RNA WILD

Figure 12 U.S. Patent Sep. 10, 2013 Sheet 33 Of 38 US 8,530,724 B2

Grain% Fatty Acid

FATBTOS17 FATB RNAi FAD2 RNA WILD

Figure 13 U.S. Patent Sep. 10, 2013 Sheet 34 of 38 US 8,530,724 B2

s

.S. 3 N (V) 3 O a - A - t H S2

y O

9 3 R 9 Linoleic Figure 14 U.S. Patent Sep. 10, 2013 Sheet 35 of 38 US 8,530,724 B2

Linoleic

Figure 15 U.S. Patent Sep. 10, 2013 Sheet 36 of 38 US 8,530,724 B2

ŽE 312|OSA314||u||Dº

R Oleic

Figure 16 U.S. Patent Sep. 10, 2013 Sheet 37 Of 38 US 8,530,724 B2

U.S. Patent Sep. 10, 2013 Sheet 38 of 38 US 8,530,724 B2

GXOg—?

Figure 18 US 8,530,724 B2 1. 2 ALTERING THE FATTY ACID COMPOSITION 1994). On the other hand, unsaturated fatty acids, such as the OF RICE monounsaturate oleic acid (18:1) and the polyunsaturates linoleic acid (18:2) and O-linolenic acid (ALA, 18:3), have This application is a S371 national stage of PCT Interna the beneficial property of lowering LDL-cholesterol (Men tional Application No. PCT/AU2007/000977, filed Jul. 13, 5 sink and Katan, 1989: Roche and Gibney, 2000), thus reduc 2007, and claims priority of Australian Patent Application ing the risk of cardiovascular disease. No. 2006903810, filed Jul. 14, 2006, the contents of all of Although nutritionally desirable, highly unsaturated oils which are hereby incorporated by reference into this applica are too unstable for use in many food applications, particu tion. larly for commercial deep-frying where they are exposed to 10 high temperatures and oxidative conditions for long periods FIELD OF THE INVENTION of time. Under such conditions, the oxidative breakdown of the numerous carbon double bonds present in unsaturated oils The present invention relates to rice oil, rice bran and rice results in the development of short-chain aldehyde, hydrop seeds which have altered levels of oleic acid, palmitic acid eroxide and keto derivatives, imparting undesirable flavours and/or linoleic acid. The present invention also provides 15 and reducing the frying performance of the oil by raising the methods for genetically modifying rice plants such that rice level of polar compounds (Changet al., 1978; Williams et al., oil, rice bran and rice seeds produced therefrom have altered 1999). levels of oleic acid, palmitic acid and/or linoleic acid. Oil processors and food manufacturers have traditionally relied on hydrogenation to reduce the level of unsaturated BACKGROUND OF THE INVENTION fatty acids in oils, thereby increasing their oxidative stability in frying applications and also providing Solid fats for use in Plant oils are an important source of dietary fat for humans, margarine and shortenings. Hydrogenation is a chemical pro representing about 25% of caloric intake in developed coun cess that reduces the degree of unsaturation of oils by con tries (Broun et al., 1999). The current world production of Verting carbon double bonds into carbon single bonds. Com plant oils is about 110 million tones per year, of which 86% is 25 plete hydrogenation produces a fully Saturated fat. However, used for human consumption. Almost all of these oils are the process of partial hydrogenation results in increased lev obtained from oilseed crops such as Soybean, canola, Sun els of both saturated fatty acids and monounsaturated fatty flower, cottonseed and groundnut, or plantation trees such as acids. Some of the monounsaturates formed during partial palm, olive and coconut (Gunstone, 2001: Oil World Annual, hydrogenation are in the trans isomer form (such as elaidic 2004). The growing scientific understanding and community 30 acid, a trans isomer of oleic acid) rather than the naturally recognition of the impact of the individual fatty acid compo occurring cis isomer (Sebedio et al., 1994: Fernandez San nents of food oils on various aspects of human health is Juan, 1995). In contrast to cis-unsaturated fatty acids, trans motivating the development of modified vegetable oils that fatty acids are now known to be as potent as palmitic acid in have improved nutritional value while retaining the required raising serum LDL cholesterol levels (Mensink and Katan, functionality for various food applications. These modifica 35 1990; Noakes and Clifton, 1998) and lowering serum HDL tions require knowledge about the metabolic pathways for cholesterol (Zock and Katan, 1992), and thus contribute to plant fatty acid synthesis and genes encoding the enzymes for increased risk of cardiovascular disease (Ascherio and Wil these pathways (Liu et al., 2002a: Thelen and Ohlrogge, lett, 1997). As a result of increased awareness of the anti 2002). nutritional effects of trans-fatty acids, there is now a growing Considerable attention is being given to the nutritional 40 trend away from the use of hydrogenated oils in the food impact of various fats and oils, in particular the influence of industry, in favour of fats and oils that are both nutritionally the constituents of fats and oils on cardiovascular disease, beneficial and can provide the required functionality without cancer and various inflammatory conditions. High levels of hydrogenation, in particular those that are rich in either oleic cholesterol and saturated fatty acids in the diet are thought to acid where liquid oils are required or Stearic acid where a increase the risk of heart disease and this has led to nutritional 45 solid or semi-solid fat is preferred. advice to reduce the consumption of cholesterol-rich Satu Plant oils are composed almost entirely of triacylglycerols rated animal fats in favour of cholesterol-free unsaturated (TAG) molecules, which consist of three fatty acid (acyl) plant oils (Liu et al., 2002a). chains esterified to a glycerol backbone and are deposited in While dietary intake of cholesterol present in animal fats specialised oil body structures called oleosomes (Stymne and can significantly increase the levels of total cholesterol in the 50 Stobart, 1987). These storage lipids serve as an energy source blood, it has also been found that the fatty acids that comprise for the germinating seedling until it is able to photosynthe the fats and oils can themselves have significant effects on sise. Edible plant oils in common use are generally comprised blood serum cholesterol levels. Of particular interest is the of five main fatty acids—the Saturated palmitic and Stearic effect of dietary fatty acids on the undesirable low density acids, the monounsaturated oleic acid, and the polyunsatu lipoprotein (LDL) and desirable high density lipoprotein 55 rated linoleic and C-linolenic acids. In addition to fatty acids, (HDL) forms of cholesterol in the blood. In general, saturated plant oils also contain some important minor components fatty acids, particularly myristic acid (14:0) and palmitic acid Such as tocopherols, phytosterols, terpenes and mixed iso (16:0), the principal saturates present in plant oils, have the prenoids. These minor constituents are of increasing interest undesirable property of raising serum LDL-cholesterol levels because some have been shown to exert beneficial effects on and consequently increasing the risk of cardiovascular dis 60 skin health, aging, eyesight and blood cholesterol or prevent ease (Zock et al., 1994; Hu et al., 1997). However, it has ing breast cancer or cardiovascular disease (Theriault et al., become well established that stearic acid (18:0), the other 1999; Moghadasian and Frohlich, 1999). main Saturate present in plant oils, does not raise LDL-cho Fatty Acid and TAG Synthesis in Seeds lesterol, and may actually lower total cholesterol (Bonanome A diagrammatic overview of the metabolic pathways for and Grundy, 1988: Dougherty et al., 1995). Stearic acid is 65 fatty acids synthesis in developing seeds is shown in FIG. 1. therefore generally considered to be at least neutral with The initial stages of fatty acid synthesis occur in the plastid respect to risk of cardiovascular disease (Tholstrup, et al., compartments of the cell, where synthesis offatty acid carbon US 8,530,724 B2 3 4 chains is initiated with a C2 molecule and extended through a This increase was mainly at the expense of linoleic acid which stepwise condensation process whereby additional C2 carbon was reduced from normal levels of 60% downto as low as 4%. units are donated from malonyl-ACP to the elongating acyl Fatty Acids in Cereals chains. The first step in this sequence involves acetyl-CoA In contrast to the considerable work done on fatty acid condensing with malonyl-ACP and is catalysed by the B-ke biosynthesis and modification in oilseeds, oil modification in toacyl synthase III (KASIII) enzyme. The subsequent con cereals is relatively unexplored. This is probably due to the densation rounds are catalysed by B-ketoacyl synthase I much lower levels of oils (about 1.5-6% by weight) in cereal (KASI) and result in the eventual formation of a saturated grains and consequently the perceived lower importance of C16 acyl chain joined to acyl carrier protein (ACP), palmi oils from cereals in the human diet. toyl-ACP. The final elongation within the plastid is catalysed 10 Rice (Oryza sativa L.) is the most important cereal crop in by B-ketoacyl synthase II (KASII) to form the saturated C18 the developing world and is grown widely, particularly in acyl chain, stearoyl-ACP. When desaturation occurs, the first Asia which produces about 90% of the world total. The vast double bond is introduced into the A9 position of the C18 majority of rice in the world is eaten as “white rice' which is chain by a soluble enzyme in the plastid, stearoyl-ACPA9-de essentially the endosperm of the rice grain, having been pro 15 duced by milling of harvested grain to remove the outer bran saturase, to yield the monounsaturated C18:1 oleoyl-ACP. layer and germ (embryo and Scutellum). This is done prima Fatty acids thus synthesised are either retained in the plas rily because “brown rice' does not keep well on storage, tid for further modification and incorporation into plastidic particularly under hot tropical conditions. lipids, or are released from their ACPs by acyl-thioesterases The oil content of cereal grains such as rice (4%) is quite to produce free fatty acids which are exported into the cytosol low relative to oilseeds where oil can make up to 60% of the for further modification and eventual incorporation into TAG weight of the grain (Ohlrogge and Jaworski, 1997). However, molecules. Higher plants have been found to have at least two lipids may still comprise up to 37% of the dry weight of the types of acyl-thioesterase, Fat A with substrate specificity cereal embryo (Choudhury and Juliano 1980). Most of the towards oleoyl-ACP, an unsaturated acyl-ACP, and FatB with lipid content in the rice grain is found in the outer bran layer preference for saturated acyl-ACPs (Jones et al., 1995; 25 (Resurreccion et al., 1979) but some is also present in the Voelker et al., 1996). endosperm, at least some associated with the starch (Tables 1 On exiting the plastids, free fatty acids become esterified to and 2). The main fatty acids in rice oil are palmitic (16:0) Co-enzyme A (CoA) and are then available for transfer to (about 20% of total fatty acids in the TAG), oleic (18:1) (about glycerol 3-phosphate (G-3-P) backbones to form lysophos 40%), and linoleic acids (18:2) (about 34%) (Radcliffe et al., phatidic acid (LPA), phosphatidic acid (PA) and phosphati 30 1997). There is a range of levels naturally occurring in differ dyl-choline (PC). Additionally, in some plants, notably the ent rice cultivars, for example for oleic acid, from 37.9% to Brassica species, oleic acid esterified to CoA is able to be 47.5% and for linoleic (18:2), from 38.2% to 30.4% (Taira et elongated to form eicosenoic acid (C20:1) and erucic acid al., 1988). (C22:1). Oleic acid esterified to PC is available for further TABLE 1 modification before incorporation into TAG. In edible oils, 35 the principal modifications on PC are the sequential desatu Typical fatty acid composition (wt % of total fatty acids) rations of oleic acid to form linoleic and O-linolenic acids by for selected fatty acids of various plant oils. the microsomal A12-desaturase (Fad2) and A15-desaturase (Fad3) enzymes respectively. Plant 16:O 18:1 18:2 Modification of Existing Fatty Acid Biosynthetic Enzymes 40 Barley 18 22 S4 Gene inactivation approaches Such as post transcriptional Soybean 11 23 51 Peanut 8 50 36 gene silencing (PTGS) have been successfully applied to Canola 4 63 2O inactivate fatty acid biosynthetic genes and develop nutrition Olive 15 75 9 ally improved plant oils in oilseed crops. For example, Soy Rice bran 22 38 34 bean lines with 80% oleic acid in their seed oil were created 45 by coSuppression of the Fad2 encoded microsomal A12-de While the FatB gene has been shown to have a high affinity saturase (Kinney, 1996). This reduced the level of A12-de to catalysing the production of free palmitic acid which is saturation and resulted in accumulation of high amounts of Subsequently converted to palmitoyl-CoA in oilseed plants oleic acid. Using a similar approach, coSuppression-based and dicot plants, no information is reported on the role of FatB silencing of the Fad2 gene was used to raise oleic acid levels 50 in rice or other cereals. in Brassica napus and B. juncea (Stoutesdijk et al., 2000). Likewise, transgenic expression in cottonseed of a mutant allele of the Fad2 gene obtained from rapeseed was found to TABLE 2 be able to suppress the expression of the endogenous cotton Fatty acid composition (wt % of total fatty acids) for selected Fad2 gene and resulted in elevated oleic acid content in about 55 fatty acids of plant lipids associated with starch. half of the primary transgenic cotton lines (Chapman et al., 2001). In another variation, transgenic expression in Soybean Plant 16:O 18:1 18:2 of a Fad2 gene terminated by a self-cleaving ribozyme was Wheat 35-44 6-14 42-52 able to inactivate the endogenous Fad2 gene resulting in Barley 55 4 36 Rye 23 41 35 increased oleic acid levels (Buhr et al., 2002). RNAi-medi 60 Oat 40 22 35 ated gene silencing techniques have also been employed to Maize 37 11 46 develop oilseeds with nutritionally-improved fatty acid com Maize- High amylose 36 2O 38 position. In cottonseed, transgenic expression of a hairpin Maize-waxy 36 23 36 Millet 36 28 29 RNA (hpRNA) gene silencing construct targeted against Rice 37-48 9-18 29-46 ghFad2-1, a seed-specific member of cotton Fad2 gene fam 65 ily, resulted in the increase of oleic acid from normal levels of Data adapted from: Morrison (1988). 15%up to 77% of total fatty acids in the oil (Liu et al., 2002b). US 8,530,724 B2 5 6 Some of the fatty acid desaturases have been characterized There is still a need for cereal, such as rice, varieties that in rice but not Fad2. Akagaietal, (1995) published the nucle produce grain with an improved oil composition for health otide sequence of a gene on rice chromosome 4 encoding benefits, which at the same time is more stable on storage, Stearoyl-acyl carrier protein desaturase from developing allowing greater use of for example, brown rice in the human seeds. The gene product participates in the production of 5 diet. oleoyl ACP from stearoyl ACP. Kodama et al. (1997) reported the structure, chromosomal location and expression of Fad3 SUMMARY OF THE INVENTION in rice. The proportion of linolenic acid (18:3) in rice seed oil has In one aspect, the present invention provides rice oil having been increased ten-fold by using Soybean Fad3 expression 10 a fatty acid composition comprising greater than about 48% (Anai et al., 2003). More recently, there have been reports of oleic acid, less than about 17% palmitic acid, less than about the production of conjugated linoleic acid in rice by introduc 30% linoleic acid and/or any combination thereof. tion of a linoleate isomerase gene from bacteria (Kohno In an embodiment, the ratio of oleic acid to linoleic acid is Murase et al., 2006); conjugated linoleic acid is reported to greater than 1.5:1, preferably greater than 2:1, more prefer have anti-carcinogenic activity. In a similar vein, in vitro 15 modification of rice bran oil to incorporate capric acid, which ably greater than 3:1, and even more preferably greater than may improve dietary lipid utilisation in Some diseases, using 4:1. immobilized microbial enzymes has also been reported (Jen In another embodiment, the rice oil has a fatty acid com nings and Akoh, 2000). In maize, Fad2 and FA-6 desaturase position comprising greater than about 48% oleic acid, less genes have been sequenced and mapped to chromosomes than about 17% palmitic acid, and less than about 30% (Mikkilinen and Rocheford, 2003). The Fad2 and Fadé clones linoleic acid. could not be mapped to any QTLS for oleic/linoliec acid ratios In a further embodiment, the rice oil has a fatty acid com in the maize grain. There are no published reports of other position comprising greater than about 40% oleic acid, pref Fad2 or FatB genes characterized from rice, maize or wheat. erably greater than about 50% oleic acid, and even more Storage of Rice 25 preferably greater than about 60% oleic acid. In an embodi Storage of rice for prolonged times at high temperatures ment, the fatty acid composition of the rice oil is in the range impairs grain quality due to hydrolytic and oxidative deterio 48-80% oleic acid, 6-16% palmitic acid and 10-25% linoleic ration of bran oil. Dehulling the outer husk during harvest to acid. produce brown rice disturbs the outer bran layers, which In yet another embodiment, the rice oil has a fatty acid allows the oil to diffuse to the outer layers. Endogenous and 30 composition comprising less than about 16% palmitic acid, microbial lipases then catalyse the hydrolysis of triglycerides preferably less than about 15% palmitic acid, more preferably to free fatty acids (FFA) which are then oxidised to produce an less than about 14% palmitic acid, more preferably less than off-flavour (Yasumatsu et al., 1966, Tsuzuki et al., 2004, Zhou about 13% palmitic acid, and even more preferably less than et al., 2002 Champagne and Grimm, 1995). about 12% palmitic acid. Hexanal is the major component increased in the head 35 In another embodiment, the rice oil has a fatty acid com space of raw and cooked brown rice stored at high tempera position comprising less than about 25% linoleic acid, pref tures (Boggs et al., 1964, Shibuya et al., 1974, Tsugita et al., erably less than about 20% linoleic acid, even more prefer 1983). However, hexanal itself is not the main cause of the ably less than about 15% linoleic acid. off smell; the unattractive smell and flavour of deteriorated In another aspect the present invention provides rice bran rice is probably due to a mixture of the volatiles that are 40 having a fatty acid composition comprising greater than about increased after storage. These include alkanals, alkenals, aro 48% oleic acid, less than about 17% palmitic acid, less than matic aldehydes, ketones, 2-pentylfuran, 4-vinylphenol and about 30% linoleic acid and/or any combination thereof. others (Tsugita et al., 1983). Nevertheless, hexanal levels In an embodiment, the ratio of oleic acid to linoleic acid is during storage have been shown to be associated with the greater than 1.5:1, preferably greater than 2:1, more prefer oxidation of linoleic acid (18:2) in brown rice and therefore 45 ably greater than 3:1, and even more preferably greater than are a good indicator of oxidative deterioration (Shin et al., 4:1. 1986). In another embodiment, the rice bran has a fatty acid com The production of hexanal from linoleic acid can be cataly position comprising greater than about 48% oleic acid, less sed by the enzyme lipoxygenase (LOX) (St Angelo et al., than about 17% palmitic acid, and less than about 30% 1980). Suzuki et al. (1999) identified rice varieties lacking 50 linoleic acid. Lox3 and found that on storage of the mutant grain at 35°C. In a further embodiment, the rice bran has a fatty acid for 8 weeks, less hexanal was formed in the headspace composition comprising greater than about 40% oleic acid, vapour, both for raw and cooked brown rice grain. They also preferably greater than about 50% oleic acid, and even more found that mutant rice formed less pentanal and pentanol. preferably greater than about 60% oleic acid. In an embodi The nutrient-rich outer rice bran layer obtained through 55 ment, the fatty acid composition of the rice bran is in the range polishing the outer layers of the rice grain is an excellent food 48-80% oleic acid, 6-16% palmitic acid and 10-25% linoleic Source, containing antioxidant compounds such as tocot acid. rienols and gamma-oryZanol which is also a phytoestrogen In yet another embodiment, the rice bran has a fatty acid (Rukmini and Raghuram, 1991). The bioactive compounds composition comprising less than about 16% palmitic acid, present in rice bran oil have been found to lower cholesterol in 60 preferably less than about 15% palmitic acid, more preferably humans (Most et al., 2005). These bioactive components have less than about 14% palmitic acid, more preferably less than also been shown to improve lipid profiles in rats fed a high about 13% palmitic acid, and even more preferably less than cholesterol diet (Ha et al., 2005). Another important compo about 12% palmitic acid. nent found primarily in the bran is vitamin A precursors. In another embodiment, the rice bran has a fatty acid com However, these nutritional and health benefits are lost 65 position comprising less than about 25% linoleic acid, pref through the polishing of rice and the consumption of white erably less than about 20% linoleic acid, even more prefer 1C. ably less than about 15% linoleic acid. US 8,530,724 B2 7 8 In a further aspect, the present invention provides a rice any one or more of the sequence of nucleotides provided as seed having a fatty acid composition comprising greater than SEQID NOs 5 to 8, 11 to 14 or 19 to 25, wherein the portion about 48% oleic acid, less than about 17% palmitic acid, less of the molecule that is double stranded is at least 19 basepairs than about 30% linoleic acid and/or any combination thereof. in length and comprises said oligonucleotide. In an embodiment, the ratio of oleic acid to linoleic acid is Preferably, the dsRNA is expressed from a single promoter, greater than 1.5:1, preferably greater than 2:1, more prefer wherein the strands of the double stranded portion are linked ably greater than 3:1, and even more preferably greater than by a single stranded portion. Examples of the construction of 4:1. vectors to produce such dsRNA molecules is provided in In another embodiment, the rice seed has a fatty acid com Example 5. position comprising greater than about 48% oleic acid, less 10 than about 17% palmitic acid, and less than about 30% In a preferred embodiment, the polynucleotide, or a strand linoleic acid. thereof, is capable of hybridising to a polynucleotide com In a further embodiment, the rice seed has a fatty acid prising any one or more of the sequence of nucleotides pro composition (i.e. of the oil inside the seed) comprising greater vided as SEQ ID NOs 5 to 8, 11 to 14 or 19 to 25 under than about 40% oleic acid, preferably greater than about 50% 15 stringent conditions. oleic acid, and even more preferably greater than about 60% In a further aspect, the present invention provides a method oleic acid. In an embodiment, the fatty acid composition of of identifying a polynucleotide which, when present in a cell the rice seed is in the range 48-80% oleic acid, 6-16% palmitic of a rice plant, down-regulates the level of activity of a Fad2 acid and 10-25% linoleic acid. and/or FatB polypeptide in the cell when compared to a cell In yet another embodiment, the rice seed has a fatty acid that lacks said polynucleotide, the method comprising composition comprising less than about 16% palnitic acid, i) determining the ability of a candidate polynucleotide to preferably less than about 15% palmitic acid, more preferably down-regulate the level of activity of a Fad2 and/or FatB less than about 14% palmitic acid, more preferably less than polypeptide in a cell, and about 13% palmitic acid, and even more preferably less than ii) selecting a polynucleotide which down-regulated the about 12% palmitic acid. 25 level of activity of a Fad2 and/or FatB polypeptide in the cell. In another embodiment, the rice seed has a fatty acid com Step i) can rely on, for example, analysing the amount or position comprising less than about 25% linoleic acid, pref enzymatic activity of a Fad2 and/or FatB polypeptide, or the erably less than about 20% linoleic acid, even more prefer amount of mRNA encoding a Fad2 and/or FatB polypeptide ably less than about 15% linoleic acid. in the cell. Alternatively, step i) may comprise analysing the In any of the embodiments described above for rice bran or 30 fatty acid content of the cell, or a seed or plant comprising said rice seed, the fatty acid composition is typically determined cell. Preferably, step i) comprises the introduction of the by extraction of the oil and analysis by FAME/GC as candidate polynucleotide or a chimeric DNA including a described in Example 1. Compositions for individual fatty promoter operably linked to the candidate polynucleotide acids are expressed as percent (w/w) of the total fatty acids in into a plant cell, more preferably into a rice cell, and even the oil. 35 more preferably comprises the step of regenerating a trans In a further aspect, provided is a rice plant which produces genic plant from the plant cell and the production of seed from rice oil of the invention, rice bran of the invention, and/or a the transgenic plant. The candidate gene may be one of a rice seed of the invention. collection of candidate genes, at least 2 or 3 in number. The In another aspect, the present invention provides an iso invention therefore provides for the use of the polynucle lated polynucleotide which, when present in a cell of a rice 40 otides of the invention in a screening method. plant, down-regulates the level of activity of a Fad2 and/or The polynucleotide can be, but not limited to, an antisense FatB polypeptide in the cell when compared to a cell that polynucleotide, a sense polynucleotide, a catalytic polynucle lacks said polynucleotide. otide, a microRNA, a polynucleotide which encodes a Preferably, the polynucleotide is operably linked to a pro polypeptide which binds a Fad2 or FatB polypeptide and a moter capable of directing expression of the polynucleotide 45 double stranded RNA. in a cell of a rice plant. In an embodiment, the antisense polynucleotide hybridises In an embodiment, the polynucleotide down-regulates under physiological conditions to a polynucleotide compris mRNA levels expressed from at least one Fad2 and/or FatB ing any one or more of the sequence of nucleotides provided gene. as SEQID NOs 5 to 8, 11 to 14 or 19 to 25. Examples of suitable polynucleotides include, but are not 50 In another embodiment, the catalytic polynucleotide is limited to, a polynucleotide selected from: an antisense poly capable of cleaving a polynucleotide comprising any one or nucleotide, a sense polynucleotide, a catalytic polynucle more of the sequence of nucleotides provided as SEQ D NOS otide, a microRNA, a polynucleotide which encodes a 5 to 8, 11 to 14 or 19 to 25. polypeptide which binds a Fad2 or FatB polypeptide and a In a further embodiment, the double stranded RNA double stranded RNA. 55 (dsRNA) molecule comprises an oligonucleotide which com In an embodiment, the polynucleotide is an antisense poly prises at least 19 contiguous nucleotides of any one or more of nucleotide which hybridises under physiological conditions the sequence of nucleotides provided as SEQID NOs 5 to 8, to a polynucleotide comprising any one or more of the 11 to 14 or 19 to 25, wherein the portion of the molecule that sequence of nucleotides provided as SEQID NOs 5 to 8, 11 to is double stranded is at least 19 basepairs in length and com 14 or 19 to 25. 60 prises said oligonucleotide. In a further embodiment, the polynucleotide is a catalytic Also provided is an isolated polynucleotide identified polynucleotide capable of cleaving a polynucleotide com using a method of the invention. prising any one or more of the sequence of nucleotides pro In a further aspect the present invention provides a vector vided as SEQID NOs 5 to 8, 11 to 14 or 19 to 25. comprising or encoding a polynucleotide of the invention. In another embodiment, the polynucleotide is a double 65 Preferably, the polynucleotide, or sequence encoding the stranded RNA (dsRNA) molecule comprising an oligonucle polynucleotide, is operably linked to a promoter. Preferably, otide which comprises at least 19 contiguous nucleotides of the promoter confers expression of the polynucleotide pref US 8,530,724 B2 10 erentially in the embryo, endosperm, bran layer and/or seed In a further embodiment, step i) comprises analysing the of a rice plant relative to at least one other tissue or organ of fatty acid composition of the oil, bran and/or seed of the said plant. mutagenized seed and/or plant. Also provided is a cell comprising the vector of the inven In a further aspect, the present invention provides a method tion, and/or the polynucleotide of the invention. of selecting a rice plant which can be used to produce rice oil In an embodiment, the polynucleotide or vector was intro of the invention, rice bran of the invention and/or rice seed of duced into the cell or a progenitor of the cell. the invention, the method comprising In a further embodiment, the cell is a rice cell or an Agro i) analysing the fatty acid content of said rice oil, rice bran bacterium cell. and/or seed obtained from a candidate rice plant, and Preferably, the polynucleotide is integrated into the 10 genome of the cell. ii) selecting a rice plant which can be used to produce rice In another aspect, the present invention provides a rice oil of the invention, rice bran of the invention and/or rice seed plant comprising a cell of the invention. of the invention. In yet another aspect, the present invention provides a In yet a further aspect, the present invention provides a method of producing the cell of the invention, the method 15 method of selecting a rice plant which can be used to produce comprising the step of introducing the polynucleotide of the rice oil of the invention, rice bran of the invention and/or rice invention, or a vector of the invention, into a cell. seed of the invention, the method comprising Preferably the method further comprises the step of regen i) analysing a sample from a candidate plant for a polypep erating a transgenic plant from the cell. tide which has Fad2 or FatB activity, and Also provided is the use of the polynucleotide of the inven ii) selecting a rice plant which can be used to produce rice tion or a vector of the invention to produce a recombinant cell. oil of the invention, rice bran of the invention and/or rice seed In yet another aspect, the present invention provides a of the invention based on the sequence, level of production genetically modified rice plant, wherein the plant has and/or activity of said polypeptide. decreased expression of a polypeptide having Fad2 and/or In another aspect, the present invention provides a method FatB activity relative to a corresponding non-modified plant. 25 of selecting a rice plant which can be used to produce rice oil Preferably, the plant has been transformed such that it of the invention, rice bran of the invention and/or rice seed of comprises a polynucleotide of the invention, or a progeny the invention, the method comprising plant thereof which comprises said polynucleotide. i) analysing the sequence and/or expression levels of a In a further aspect the present invention provides a method Fad2 or FatB gene of a candidate plant, and of producing rice oil of the invention, rice bran of the inven 30 ii) selecting a rice plant which can be used to produce rice tion and/or rice seed of the invention, the method comprising exposing a rice plant to an antagonist of a Fad2 or FatB oil of the invention rice bran of the invention and/or rice seed polypeptide. of the invention based on the sequence and/or expression In another aspect, the present invention provides a method levels of said gene. of obtaining a genetically modified rice plant which can be 35 In yet another aspect the present invention provides a used to produce brown rice seed with an increased storage life method of identifying a rice plant which can be used to when compared to unmodified brown rice seed, the method produce rice oil of the invention, rice bran of the invention comprising genetically manipulating the plant Such that the and/or rice seed of the invention, the method comprising activity and/or level of production of a Fad2 and/or FatB detecting a nucleic acid molecule of the plant, wherein the polypeptide is reduced in the rice seed when compared to a 40 nucleic acid molecule is linked to, and/or comprises at least a corresponding plant which produces unmodified brown rice part of a Fad2 gene and/or FatB gene in the plant seed. In a further aspect, the present invention provides a method Preferably, the activity and/or level of production of a Fad2 of identifying a rice plant which can be used to produce brown and/or FatB polypeptide is only reduced in the seed of the rice seed with an increased storage life, the method compris plant. 45 ing detecting a nucleic acid molecule of the plant, wherein the In an embodiment, the activity and/or level of production nucleic acid molecule is linked to, and/or comprises at least a of a Fad2 polypeptide is reduced. part of a Fad2 gene and/or FatB gene in the plant. In a further embodiment, the transgenic plant comprises a In an embodiment, the above two methods comprise: polynucleotide of the invention or a vector of the invention. i) hybridising a second nucleic acid molecule to said In a further aspect, the present invention provides a geneti 50 nucleic acid molecule which is obtained from said plant, cally modified rice plant produced using a method of the ii) optionally hybridising at least one other nucleic acid invention, or progeny thereof. molecule to said nucleic acid molecule which is obtained In a further aspect, the present invention provides a method from said plant; and of selecting a rice plant which can be used to produce rice oil iii) detecting a product of said hybridising step(s) or the of the invention, rice bran according to the invention and/or 55 rice seed of the invention, the method comprising: absence of a product from said hybridising step(s). i) screening a mutagenized population of rice seeds or rice In an embodiment, the second nucleic acid molecule is plants, and used as a primer to reverse transcribe or replicate at least a ii) selecting a seed or plant which is capable of producing portion of the nucleic acid molecule. rice oil of the invention, rice bran of the invention and/or rice 60 The nucleic acid can be detected using any technique Such seed of the invention. as, but not limited to, restriction fragment length polymor In one embodiment, step i) comprises analysing a phism analysis, amplification fragment length polymorphism mutagenized seed and/or plant for a polypeptide which has analysis, microsatellite amplification and/or nucleic acid Fad2 or FatB activity. sequencing. In another embodiment, step i) comprises analysing the 65 In an embodiment, the method comprises nucleic acid sequence and/or expression levels of a Fad2 or FatB gene of amplification. In another embodiment, the method analyses the mutagenized seed and/or plant. expression levels of the gene. US 8,530,724 B2 11 12 Also provided is a method of obtaining a rice plant or seed, In another aspect, the present invention provides a method the method comprising: of preparing food, the method comprising cooking an edible i) crossing a first parental rice plant which comprises a substance in rice oil of the invention. Fad2 allele which confers an increased proportion of oleic As will be apparent, preferred features and characteristics acid in oil of the grain of the plant with a second parental rice of one aspect of the invention are applicable to many other plant which comprises a FatB allele which confers a aspects of the invention. decreased proportion of palmitic acid in oil of the grain of the Throughout this specification the word “comprise', or plant; variations such as "comprises' or “comprising, will be ii) Screening progeny plants or grain from the cross for the understood to imply the inclusion of a stated element, integer presence of both alleles; and 10 iv) selecting a progeny plant or grain comprising both or step, or group of elements, integers or steps, but not the alleles and having an increased proportion of oleic acid and a exclusion of any other element, integer or step, or group of decreased proportion of palmitic acid in oil of the grain of the elements, integers or steps. plant. The invention is hereinafter described by way of the fol In another aspect, the present invention provides a method 15 lowing non-limiting Examples and with reference to the of introducing a Fad2 allele into a rice plant, the method accompanying figures. comprising i) crossing a first parental rice plant with a second parental BRIEF DESCRIPTION OF THE rice plant, wherein the second plant comprises said allele, and ACCOMPANYING DRAWINGS ii) backcrossing the progeny of the cross of step i) with plants of the same genotype as the first parent plant for a FIG.1—Principal fatty acid biosynthetic pathways in plas Sufficient number of times to produce a plant with a majority tid and cytosol of higher plants. of the genotype of the first parent but comprising said allele FIG. 2 Alignment of rice FatB proteins. iii)Selecting a plant with the majority of the genotype of the ProteinFATB2=SEQ ID NO:1, proteinFATB3=SEQ ID first plant and comprising said allele; 25 NO:2, proteinFATB1=SEQ ID NO:3 and wherein said allele confers an increased proportion of oleic proteinFATB4=SEQ ID NO:4. acid in oil, bran and/or seed of the plant. FIG. 3 Rice FatB gene structures. LOC Os02.g4=SEQ In yet another aspect, the present invention provides a ID NO:5, LOC Os11.g4=SEQID NO:6, LOC Os06g.0=SEQ method of introducing a FatB allele into a rice plant, the ID NO:7 and LOC Os06g3=SEQID NO:8. method comprising 30 FIG.4—Alignment of FatB gene sequences by ClustalW. i) crossing a first parental rice plant with a second parental Default parameters were used and note that the genes are of rice plant, wherein the second plant comprises said allele, and different lengths. ii) backcrossing the progeny of the cross of step i) with FIG.5 The exon-intron structures of the FatB gene cor plants of the same genotype as the first parent plant for a responding to LOC OS6g05.130. The top line corresponds to Sufficient number of times to produce a plant with a majority 35 of the genotype of the first parent but comprising said allele the start of the coding sequence in mRNA (SEQID NO:9) and iii)Selecting a plant with the majority of the genotype of the the second line of the pair corresponds to the gene (SEQ ID first plant and comprising said allele; NO:10). wherein said allele confers a decreased proportion of palmitic FIG. 6—Alignment of coding sequence of four FatB iso acid in oil, bran and/or seed of the plant. 40 forms showing consecutive exons in alternating lower case Further, provided is a method of increasing the proportion and upper case respectively and location of primers (under of oleic acid in oil, branand/or seed of a rice plant, the method lined) used to distinguish the isoforms by RT-PCR. The ini comprising genetically manipulating said plant such that the tiating codon (start position 1) is in bold. AC108870=SEQID production of a Fad2 polypeptide is decreased when com NO:11, AP005291=SEQ ID NO:12, AP000399–SEQ ID pared to a wild-type plant, wherein the polypeptide has A12 45 NO:13 and AP004236=SEQID NO:14. desaturase activity. FIG. 7 Clustal W alignment of deduced polypeptide In yet another aspect, the present invention provides a sequence of Fad2 isoforms. Note that line F 1 corresponds to method of decreasing the proportion of palmitic acid in oil, Os02.g48560, F 2 corresponds to Os07g23410, F 3 to bran and/or seed of a rice plant, the method comprising Os07g23430 and O 4 to Os07g23390. The program Clust genetically manipulating said plant such that the production 50 alW (Fast) with default parameters was used. ProteinF of a FatB polypeptide is decreased when compared to a wild 1=SEQ ID NO:15, ProteinF 3=SEQID NO:16, ProteinF type plant, wherein the polypeptide has (FatB) activity. 2=SEQID NO:17 and ProteinF 4=SEQID NO:18. Also provided is a rice plant obtained using a method of the FIG. 8 Alignment of Fad2 sequences showing location of invention, or progeny plant thereof. 5' UTR in isoform AP004.047 (lowercase) and location of In a further aspect, the present invention provides rice oil 55 primers used for amplification by RT-PCR (underlined). The obtained from a plant of the invention. location of the stop codon is indicated by a box and untrans In a further aspect, the present invention provides rice bran lated regions downstream of the stop codon are in lower case. obtained from a plant of the invention. AP005168=SEQID NO:19, AP004.047=SEQID NO:20 and In a further aspect, the present invention provides rice seed Contig2654=SEQID NO:21. obtained from a plant of the invention. 60 FIG.9—Rice Fad2 gene structures. Further, provided is a method of producing seed, the FIG. 10 Alignment of the nucleotide sequences of the method comprising: protein coding regions for rice Fad2 genes. Line 0 2 corre a) growing a plant of the invention, and sponds to Os07g23410, O 4 to Os07g23390, O 1 to b) harvesting the seed. Os02.g48560 and 0 3 to Os07g23410. The program Clust In yet another aspect, the present invention provides a food 65 alW with default parameters was used. CdsFAD2O 2=SEQ product comprising rice oil of the invention, rice bran of the ID NO:22, CdsFAD2O 4=SEQ ID NO:23, CdsFAD2O invention and/or rice seed of the invention. 1=SEQ ID NO:24 and CdsFAD2O 3=SEQID NO:25. US 8,530,724 B2 13 14 FIG. 11—Graphical representation of the relative percent SEQID NO:22—Open reading frame encoding rice Fad2 ages of palmitic, oleic and linoleic acid as determined by GC 2. analysis of total oil fraction from grains of indicated geno SEQID NO:23 Open reading frame encoding rice Fad2 types. 4. FIG. 12 Graphical representation of the relative percent SEQID NO:24 Open reading frame encoding rice Fad2 ages of palmitic and oleic acid in a GC total lipid analysis 1. from grains of the genotypes indicated. SEQID NO:25 Open reading frame encoding rice Fad2 FIG. 13 Graphical representation of the relative percent 3. ages of linoleic and oleic acid in a GC total lipid analysis from SEQID NO:26—FatB consensus sequence. grains of the genotypes indicated. 10 SEQID NOS 27 to 33—Fad2 consensus sequences. FIG. 14 Scatterplot showing the percentage of linoleic SEQ ID NOS 34 to 55 and 60 to 63 Oligonucleotide Versus oleic acid in the grain of rice plants of the indicated primers. genotypes. Note that the relationship (reflected in the slope of SEQ ID NOS 56 to 59 Antigenic rice FatB peptides. the line) between the amounts of these two fatty acids is SEQ ID NOS 64 to 83—Sequence of one strand of mol essentially the same in all of the lines analysed but the pool 15 ecules that can be used for RNAi. size capacity appears to be different (as reflected in the dis placements of the different lines along the space analysed. DETAILED DESCRIPTION OF THE INVENTION FIG. 15 Scatterplot of the percentage of linoleic versus palmitic acid among different genotypes. Note the different General Techniques slopes of the lines affected in FatB compared to those affected Unless specifically defined otherwise, all technical and in Fad2. This suggests the relationship between these com scientific terms used herein shall be taken to have the same ponents is different in the different genotypes, probably meaning as commonly understood by one of ordinary skill in reflecting the differences in the steps affected. the art (e.g., in cell culture, plant molecular biology, molecu FIG. 16—Scatterplot of the percentage of oleic versus lar genetics, immunology, immunohistochemistry, protein palmitic acid for various genotypes. Note the differences in 25 chemistry, and biochemistry). slopes. Unless otherwise indicated, the recombinant protein, cell FIG. 17 Graphical representation of Principal Compo culture, and immunological techniques utilized in the present nent Analysis of variation in oil composition for Fad2 RNAi invention are standard procedures, well known to those plants and FatB RNAi plants. The results show that Principal skilled in the art. Such techniques are described and explained Component 2 is Linoleic versus Oleic and Principal Compo 30 throughout the literature in sources such as, J. Perbal, A nent 2 is Palmitic versus Linoleic plus Oleic. Practical Guide to Molecular Cloning, John Wiley and Sons FIG. 18 Western blot showing the reaction of antisera (1984), J. Sambrook et al., Molecular Cloning: A Laboratory raised against peptide. FatB-99 against total leaf protein Manual, Cold Spring Harbour Laboratory Press (1989), T. A. extracts analysed by SDS-PAGE. A peptide of approx 20 kDa Brown (editor), Essential Molecular Biology: A Practical is missing in the Tos-17 line. The reaction with preimmune 35 Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover sera is indicated. R refers to FatB RNAi lines and T is the and B. D. Hames (editors), DNA Cloning: A Practical Tos-17 line. W1 and W2 are wildtype. Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular KEY TO SEQUENCE LISTING Biology, Greene Pub. Associates and Wiley-Interscience 40 (1988, including all updates until present), Ed Harlow and SEQ ID NO:1-Rice FatB2 protein. David Lane (editors) Antibodies: A Laboratory Manual, Cold SEQ ID NO:2 Rice FatB3 protein. Spring Harbour Laboratory, (1988), and J. E. Coligan et al. SEQ ID NO:3—Rice FatB1 protein. (editors) Current Protocols in Immunology, John Wiley & SEQ ID NO.4 Rice FatB4 protein. Sons (including all updates until present). SEQ ID NO:5 Rice FatB3 gene. 45 SEQ ID NO:6 Rice FatB2 gene. SELECTED DEFINITIONS SEQ ID NO:7 Rice FatB1 gene. SEQ ID NO:8 Rice FatB4 gene. As used herein, the term “Fad2 polypeptide' refers to a SEQ ID NO:9–cDNA encoding rice FatB1 protein. protein which performs a desaturase reaction converting oleic SEQID NO:10 Gene encoding rice FatB1 protein partial 50 acid to linoleic acid. Thus, the term “Fad2 activity” refers to sequence only, see FIG. 5 includes all exon sequences and the conversion of oleic acid to linoleic acid. These fatty acids Some flanking and intron sequence). may be in an esterified form, such as, for example, as part of SEQID NO:11—Open reading frame encoding rice FatB2 a phospholipid. Examples of rice Fad2 polypeptides include protein. proteins comprising an amino acid sequence provided in FIG. SEQID NO:12 Open reading frame encoding rice FatB3 55 7 and SEQID NOS 15 to 18, as well as variants and/or mutants protein. thereof. Such variants and/or mutants may be at least 80% SEQID NO:13 Open reading frame encoding rice FatB1 identical, more preferably at least 90% identical, more pref protein. erably at least 95% identical, and even more preferably at SEQID NO:14 Open reading frame encoding rice FatB4 least 99% identical to any one of the polypeptides provided in protein. 60 FIG. 7 and SEQID NOs 15 to 18. SEQ ID NO:15 Rice Fad2 isoform 1. A “Fad2 polynucleotide' or “Fad2 gene' encodes a Fad2 SEQ ID NO:16 Rice Fad2 isoform 3. polypeptide. Examples of Fad2 polynucleotides include SEQ ID NO:17 Rice Fad2 isoform 2. nucleic acids comprising a nucleotide sequence provided in SEQ ID NO:18 Rice Fad2 isoform 4. FIG. 8 or 10 and SEQ ID NOS 19 to 25, as well as allelic SEQID NO:19 Rice Fad2-3 cDNA. 65 variants and/or mutants thereof. Examples of Fad2 genes SEQID NO:20 Rice Fad2-1 cDNA. include nucleic acids comprising a nucleotide sequence pro SEQID NO:21 Rice Fad2-2 cDNA. vided in FIG. 8 and SEQID NOs 19 to 21, as well as allelic US 8,530,724 B2 15 16 variants and/or mutants thereof. Such allelic variants and/or palmitic acid to oleic acid and/or palmitic acid to linoleic acid mutants may be at least 80% identical, more preferably at has not been significantly altered (for example, no greater least 90% identical, more preferably at least 95% identical, than a 5% alteration) when compared to the ratio in the intact and even more preferably at least 99% identical to any one of seed/grain or bran. In a further embodiment, the rice oil has the polynucleotides provided in FIGS. 8 and/or 10, and/or 5 not been exposed to a procedure. Such as hydrogenation, SEQID NOs 19 to 25. which may alter the ratio of oleic acid to linoleic acid, palm As used herein, the term “FatB polypeptide' refers to a itic acid to oleic acid and/or palmitic acid to linoleic acid protein which hydrolyses palmitoyl-ACP to produce free when compared to the ratio in the intact seed/grain or bran. palmitic acid. Thus, the term “FatB activity” refers to the Rice oil of the invention may further comprise non-fatty acid hydrolysis of palmitoyl-ACP to produce free palmitic acid. 10 Examples of rice FatB polypeptides include proteins com molecules Such as, but not limited to, Y-oryZanols and sterols. prising an amino acid sequence provided FIG. 2 SEQID NOS Rice oil may be extracted from rice seed or bran by any 1 to 4, as well as variants and/or mutants thereof. Such vari method known in the art. This typically involves extraction ants and/or mutants may be at least 80% identical, more with nonpolar solvents such as diethyl ether, petroleum ether, preferably at least 90% identical, more preferably at least 15 chloroform/methanol or butanol mixtures. Lipids associated 95% identical, and even more preferably at least 99% identi with the starch in the grain may be extracted with water cal to any one of the polypeptides provided in FIG.2 and SEQ saturated butanol. The rice oil may be "de-gummed by meth ID NOS 1 to 4. ods known in the art to remove polysaccharides or treated in A “FatB polynucleotide' or “FatB gene' encodes a FatB other ways to remove contaminants or improve purity, Stabil polypeptide. Examples of FatB polynucleotides include ity or colour. The triacylglycerols and other esters in the oil nucleic acids comprising a nucleotide sequence provided in may be hydrolysed to release free fatty acids, or the oilhydro FIGS. 4 and 6 and SEQID NOs 5 to 8 and 11 to 14, as well as genated or treated chemically or enzymatically as known in allelic variants and/or mutants thereof. Examples of FatB the art. genes include nucleic acids comprising a nucleotide sequence Rice oil after extraction from rice seed or bran typically provided in FIG. 4 and SEQID NOs 5 to 8, as well as allelic 25 comprises the group of lipids called Y-oryZanols. As used variants and/or mutants thereof. Such allelic variants and/or herein, "comprises Y-oryzanol refers to the presence of at mutants may be at least 80% identical, more preferably at least 0.1% (w/w) Y-oryzanol compounds in the oil. The levels least 90% identical, more preferably at least 95% identical, of Y-oryZanol in rice oil after extraction and before removal and even more preferably at least 99% identical to any one of from the TAG is typically 1.5-3.5% (w/w). The compounds the polynucleotides provided in FIGS. 4 and/or 6, and/or SEQ 30 ID NOS 5 to 8 and 11 to 14. are typically a mixture of steryl and other triterpenyl esters of As used herein, the term “rice' refers to any species of the ferulic acid (4-hydroxy-3-methoxy cinnamic acid). Genus Oryza, including progenitors thereof, as well as prog Cycloartenyl ferulate, 24-methylene cycloartanyl ferulate eny thereof produced by crosses with other species. It is and campesteryl ferulate are the predominant ferulates in preferred that the plant is of a Oryza species which is com 35 oryzanol, with lower levels of B-sitosteryl ferulate and stig mercially cultivated Such as, for example, a strain or cultivar masteryl ferulate. The presence of Y-oryZanols is thought to or variety of Oryza sativa or suitable for commercial produc help protect consumers of rice oil against chronic diseases tion of grain. Such as heart disease and cancer and therefore the presence of As used herein, the term “rice oil” refers to a composition Y-ory Zanol is advantageous. obtained from the seed/grain, or a portion thereof Such as the 40 As used herein, the term “rice bran” refers to the layer bran layer, of a rice plant which comprises at least 60% (w/w) (aleurone layer) between the inner white rice grain and the lipid. Rice oil is typically a liquid at room temperature. Pref outer hull of a rice seed/grain as well as the embryo/scutellum erably, the lipid comprises fatty acids that are at least 6 car of the grain. The rice bran is the primary by product of the bons in length. The fatty acids are typically in an esterified polishing of brown rice to produce white rice. form, such as for example as triacylglycerols, phospholipid. 45 As used herein, the term “increased storage life” refers to a Rice oil of the invention comprises oleic acid. Rice oil of the method of the invention producing a seed/grain, which upon invention may also comprise at least Some other fatty acids harvesting, can be stored as brown rice for an enhanced period Such as palmitic acid, linoleic acid, myristic acid, Stearic acid of time when compared to, for example, brown rice harvested and/or linolenic acid. The fatty acids may be free fatty acids from a wild type (non-genetically modified) rice plant AS and/or be found as triacylglycerols (TAGs). In an embodi 50 described herein, one measure for “increased storage life of ment, at least 50%, more preferably at least 70%, more pref brown rice is hexanal production following storage for at least erably at least 80% of the fatty acids in rice oil of the invention 8 weeks at 40°C. (see Example 8). be found as TAGs. Rice oil of the invention can form part of The term “plant' includes whole plants, vegetative struc the rice grain/seed or portion thereof Such as the aleurone tures (for example, leaves, stems), roots, floral organs/struc layer or embryo/scutellinum, which together are referred to as 55 tures, seed (including embryo, endosperm, and seed coat), “rice bran”. Alternatively, rice oil of the invention has been plant tissue (for example, vascular tissue, ground tissue, and extracted from rice grain/seed or rice bran. An example of the like), cells and progeny of the same. Such an extraction procedure is provided in Example 1. Thus, A “transgenic plant”, “genetically modified plant’ or varia in an embodiment, “rice oil of the invention is “substantially tions thereof refers to a plant that contains a gene construct purified’ or “purified’ rice oil that has been separated from 60 (“transgene') not found in a wild-type plant of the same one or more other lipids, nucleic acids, polypeptides, or other species, variety or cultivar. A “transgene' as referred to herein contaminating molecules with which it is associated in its has the normal meaning in the art of biotechnology and native state. It is preferred that the substantially purified rice includes a genetic sequence which has been produced or oil is at least 60% free, more preferably at least 75% free, and altered by recombinant DNA or RNA technology and which more preferably at least 90% free from other components 65 has been introduced into the plant cell. The transgene may with which it is naturally associated. In a preferred embodi include genetic sequences derived from a plant cell. Typi ment, upon extraction the ratio of oleic acid to linoleic acid, cally, the transgene has been introduced into the plant by US 8,530,724 B2 17 18 human manipulation Such as, for example, by transformation transcriptional regulatory elements, such as enhancers, need but any method can be used as one of skill in the art recog not be physically contiguous or located in close proximity to nizes. the coding sequences whose transcription they enhance. The terms “seed' and “grain” are used interchangeably As used herein, the term “gene' is to be taken in its broadest herein. “Grain generally refers to mature, harvested grain context and includes the deoxyribonucleotide sequences but can also refer to grain after imbibition or germination, comprising the protein coding region of a structural gene and according to the context. Mature grain commonly has a mois including sequences located adjacent to the coding region on ture content of less than about 18-20%. both the 5' and 3' ends for a distance of at least about 2kb on As used herein, the term “corresponding non-modified either end and which are involved in expression of the gene. plant” refers to a wild-type plant. “Wild type', as used herein, 10 The sequences which are located 5' of the coding region and refers to a cell, tissue or plant that has not been modified which are present on the mRNA are referred to as 5' non according to the invention. Wild-type cells, tissue or plants translated sequences. The sequences which are located 3' or may be used as controls to compare levels of expression of an downstream of the coding region and which are present on the exogenous nucleic acid or the extent and nature of trait modi mRNA are referred to as 3' non-translated sequences. The fication with cells, tissue or plants modified as described 15 term “gene' encompasses both cDNA and genomic forms of herein. Wild-type rice varieties that are suitable as a reference a gene. A genomic form or clone of agene contains the coding standard include Nipponbare. region which may be interrupted with non-coding sequences “Nucleic acid molecule' refers to a oligonucleotide, poly termed “introns' or “intervening regions” or “intervening nucleotide or any fragment thereof. It may be DNA or RNA of sequences.” Introns are segments of a gene which are tran genomic or synthetic origin, double-stranded or single scribed into nuclear RNA (hnRNA); introns may contain Stranded, and combined with carbohydrate, lipids, protein, or regulatory elements such as enhancers. Introns are removed other materials to perform a particular activity defined herein. or “spliced out from the nuclear or primary transcript: The terms “nucleic acid molecule' and “polynucleotide' are introns therefore are absent in the messenger RNA (mRNA) used herein interchangeably. transcript. The mRNA functions during translation to specify The % identity of a polynucleotide is determined by GAP 25 the sequence or order of amino acids in a nascent polypeptide. (Needleman and Wunsch, 1970) analysis (GCG program) The term “gene' includes a synthetic or fusion molecule with a gap creation penalty 5, and a gap extension pen encoding all or part of the proteins of the invention described alty=0.3. Unless stated otherwise, the query sequence is at herein and a complementary nucleotide sequence to any one least 45 nucleotides in length, and the GAP analysis aligns the of the above. two sequences over a region of at least 45 nucleotides. Pref 30 As used herein, the term “genetically linked' or similar erably, the query sequence is at least 150 nucleotides in refers to a marker locus and a second locus being Sufficiently length, and the GAP analysis aligns the two sequences over a close on a chromosome that they will be inherited together in region of at least 150 nucleotides. More preferably, the query more than 50% of meioses, e.g., not randomly. This definition sequence is at least 300 nucleotides in length and the GAP includes the situation where the marker locus and second analysis aligns the two sequences over a region of at least 300 35 locus form part of the same gene. Furthermore, this definition nucleotides. Even more preferably, the GAP analysis aligns includes the embodiment where the marker locus comprises a the two sequences over their entire length. polymorphism that is responsible for the trait of interest (in “Oligonucleotides’ can be RNA, DNA, or derivatives of other words the marker locus is directly “linked' or “perfectly either. Although the terms polynucleotide and oligonucle linked to the phenotype). In another embodiment, the otide have overlapping meaning, oligonucleotide are typi 40 marker locus and a second locus are different, yet Sufficiently cally relatively short single stranded molecules. The mini close on a chromosome that they will be inherited together in mum size of such oligonucleotides is the size required for the more than 50% of meioses. The percent of recombination formation of a stable hybrid between an oligonucleotide and observed between genetically linked lociper generation (cen a complementary sequence on a target nucleic acid molecule. timorgans (cM)), will be less than 50. In particular embodi Preferably, the oligonucleotides are at least 15 nucleotides, 45 ments of the invention, genetically linked loci may be 45, 35, more preferably at least 18 nucleotides, more preferably at 25, 15, 10, 5, 4, 3, 2, or 1 or less cMapart on a chromosome. least 19 nucleotides, more preferably at least 20 nucleotides, Preferably, the markers are less than 5 cM apart and most even more preferably at least 25 nucleotides in length. preferably about OcM apart. As used herein, the term “nucleic acid amplification” refers An “allele refers to one specific form of a genetic to any in vitro method for increasing the number of copies of 50 sequence (Such as a gene) within a cell, an individual plant or a nucleic acid molecule with the use of a DNA polymerase. within a population, the specific form differing from other Nucleic acid amplification results in the incorporation of forms of the same gene in the sequence of at least one, and nucleotides into a DNA molecule or primer thereby forming frequently more than one, variant sites within the sequence of a new DNA molecule complementary to a DNA template. the gene. The sequences at these variant sites that differ The newly formed DNA molecule can be used a template to 55 between different alleles are termed “variances”, “polymor synthesize additional DNA molecules. phisms”, or “mutations”. “Operably linked as used herein refers to a functional A "polymorphism' as used herein denotes a variation in the relationship between two or more nucleic acid (e.g., DNA) nucleotide sequence between alleles of the loci of the inven segments. Typically, it refers to the functional relationship of tion, of different species, cultivars, strains or individuals of a transcriptional regulatory element (promoter) to a transcribed 60 plant. A "polymorphic position' is a preselected nucleotide sequence. For example, a promoter is operably linked to a position within the sequence of the gene. In some cases, coding sequence. Such as a polynucleotide defined herein, if it genetic polymorphisms are reflected by an amino acid stimulates or modulates the transcription of the coding sequence variation, and thus a polymorphic position can sequence in an appropriate cell. Generally, promoter tran result in location of a polymorphism in the amino acid Scriptional regulatory elements that are operably linked to a 65 sequence at a predetermined position in the sequence of a transcribed sequence are physically contiguous to the tran polypeptide. In other instances, the polymorphic region may scribed sequence, i.e., they are cis-acting. However, some be in a non-polypeptide encoding region of the gene, for US 8,530,724 B2 19 20 example in the promoter region Such may influence expres the generally greater divergence of the UTRS, targeting these sion levels of the gene. Typical polymorphisms are deletions, regions provides greater specificity of gene inhibition. insertions or Substitutions. These can involve a single nucle The length of the antisense sequence should be at least 19 otide (single nucleotide polymorphism or SNP) or two or contiguous nucleotides, preferably at least 50 nucleotides, more nucleotides. 5 and more preferably at least 100, 200, 500 or 1000 nucle The terms “polypeptide' and “protein’ are generally used otides. The full-length sequence complementary to the entire interchangeably and refer to a single polypeptide chain which gene transcript may be used. The length is most preferably may or may not be modified by addition of non-amino acid 100-2000 nucleotides. The degree of identity of the antisense groups. It would be understood that such polypeptide chains sequence to the targeted transcript should be at least 90% and 10 more preferably 95-100%. The antisense RNA molecule may may associate with other polypeptides or proteins or other of course comprise unrelated sequences which may function molecules such as co-factors. The terms “proteins” and to stabilize the molecule. "polypeptides' as used herein also include variants, mutants, Catalytic Polynucleotides modifications, analogous and/or derivatives of the polypep The term catalytic polynucleotide/nucleic acid refers to a tides of the invention as described herein. 15 DNA molecule or DNA-containing molecule (also known in The % identity of a polypeptide is determined by GAP the art as a “deoxyribozyme’) or an RNA or RNA-containing (Needleman and Wunsch, 1970) analysis (GCG program) molecule (also known as a “ribozyme’) which specifically with a gap creation penalty 5, and a gap extension pen recognizes a distinct Substrate and catalyzes the chemical alty 0.3. The query sequence is at least 25 amino acids in modification of this substrate. The nucleic acid bases in the length, and the GAP analysis aligns the two sequences over a catalytic nucleic acid can be bases A, C, G, T (and U for region of at least 25 amino acids. More preferably, the query RNA). sequence is at least 50 amino acids in length, and the GAP Typically, the catalytic nucleic acid contains an antisense analysis aligns the two sequences over a region of at least 50 sequence for specific recognition of a target nucleic acid, and amino acids. More preferably, the query sequence is at least a nucleic acid cleaving enzymatic activity (also referred to 100 amino acids in length and the GAP analysis aligns the two 25 hereinas the “catalytic domain'). The types of ribozymes that sequences over a region of at least 100 amino acids. Even are particularly useful in this invention are the hammerhead more preferably, the query sequence is at least 250 amino ribozyme (Haseloff and Gerlach, 1988: Perriman et al., 1992) acids in length and the GAP analysis aligns the two sequences and the hairpin ribozyme (Shippy et al., 1999). over a region of at least 250 amino acids. Even more prefer The ribozymes of this invention and DNA encoding the ably, the GAP analysis aligns the two sequences over their 30 ribozymes can be chemically synthesized using methods well entire length. known in the art. The ribozymes can also be prepared from a Antisense Polynucleotides DNA molecule (that upon transcription, yields an RNA mol The term “antisense polynucleotide' shall be taken to ecule) operably linked to an RNA polymerase promoter, e.g., mean a DNA or RNA, or combination thereof, molecule that the promoter for T7 RNA polymerase or SP6 RNA poly is complementary to at least a portion of a specific mRNA 35 merase. Accordingly, also provided by this invention is a molecule encoding a FatB or Fad2 polypeptide and capable of nucleic acid molecule, i.e., DNA or cDNA, coding for a interfering with a post-transcriptional event Such as mRNA catalytic polynucleotide of the invention. When the vector translation. The use of antisense methods is well known in the also contains an RNA polymerase promoter operably linked art (see for example, G. Hartmann and S. Endres, Manual of to the DNA molecule, the ribozyme can be produced in vitro Antisense Methodology, Kluwer (1999)). The use of anti 40 upon incubation with RNA polymerase and nucleotides. In a sense techniques in plants has been reviewed by Bourque, separate embodiment, the DNA can be inserted into an 1995 and Senior, 1998. Bourque, 1995 lists a large number of expression cassette or transcription cassette. After synthesis, examples of how antisense sequences have been utilized in the RNA molecule can be modified by ligation to a DNA plant systems as a method of gene inactivation. She also states molecule having the ability to stabilize the ribozyme and that attaining 100% inhibition of any enzyme activity may not 45 make it resistant to RNase. be necessary as partial inhibition will more than likely result As with antisense polynucleotides described herein, cata in measurable change in the system. Senior (1998) states that lytic polynucleotides of the invention should also be capable antisense methods are now a very well established technique of hybridizing a target nucleic acid molecule (for example an for manipulating gene expression. mRNA encoding any polypeptide provided in FIG. 2 or 7 or An antisense polynucleotide of the invention will hybridize 50 SEQID NOS 1 to 4 or 15 to 18) under “physiological condi to a target polynucleotide under physiological conditions. As tions', namely those conditions within a cell (especially con used herein, the term “an antisense polynucleotide which ditions in a plant cell Such as a rice cell). hybridises under physiological conditions' means that the RNA Interference polynucleotide (which is fully or partially single stranded) is RNA interference (RNAi) is particularly useful for specifi at least capable of forming a double stranded polynucleotide 55 cally inhibiting the production of a particular protein. with mRNA encoding a protein, Such as those provided in Although not wishing to be limited by theory, Waterhouse et FIG. 2 or 7 or SEQID NOs 1 to 4 or 15 to 18 under normal al. (1998) have provided a model for the mechanism by which conditions in a cell, preferably a rice cell. dsRNA (duplex RNA) can be used to reduce protein produc Antisense molecules may include sequences that corre tion. This technology relies on the presence of dsRNA mol spond to the structural genes or for sequences that effect 60 ecules that contain a sequence that is essentially identical to control over the gene expression or splicing event. For the mRNA of the gene of interest or part thereof, in this case example, the antisense sequence may correspond to the tar an mRNA encoding a polypeptide according to the invention. geted coding region of the genes of the invention, or the Conveniently, the dsRNA can be produced from a single 5'-untranslated region (UTR) or the 3'-UTR or combination promoterina recombinant vector or host cell, where the sense of these. It may be complementary in part to intron sequences, 65 and anti-sense sequences are flanked by an unrelated which may be spliced out during or after transcription, pref sequence which enables the sense and anti-sense sequences to erably only to exon sequences of the target gene. In view of hybridize to form the dsRNA molecule with the unrelated US 8,530,724 B2 21 22 sequence forming a loop structure. The design and production understood but is thought to involve post-transcriptional gene of suitable dsRNA molecules for the present invention is well silencing (PTGS) and in that regard may be very similar to within the capacity of a person skilled in the art, particularly many examples of antisense Suppression. It involves intro considering Waterhouse etal. (1998), Smith etal. (2000), WO ducing an extra copy of a gene or a fragment thereof into a 99/32619, WO 99/53050, WO 99/49029, and WO 01/34815. plant in the sense orientation with respect to a promoter for its In one example, a DNA is introduced that directs the syn expression. The size of the sense fragment, its correspon thesis of an at least partly double stranded RNA product(s) dence to target gene regions, and its degree of sequence with homology to the target gene to be inactivated. The DNA identity to the target gene are as for the antisense sequences therefore comprises both sense and antisense sequences that, described above. In some instances the additional copy of the when transcribed into RNA, can hybridize to form the double 10 gene sequence interferes with the expression of the target stranded RNA region. In a preferred embodiment, the sense plant gene. Reference is made to WO 97/20936 and EP and antisense sequences are separated by a spacer region that 0465572 for methods of implementing co-suppression comprises an intron which, when transcribed into RNA, is approaches. spliced out. This arrangement has been shown to result in a Nucleic Acid Hybridization higher efficiency of gene silencing. The double-stranded 15 In an embodiment, polynucleotides of the invention, or a region may comprise one or two RNA molecules, transcribed Strand thereof, hybridize under physiological conditions to a from either one DNA region or two. The presence of the polynucleotide comprising any one or more of the sequence double stranded molecule is thought to trigger a response of nucleotides provided as SEQID NOs 5 to 8, 11 to 14 or 19 from an endogenous plant system that destroys both the to 25. In a further embodiment, polynucleotides of the inven double stranded RNA and also the homologous RNA tran tion, or a strand thereof, also hybridize to a polynucleotide Script from the target plant gene, efficiently reducing or elimi comprising any one or more of the sequence of nucleotides nating the activity of the target gene. provided as SEQID NOs 5 to 8, 11 to 14 or 19 to 25 under The length of the sense and antisense sequences that hybri stringent conditions. dise should each be at least 19 contiguous nucleotides, pref As used herein, the phrase “stringent conditions” refers to erably at least 30 or 50 nucleotides, and more preferably at 25 conditions under which a polynucleotide, probe, primer and/ least 100, 200, 500 or 1000 nucleotides. The full-length or oligonucleotide will hybridize to its target sequence(s), but sequence corresponding to the entire gene transcript may be to no other sequences. Stringent conditions are sequence used. The lengths are most preferably 100-2000 nucleotides. dependent and will be different in different circumstances. The degree of identity of the sense and antisense sequences to Longer sequences hybridize specifically at higher tempera the targeted transcript should be at least 85%, preferably at 30 tures than shorter sequences. Generally, Stringent conditions least 90% and more preferably 95-100%. The RNA molecule are selected to be about 5°C. lower than the thermal melting may of course comprise unrelated sequences which may point (Tm) for the specific sequence at a defined ionic function to stabilize the molecule. The RNA molecule may be strength and pH. The Tm is the temperature (under defined expressed under the control of a RNA polymerase II or RNA ionic strength, pH and nucleic acid concentration) at which polymerase III promoter. Examples of the latter include 35 50% of the probes complementary to the target sequence tRNA or snRNA promoters. hybridize to the target sequence at equilibrium. Since the Preferred small interfering RNA (siRNA) molecules target sequences are generally present at excess, at Tm, 50% comprise a nucleotide sequence that is identical to about of the probes are occupied at equilibrium. Typically, stringent 19-21 contiguous nucleotides of the target mRNA. Prefer conditions will be those in which the salt concentration is less ably, the target mRNA sequence commences with the 40 than about 1.0 M sodium ion, typically about 0.01 to 1.0 M dinucleotide AA, comprises a GC-content of about 30-70% sodium ion (or other salts) at pH 7.0 to 8.3 and the tempera (preferably, 30-60%, more preferably 40-60% and more pref ture is at least about 30° C. for short probes, primers or erably about 45%-55%), and does not have a high percentage oligonucleotides (e.g., 10 nt to 50 nt) and at least about 60° C. identity to any nucleotide sequence other than the target in the for longer probes, primers and oligonucleotides. Stringent genome of the plant (preferably rice) in which it is to be 45 conditions may also be achieved with the addition of desta introduced, e.g., as determined by standard BLAST search. bilizing agents, such as formamide. Examples of dsRNA molecules of the invention are pro Stringent conditions are known to those skilled in the art vided in Example 5. Further examples include those which and can be found in Ausubel et al. (supra), Current Protocols comprise a sequence as provided in one or more of SEQID In Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1- NOs 64 to 73 (for Fad2) and SEQID NOS 74 to 83 (for FatB). 50 6.3.6, as well as the Examples described herein. Preferably, MicroRNA the conditions are Such that sequences at least about 65%, MicroRNA regulation is a clearly specialized branch of the 70%, 75%, 85%, 90%. 95%, 98%, or 99% homologous to RNA silencing pathway that evolved towards gene regula each other typically remain hybridized to each other. A non tion, diverging from conventional RNAi/PTGS. MicroRNAs limiting example of stringent hybridization conditions are are a specific class of Small RNAS that are encoded in gene 55 hybridization in a high salt buffer comprising 6xSSC, 50 mM like elements organized in a characteristic inverted repeat. Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, When transcribed, microRNA genes give rise to stem-looped 0.02% BSA, and 500 mg/ml denatured salmon sperm DNA at precursor RNAs from which the microRNAs are subse 65° C., followed by one or more washes in 0.2.xSSC, 0.01% quently processed. MicroRNAs are typically about 21 nucle BSA at 50° C. In another embodiment, a nucleic acid otides in length. The released miRNAs are incorporated into 60 sequence that is hybridizable to the nucleic acid molecule RISC-like complexes containing a particular Subset of Argo comprising the nucleotide sequence of SEQID NOs 5 to 8, 11 naute proteins that exert sequence-specific gene repression to 14 or 19 to 25, under conditions of moderate stringency is (see, for example, Millar and Waterhouse, 2005; Pasquinelli provided. A non-limiting example of moderate stringency et al., 2005: Almeida and Allshire, 2005). hybridization conditions are hybridization in 6xSSC, 5xDen CoSuppression 65 hardt’s solution, 0.5% SDS and 100 mg/ml denatured salmon Another molecular biological approach that may be used is sperm DNA at 55° C., followed by one or more washes in co-Suppression. The mechanism of co-suppression is not well 1xSSC, 0.1% SDS at 37° C. Other conditions of moderate US 8,530,724 B2 23 24 stringency that may be used are well-known within the art, promoter, the mannopine synthase and octopine synthase see, e.g., Ausubel et al. (Supra), and Kriegler, 1990; Gene promoters, the Adh promoter, the Sucrose synthase promoter, Transfer And Expression, A Laboratory Manual, Stockton the R gene complex promoter, and the chlorophyll C/B bind Press, NY. In yet another embodiment, a nucleic acid that is ing protein gene promoter. These promoters have been used to hybridizable to the nucleic acid molecule comprising the create DNA vectors that have been expressed in plants; see, nucleotide sequences SEQID NOs 5 to 8, 11 to 14 or 19 to 25, e.g., PCT publication WO 8402913. All of these promoters under conditions of low stringency, is provided. A non-limit have been used to create various types of plant-expressible ing example of low stringency hybridization conditions are recombinant DNA vectors. hybridization in 35% formamide, 5xSSC, 50 mM Tris-HCl The promoter may be modulated by factors such as tem (pH 7.5), 5 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA, 10 perature, light or stress. Ordinarily, the regulatory elements 100 mg/ml denatured salmon sperm DNA, 10% (wt/vol) dex will be provided 5' of the genetic sequence to be expressed. tran sulfate at 40° C., followed by one or more washes in The construct may also contain other elements that enhance 2xSSC, 25 mM Tris-HCl (pH 7.4), 5 mM EDTA, and 0.1% transcription Such as the nos 3' or the ocs 3' polyadenylation SDS at 50°C. Other conditions of low stringency that may be regions or transcription terminators. used are well known in the art, see, e.g., Ausubeletal. (Supra) 15 The 5' non-translated leader sequence can be derived from and Kriegler, 1990, Gene Transfer And Expression, A Labo the promoter selected to express the heterologous gene ratory Manual, Stockton Press, NY, as well as the Examples sequence of the polynucleotide of the present invention, and provided herein. can be specifically modified if desired so as to increase trans Nucleic Acid Constructs, Vectors and Host Cells lation of mRNA. For a review of optimizing expression of The present invention includes the production of geneti transgenes, see Koziel et al. (1996). The 5' non-translated cally modified rice plants, wherein the plant has decreased regions can also be obtained from plant viral RNAs (Tobacco expression of a polypeptide having Fad2 and/or FatBactivity mosaic virus, Tobacco etch virus, Maize dwarf mosaic virus, relative to a corresponding non-modified plant. Alfalfa mosaic virus, among others) from Suitable eukaryotic Nucleic acid constructs useful for producing the above genes, plant genes (wheat and maize chlorophyll afb binding mentioned transgenic plants can readily be produced using 25 protein gene leader), or from a synthetic gene sequence. The standard techniques. present invention is not limited to constructs wherein the When inserting a region encoding an mRNA the construct non-translated region is derived from the 5' non-translated may comprise intron sequences. These intron sequences may sequence that accompanies the promoter sequence. The aid expression of the transgene in the plant. The term “intron' leader sequence could also be derived from an unrelated is used in its normal sense as meaning a genetic segment that 30 promoter or coding sequence. Leader sequences useful in is transcribed but does not encode protein and which is context of the present invention comprise the maize Hsp70 spliced out of an RNA before translation. Introns may be leader U.S. Pat. No. 5,362,865 and U.S. Pat. No. 5,859,347), incorporated in a 5'-UTR or a coding region if the transgene and the TMV omega element. encodes a translated product, or anywhere in the transcribed The termination of transcription is accomplished by a 3' region if it does not. However, in a preferred embodiment, any 35 non-translated DNA sequence operably linked in the chi polypeptide encoding region is provided as a single open meric vector to the polynucleotide of interest. The 3' non reading frame. As the skilled addressee would be aware, Such translated region of a recombinant DNA molecule contains a open reading frames can be obtained by reverse transcribing polyadenylation signal that functions in plants to cause the mRNA encoding the polypeptide. addition of adenylate nucleotides to the 3' end of the RNA. To ensure appropriate expression of the gene encoding an 40 The 3' non-translated region can be obtained from various mRNA of interest, the nucleic acid construct typically com genes that are expressed in plant cells. The nopaline synthase prises one or more regulatory elements such as promoters, 3' intranslated region, the 3' untranslated region from pea enhancers, as well as transcription termination or polyadeny Small subunit Rubisco gene, the 3' untranslated region from lation sequences. Such elements are well known in the art. Soybean 7S seed storage protein gene are commonly used in The transcriptional initiation region comprising the regu 45 this capacity. The 3' transcribed, non-translated regions con latory element(s) may provide for regulated or constitutive taining the polyadenylate signal of Agrobacterium tumor expression in the plant Preferably, expression at least occurs inducing (Ti) plasmid genes are also Suitable. in cells of the embryo, endosperm, bran layer developing seed Typically, the nucleic acid construct comprises a selectable and/or mature seed (grain). In an alternate embodiment, the marker. Selectable markers aid in the identification and regulatory elements may be promoters not specific for seed 50 screening of plants or cells that have been transformed with cells (such as ubiquitin promoter or CaMV35S or enhanced the exogenous nucleic acid molecule. The selectable marker 35S promoters). gene may provide antibiotic or herbicide resistance to the rice Examples of seed specific promoters useful for the present cells, or allow the utilization of Substrates such as mannose. invention include, but are not limited to, the wheat low The selectable marker preferably confers hygromycin resis molecular weight glutenin promoter (Colot et al., 1987), the 55 tance to the rice cells. promoter expressing C.-amylase in wheat seeds (Stefanov et Preferably, the nucleic acid construct is stably incorporated al., 1991), and the hordein promoter (Brandt et al., 1985). into the genome of the plant. Accordingly, the nucleic acid A number of constitutive promoters that are active in plant comprises appropriate elements which allow the molecule to cells have been described. Suitable promoters for constitutive be incorporated into the genome, or the construct is placed in expression in plants include, but are not limited to, the cauli 60 an appropriate vector which can be incorporated into a chro flower mosaic virus (CaMV) 35S promoter, the Figwort mosome of a plant cell. mosaic virus (FMV) 35S, the sugarcane bacilliform virus One embodiment of the present invention includes a promoter, the commelina yellow mottle virus promoter, the recombinant vector, which includes at least one polynucle light-inducible promoter from the small subunit of the ribu otide molecule of the present invention, inserted into any lose-1,5-bis-phosphate carboxylase, the rice cytosolic triose 65 vector capable of delivering the nucleic acid molecule into a phosphate isomerase promoter, the adenine phosphoribosyl host cell. Such a vector contains heterologous nucleic acid transferase promoter of Arabidopsis, the rice actin 1 gene sequences, that is nucleic acid sequences that are not naturally US 8,530,724 B2 25 26 found adjacent to nucleic acid molecules of the present inven example of a method for delivering transforming nucleic acid tion and that preferably are derived from a species other than molecules to plant cells is microprojectile bombardment. the species from which the nucleic acid molecule(s) are This method has been reviewed by Yang et al., Particle Bom derived. The vector can be either RNA or DNA, either bardment Technology for Gene Transfer, Oxford Press, prokaryotic or eukaryotic, and typically is a virus or a plas 5 Oxford, England (1994). Non-biological particles (micro mid. projectiles) that may be coated with nucleic acids and deliv A number of vectors suitable for stable transfection of plant ered into cells by a propelling force. Exemplary particles cells or for the establishment of transgenic plants have been include those comprised oftungsten, gold, platinum, and the described in, e.g., Pouwels et al. Cloning Vectors: A Labora like. A particular advantage of microprojectile bombardment, tory Manual, 1985, Supp. 1987; Weissbach and Weissbach, 10 in addition to it being an effective means of reproducibly Methods for Plant Molecular Biology, Academic Press, 1989; transforming monocots, is that neither the isolation of proto and Gelvin et al., Plant Molecular Biology Manual, Kluwer plasts, nor the Susceptibility of Agrobacterium infection are Academic Publishers, 1990. Typically, plant expression vec required. An illustrative embodiment of a method for deliv tors include, for example, one or more cloned plant genes ering DNA into Zea mays cells by acceleration is a biolistics under the transcriptional control of 5' and 3' regulatory 15 C-particle delivery system, that can be used to propel particles sequences and a dominant selectable marker. Such plant coated with DNA through a screen, Such as a stainless steel or expression vectors also can contain a promoter regulatory Nytex screen, onto a filter surface covered with corn cells region (e.g., a regulatory region controlling inducible or con cultured in Suspension. A particle delivery system Suitable for stitutive, environmentally- or developmentally-regulated, or use with the present invention is the helium acceleration cell- or tissue-specific expression), a transcription initiation PDS-1000/He gun is available from Bio-Rad Laboratories. start site, a ribosome binding site, an RNA processing signal, For the bombardment, cells in Suspension may be concen a transcription termination site, and/or a polyadenylation sig trated on filters. Filters containing the cells to be bombarded nal. are positioned at an appropriate distance below the micro Another embodiment of the present invention includes a projectile stopping plate. If desired, one or more screens are recombinant cell comprising a host cell transformed with one 25 also positioned between the gun and the cells to be bom or more recombinant molecules of the present invention. barded. Transformation of a nucleic acid molecule into a cell can be Alternatively, immature embryos or other target cells may accomplished by any method by which a nucleic acid mol be arranged on solid culture medium. The cells to be bom ecule can be inserted into the cell. Transformation techniques barded are positioned at an appropriate distance below the include, but are not limited to, transfection, electroporation, 30 microprojectile stopping plate. If desired, one or more microinjection, lipofection, adsorption, and protoplast screens are also positioned between the acceleration device fusion. A recombinant cell may remain unicellular or may and the cells to be bombarded. Through the use of techniques grow into a tissue, organ or a multicellular organism. Trans set forth herein one may obtain up to 1000 or more foci of formed nucleic acid molecules of the present invention can cells transiently expressing a marker gene. The number of remain extrachromosomal or can integrate into one or more 35 cells in a focus that express the exogenous gene product 48 sites within a chromosome of the transformed (i.e., recombi hours post-bombardment often range from one to ten and nant) cell in such a manner that their ability to be expressed is average one to three. retained. Preferred host cells are plant cells, more preferably In bombardment transformation, one may optimize the cells of a cereal plant, and even more preferably a rice cell. pre-bombardment culturing conditions and the bombardment Transgenic Plants 40 parameters to yield the maximum numbers of stable transfor Transgenic rice (also referred to herein as genetically mants. Both the physical and biological parameters for bom modified rice) can be produced using techniques known in the bardment are important in this technology. Physical factors art, such as those generally described in A. Slater et al., Plant are those that involve manipulating the DNA/microprojectile Biotechnology. The Genetic Manipulation of Plants, precipitate or those that affect the flight and velocity of either Oxford University Press (2003), and P. Christou and H. Klee, 45 the macro- or microprojectiles. Biological factors include all Handbook of Plant Biotechnology, John Wiley and Sons steps involved in manipulation of cells before and immedi (2004). ately after bombardment, the osmotic adjustment of target In a preferred embodiment, the transgenic plants are cells to help alleviate the trauma associated with bombard homozygous for each and every polynucleotide that has been ment, and also the nature of the transforming DNA, such as introduced (transgene) so that their progeny do not segregate 50 linearized DNA or intact supercoiled plasmids. It is believed for the desired phenotype. The transgenic plants may also be that pre-bombardment manipulations are especially impor heterozygous for the introduced transgene(s). Such as, for tant for Successful transformation of immature embryos. example, in F1 progeny which have been grown from hybrid In another alternative embodiment, plastids can be stably seed. Such plants may provide advantages such as hybrid transformed. Method disclosed for plastid transformation in vigour, well known in the art. 55 higher plants include particle gun delivery of DNA contain Four general methods for direct delivery of a gene into cells ing a selectable marker and targeting of the DNA to the plastid have been described: (1) chemical methods (Graham et al., genome through homologous recombination (U.S. Pat. No. 1973); (2) physical methods such as microinjection (Capec 5,451,513, U.S. Pat. No. 5,545,818, U.S. Pat. No. 5,877,402, chi, 1980); electroporation (see, for example, WO 87/06614, U.S. Pat. No. 5,932,479, and WO99/05265. U.S. Pat. No. 5,472,869, 5,384,253, WO92/09696 and WO 60 Accordingly, it is contemplated that one may wish to adjust 93/21335); and the gene gun (see, for example, U.S. Pat. No. various aspects of the bombardment parameters in Small scale 4.945,050 and U.S. Pat. No. 5,141,131); (3) viral vectors studies to fully optimize the conditions. One may particularly (Clapp, 1993: Lu et al., 1993; Eglitis et al., 1988); and (4) wish to adjust physical parameters such as gap distance, flight receptor-mediated mechanisms (Curiel et al., 1992; Wagner distance, tissue distance, and helium pressure. One may also et al., 1992). 65 minimize the trauma reduction factors by modifying condi Acceleration methods that may be used include, for tions that influence the physiological state of the recipient example, microprojectile bombardment and the like. One cells and that may therefore influence transformation and US 8,530,724 B2 27 28 integration efficiencies. For example, the osmotic state, tissue for the regeneration of cereals from protoplasts are described hydration and the subculture stage or cell cycle of the recipi (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., ent cells may be adjusted for optimum transformation. The 1986). execution of other routine adjustments will be known to those Other methods of cell transformation can also be used and of skill in the art in light of the present disclosure. include but are not limited to introduction of DNA into plants Agrobacterium-mediated transfer is a widely applicable by direct DNA transfer into pollen, by direct injection of system for introducing genes into plant cells because the DNA into reproductive organs of a plant, or by direct injection DNA can be introduced into whole plant tissues, thereby of DNA into the cells of immature embryos followed by the bypassing the need for regeneration of an intact plant from a rehydration of desiccated embryos. protoplast. The use of Agrobacterium-mediated plant inte 10 The regeneration, development, and cultivation of plants grating vectors to introduce DNA into plant cells is well from single plant protoplast transformants or from various known in the art (see, for example, U.S. Pat. No. 5,177,010, transformed explants is well known in the art (Weissbach et U.S. Pat. No. 5,104,310, U.S. Pat. No. 5,004,863, U.S. Pat. al., In: Methods for Plant Molecular Biology, Academic No. 5,159,135). Further, the integration of the T-DNA is a Press, San Diego, Calif., (1988). This regeneration and relatively precise process resulting in few rearrangements. 15 growth process typically includes the steps of selection of The region of DNA to be transferred is defined by the border transformed cells, culturing those individualized cells sequences, and intervening DNA is usually inserted into the through the usual stages of embryonic development through plant genome. the rooted plantlet stage. Transgenic embryos and seeds are Modern Agrobacterium transformation vectors are capable similarly regenerated. The resulting transgenic rooted shoots of replication in E. coli as well as Agrobacterium, allowing are thereafter planted in an appropriate plant growth medium for convenient manipulations as described (Klee et al., In: Such as soil. Plant DNA Infectious Agents, Hohn and Schell, eds., The development or regeneration of plants containing the Springer-Verlag, New York, pp. 179-203 (1985). Moreover, foreign, exogenous gene is well known in the art. Preferably, technological advances in vectors for Agrobacterium-medi 25 the regenerated plants are self-pollinated to provide homozy ated gene transfer have improved the arrangement of genes gous transgenic plants. Otherwise, pollen obtained from the and restriction sites in the vectors to facilitate construction of regenerated plants is crossed to seed-grown plants of agro vectors capable of expressing various polypeptide coding nomically important lines. Conversely, pollen from plants of genes. The vectors described have convenient multi-linker these importantlines is used to pollinate regenerated plants. A regions flanked by a promoter and a polyadenylation site for 30 transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well direct expression of inserted polypeptide coding genes and known to one skilled in the art. are suitable for present purposes. In addition, Agrobacterium Methods for transformation of cereal plants such as rice for containing both armed and disarmed Tigenes can be used for introducing genetic variation into the plant by introduction of the transformations. In those plant varieties where Agrobac 35 an exogenous nucleic acid and for regeneration of plants from terium-mediated transformation is efficient, it is the method protoplasts or immature plant embryos are well known in the of choice because of the facile and defined nature of the gene art, see for example, Canadian Patent Application No. 2,092, transfer. 588, Australian Patent Application No. 61781/94, Australian A transgenic plant formed using Agrobacterium transfor Patent No 667939, U.S. Pat. No. 6,100,447, International mation methods typically contains a single genetic locus on 40 Patent Application PCT/US97/10621, U.S. Pat. No. 5,589, one chromosome. Such transgenic plants can be referred to as 617, U.S. Pat. No. 6,541,257, and other methods are set out in being hemizygous for the added gene. More preferred is a Patent specification WO99/14314. Preferably, transgenic rice transgenic plant that is homozygous for the added structural plants are produced by Agrobacterium tumefaciens mediated gene; i.e., a transgenic plant that contains two added genes, transformation procedures. An example of Agrobacterium one gene at the same locus on each chromosome of a chro 45 mediated transformation of rice is provided herein in mosome pair. Ahomozygous transgenic plant can be obtained Example 5. Vectors carrying the desired nucleic acid con by sexually mating (selfing) an independent segregant trans struct may be introduced into regenerable rice cells of tissue genic plant that contains a single added gene, germinating cultured plants or explants, or Suitable plant systems such as Some of the seed produced and analyzing the resulting plants protoplasts. for the gene of interest. 50 The regenerable rice cells are preferably from the scutel It is also to be understood that two different transgenic lum of immature embryos, mature embryos, callus derived plants can also be mated to produce offspring that contain two from these, or the meristematic tissue. independently segregating exogenous genes. Selfing of To confirm the presence of the transgenes in transgenic appropriate progeny can produce plants that are homozygous cells and plants, a polymerase chain reaction (PCR) amplifi for both exogenous genes. Back-crossing to a parental plant 55 cation or Southern blot analysis can be performed using and out-crossing with a non-transgenic plant are also contem methods known to those skilled in the art. Expression prod plated, as is vegetative propagation. Descriptions of other ucts of the transgenes can be detected in any of a variety of breeding methods that are commonly used for different traits ways, depending upon the nature of the product, and include and crops can be found in Fehr, In: Breeding Methods for Western blot and enzyme assay. One particularly useful way Cultivar Development, Wilcox J. ed., American Society of 60 to quantitate protein expression and to detect replication in Agronomy, Madison Wis. (1987). different plant tissues is to use a reporter gene, such as GUS. Transformation of plant protoplasts can be achieved using Once transgenic plants have been obtained, they may be methods based on calcium phosphate precipitation, polyeth grown to produce plant tissues or parts having the desired ylene glycol treatment, electroporation, and combinations of phenotype. The plant tissue or plant parts, may be harvested, these treatments. Application of these systems to different 65 and/or the seed collected. The seed may serve as a source for plant varieties depends upon the ability to regenerate that growing additional plants with tissues or parts having the particular plant strain from protoplasts. Illustrative methods desired characteristics. US 8,530,724 B2 29 30 Marker Assisted Selection amplicons. Repeated cycles of heat denaturation of the DNA, Marker assisted selection is a well recognised method of annealing of primers to their complementary sequences and selecting for heterozygous plants required when backcross extension of the annealed primers with polymerase result in ing with a recurrent parent in a classical breeding program. exponential amplification of the target sequence. The terms The population of plants in each backcross generation will be target or target sequence or template refer to nucleic acid heterozygous for the gene of interest normally present in a 1:1 sequences which are amplified. ratio in a backcross population, and the molecular marker can Methods for direct sequencing of nucleotide sequences are be used to distinguish the two alleles of the gene. By extract well known to those skilled in the art and can be found for ing DNA from, for example, young shoots and testing with a example in Ausubeletal. (Supra) and Sambrook et al. (Supra). specific marker for the introgressed desirable trait, early 10 Sequencing can be carried out by any Suitable method, for selection of plants for further backcrossing is made whilst example, dideoxy sequencing, chemical sequencing or varia energy and resources are concentrated on fewer plants. To tions thereof. Direct sequencing has the advantage of deter further speed up the backcrossing program, the embryo from mining variation in any base pair of a particular sequence. immature seeds (25 days post anthesis) may be excised and Hybridization based detection systems include, but are not grown up on nutrient media under sterile conditions, rather 15 limited to, the TaqMan assay and molecular beacons. The than allowing full seed maturity. This process, termed TaqMan assay (U.S. Pat. No. 5,962.233) uses allele specific "embryo rescue', used in combination with DNA extraction (ASO) probes with a donor dye on one end and an acceptor at the three leaf stage and analysis for the desired genotype dye on the other end such that the dye pair interact via fluo allows rapid selection of plants carrying the desired trait, rescence resonance energy transfer (FRET). A target which may be nurtured to maturity in the greenhouse or field sequence is amplified by PCR modified to include the addi for Subsequent further backcrossing to the recurrent parent. tion of the labeled ASO probe. The PCR conditions are Any molecular biological technique known in the art which adjusted so that a single nucleotide difference will effect is capable of detecting a Fad2 or FatB gene can be used in the binding of the probe. Due to the 5' nuclease activity of the Taq methods of the present invention. Such methods include, but polymerase enzyme, a perfectly complementary probe is are not limited to, the use of nucleic acid amplification, 25 cleaved during PCR while a probe with a single mismatched nucleic acid sequencing, nucleic acid hybridization with Suit base is not cleaved. Cleavage of the probe dissociates the ably labeled probes, single-strand conformational analysis donor dye from the quenching acceptor dye, greatly increas (SSCA), denaturing gradient gel electrophoresis (DGGE), ing the donor fluorescence. heteroduplex analysis (HET), chemical cleavage analysis An alternative to the TaqManassay is the molecular beacon (CCM), catalytic nucleic acid cleavage or a combination 30 assay (U.S. Pat. No. 5,925.517). In the molecular beacon thereof (see, for example, Lemieux, 2000; Langridge et al., assay, the ASO probes contain complementary sequences 2001). The invention also includes the use of molecular flanking the target specific species so that a hairpin structure marker techniques to detect polymorphisms linked to alleles is formed. The loop of the hairpin is complimentary to the of (for example) a Fad2 or FatB gene which confer the desired target sequence while each arm of the hairpin contains either phenotype. Such methods include the detection or analysis of 35 donor or acceptor dyes. When not hybridized to a donor restriction fragment length polymorphisms (RFLP), RAPD, sequence, the hairpin structure brings the donor and acceptor amplified fragment length polymorphisms (AFLP) and mic dye close together thereby extinguishing the donor fluores rosatellite (simple sequence repeat, SSR) polymorphisms. cence. When hybridized to the specific target sequence, how The closely linked markers can be obtained readily by meth ever, the donor and acceptor dyes are separated with an ods well known in the art, Such as Bulked Segregant Analysis, 40 increase in fluorescence of up to 900 fold. Molecular beacons as reviewed by Langridge et al. (2001). can be used in conjunction with amplification of the target The “polymerase chain reaction” (“PCR) is a reaction in sequence by PCR and provide a method for real time detec which replicate copies are made of a target polynucleotide tion of the presence of target sequences or can be used after using a "pair of primers' or “set of primers' consisting of amplification. “upstream” and a “downstream primer, and a catalyst of 45 Tilling polymerization, such as a DNA polymerase, and typically a Plants of the invention can be produced using the process thermally-stable polymerase enzyme. Methods for PCR are known as TILLING (Targeting Induced Local Lesions IN known in the art, and are taught, for example, in “PCR (Ed. Genomes). In a first step, introduced mutations such as novel M. J. McPherson and S. G Moller (2000) BIOS Scientific single base pair changes are induced in a population of plants Publishers Ltd, Oxford). PCR can be performed on cDNA 50 by treating seeds (or pollen) with a chemical mutagen, and obtained from reverse transcribing mRNA isolated from plant then advancing plants to a generation where mutations will be cells. However, it will generally be easier if PCR is performed stably inherited. DNA is extracted, and seeds are stored from on genomic DNA isolated from a plant. all members of the population to create a resource that can be A primer is an oligonucleotide sequence that is capable of accessed repeatedly over time. hybridising in a sequence specific fashion to the target 55 For a TILLING assay, PCR primers are designed to spe sequence and being extended during the PCR. Amplicons or cifically amplify a single gene target of interest. Specificity is PCR products or PCR fragments or amplification products especially important if a target is a member of a gene family are extension products that comprise the primer and the newly or part of a polyploid genome. Next, dye-labeled primers can synthesized copies of the target sequences. Multiplex PCR be used to amplify PCR products from pooled DNA of mul systems contain multiple sets of primers that result in simul 60 tiple individuals. These PCR products are denatured and taneous production of more than one amplicon. Primers may reannealed to allow the formation of mismatched base pairs. be perfectly matched to the target sequence or they may Mismatches, or heteroduplexes, represent both naturally contain internal mismatched bases that can result in the intro occurring single nucleotide polymorphisms (SNPs) (i.e., sev duction of restriction enzyme or catalytic nucleic acid recog eral plants from the population are likely to carry the same nition/cleavage sites in specific target sequences. Primers 65 polymorphism) and induced SNPs (i.e., only rare individual may also contain additional sequences and/or contain modi plants are likely to display the mutation). After heteroduplex fied or labelled nucleotides to facilitate capture or detection of formation, the use of an endonuclease, such as Cel I, that US 8,530,724 B2 31 32 recognizes and cleaves mismatched DNA is the key to dis plant cells in a dosage of approximately 60 to 200 Krad., and covering novel SNPs within a TILLING population. most preferably in a dosage of approximately 60 to 90 Krad. Using this approach, many thousands of plants can be Plants are typically exposed to a mutagen for a sufficient screened to identify any individual with a single base change duration to accomplish the desired genetic modification but as well as Small insertions or deletions (1-30 bp) in any gene insufficient to completely destroy the viability of the cells and or specific region of the genome. Genomic fragments being their ability to be regenerated into a plant. assayed can range in size anywhere from 0.3 to 1.6 kb. At Antibodies 8-fold pooling, 1.4 kb fragments (discounting the ends of Monoclonal or polyclonal antibodies which bind specifi fragments where SNP detection is problematic due to noise) cally to FatB or Fad2 polypeptides can be useful for some of 10 the methods of the invention. and 96 lanes per assay, this combination allows up to a million The term “binds specifically” refers to the ability of the base pairs of genomic DNA to be screened per single assay, antibody to bind to a FatB or Fad2 polypeptide but not other making TILLING a high-throughput technique. proteins of rice, especially proteins of rice seeds. TILLING is further described in Slade and Knauf (2005) As used herein, the term “epitope” refers to a region of a and Henikoffet al. (2004). 15 FatB or Fad2 polypeptide which is bound by the antibody. An In addition to allowing efficient detection of mutations, epitope can be administered to an animal to generate antibod high-throughput TILLING technology is ideal for the detec ies against the epitope, however, antibodies useful for the tion of natural polymorphisms. Therefore, interrogating an methods described herein preferably specifically bind the unknown homologous DNA by heteroduplexing to a known epitope region in the context of the entire polypeptide. sequence reveals the number and position of polymorphic If polyclonal antibodies are desired, a selected mammal sites. Both nucleotide changes and Small insertions and dele (e.g., mouse, rabbit, goat, horse, etc.) is immunised with an tions are identified, including at least Some repeat number immunogenic polypeptide Such as those provided in FIG. 2 or polymorphisms. This has been called Ecotilling (Comai et al., 7 or SEQID NOs 1 to 4 or 15 to 18. Serum from the immu 2004). nised animal is collected and treated according to known Each SNP is recorded by its approximate position within a 25 procedures. If serum containing polyclonal antibodies con few nucleotides. Thus, each haplotype can be archived based tains antibodies to other antigens, the polyclonal antibodies on its mobility. Sequence data can be obtained with a rela can be purified by immunoaffinity chromatography. Tech tively small incremental effort using aliquots of the same niques for producing and processing polyclonal antisera are amplified DNA that is used for the mismatch-cleavage assay. known in the art. In order that such antibodies may be made, The left or right sequencing primer for a single reaction is 30 the invention also provides peptides of the invention or frag chosen by its proximity to the polymorphism. Sequencher ments thereofhaptenised to another peptide for use as immu software performs a multiple alignment and discovers the nogens in animals. base change, which in each case confirmed the gel band. Monoclonal antibodies directed against polypeptides of Ecotilling can be performed more cheaply than full the invention can also be readily produced by one skilled in sequencing, the method currently used for most SNP discov 35 the art. The general methodology for making monoclonal ery. Plates containing arrayed ecotypic DNA can be screened antibodies by hybridomas is well known. Immortal antibody rather than pools of DNA from mutagenized plants. Because producing cell lines can be created by cell fusion, and also by detection is on gels with nearly base pair resolution and other techniques such as direct transformation of B lympho background patterns are uniform across lanes, bands that are cytes with oncogenic DNA, or transfection with Epstein-Barr of identical size can be matched, thus discovering and geno 40 virus. Panels of monoclonal antibodies produced can be typing SNPs in a single step. In this way, ultimate sequencing screened for various properties; i.e., for isotype and epitope of the SNP is simple and efficient, made more so by the fact affinity. that the aliquots of the same PCR products used for screening An alternative technique involves screening phage display can be subjected to DNA sequencing. libraries where, for example the phage express ScFv frag Mutagenesis Procedures 45 ments on the surface of their coat with a large variety of Techniques for generating mutant rice plant lines are complementarity determining regions (CDRS). This tech known in the art. Examples of mutagens that can be used for nique is well known in the art. generating mutant rice plants include irradiation and chemi For the purposes of this invention, the term “antibody’. cal mutagenesis. Mutants may also be produced by tech unless specified to the contrary, includes fragments of whole niques such as T-DNA insertion and transposon-induced 50 antibodies which retain their binding activity for a target mutagenesis. The mutagenesis procedure may be performed antigen. Such fragments include Fv, F(ab') and F(ab')2 frag on any parental cell of a rice plant, for example a seed or a ments, as well as single chainantibodies (scFV). Furthermore, parental cell in tissue culture. the antibodies and fragments thereof may be humanised anti Chemical mutagens are classifiable by chemical proper bodies, for example as described in EP-A-2394.00. ties, e.g., alkylating agents, cross-linking agents, etc. Useful 55 Antibodies may be bound to a solid Support and/or pack chemical mutagens include, but are not limited to, N-ethyl aged into kits in a Suitable container along with Suitable N-nitrosourea (ENU); N-methyl-N-nitrosourea (MNU); pro reagents, controls, instructions and the like. carbazine hydrochloride; chlorambucil; cyclophosphamide; Preferably, the antibodies are detectably labeled. Exem methyl methanesulfonate (MMS): ethyl methanesulfonate plary detectable labels that allow for direct measurement of (EMS); diethyl sulfate; acrylamide monomer; triethylene 60 antibody binding include radiolabels, fluorophores, dyes, melamine (TEM); melphalan; nitrogen mustard; Vincristine; magnetic beads, chemiluminescers, colloidal particles, and dimethylnitrosamine; N-methyl-N'-nitro-Nitrosoguani-dine the like. Examples of labels which permit indirect measure (MNNG): 7.12 dimethylbenzanthracene (DMBA); ethylene ment of binding include enzymes where the Substrate may oxide; hexamethylphosphoramide; and bisulfan. provide for a coloured or fluorescent product. Additional An example of Suitable irradiation to induce mutations is 65 exemplary detectable labels include covalently bound by gamma radiation, such as that Supplied by a Cesium 137 enzymes capable of providing a detectable product signal Source. The gamma radiation preferably is Supplied to the after addition of suitable substrate. Examples of suitable US 8,530,724 B2 33 34 enzymes for use in conjugates include horseradish peroxi dissolved in 20 Jul of hexane and transferred to conical glass dase, alkaline phosphatase, malate dehydrogenase and the inserts in vials for GC analysis. like. Where not commercially available, such antibody-en FA Analysis by Gas Chromatography Zyme conjugates are readily produced by techniques known Fatty acid methyl esters were prepared by alkaline trans to those skilled in the art. Further exemplary detectable labels methylation as follows. Single seed samples were squashed include biotin, which binds with high affinity to avidin or between filter paper disks. The fatty acids in the lipid trans streptavidin; fluorochromes (e.g., phycobiliproteins, phyco ferred to the filter paper disks were then methylated in 2 mL erythrin and allophycocyanins; fluorescein and Texas red), of 0.02 M sodium methoxide for 10 minutes at 80° C., fol which can be used with a fluorescence activated cell sorter; lowed by cooling for 30 minutes. 0.1 mL of glacial acetic acid haptens; and the like. Preferably, the detectable label allows 10 was then added, followed in order by 2 mL of distilled water for direct measurement in a plate luminometer, e.g., biotin. and 2 mL of hexane. After Vortexing and phase separation, the Such labeled antibodies can be used in techniques known in upper hexane layer containing the fatty acid methyl esters was the art to detect polypeptides of the invention. transferred to a microvial. Fatty acid methyl esters were analysed by gas-liquid chromatography as previously EXAMPLES 15 described (Stoutesdijk et al., 2002). Transformation of Rice Example 1 Rice (cv. Nipponbare) was transformed as follows. i) Callus Induction and Culture Materials and Methods Husks were removed from mature grain, which were then soaked in 70% EtOH for 30 sec to remove any outer layer of Extraction of Oil with Sodium Methoxide wax. The cleaned grains were washed 3 times with sterile For fatty acid and other analyses, total lipid was extracted H2O and soaked in a solution of 25% bleach (with 2 drops from rice grains as follows unless stated otherwise. In some Tween-20 detergent added) for 20 minutes with shaking to cases, samples each consisting of a half grain were used for Surface sterilize them. Under asceptic conditions, the grains the extraction, with the second half-grain containing the 25 were rinsed briefly with 70% EtOH, washed thoroughly with embryo being used for embryo rescue. The technique can also sterile HO 8-10 times and plated onto ND medium. Plates be used with other cereals. were sealed with Micropore-tape and incubated under full A single developing seed or half-seed was squashed light at 28°C. Calli were produced after 6-8 weeks and then between filter papers and placed in a tube. 2 ml 0.5M sodium transferred to NB media They were sealed with paraffin paper methoxide was added, the tube sealed tightly and then incu 30 and left in the at 28°C. with sub-culturing every 4 weeks onto bated at 80° C. for 10 min. After the tube was cooled, 0.1 ml fresh NB plates. Calli were not used for transformation after glacial acetic acid was added followed by 2 ml of distilled more than 5 subcultures. water and 2 ml of petroleum spirit. The mixtures were Vor ii) Transformation texed for 10 sec and, after the phases had separated, the upper Healthy looking calli were picked from subculture plates petroleum layer was transferred to a small test tube. Approxi 35 and transferred onto fresh NB plates at a density of 25-30 mately 1 g of potassium bicarbonate/sodium Sulphate mixture calli/plate. Two days later, a fresh culture was established of was added to the test tubes and the mixture vortexed. The the Agrobacterium strain containing the construct to be used, sample solutions were transferred to autosampler vials and and incubated at 28°C. The culture medium was NB medium stored in a freezer at -20°C. until GCanalysis was performed supplemented with 100 uM acetosyringone. Calli were as described by Soutjesdic et al. (2002). 40 immersed in a suspension of the cells for 10 minutes. After Extraction of Lipids from Tissues with High Water Content draining off excess Suspension, calli were placed on NB (Bligh-Dyer Method) medium Supplemented with 100 LM acetosyringone and This method was adapted from Bligh and Dyer (1959). 1.5 incubated in the dark at 25° C. for 3 days (co-cultivation). ml of CHCl/MeOH (1:2) was added to a tissue sample in 0.4 After the co-cultivation step, calli were washed gently three ml of buffer and the sample vortexed vigorously. A further 0.5 45 times in a tube with sterile HO containing 150 mg/ml Time ml of CHC1 was added and the sample vortexed again. 0.5 ml tin. Calli were blotted dry on filter paper and plated well of HO was added and the sample vortexed again. The tube spaced onto NBCT plates (containing 100 ug/ml kanamycin was centrifuged briefly at 3000 rpm to separate phases; a if a kanamycin selectable marker gene was used or other white precipitate appeared at the interface. The organic selection agent as appropriate, 150 ug/ml Timentin and 200 (lower) phase was transferred to a new tube and concentrated 50 ug/ml Claroforan). The plates were incubated in the dark for under vacuum. If acidic lipids were to be extracted, 0.5 ml of 3-4 weeks at 26-28°C. Resistant calli were observed after 1% HClO was added instead of 0.5 ml of H2O. The volumes about 10 days and transferred to NBCT+ selection plates and in the above procedure could be modified as long as the ratios incubated in the dark for a further 14-21 days. Healthy calli of CHC1/MeoH/HO were maintained. were transferred onto PRCT+selection plates and incubated Preparation of Fatty Acid Methyl Esters (FAME) for Quan 55 in the dark for 8-12 days, then transferred onto RCT+selec titative Determination of Fatty Acid Content tion plates and incubated in fill light at 28°C. for 30 days. To prepare FAME directly from grain, 10-15 seed were After this time, plantlets that had developed were transferred weighed accurately and transferred to a glass tube. An inter to /2MS medium in tissue culture pots and incubated under nal standard of 10 ul of 1 mg/ml 17:0-methyl ester was added light for 10-14 days for further growth before transfer to soil. to each seed sample. 0.75 ml 1 N methanolic-HCl (Supelco) 60 iii) Media Composition and Components for Rice Tissue was added to each tube which was capped tightly and refluxed Culture at 80° C. for at least 2-3 hrs or overnight. Samples were N6 macro-elements (20x) (g/l): (NH4)2SO 9.3; KNO, cooled, 0.5 ml NaCl (0.9% w/v) added followed by 300 ul 56.6; KHPO 8: MgSO.7HO, 3.7: CaCl2HO, 3.3. hexane. The tubes were capped again and Vortexed vigor N6 micro (100x) (mg/100 ml): MnSO4H2O, 440; ously. The upper hexane phase (200-250 ul) was carefully 65 ZnSO.7H2O, 150; H BO, 160; KI, 80. transferred to an eppendorf tube. The sample was dried down N6 Vitamins (100x) (mg/100 ml): Glycine, 20; Thiamine completely under nitrogen. The dried FAME samples were HCl, 10; Pyridoxine-HCl, 5; Nicotinic acid, 5. US 8,530,724 B2 35 36 B5 micro-elements (100x) (mg/1000 ml): MnSO.4H2O, Example 2 1000; Na MoO2HO, 25; HBO, 300; ZnSO.7HO, 200; CuSO4.5H2O, 3.87; CoC1.6HO, 2.5; KI, 75. Identification and Isolation of FatB Genes from Rice B5 vitamins (100x) and Gamborg's vitamin solution (1000x) from Sigma cell culture. 5 FatB genes encode the enzyme palmitoyl-ACP FeEDTA(200x) (g/200 ml): Ferric-sodium salt, 1.47. thioesterase which have the activity of preferentially trans 2,4-D (1 mg/ml): Dissolve 100 mg of 2,4-dichloro-phenoxy ferring fatty acids that have a length of 16 carbons or less from acetic acid in 1 ml absolute ethanol, add 3 ml of 1N KOH, acyl carrier protein to acyl-CoA and thus prevent further adjust to pH 6 with 1N HC1. elongation of the fatty acid carbon chain. Putative rice FatB BAP (1 mg/ml): 6-benzyl amino purine from Sigma cell 10 culture. sequences were identified using homology based searches NAA (1 mg/ml): Naphthalene acetic acid from Sigma cell using the sequence for the Genbank accession Arabidopsis culture. locus AtACPTE32 and Iris locus AF213480. The program ABA (2.5 mg/ml): Dissolve 250 mg of Abscisic acid in 2 used was Megablast available at NCBI (www.ncbi.nlm.nih. ml of 1M NaOH, make up to 100 ml with sterile distilled 15 gov/). Default parameters used by NCBI were used and the water. Final background concentration to be 20 mM NaOH. databases used were both non-redundant (nr) and high Hygromycin (50 mg/ml): Hygromycin solution from throughput gene sequences (htgs) for rice, Oryza sativa. The Roche. most similar sequences from rice selected by the Megablast Timetin (150 mg/ml): Dissolve 3100 mg of Timetin in program were then translated and examined for the presence 20.66 ml of sterile water. Final concentration to be 150 of the conserved sequence NQHVNN(SEQID NO:26) found mg/ml. in all FatB sequences. A further amino acid residue believed Claforan (200 mg/ml): Dissolve 4 gm of Claforan in 20 ml to be essential in Arabidopsis is cysteine 264 and along with of sterile water. asparagine 227 and histidine 229 (which are both present in MS Salts: Murashige-Skoog minimal organic medium. the conserved sequence NQHVNN) comprise the proposed N6D medium (amount per liter): 25 catalytic triad. The Chinese Rice Database (current Website address rise.genomics.org.cn/rice/index2.jsp) was also used to a limited extent and default parameters for BLAST search ing were used with the Arabidopsis sequence and Iris N6 macro (10X) 100 ml N6 micro (1000X) 1 ml sequences. The translated sequences are aligned in FIG. 2. N6 vitamins (1000X) 1 ml 30 An overview of the structures of all the FatB genes is shown MS iron. EDTA 5 ml as in FIG.3. The genes described correspond as follows to the Myoinositol 100 mg protein sequences discussed—AC108870 corresponds to Casamino acid 300 mg Proline 2.9 g, Os11g43820, AP005291 corresponds to Os02.g43090, 2,4-D (1 mg/ml) 2 ml AP000399 corresponds to Os06g,5130 and AP004236 corre 35 sponds to Os06g,39520. Note the possibility of multiple tran Scripts from one gene as indicated on the diagram. FIG. 4 Sucrose 30 g shows a CLUSTAL W (fast) alignment of the gene’ pH adjusted to 5.8 with 1M KOH, add 3 g phytogel/liter, sequences using default parameters—note that the genes are autoclave. of different lengths. NB medium (amount per liter): 40 The genes comprise 6 exons. The structure of the gene described by Os06g,5130 is shown in detail FIG. 5. FIG. 6 shows an alignment of the coding sequences of the N6 macro-elements (20X) 50 ml FatB cDNAs indicating the different primers used for selec B5 micro-elements (100X) 10 ml tive PCR amplification. B5 vitamins (100X) 10 ml 45 The sequence identity between the translated peptide FeEDTA (200X) 5 ml 2,4-D (1 mg/ml) 2 ml sequence of Os06g5130 and Os06g,39520 (corresponding to Sucrose 30 g sequence ap000399 and ap004236 in FIG. 2) was 74% over Proline 500 mg all, and the identity at the nucleotide level over the entire Glutamine 500 mg coding sequence was 69%. In both cases the program BEST Casein enzymatic hydrolysate (CEH) 300 mg 50 FIT with default parameters was used. The polypeptides deduced from Os02.g43090 (one transcript), Os06g,05130, NBO: NB media, plus 30 g/l mannitol and 30 g/l sorbitol, Os06g,39520 and Os011g43820 correspond to 298, 427, 423 added before pH adjustment. and 425 amino acids respectively. NBCT+selection (Hygromycin-H30): NB media plus 30 Activity of the encoded proteins was surmised from the mg/l hygromycin, Timentin 150 mg/ml. Claforan 200 mg/l. 55 high degree of sequence identity with known polypeptides NBCT+selection (Hygromycin-H50); NB media plus selec shown to have this activity. Furthermore, the observed effect tion 50 mg/l hygromycin, 200 mg/l Claforan and Timentin on palmitic acid levels of gene inactivating constructs based 150 mg/ml. on these sequences was also consistent with this conclusion PRCT+Selection:NB media with no 2,4-D, plus following (see below). added after autoclave: BAP 2 mg/l; NAA, 1 mg/l; ABA, 5 60 Expression of the gene family was complex, with at least mg/l. Claforan, 100 g/l. Timetin: 150 mg/ml+selection. seven transcripts predicted from these four genes. On the RCT+Selection: NB media with no 2,4-D, plus following basis of RT-PCR experiments that were performed and rela added after autoclave: BAP; 3 mg/l; NAA, 0.5 mg/l; Timetin, tive numbers of clones recovered from EST libraries, it 150 mg/ml. Claforan, 100 mg/1+selection. appeared that RNA from Os06g,5130 was relatively abundant /2 MS media: MS salts and vitamin mixture, 2.21 g; 65 in the grain, while Os11.g43820 was expressed at a moderate Sucrose, 10g per liter, add 2.5g phytogel/l, after autoclaving levels in that tissue and the other genes were only expressed at add 0.05 mg/l NAA and Timentin 150 mg/ml. a low level. US 8,530,724 B2 37 38 Example 3 Os02.g485.60 were indistinguishable by sequence. The sequence deduced from Os02g485.60 was clearly expressed Identification and Isolation of Fad2 Genes from Rice in the grain.

Proteins encoded by Fad2 genes (Fatty acid desaturase 2) 5 Example 4 are responsible for the introduction of a double bond into 18:1 fatty acids—they are A12 desaturases. The Genbank sequence from the Arabiodopsis locus athd12aaa was used to Expression of FatB and Fad2 Genes in Rice search the nr and htgs databases for Oryza sativa using Mega 10 blast at default settings. The most similar sequences retrieved To determine which, if any, of the 4 putative FatB and 3 from rice were translated and examined for the presence of Fad2 genes identified in rice as described in Examples 2 and conserved hydrophobic motifs FSYVVHDLVIVAALL 3 might be expressed in developing rice grain, reverse tran FALVMI (SEQ ID NO:27). AWPLYIAQGCVLTGVWVIA scription polymerase chain reaction (RT-PCR) assays were (SEQID NO:28), ISDVGVSAGLALFKLSSAFGF (SEQID 15 carried out. Since the genes were closely related in sequence, NO:29), VVRVYGVPLLIVNAWLVLITYLQ (SEQ ID primers had to be designed that were specific for each of the NO:30) and the histidine rice sequences HECGHH (SEQ ID genes, to assay transcripts for each gene specifically. Regions NO:31), HRRHHA (SEQID NO:32) and HVAHH (SEQ ID of sequence divergence were identified from the alignments NO:33). The translated amino acid sequences of the isoforms (FIGS. 6 and 8) and several primer pairs were designed and obtained are shown in FIG. 7. tested. Primer sequences for detecting expression of the puta FIG. 8 provides an alignment of Fad2 sequences showing tive FatB genes are given in Tables 3 and 4. As an internal location of 5' UTR in isoform AP004.047 (lowercase) and standard against which to compare expression levels, RT location of primers used for amplification by RT-PCR (under PCR was also carried out on the RNA for expression of the lined). The location of the stop codon is indicated by a box rice gene encoding alpha-tubulin, OSTubA1. This gene was and untranslated regions downstream of the stop codon are in 25 known to be expressed in all actively dividing tissues and was lower case. not affected by the hormone ABA and so was suitable as a Four gene sequences are recovered as being highly similar constitutively expressed control for leaf and grain analysis. from the rice genome when the nucleotide sequence encoding RNA was prepared from rice grains approx 15 days after the protein with the amino acid sequence of AP004.047 was flowering using the Qiagen RNeasy kit following protocols used to search the rice genome using the program BLAST 30 supplied by the manufacturer. DNAse treatment (DNA-free with the default parameters. The overall structure of these kit, Ambion) was then used to remove contaminating DNA genes are shown in FIG. 9. The genes correspond to the from the RNA preparation. The RT-PCR mix contained 5ul of protein sequences as follows. The protein sequence 5x Qiagen OneStep RT-PCR buffer, 1 ul of dNTP mix (con AP004.047 (also called FAD2-1 herein) corresponded to the taining 10 mM of each dNTP), 15 pmol of each primer and gene Os02.g48560, the sequence AP005168 (also called 35 approximately 20 pg of RNA to a final volume of 25ul. The FAD2-2 herein) corresponded to Os07g23410, and the following RT-PCR cycling program was used for the RT-PCR sequence contig2654 corresponded to Os07g23430. In addi amplifications: 30 min at 50° C. (reverse transcription), 15 tion there was a sequence that shared an intriguing extent of min at 95°C. (initial PCR activation), 30 cycles of (1 min at sequence identity but was clearly different to these sequences 94°C., 1 minat 57°C., 1 min at 72°C.) (PCR amplification), and may be a pseudo-gene. This sequence was OsO7g23390. 40 then a final extension of 10 min at 72° C. Unlike the FatB genes, the Fad2 genes did not contain any introns. An alignment of all the protein coding sequences is TABLE 3 shown in FIG. 10. The sequence identity over the entire Primers designed to amplify and discriminate coding region for Os02.g48560 to Os07g23410 was 79%. relative expression of the putative FatB The molecular weight of the polypeptide encoded by 45 transcripts usind one-step RT-PCR Os02.g48560 (ie AP004.047) was 44.35 kDa before process ing and contained 388 amino acids. The molecular weight of Genbank the polypeptide encoded by Os07g23410 was 44.9 kDa and IDAChi Gene eSe contained 390 amino acids. These deduced polypeptides had Ampli- Contig Primer 77% sequence identity as determined by the program BEST 50 fied no. ID name Primer Sequence FIT using default parameters. The deduced polypeptide from FatB-1 APOOO399 po399F2 CGCTGCTACCAAACAATTCA Os07g23430 had a molecular weight of 41 kDa (363 amino (SEQ ID NO: 34) acids) and from Os07g23390 was 24 kDa (223 amino acids). pO399R2 TTCTGTGTTGCCATCATCG An alignment of all the deduced polypeptide sequences is (SEO ID NO: 35) shown in FIG. 7. 55 FatB-2 AC10887 Op5291 F2 CAGGAAATAAAGTTGGTGATGATG The sequence corresponding to Os02.g48560 was (SEQ ID NO: 36) expressed in the grain and this observation was consistent p887 OR CTTCACAATATCAGCTCCTGACTC with data from the relative frequencies of clones for this gene (SEO ID NO : 37) in EST libraries where cognate sequences were recovered FatB-3 APOO5291 p5291 F2 CAGGAAATAAAGTTGGTGATGATG from grain cDNA libraries. Sequences corresponding to two 60 (SEQ ID NO: 38) of the isoforms encoded on chromosome 7 (OsO7g23430, p5291R CTTCACAATGTCAGCCTTCAC 23410) have been recovered from a leaf EST library but the (SEO ID NO: 39) sequence corresponding to the other gene (Os07g23390) has FatB- 4 APOO4236 p4236F2 ACAGGCCTGACTCCACGAT not yet been reported; we concluded it may be expressed at (SEQ ID NO: 4 O) low levels if at all. 65 p423.6R2 GTCCAGAGTGCTTGTTGCAG In conclusion, the rice Fad2 gene family was also a com (SEQ ID NO: 41) plex gene family. The two transcripts deduced from US 8,530,724 B2 39 40 TABLE 3 - continued This conclusion is corroborated by EST database search ing. When the Fad2-1 (TIGR Os02.g48560) sequence was Primers designed to amplify and discriminate relative expression of the putative FatB used to search rice EST sequences, transcript sequences were transcripts using one-step RT-PCR present in panicle, root and whole plant clNA libraries. In 5 contrast, Fad2-2 (TIGR Os07g23410) and Fad2-3 (TIGR Genbank Os07g23430) sequences were present only in leaf, shoot or IDAChi whole plant libraries. The sequence for Os07g23390, the Gene le See Ampli- Contig Primer Fad2-like gene considered to be a pseudogene, was not fied no. ID name Primer Sequence present in any of the EST libraries. Similarly, FatB-1 (TIGR 10 Os06g05130) sequences were present in both leafand panicle OSTubA1 AF182523 OSTUA1 F TACCCACTCCCTCCTTGAGC EST libraries, whereas FatB-2 sequences (TIGR (SEQ ID NO: 42) Os11.g43820) were present only in panicle or whole plant OSTUBA1 R AGGCACTGTTGGTGATCTCG EST libraries and FatB-4 (TIGR Os06g,39520) only in a leaf (SEQ ID NO: 43) library. FatB-3 (AP005291, Os02.g430900) sequences 15 although expressed at a relatively low level to the others in both leaf and grain as judged by RT-PCR, were present in TABLE 4 panicle and whole plant EST libraries. These searches used the BLAST program on the NCBI website (ncbi.nlm.nih.gov/ Primers designed to amplify and discriminate BLAST/Blast.cgi) using the EST database and limiting the relative expression of the putative Fad2 search to sequences from rice. transcripts usind one-step RT-PCR. Based on these data, Fad2-1 and FatB-2 were considered to Genbank IDA be the genes that should be down-regulated for alteration of Gene Chinese grain lipid. FatB-3 was also thought be important in this Ampli- Contig Primer regard. fied no ID ale Primer Sequence 25 Fad2 - 1 APOO4 O47 pFad2-1F CACAAAGAGGGAGGGAACAA Example 5 (SEQ ID NO: 44) pFad2-1R GAAGGACTTGATCACCGAGC Construction of Gene Silencing Constructs and (SEQ ID NO: 45) Transformation of Rice Fad2-2 Contig2654 UTR 2654 CACAACATCACGGACACACA 30 F (SEQ ID NO: 46) Creation of DuplexRNA Construct for Inhibition of Fad2 UTR 2654 GCAAGACCGACATGGCTAAT Expression R (SEO ID NO: 47) A construct was designed to express a duplex RNA (hairpin Fad2-3 APOO51.68 UTR 51.68 ACGTCCTCCACCACCTCTT RNA) in developing rice grain in order to reduce expression F (SEQ ID NO: 48) 35 of Fad2-1. By targeting common regions of the three Fad2 UTR 51.68 CAGAAGCAGTGACATACCCAAG gene sequences, the construct was designed so that it would R (SEQ ID NO: 49) be effective for all three of the identified Fad2 genes in rice OsTuloa1 AF182523 OSTUBA1 TACCCACTCCCTCCTTGAGC grain in order to potentially maximize the effect on fatty acid F (SEO ID NO: 5O) composition. To improve silencing efficiency, the construct OSTUBA1, AGGCACTGTTGGTGATCTCG 40 contained an intron between the sense and antisense portions R (SEQ ID NO: 51) of the inverted repeat sequences as described by Smith et al. (2000). Results from the RT-PCR experiments demonstrated that A 505 basepairfragment was amplified by PCR from the 5' the sequence Fad2-1 gene (TIGR rice database identifier end of the Fad2-1 gene using the oligonucleotides pFad2-F LOC Os02.g48560) was highly expressed in both grain and 45 5'-AAAGGATCCTCTAGAGGGAGGAGCAGCAGAAGC leaf relative to the genes encoding the other isoforms. The other two Fad2 genes (LOC Os07g23410 and 3' (SEQ ID NO:52) and pFad2-R 5'-AAAACTAGTGAAT LOC Os07g23430) appeared to be expressed at low levels TCTACACGTACGGGGTGTACCA-3' (SEQ ID NO:53). and primarily in the leaf. The analysis of genes encoding the The PCR product was ligated into pGEM-Teasy, transformed FatB isoforms showed that FatB-1 (Genbank identifier into E. coli and colonies containing the insert identified. The AP000399, Tigr LOC Os06g05130) and FatB-2 (Genbank 50 Xbal/EcoRI fragment from the plasmid designated pCEM identifier AC108870, TIGR identifier Os11g43820) were T-Fad2, containing the 505 bp Fad2 fragment, was then more highly expressed in the grain than the other two genes. ligated in the sense direction into the vector The ToS-17 transpositional insertion mutant had an insertion ZLRint9 BC3895 (obtained from Zhongyi Li, CSIRO Plant in the gene encoding AP000399. Industry) containing the intron Rint9. A BamHI/Spel frag In leaf tissue, FatB-1 (Genbank identifier AP000399, 55 ment from pCEM-T-Fad2 was then ligated (in the antisense TIGR LOC Os06g05130) and FatB-4 (AP004236, TIGR orientation) into the resultant plasmid so that an intron con LOC Os06g39520) were more highly expressed, referring to taining hairpin construct was formed. The BamHI/KpnI frag the relative abundance of mRNA transcripts from the genes. ment containing the Fad2-1 intron containing hairpin was When compared to the abundance of the tubulin gene tran then inserted into the same restriction sites of the Scripts as a standard, which was a moderately abundant 60 pBx17casNOT vector (Zhongyi Li, personal communica mRNA in wheatgrain and was therefore expected to similarly tion), containing the BX17 seed specific promoter containing abundant in rice grain, all the FatB and Fad2 mRNAs accu a Nos terminator/polyadenylation sequence so that the silenc mulated to low levels as determined by RT-PCR. However, ing gene would be expressed in developing seed in the order this conclusion was based on the assumption that the primers, (promoter) sense-intron-antisense (terminator). The HindIII/ for each of the genes tested, hybridized to the target tran 65 NotI fragment containing the BX17 promoter and Fad2-1 scripts with similar efficiency to the tubulin primers/tran inverted repeat region was then inserted into the same restric Script. tion sites of the binary vector pWBvec8 (Wang et al., 1998) US 8,530,724 B2 41 42 that contained a selectable maker gene conferring hygromy (w/w) and that of linoleic acid decreased from 37% to about cin resistance. This vector was then introduced into Agrobac 13% in the rice line most affected (Line 22A). Surprisingly, terium and used for rice transformation as described in the proportion of palmitic acid in the Fad2 lines was also Example 1. The duplex RNA construct was designated decreased, for example in Line 22A to less than 14% as dsRNA-Fad2-1. compared to the control (18%). Creation of DuplexRNA Construct for Inhibition of FatB Expression In the FatB dsRNA lines, the reduction in the proportion of A 665-basepair fragment of the rice palmitoyl-ACP palmitic acid in the grain was correlated with an increase in thioesterase FatB-1 gene (Tigr LOC Os06g05130) was the linoleic acid content while the proportions of oleic acid amplified by PCR using primers with the following 10 and linolenic acids were essentially unchanged. It was noted Sequences: Rte-s1, 5'-AGTCATGGCTGGTTCTCT that the extent of the decrease in the proportion of palmitic TGCGGC-3' (SEQ ID NO:54) and Rite-a1, 5'-ACCATCAC acid in both Fad2 and FatB transgenic lines was similar, but CTAAGAGACCAGCAGT-3' (SEQ ID NO:55). This PCR the extent of increase in the linoleic acid level in the FatBlines fragment was used to make an inverted repeat construct with was much less than the extent of the decrease observed in the one copy of the fragment in the sense orientation and a second 15 Fad2 lines. That is, the extent of the change in levels of copy in the antisense orientation, separated by the intron linoleic was greater with the Fad2 construct. sequence from the 5' UTR of the cotton microsomsal (O6-de An interesting insight into the FatB catalysed step of the saturase GhPad 2-1 gene (Liu et al., 1999). The inverted repeat pathway is provided by analysis of the Tos-17 insertional construct was Subsequently inserted into the SacI site knockout of one isoform of FatB, FatB-1. In the Tos-17 between the Ubil promoter and Nos terminator of pubilcas mutant, the extent of the change in the proportions of palmitic NOT (from Zhongyi Li based on sequence described in Liet acid and oleic acid was reduced compared to the FatB dsRNA al., 1997). The inverted repeat portion of rice FatB with the lines. These results indicated that genes encoding the FatB pUbil promoter was then inserted in the NotI site of the binary isoforms differed in their function. vector pWBVec8 and introduced into Agrobacterium as for When the results of the proportions of linoleic acid versus the Fad2 construct described above. The duplex RNA con 25 oleic acid were plotted as a scatter plot (FIG. 14), it was clear struct was designated dsRNA-FatB-1. that the relationship between these two fatty acids in the Fad2 Analysis of Fatty Acid Composition in Transformed Rice knockouts was the same as in wildtype rice, although the Ten independent fertile transgenic plants obtained with proportion of linoleic acid was vastly reduced. In contrast, dsRNA-Fad2-1 were tested for the presence of the dRNA with the FatB knockout and gene by PCR using one primer corresponding to a site within 30 the promoter region and a second primer for the end of the Fad2 sequence. Nine of the ten plants were found to be TABLE 5 positive in the PCR reaction and therefore contained the Fad2 GC analysis of fatty acid composition in rice grain of RNAi construct. Similarly, 23 fertile transgenic lines were FatB and Fad2 mutants tested for the FatB RNAi construct and 20 lines were found to 35 be PCR positive. Grain- Myristic Palmitic Stearic Oleic Linoleic Linolenic To analyse the effect of the transgenes on fatty acid com Mutant (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) position, total lipid was isolated from grain and leaf samples Wild type O.70 8.83 1.64 38.41 36.42 29 (WH12) of the transformed rice plants. This was also done for a rice FatB ToS17 0.72 S.13 2.33 37.15 38.61 .87 mutant line containing a ToS 17 insertional sequence in the 40 insertional gene for FatB-1 (TIGR locus Os06g5130 corresponding to mutant FatB dsRNA O.S8 1.43 1.81 34.92 46.60 .91 the protein identified by the Accession No. AP000399) to transformed compare the effect of specifically inactivating this gene. Fatty ine acid composition was determined for each lipid extract by Fad2 dsRNA O.S8 4.26 2.11 64.94 12.62 .23 GC-FAME as described in Example 1. The data are presented 45 transformed in Tables 5 to 7 and some of that data is presented graphically ine Control for O.85 7.91 2.60 33.23 39.84 .76 in FIGS. 11 to 13. The proportion of each fatty acid was ToS17 expressed as a percentage of the total fatty acid in the seed oil Control for 1.03 8.86 1.84 34.08 39.63 75 of the grain as determined by HPLC as described in Example FatB 1. 50 dsRNA Control for 1.02 747 2.38 36.03 37.42 SO The most striking and Surprising aspect of the results was Fad2 the extent of the change in grain oleic acid and linoleic acid dsRNA composition in the Fad2 dsRNA plants. The proportion of oleic acid in some lines increased from 36% to at least 65% TABLE 6 GC analysis of fatty acid composition in rice leaves of FatB and Fad2 mutants Lauric Myristic Palmitic Stearic Oleic Linoleic Linolenic Leaf-mutant (C12:0) (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) Wild-type (WF2) O.80 14.43 1.90 2.32 8.99 68.96 FatB ToS17 O.34 11.SS 1.84 2.24 15.04 67.70 insertional mutant FatB dsRNA O.56 101 14.39 2.09 2.07 1321 64.56 transformed line US 8,530,724 B2 43 44 TABLE 6-continued GC analysis of fatty acid composition in rice leaves of FatB and Fad2 mutants Lauric Myristic Palmitic Stearic Oleic Linoleic Linolenic Leaf-mutant (C12:0) (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) Fad2 dsRNA transformed line Control for O.39 10.52 18O 2.30 15.61 67.65 ToS17 Control for 0.72 1.15 13.30 2.03 4.04 24.62 52.28 FatB dsRNA

TABLE 7 15 We also concluded from the results presented in this Example that crossing the dsRNA Fad2 plants with the Relative amounts of grain fatty acids in mutant lines compared to dsRNA FatB plants or Tos-17 FatB plants to combine the corresponding control lines (90 in mutant/96 in corresponding control mutations would further increase the relative proportion of Myristic Palmitic Stearic Oleic Linoleic Linolenic oleic acid and further decrease palmitic and linoleic acid (C14:0) (C16:0) (C18:0) (C18:1) (C18:2) (C18:3) levels. Grain fatty Example 6 acids

FatB ToS17 O.85 O.8451* O.899 1.118* O.9691 1.06 Production and Use of Antibodies insertional mutant 25 Antibodies were raised by synthesizing 15 or 16-mer pep FatB dsRNA 0.57* 0.6060* 0.980 1.025 1.176* 1.09 tides that were present in the deduced sequence of FatB. The transformed ine peptides used to raise antibodies against FatB were: Fad2 dsRNA 0.570* 0.81678 O.887: 1802* O.3373* O.822* FatB-U1 Ac-CGMNKNTRRLSKMPDE (SEQ ID NO:56). transformed This corresponds to the translated sequence of FatB (Ac ine 30 cession No. AP000399) from amino acid position number Leaf fatty 259 and was also found in sequences translated from acids AP005291, AC108870 and AC004236. However, the FatB ToS17 ind 0.911* 0.977 1.03 1.037 O.9992 sequence was only identical between the four isoforms in insertional the sequence TRRLSKMPDE (SEQ ID NO:57). mutant 35 FatB-U2. Ac-CGEKQWTLLDWKPKKPD (SEQ ID FatB dsRNA ind O.92.47 0.969 195* 1864: 0.8098: NO:58). This sequence was found in the translated transformed sequence of all four FatB isoforms. ine FatB-99. Ac-CGAQGEGNMGFFPAES (SEQ ID NO:59). Statistically significant change This sequence was found only in AP00399 and was at the very C terminus of the deduced polypeptide. to a lesser extent in the FatB Tos-17 line, although the rela 40 After synthesis the peptides were coupled to either Oval tionship between linoleic acid and oleic was similar, it is buminor Keyhole Limpet Haemocyanin protein (KLH) using shifted by a constant. This meant that there was more linoleic the cross-linker MBS (maleimidobenzoic acid N-hydroxyl acid in the FatB knockout plants for a given amount of oleic Succinamide ester) using standard techniques. The cross acid than in wild-type or Fad2 knockout plants. This was linked peptide was dialysed and lyophilized and injected into consistent with the idea that knockout of FatB influenced the 45 rabbits at two weekly intervals for two months with Friends pathways controlling the amounts of oleic and linoleic acid incomplete adjuvant at a concentration of approx 1 mg/ml. but not the step directly linking oleic acid and linoleic acid Antisera raised against FatB-99 detected a clear difference which was controlled by Fad2. between FatB isoforms in that a polypeptide of 20 kDa The results of the proportion of linoleic acid versus palm present in wild-type rice was missing in the ToS-17 mutant itic were also plotted for all of the rice lines analysed. A 50 line having an insertion in the gene corresponding to TIGR positive linear relationship was observed for the Fad2 knock identifier Os06g5130, the product corresponds to FatB-1, the out lines, inverse of what was observed for linoleic versus sequence is represented by accession No. AP000399 (FIG. oleic acid. For the FatB lines, however, a different relation 18). Although this was different to the expected size of approx ship is observed (FIG. 15). A difference in the relationship 40kDa, such a discrepancy had been noticed before with FatB isoforms Different size of FatB products have been observed between oleic and palmitic acid was also observed when the 55 in developing and mature Cuphea Wrightii seeds showing five Fad2 dsRNA plants and FatB dsRNA plants were plotted as a different FatB isoforms, longer size in mature seeds and scatter plot (FIG. 16). These results confirmed that the rela shorter product in mature seeds (Leonard et al., 1997). tionship between palmitic and linoleic acid (and oleic acid) The antisera can be used to detect FatB protein in the was different for the two perturbations of the pathway. transgenic or mutant plant samples and confirm the extent of Principal component analysis of the proportions of the 60 gene inactivation. various fatty acids under different perturbations of the path way confirm that principal component 1 (which indicates the Example 7 axes that contribute the greatest variation) was composed of the proportions of linoleic versus oleic whereas the principal Identification of Mutants in Rice Fad2 component 2 (the second most important set of axes) was 65 composed of proportions of linoleic and oleic acid versus PCR products spanning the active sites (essentially posi palmitic acid). This is illustrated in FIG. 17. tions 330 to 1020 if the initiating ATG is taken as the start of US 8,530,724 B2 45 46 the numbering in TIGR Loc Os2.g48560) of Fad2-1 (coding for 8 weeks. The gas sample released from brown rice can be sequence corresponding to AP00 4047 in NCBI database, obtained in the headspace of a vial by either heating at 80°C. TGR locus identifier LOC Os02.g48560) will be produced or by natural diffusion. The volatile components in the head from rice DNA extracted from a large number of different rice space can then be analysed by direct injection into a GC or accessions. The size of the products will be up to 800 bp 5 GC-MS machine and analysis of the gas chromatographic depending on the primers used. Two sets of overlapping profiles (Suzuki et al., 1999). Another method for analysis of primer pairs may need to be used. One possible set of primers Volatiles in the headspace is through the trapping of volatiles onto a suitable matrix (eg 250 mg Tenax GR) as described by Nielsen et al. (2004) using nitrogen as a purge gas. The 10 desorption of the aroma compounds is then done thermally Set A. and the trapped molecules are analysed by GC and identified GTGCCGGCGGCAGGATGACGG (SEQ ID NO: 6O) using standards. (positions 5-20 in the alignment shown in FIG. 10) The expectation that storage of rice would be improved in GCCGACGATGTCGTCGAGCAC (SEO ID NO : 61) rice lines with low linoleic acid is based on a number of (reverse complement of positions 379-398 in the 15 observations. Suzuki et al. (1999). have presented data that alignment shown in FIG. 10 the amount of free linoleic acid increases during storage and Set B that the amount of Volatile aldehydes such as pentanal, hexa TGCCTTCTCCGACTACTCGG (SEQ ID No. 62) nal and pentanol increase three fold at 35C. The correlation of (positions 360-379 in FIG. 10 hexanal and volatile aldehydes with odour has been noted by 2O other authors as well. On the other hand, Zhou et al. (2002) CCTCGCGCCATGTCGCCTTGG (SEO ID NO: 63) (reverse complement of positions 1099-1118 in FIG. found a reduction of total linoleic acid upon storage and 10). related this to the decomposition of linoleic acid to other products, including volatiles responsible for off-odours. The The annealed products will then be subjected to melting in differences in the results may be due to differences in the a Rotorgene 6000 instrument (Corbett Life Science) or a 25 extraction and analytical methods. comparable instrument where differences in melting of het The production of hexanal for linoleic acid in vitro has eroduplexes can be sensitively detected by means of alter been demonstrated by Nielsen et al. (2004). ation of fluorescence of a dye LC Green. Hundreds and pos It will be appreciated by persons skilled in the art that sibly thousands of rice lines can be screened daily by this numerous variations and/or modifications may be made to the technique. 30 invention as shown in the specific embodiments without The PCR products from samples showing an altered ther departing from the spirit or scope of the invention as broadly mal profile will be sequenced and the mutations in Fad2 described. The present embodiments are, therefore, to be identified. Selected mutations which inactivate Fad2 can then considered in all respects as illustrative and not restrictive. be crossed into elite rice lines to produce rice lines with All publications discussed and/or referenced herein are reduced Fad2 activity and therefore high oleic acid. If two or 35 incorporated herein in their entirety. all of the Fad2 isoforms need to be eliminated then this can be This application claims priority from AU 2006903810, the achieved by identifying lines with the required mutations in entire contents of which are incorporated herein by reference. different isoforms and combining the mutations in an elite Any discussion of documents, acts, materials, devices, rice line through marker assisted breeding. At least the Fad2-1 articles or the like which has been included in the present gene needs to be inactive for substantial increases in oleic 40 specification is solely for the purpose of providing a context acid content or decreased linoleic acid content. Inactivation of for the present invention. It is not to be taken as an admission one or more of the additional Fad2genes will further increase that any or all of these matters form part of the prior art base oleic acid content and decrease linoleic acid content. Mutants or were common general knowledge in the field relevant to having mutations in additional Fad2 genes may be identified the present invention as it existed before the priority date of in the same way as for Fad2-1, using specific primers for the 45 each claim of this application. additional Fad genes. REFERENCES Example 8 Abdullah et al. (1986) Biotechnology 4: 1087. Stability Analysis—Detection of Hexanal Production 50 Akagi et al. (1995) Plant Physiol. 108,845-846 in Storage Almeida and Allshire (2005) TRENDS Cell Biol 15: 251 258. Experiments are underway with FSA, Werribee to detect Anai et al. (2003) Plant Cell Rep. 21,988-992. the production of hexanal on Storage in wildtype rice. This Ascherio and Willett (1997) Am. J. Clin. Nutr. 66: 1006S involves GC using a sampler to detect the volatiles in the 55 101OS. headspace of grain stored at high temperature (40°C.). Once Bligh and Dyer Canadian J. Biochem. (1959) 37: 911-917. the system is optimized (and also we have sufficient quantity Boggs et al. (1964) J. Food Sci. 29:487-489. of grain) we will undertake a comparison of the production of Bonanome and Grundy (1988). N. Engl. Med. 318: 1244 Volatiles, particularly hexanal, upon storage of wildtype and 1248. Fad2 RNAi and FatB RNAi rice lines and suitable combina- 60 Brandt et al. (1985) Carlsberg Res. Commun. 50: 333-345. tions of genotypes. This is an important quality issue in the Broun et al., (1999) Annu. Rev. Nutr. 19: 197-216. rice industry for storage of grain and also of storage of bran. Buhr et al. (2002). Plant J.30: 155-163. The production and detection of other volatiles, which could Capecchi (1980) Cell 22:479-488. have a role in affecting grain quality, is also being investi Champagne et al. (1995) Cereal Chem 72:255-258. gated, both with FSA, Werribee and CSIRO Entomology. 65 Changet al., (1978). J. Am. Oil Chem. Soc. 55: 718–727. Around 10 g of raw brown rice is required for headspace Chapman et al., (2001). J. Am. Oil Chem. Soc. 78:941-947. analysis. The brown rice is stored at 4°C. (control) and 35°C. Choudry et al. (1980) Phytochemistry 19: 1063-1069. US 8,530,724 B2 47 48 Clapp (1993) Clin. Perinatol. 20:155-168. Oil World Annual (2004) International Seed Testing Associa Colotet al. (1987) EMBOJ 6:3559-3564. tion (ISTA) Mielke GmbH, Hamburg, Germany Comai et al. (2004) Plant J 37: 778-786. Pasquinelli et al. (2005) Curr Opin Genet Develop 15: 200 Curiel et al. (1992) Hum. Gen. Ther. 3:147-154. 205. Dougherty et al. (1995). Am. J. Clin. Nutr. 61:1120-1128. 5 Perriman et al. (1992) Gene 113: 157-16. Eglitis et al. (1988) Biotechniques 6:608-614. Radcliffe et al (1997) Biochem Arch 13: 87-95. Fenandez San Juan (1995). Alimentaria 33:93-98. Resurreccion etal (1979) Journal of the Science of Food and Fujimura et al. (1985) Plant Tissue Culture Letters 2:74. Agriculture, 30: 475-481. Graham et al. (1973) Virology 54:536-539. Roche and Gibney (2000) Am. J. Clin. Nutr. 71: 232S-237S. Gunstone (2001) Inform 11: 1287-1289. 10 Ha (2005) Nutrition research 25,597-606. Rukmini et al. (1991). Journal of The American College of Haseloff and Gerlach (1988) Nature 334:585-591. Nutrition 10:593-601. Henikoffet. al. (2004) Plant Physiol 135: 630-636. Sebedio et al. (1994) Fett. Wiss. Technol. 96: 235-239. Hu et al. (1997). N. Engl. J. Med. 337: 1491-1499. Senior (1998) Biotech. Genet Engin. Revs. 15:79-119. Jennings and Akoh (2000) Journal of Agricultural and Food 15 Shibuya et al. (1974) Journal of the Japanese Society of Food Chemistry, 48:4439-4443. Science and Technology 21:597-603. Jones et al. (1995) Plant Cell 7: 359-371. Shin et al. (1986) J. Food Sci. 51:460-463. Kinney (1996).J. Food Lipids 3:273-292. Shippy et al. (1999) Mol. Biotech. 12: 117-129. Kodama et al. (1997) Plant Molecular Biology 33:493-502. Slade and Knauf (2005) Transgenic Res 14: 109-115. Kohno-Murase etal. (2006). Transgenic Research 15:95-100. Smith et al. (2000) Nature 407:319-320. Koziel et al. (1996) Plant Mol. Biol. 32:393-405. St Angelo et al. (1980) J Lipids 1:45-49. Langridge et al. (2001) Aust J Agric Res 52: 1043-1077. Stefanov et al. (1991) Acta Biologica Hungarica 42:323-330. Lemieux (2000) Current Genomics 1:301-311. Stoutjesdijket al., (2000). Biochem. Soc. Trans. 28:938-940. Leonard et al. (1997) Plant Molecular Biology, Volume 34, Stoutjesdijk et al. (2002) Plant Physiology 129: 1723-1731. ISSue 4: 669-679. 25 Stymne and Stobart (1987) Lipids, Vol. 9: 175-214. Liet al. (1997) Molec Breeding 3:1-14. Suzuki et al. (1999) J. Agric. Food Chem. 47: 1119-1124. Lu et al. (1993) J. Exp. Med. 178:2089-2096. Taira et al. (1988).J. Agric. Food Chem. 34:542-545. Liu et al. (1999) Aust. J. Plant Physiol. 26:101-106. Thelen and Ohlrogge (2002) Metabolic Engineering 4: 12-21 Liu et al. (2002a). J. Am. Coll. Nutr. 21: 205S-211S. Theriault et al. (1999). Clin. Biochem. 32: 309-19. Liu et al. (2002b). Plant Physiol. 129: 1732-1743. 30 Tholstrup et al. (1994) Am. J. Clin. Nutr. 59:371-377. Mensink and Katan (1990). N. Engl. J. Med. 323: 439-445. Toriyama et al. (1986) Theor. Appl. Genet. 205:34. Mikidlineni and Rocheford (2003) Theor. Applied Genetics, Tsugita et al (1983) Agricultural and Biological Chemistry 106, 1326-1332. 47: 543-549. Millar and Waterhouse (2005) Funct Integr Genomics 5:129 Tsuzuki et al (2004) Lipids 39:475-480. 135. 35 Voelker et al. (1996). Plant J. 9: 229-241. Moghadasian and Frohlich (1999) Am. J. Med. 107:588-94. Wagner et al. (1992) Proc. Natl. Acad. Sci. USA 89:6099 Morrison (1988) J Cereal Sci 8:1-15. 6103. Most et al. (2005) Am J Clin Nutr 81:64-8. Wang et al. (1998) ACTA Hort. 461:401-407. Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453. Waterhouse et al. (1998) Proc. Natl. Acad. Sci. USA 95: Nielsen et al. (2004) Journal of Agricultural and Food Chem 40 13959-13964. istry 52:2315-2321. Williams et al. (1999).J. Am. Coll. Cardiol. 33:1050-1055. Noakes and Clifton (1998) Am. J. Clin. Nutr. 98: 242-247. Yasumatsu et al. (1966) Agric. Biol. Chem. 30:483-486. Ohlrogge and Jaworski (1997) Annu Rev Plant Physiol Plant Zhou et al. (2002) Journal of Cereal Science 35:65-78. Mol Biol. 48:109-136. Zocket al. (1994) Arterioscler Thromb. 14: 567-575

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS: 83

<21 Os SEQ ID NO 1 &211s LENGTH: 425 212s. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs SEQUENCE: 1 Met Ala Gly Ser Leu Ala Ala Ser Ala Phe Phe Pro Gly Pro Gly Ser 1. 5 1O 15 Ser Pro Ala Ala Ser Ala Arg Ser Ser Lys Asn Ala Ala Val Thr Gly 2O 25 3 O

Glu Lieu Pro Glu Asn Lieu. Ser Val Arg Gly Ile Val Ala Lys Pro Asn 35 4 O 45

Pro Pro Pro Ala Ala Met Glin Val Lys Ala Glin Ala Glin Thr Lieu Pro SO 55 60 US 8,530,724 B2 49 50 - Continued

Lys Wall Asn Gly Thir Lys Wall Asn Luell Lys Thir Wall Lys Pro Asp Met 65 70 7s

Glu Glu Thir Wall Pro Ser Ala Pro Lys Thir Phe Tyr Asn Glin Luell 85 90 95

Pro Asp Trp Ser Met Lell Lell Ala Ala Ile Thir Thir Ile Phe Luell Ala 105 11 O

Ala Glu Lys Glin Trp Thir Lell Luell Asp Trp Pro Lys Pro Asp 115 12 O 125

Met Luell Wall Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Met 13 O 135 14 O

Wall Phe Arg Glin Asn Phe Met Ile Arg Ser Tyr Glu Ile Gly Ala Asp 145 150 155 160

Arg Thir Ala Ser Ile Glu Thir Luell Met Asn His Lell Glin Glu Thir Ala 1.65 17O 17s

Lell Asn His Wall Arg Thir Ala Gly Luell Luell Gly Asp Gly Phe Gly Ala 18O 185 19 O

Thir Pro Glu Met Ser Arg Asn Luell Ile Trp Wall Wall Ser Ile 195

Glin Luell Luell Wall Glu Glin Tyr Pro Ala Trp Gly Asp Thir Wall Glin Wall 21 O 215 22O

Asp Thir Trp Wall Ala Ala Ala Gly Asn Gly Met Arg Arg Asp Trp 225 23 O 235 24 O

His Wall Arg Asp Tyr Asn Ser Gly Arg Thir Ile Lell Arg Ala Thir Ser 245 250 255

Wall Trp Wall Met Met His Thir Arg Arg Lell Ser Lys Met Pro 26 O 265 27 O

Asp Glu Wall Arg Ala Glu Ile Gly Pro Phe Asn Asp Arg Ser Ala 285

Ile Thir Glu Glu Glin Ser Glu Luell Ala Thir Gly Asn Wall 29 O 295 3 OO

Gly Asp Asp Ala Thir Glu Glin Phe Ile Arg Lys Gly Lell Thir Pro Arg 3. OS 310 315

Trp Gly Asp Luell Asp Wall Asn Glin His Wall ASn Asn Wall Tyr Ile 3.25 330 335

Gly Trp Ile Luell Glu Ser Ala Pro Ile Ser Wall Lell Glu Lys His Glu 34 O 345 35. O

Lell Ala Ser Met Thir Lell Asp Tyr Arg Glu Gly Arg Asp Ser 355 360 365

Wall Luell Glin Ser Lell Thir Thir Wall Ser Glu Cys Thir Ser Ile Gly 37 O 375 38O

Ala Asp Glin Ala Ser Ala Ile Glin Asp His Lell Luell Glin Luell 385 390 395 4 OO

Glu Ser Gly Ala Asp Ile Wall Ala His Thir Glu Trp Arg Pro 4 OS 41O 415

Arg Ser His Ala Ala Ala Glu Asn Ala 42O 425

<210s, SEQ ID NO 2 &211s LENGTH: 298 212. TYPE : PRT <213> ORGANISM: Oryza sativa

<4 OOs, SEQUENCE: 2 Met Ala Gly Ser Leu Ala Ala Ser Ala Phe Phe Pro Gly Pro Gly Ser 1. 5 15 US 8,530,724 B2 51 52 - Continued

Ser Pro Ala Ala Ser Ala Arg Ser Ser ASn Ala Ala Wall Thir Gly 25

Glu Luell Pro Glu Asn Lell Ser Wall Gly Ile Wall Ala Lys Pro Asn 35 4 O 45

Pro Pro Pro Ala Ala Met Glin Wall Ala Glin Ala Glin Thir Luell Pro SO 55 6 O

Lys Wall Asn Gly Thir Lys Wall Asn Luell Thir Wall Pro Asp Met 65 70

Glu Glu Thir Wall Pro His Ser Ala Pro Lys Thir Phe Asn Glin Luell 85 90 95

Pro Asp Trp Ser Met Lell Lell Ala Ala Ile Thir Thir Ile Phe Luell Ala 105 11 O

Ala Glu Lys Glin Trp Thir Lell Luell Asp Trp Pro Lys Pro Asp 115 12 O 125

Met Luell Wall Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Met 13 O 135 14 O

Wall Phe Arg Glin Asn Phe Met Ile Arg Ser Tyr Glu Ile Gly Ala Asp 145 150 155 160

Arg Thir Ala Ser Ile Glu Thir Luell Met Asn His Lell Glin Glu Thir Ala 1.65 17O 17s

Lell Asn His Wall Arg Thir Ala Gly Luell Luell Gly Asp Gly Phe Gly Ala 18O 185 19 O

Thir Pro Glu Met Ser Arg Asn Luell Ile Trp Wall Wall Ser Ile 195

Glin Luell Luell Wall Glu Glin Tyr Pro Ala Trp Gly Asp Met Wall Glin Wall 21 O 215 22O

Asp Thir Trp Wall Ala Ala Ala Gly Asn Gly Met Arg Arg Asp Trp 225 23 O 235 24 O

His Wall Arg Asp Tyr Asn Ser Gly Arg Thir Ile Lell Arg Ala Thir Ser 245 250 255

Wall Trp Wall Met Met His Thir Arg Arg Lell Ser Lys Met Pro 26 O 265 27 O

Asp Glu Wall Arg Ala Glu Ile Gly Pro Phe Asn Asp Arg Ser Ala 28O 285

Ile Thir Glu Glu Glin Ser Glu Luell Ala 29 O 295

SEQ ID NO 3 LENGTH: 427 TYPE : PRT ORGANISM: Oryza sativa

< 4 OOs SEQUENCE: 3

Met Ala Gly Ser Lell Ala Ala Ser Ala Phe Phe Pro Wall Pro Gly Ser 1. 5 15

Ser Pro Ala Ala Ser Ala Arg Ser Ser ASn Thir Thir Gly Glu Luell 25 3O

Pro Glu Asn Luell Ser Wall Arg Gly Ile Wall Ala Pro Asn Pro Ser 35 4 O 45

Pro Gly Ala Met Glin Wall Lys Ala Glin Ala Glin Ala Lell Pro Wall SO 55 6 O

Asn Gly Thir Lys Wall Asn Lell Thir Thir Ser Pro Asp Glu Asp 65 70 7s

Ile Ile Pro Tyr Thir Ala Pro Thir Phe Asn Glin Luell Pro Asp 85 90 95 US 8,530,724 B2 53 54 - Continued

Trp Ser Met Luell Lell Ala Ala Wall Thir Thir Ile Phe Lell Ala Ala Glu 105 11 O

Glin Trp Thir Lell Lell Asp Trp Pro Lys Pro Asp Met Luell 115 12 O 125

Ala Asp Thir Phe Gly Phe Gly Arg Ile Ile Glin Asp Gly Luell Wall Phe 13 O 135 14 O

Arg Glin Asn Phe Lell Ile Arg Ser Glu Ile Gly Ala Asp Arg Thir 145 150 155 160

Ala Ser Ile Glu Thir Lell Met Asn His Luell Glin Glu Thir Ala Luell Asn 1.65 17O 17s

His Wall Thir Ala Gly Lell Luell Gly Asp Gly Phe Gly Ala Thir Pro 18O 185 19 O

Glu Met Ser Asn Lell Ile Trp Wall Wall Ser Lys Ile Glin Luell 195

Lell Wall Glu Arg Tyr Pro Ser Trp Gly Asp Met Wall Glin Wall Asp Thir 21 O 215 22O

Trp Wall Ala Ala Ala Gly Asn Gly Met Arg Arg Asp Trp His Wall 225 23 O 235 24 O

Arg Asp Asn Ser Gly Glin Thir Ile Luell Arg Ala Thir Ser Wall Trp 245 250 255

Wall Met Met Asn Lys Asn Thir Arg Arg Luell Ser Met Pro Asp Glu 26 O 265 27 O

Wall Arg Ala Glu Ile Gly Pro Tyr Phe Asn Gly Arg Ser Ala Ile Ser 285

Glu Glu Glin Gly Glu Lell Pro Pro Gly Thir Thir Phe Asp Gly 29 O 295 3 OO

Ala Ala Thir Glin Phe Thir Arg Gly Luell Thir Pro Trp Ser 3. OS 310 315

Asp Luell Asp Wall Asn Glin His Wall Asn Asn Wall Ile Gly Trp 3.25 330 335

Ile Luell Glu Ser Ala Pro Ile Ser Ile Luell Glu His Glu Luell Ala 34 O 345 35. O

Ser Met Thir Luell Asp Arg Lys Glu Gly Arg Asp Ser Wall Luell 355 360 365

Glin Ser Luell Thir Ala Wall Ser Gly Glu Asp Asp Gly Asn Thir Glu 37 O 375 38O

Ser Ser Ile Glin Cys Asp His Luell Luell Glin Luell Glu Ser Gly Ala Asp 385 390 395 4 OO

Ile Wall Ala His Thir Glu Trp Arg Pro Lys Arg Ala Glin Gly Glu 4 OS 41O 415

Gly Asn Met Gly Phe Phe Pro Ala Glu Ser Ala 42O 425

<210s, SEQ ID NO 4 &211s LENGTH: 423 212. TYPE : PRT <213> ORGANISM: Oryza sativa

<4 OOs, SEQUENCE: 4.

Met Ala Gly Ser Ile Ala Ala Ser Ala Phe Lieu. Pro Gly Ser Pro Ala 1. 5 15

Ala Ala Pro Pro Llys Ser Val Luell Gly Glu Arg Pro Asp Ser Luell Asp 25 3O

Val Arg Gly Ile Ala Ala Lys Pro Gly Ser Ser Ser Ser Ala Ala Ala 35 4 O 45 US 8,530,724 B2 55 56 - Continued

Lell Arg Ala Gly Lys Thir Arg Thir His Ala Ala Ile Pro Lys Wall Asn SO 55 6 O

Gly Gly Ser Ser Ala Lell Ala Asp Pro Glu His Asp Thir Met Ser Ser 65 70

Ser Ser Ser Ser Ala Ala Pro Arg Thir Phe Asn Glin Luell Pro Asp 85 90 95

Trp Ser Met Luell Lell Ala Ala Ile Thir Thir Ile Phe Lell Ala Ala Glu 105 11 O

Glin Trp Thir Lell Lell Asp Trp Pro Arg Pro Asp Met Luell 115 12 O 125

Thir Asp Thir Phe Gly Phe Gly Arg Met Ile His Glu Gly Luell Met Phe 13 O 135 14 O

Arg Glin Asn Phe Ser Ile Arg Ser Glu Ile Gly Ala Asp Arg Thir 145 150 155 160

Ala Ser Ile Glu Thir Lell Met Asn His Luell Glin Glu Thir Ala Luell Asn 1.65 17O 17s

His Wall Ser Ala Gly Lell Luell Gly Asp Gly Phe Gly Ser Thir Pro 18O 185 19 O

Glu Met Ser Asp Lell Phe Trp Wall Wall Ser Glin Met Glin Ala 195

Ile Wall Glu Arg Tyr Pro Cys Trp Gly Asp Thir Wall Glu Wall Asp Thir 21 O 215 22O

Trp Wall Gly Ala His Gly Asn Gly Met Arg Arg Asp Trp His Ile 225 23 O 235 24 O

Arg Asp Ser Wall Thir Gly His Thir Ile Luell Ala Thir Ser Lys Trp 245 250 255

Wall Met Met His Lys Lell Thir Arg Arg Luell Ala Arg Ile Pro Asp Glu 26 O 265 27 O

Wall Arg Thir Glu Ile Glu Pro Tyr Phe Phe Glu His Ala Ser Ile Wall 27s 285

Asp Glu Asp Asn Glin Lell Pro Luell Pro Asp Ile Glu Gly Ala 29 O 295 3 OO

Asn Wall Ala Tyr Wall Arg Thir Gly Luell Thir Pro Arg Trp Ala Asp 3. OS 310 315

Lell Asp Ile Asn Glin His Wall Asn Asn Wall Ile Gly Trp Ile 3.25 330 335

Lell Glu Ser Ala Pro Ile Ser Ile Luell Glu His Glu Luell Ala Ser 34 O 345 35. O

Ile Wall Luell Asp Tyr Arg Glu Gly Asp Ser Wall Luell Glin 355 360 365

Ser His Thir Thir Wall Thir Asp Asn His Ser Gly Glin Thir 37 O 375

Thir Luell His Glu His Lell Luell Ser Luell Glu Ser Gly Pro Thir Ile 385 390 395 4 OO

Wall Ala Arg Thir Met Trp Arg Pro Lys Gly Thir Arg Pro Glin Glu 4 OS 41O 415

Ser Ile Ile Pro Ser Ser Ser 42O

SEO ID NO 5 LENGTH: 6943 TYPE: DNA ORGANISM: Oryza sativa

< 4 OOs SEQUENCE: 5

US 8,530,724 B2 83 84 - Continued

Luell Luell Gly Arg Ala Gly Asn Gly Ala Ala Val Glin Arg Ser Pro 25

Thir Asp Lys Pro Pro Phe Thir Luell Gly Glin Ile Lys Lys Ala Ile Pro 35 4 O 45

Pro His Phe Glin Arg Ser Wall Ile Ser Phe Ser Tyr Wall Wall SO 55 6 O

His Asp Luell Wall Ile Wall Ala Ala Luell Luell Tyr Phe Ala Luell Wall Met 65 70

Ile Pro Wall Luell Pro Ser Gly Met Glu Phe Ala Ala Trp Pro Luell Tyr 85 90 95

Trp Ile Ala Glin Gly Wall Luell Thir Gly Wall Trp Wall Ile Ala His 105 11 O

Glu Gly His His Ala Phe Ser Asp Ser Wall Lell Asp Asp Ile 115 12 O 125

Wall Gly Luell Wall Lell His Ser Ser Luell Luell Wall Pro Phe Ser Trp 13 O 135 14 O

Lys Ser His Arg Arg His His Ser Asn Thir Gly Ser Luell Glu Arg 145 150 155 160

Asp Glu Wall Phe Wall Pro Glin Ser Ala Met Ala Trp Tyr Thir 1.65 17O 17s

Pro Wall Tyr His Asn Pro Ile Gly Arg Luell Wall His Ile Phe Wall 18O 185 19 O

Glin Luell Thir Luell Gly Trp Pro Luell Lel Ala Phe Asn Wall Ser Gly 195

Arg Pro Pro Arg Phe Ala His Phe Asp Pro Gly Pro Ile 21 O 215 22O

Tyr Asn Asp Arg Glu Arg Wall Glin Ile Phe Ile Ser Asp Wall Gly Wall 225 23 O 235 24 O

Wall Ser Ala Gly Lell Ala Lell Phe Lel Ser Ser Ala Phe Gly Phe 245 250 255

Trp Trp Wall Wall Arg Wall Gly Wall Luell Lell Ile Wall Asn Ala 26 O 265 27 O

Trp Luell Wall Luell Ile Thir Luell Glin His Thir His Pro Ala Luell Pro 285

His Tyr Asp Ser Ser Glu Trp Asp Trp Lel Arg Gly Ala Luell Ala Thir 29 O 295 3 OO

Wall Asp Arg Asp Tyr Gly Ile Luell Asn Wall Phe His Asn Ile Thir 3. OS 310 315

Asp Thir His Wall Ala His His Luell Phe Ser Thir Met Pro His Tyr His 3.25 330 335

Ala Met Glu Ala Thir Ala Ile Arg Pro Ile Lell Gly Glu Tyr Tyr 34 O 345 35. O

Glin Phe Asp Pro Thir Pro Wall Ala Ala Thir Trp Arg Glu Ala 355 360 365

Glu Cys Ile Wall Glu Pro Glu Asp Asn Lys Gly Wall Phe Trp Tyr 37 O 375 38O

Asn Asn Phe 385

SEQ ID NO 16 LENGTH: 362 TYPE : PRT ORGANISM: Oryza sativa

< 4 OOs SEQUENCE: 16 US 8,530,724 B2 85 86 - Continued

Glin Arg Ser Pro Wall Asp Pro Pro Phe Thir Lieu. Gly Asp Ile 15

Ala Ile Pro Pro His Phe His Arg Ser Wall Ile Lys Ser 25

Phe Ser Tyr Luell Lell His Asp Luell Ala Ile Ala Ala Gly Luell Luell Tyr 35 4 O 45

Phe Ala Luell Wall Gly Ile Pro Ala Luell Pro Ser Ile Lell Arg Luell Wall SO 55 6 O

Ala Trp Pro Luell Tyr Trp Ala Ala Glin Gly Ser Wall Lell Thir Gly Wall 65 70

Trp Wall Ile Gly His Glu Gly His His Ala Phe Ser Asp Tyr Luell 85 90 95

Lell Luell Asp Asn Lell Wall Luell Wall Luell His Ser Ala Luell Luell Thir 105 11 O

Pro Phe Phe Ser Trp Ser His Arg Arg His His Ala Asn Thir 115 12 O 125

Gly Ser Met Glu Asp Glu Wall Wall Ala Lys Ser Ala 13 O 135 14 O

Lell Pro Trp Thir Pro Wall Phe Gly ASn Pro Wall Gly Arg Luell 145 150 155 160

Wall Ile Ala Lell Glin Lell Thir Luell Ala Trp Pro Lell Tyr Luell Ala 1.65 17s

Phe Asn Luell Ser Gly Glin Pro Pro Arg Luell Wall Thir Cys His Tyr 18O 185 19 O

Asp Pro Tyr Ser Pro Lell Phe Ser Asp Glin Glu Arg Wall Glin Wall Luell 195 2OO

Wall Ser Asp Ala Ala Ile Lell Ala Wall Luell Luell Ala Lell His Arg Luell 21 O 215

Thir Ala Ala Gly Lell Trp Trp Wall Wall Arg Wall Gly Wall Pro 225 23 O 235 24 O

Wall Met Ile Wall Gly Ala Lell Phe Wall Luell Ile Thir Luell His His 245 250 255

Thir His Arg Ala Lell Pro His Asp Ser Ser Glu Trp Glu Trp Luell 26 O 265 27 O

Arg Gly Ser Luell Ala Thir Wall Asp Arg Asp Gly Wall Luell Asn 27s 28O 285

Wall Luell His Asn Wall Thir Asp Thir His Wall Luell His His Luell Phe Pro 29 O 295 3 OO

Ser Met Pro His Tyr His Ala Met Glu Ala Thir Arg Ala Ala Arg Pro 3. OS 310 315 32O

Wall Luell Gly Glu Tyr Phe Asp Arg Thir Pro Ile Ile Glu Ala 3.25 330 335

Thir Trp Arg Glu Ala Glu Met Tyr Wall Glu Pro Arg Glu Arg 34 O 345 35. O

Asp Gly Ile Trp Asn Asn Phe 355 360

SEO ID NO 17 LENGTH: 390 TYPE : PRT ORGANISM: Oryza sativa

< 4 OOs SEQUENCE: 17 Met Gly. Thir Ser Ser Arg Pro Thr Thr Val Lys Glu Gly Lys Llys Lieu. 1. 5 15 US 8,530,724 B2 87 88 - Continued

Glu Ala Pro Arg Arg Ala Gly Ser His Ala Ala Wall Lys Arg Ser Pro 25

Wall Asp Lys Pro Pro Phe Thir Luell Gly Asp Ile Arg Lys Ala Ile Pro 35 4 O 45

Pro His Phe His Arg Ser Wall Ile Ser Phe Ser Tyr Luell Luell SO 55 6 O

His Asp Luell Ala Ile Ala Ala Gly Luell Luell Tyr Phe Ala Luell Wall Wall 65 70

Ile Pro Ala Luell Pro Gly Wall Luell Arg Luell Wall Ala Trp Pro Phe 85 90 95

Trp Ala Ala Glin Gly Phe Luell Phe Gly Wall Trp Ile Ile Ala His 105 11 O

Glu Gly His His Ala Phe Ser Gly His Ala Lell Lell Asp Asp Thir 115 12 O 125

Lell Gly Luell Wall Lell His Ser Trp Luell Luell Ala Pro Phe Ser Trp 13 O 135 14 O

Lys Thir His Glin Arg His His Ser Asn Thir Ser Ser Glin Glu Arg 145 150 155 160

Asp Glu Wall Phe Wall Pro Arg Phe Ser Asp Lell Pro Trp Tyr Ser 1.65 17O 17s

Pro Wall Tyr Lys Asn Asn Pro Wall Ala Arg Lell Luell Luell Luell 18O 185 19 O

Wall Wall Glin Luell Thir Wall Gly Trp Pro Met Lell Wall Phe Asn Thir 195 2O5

Trp Gly Arg Glin Tyr Pro Arg Phe Ala Ser His Phe Asp Pro Ser Gly 21 O 215 22O

Pro Ile Gly Arg Glu Arg Wall Phe Ile Ala Ile Ser Asp Ile 225 23 O 235 24 O

Gly Met Luell Ala Wall Ser Lell Ala Luell Tyr Arg Lell Ala Glu Gly 245 250 255

Gly Phe Trp Trp Wall Wall Arg Wall Tyr Gly Wall Pro Lell Luell Wall Wall 26 O 265 27 O

Asn Ala Trp Luell Wall Wall Wall Thir Luell His His Thir His Arg Ala 285

Ile Pro His Asp Ser Ser Glu Trp Asp Trp Lell Arg Gly Ala Luell 29 O 295 3 OO

Ala Thir Wall Asp Arg Asp Ser Phe Luell ASn Arg Wall Phe His Asn 3. OS 310 315

Ile Thir Asp Thir His Wall Wall His His Luell Phe Pro Thir Ile Pro His 3.25 330 335

His Ala Wall Glu Ala Thir Ala Ile Arg Pro Ile Luell Gly Glu 34 O 345 35. O

Glin Phe Asp Pro Thir Pro Ile Wall Lys Ala Ile Trp Arg Glu 355 360 365

Ala Lys Glu Ile Ile Glin Ser Glu Asp His Gly Wall Phe 37 O 375 38O

Trp Ser Asn Lys Phe 385 390

SEQ ID NO 18 LENGTH: 223 TYPE : PRT ORGANISM: Oryza sativa

< 4 OOs SEQUENCE: 18

US 8,530,724 B2 99 100 - Continued <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 27 Phe Ser Tyr Val Val His Asp Lieu Val Ile Val Ala Ala Lieu. Lieu. Phe 1. 5 1O 15

Ala Lieu Wal Met Ile 2O

<210s, SEQ ID NO 28 &211s LENGTH: 19 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 28 Ala Trp Pro Leu Tyr Ile Ala Glin Gly Cys Val Lieu. Thr Gly Val Trp 1. 5 1O 15

Wall Ile Ala

<210s, SEQ ID NO 29 &211s LENGTH: 21 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 29 Ile Ser Asp Val Gly Val Ser Ala Gly Lieu Ala Lieu. Phe Llys Lieu. Ser 1. 5 1O 15 Ser Ala Phe Gly Phe 2O

<210s, SEQ ID NO 3 O &211s LENGTH: 23 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 30 Val Val Arg Val Tyr Gly Val Pro Lieu. Lieu. Ile Val Asn Ala Trp Lieu 1. 5 1O 15 Val Lieu. Ile Thr Tyr Lieu Gln 2O

<210s, SEQ ID NO 31 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 31 His Glu. Cys Gly His His 1. 5

<210s, SEQ ID NO 32 &211s LENGTH: 6 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence

<4 OOs, SEQUENCE: 32 US 8,530,724 B2 101 102 - Continued His Arg Arg His His Ala 1. 5

<210s, SEQ ID NO 33 &211s LENGTH: 5 212. TYPE: PRT <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Fad2 consensus sequence <4 OOs, SEQUENCE: 33

His Wall Ala His His 1. 5

<210s, SEQ ID NO 34 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 34 cgctgctaccaaacaattica

<210s, SEQ ID NO 35 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 35 ttctgttgttg ccatcatcg 19

<210s, SEQ ID NO 36 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 36

Caggaaataa agttggtgat gatg 24

<210s, SEQ ID NO 37 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OO > SEQUENCE: 37 citt cacaata t cagotcc td actic 24

<210s, SEQ ID NO 38 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 38

Caggaaataa agttggtgat gatg 24

<210s, SEQ ID NO 39 &211s LENGTH: 21 &212s. TYPE: DNA US 8,530,724 B2 103 104 - Continued <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 39 citt cacaatgtcagoctt.ca c 21

<210s, SEQ ID NO 4 O &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 4 O acaggcctga citccacgat 19

<210s, SEQ ID NO 41 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 41 gtccagagtg Cttgttgcag

<210s, SEQ ID NO 42 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 42 tacc cact co ctic ctitgagc

<210s, SEQ ID NO 43 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 43 aggcactgtt ggtgat ct cq

<210s, SEQ ID NO 44 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 44

Cacaaagagg gagggaacaa

<210s, SEQ ID NO 45 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 45 gaaggactitg at Caccgagc US 8,530,724 B2 105 106 - Continued

<210s, SEQ ID NO 46 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 46

Cacaa.cat Ca cggacacaca

<210s, SEQ ID NO 47 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 47 gcaa.gaccga catggctaat

<210s, SEQ ID NO 48 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 48 acgt.cct c ca ccacct citt 19

<210s, SEQ ID NO 49 &211s LENGTH: 22 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 49

Cagaag cagt gaCataccca ag 22

<210s, SEQ ID NO 50 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 50 tacc cact co ctic ctitgagc

<210s, SEQ ID NO 51 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 51 aggcactgtt ggtgat ct cq

<210s, SEQ ID NO 52 &211s LENGTH: 33 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer US 8,530,724 B2 107 108 - Continued <4 OOs, SEQUENCE: 52 aaaggat.cct Ctagagggag gag cagoaga agc 33

<210s, SEQ ID NO 53 &211s LENGTH: 35 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 53 aaaact agtgaattct acac gitacggggtg tacca 35

<210s, SEQ ID NO 54 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 54 agt catggct ggttct Cttg cggc 24

<210s, SEQ ID NO 55 &211s LENGTH: 24 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OO > SEQUENCE: 55 accatcacct aagagaccag cagt 24

<210s, SEQ ID NO 56 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 56 Cys Gly Met Asn Lys Asn. Thir Arg Arg Lieu. Ser Lys Met Pro Asp Glu 1. 5 1O 15

<210s, SEQ ID NO 57 &211s LENGTH: 10 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OO > SEQUENCE: 57 Thir Arg Arg Lieu. Ser Lys Met Pro Asp Glu 1. 5 1O

<210s, SEQ ID NO 58 &211s LENGTH: 17 212. TYPE: PRT <213> ORGANISM: Oryza sativa <4 OOs, SEQUENCE: 58 Cys Gly Glu Lys Glin Trp Thr Lieu. Lieu. Asp Trp Llys Pro Llys Llys Pro 1. 5 1O 15 Asp

<210s, SEQ ID NO 59 &211s LENGTH: 16 212. TYPE: PRT <213> ORGANISM: Oryza sativa US 8,530,724 B2 109 110 - Continued

<4 OO > SEQUENCE: 59 Cys Gly Ala Glin Gly Glu Gly Asn Met Gly Phe Phe Pro Ala Glu Ser 1. 5 1O

<210s, SEQ ID NO 60 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 60 gtgc.cggcgg Caggatgacg g 21

<210s, SEQ ID NO 61 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 61 gcc.gacgatgtcgt.cgagca C 21

<210s, SEQ ID NO 62 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 62 tgcc ttct co gac tact.cgg

<210s, SEQ ID NO 63 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Oligonucleotide primer

<4 OOs, SEQUENCE: 63

Cctcgc.gc.ca ttctgccttgg 21

<210s, SEQ ID NO 64 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 64 ggagcgggag gag cagcag 19

<210s, SEQ ID NO 65 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 65

19

<210s, SEQ ID NO 66 US 8,530,724 B2 111 112 - Continued

&211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 66 luggcgcggcc glugcagcgg 19

<210s, SEQ ID NO 67 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 67 gcc.gc.cgullc acgclugggg 19

<210s, SEQ ID NO 68 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 68 gaaggc cauc cc.gc.culcac 19

<210s, SEQ ID NO 69 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 69 ggcc aucccg cculcaculgc 19

<210s, SEQ ID NO 70 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 7 O guccuulcucculacguggluc 19

<210s, SEQ ID NO 71 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 71 guacagccac cqgcgc.cac 19

<210s, SEQ ID NO 72 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 72 US 8,530,724 B2 113 114 - Continued

Caccgggllcg cluggagcgc 19

<210s, SEQ ID NO 73 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 73 gCagaagllcg gCaluggcg 19

<210s, SEQ ID NO 74 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 74 gCuccaagaa lugclugclugu 19

<210s, SEQ ID NO 75 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 75 gaalugclugclu. gullaccggc 19

<210s, SEQ ID NO 76 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 76 lugclugcluguu accggcgaa 19

<210s, SEQ ID NO 77 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 77 ulugc.cggaga aluulugagllg 19

<210s, SEQ ID NO 78 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 78 ulugagluguc C9uggCalull 19

<210s, SEQ ID NO 79 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: US 8,530,724 B2 115 116 - Continued <223> OTHER INFORMATION: RNAi molecule

<4 OO > SEQUENCE: 79 agccuaac cc accucculgc 19

<210s, SEQ ID NO 8O &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 80

Cccaccuccu go agc.caug 19

<210s, SEQ ID NO 81 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 81 guaaaggcac aggcucaaa 19

<210s, SEQ ID NO 82 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 82 aggcacaggc ulcaaac ccu. 19

<210s, SEQ ID NO 83 &211s LENGTH: 19 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: RNAi molecule

<4 OOs, SEQUENCE: 83 acccuuccca agguluaalug 19

The invention claimed is: 4. The rice oil of claim 1, further comprising Y-ory Zanol. 1. Rice oil obtained from rice grain, the rice oil having a fatty acid composition comprising greater than 60% w/w 5. A food product comprising the rice oil of claim 1. oleic acid, less than 15% w/w palmitic acid and less than 25% 6. The rice oil of claim 1, which is substantially purified. w/w linoleic acid, wherein the ratio of oleic to linoleic acid in 7. The substantially purified rice oil of claim 6, which is at the rice oil differs by no more than 5% when compared to the least 75% free from other components with which it is natu ratio of oleic acid to linoleic acid in the rice grain. rally associated. 2. The rice oil of claim 1, wherein the weight ratio of oleic acid to linoleic acid is greater than 3.0:1. 55 8. The substantially purified rice oil of claim 7, which is at 3. The rice oil of claim 1, having a fatty acid composition least 90% free from other components with which it is natu comprising greater than 60% w/w oleic acid, less than 12% rally associated. w/w palmitic acid, and/or less than 15% w/w linoleic acid. k . . . .