DOCSLIB.ORG

Robust Genomic Copy Number Predictor of Pan Cancer Metastasis – Pearlman Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Robust Genomic Copy Number Predictor of Pan Cancer Metastasis – Pearlman Et Al Robust Genomic Copy Number Predictor of Pan Cancer Metastasis – Pearlman et al S1 Table. Left and Center: Logistic regression and Cox proportional hazards models predict progression to metastasis for full set (variable number by cohort) and panMPS (295) genes. Right: Linear regression model predicting correlation (r2) between MPS and panMPS. Linear Logistic Regression Cox Regression Regres Variable sion Cohort s Conc Odds Hazard P 95% CI AUC 95% CI - P r2 Ratio Ratio index MPS 2.03 2.00 to (320 5.39 0.001 0.69 4.85 0.72 0.0005 0.97 MSK_Prost to15.49 11.77 genes) ate 2.21 to 2.18 to panMPS 6.01 0.001 0.71 5.42 0.74 0.0003 0.97 17.89 13.49 MPS 2.36 to 1.20 to (351 10.99 0.004 0.72 3.54 0.62 0.02 0.99 Duke_Pros 65.88 10.44 genes) tate 2.39 to 1.15 to panMPS 11.39 0.004 0.72 3.41 0.62 0.03 0.97 70.36 10.12 MPS 2.87 to 1.04 to (352 44.36 0.02 0.75 4.01 0.59 0.04 0.99 Montefiore 2005.4 15.44 genes) _TNBC 2.91 to 1.03 to panMPS 44.74 0.02 0.75 4.06 0.59 0.05 0.96 1927.9 16.04 42.79 MPS 3.78× to 1.04 to (353 0.006 0.94 4.65 0.65 0.04 0.96 103 1.04×10 20.63 genes) MSK_Lung 7 41.5 3.45× 1.31 to panMPS 0.006 to1.26× 0.94 6.57 0.67 0.02 0.96 103 33.04 107 S2 Table. Logistic regression models predicting progression to metastasis for prostate cancer based on panMPS and clinical variables MSK Prostate CA (n=182, mPT=25, Duke Prostate CA (n=61, mPT=37, Cohort iPT=157) iPT=24) Odds Odds Variable P 95% CI AUC P 95% CI AUC Ratio Ratio Univariate panMPS 5.98 0.001 2.12 to 18.57 0.7 11.84 0.002 2.78 to 67.71 0.75 Preop PSA 1.06 0.02 1.02 to 1.11 0.66 1.1 0.08 1.01 to 1.21 0.61 Biopsy 3.82 0.02 1.21 to 11.10 0.58 3.96 0.09 0.89 to 27.84 0.59 Gleason Clinical Stage 2.3 0.06 0.98 to 5.59 0.6 4 0.1 0.86 to 28.88 0.61 1.3×10- 20.51 to Path Gleason 68 0.81 7.5 0.01 1.83 to 51.3 0.66 10 280.1 Path Stage 5.19 0.001 2.12 to 14.08 0.7 0.47 0.23 0.13 to 1.63 0.57 %Genome 1.17 1.4×10-5 1.09 to 1.26 0.74 1.04 0.12 1.00 to 1.12 0.8 Inst. Multivariate panMPS 4.09 0.01 1.38 to 13.19 0.75 14.32 0.003 2.7 to 103.6 0.78 Preop PSA 1.04 0.05 1.01 to 1.1 1.1 0.06 1.01 to 1.24 panMPS 5.09 0.003 1.8 to 15.54 0.73 6.06 0.06 2.4 to 70.4 0.68 Biopsy 2.32 0.15 0.69 to 7.17 1.18 0.88 1.03 to 47.04 Gleason panMPS 5.51 0.001 1.99 to 16.59 0.73 4.42 0.13 0.71 to 34.06 0.72 Clinical Stage 1.93 0.15 0.79 to 4.83 2.76 0.26 0.52 to 21.2 panMPS 1.5 0.55 0.39 to 5.88 0.86 7.45 0.03 1.4 to 49.38 0.77 1.21×10- 15.57 to Path Gleason 56.8 4.83 0.06 1.1 to 34.44 8 263.14 panMPS 3.93 0.01 1.43 to 11.94 0.77 10.59 0.01 2.18 to 65.6 0.73 Path Stage 3.83 0.006 1.49 to 10.74 0.59 0.45 0.15 to 2.32 panMPS 1.79 0.32 0.59 to 5.97 0.75 8,45 0.03 1.41 to 62.2 0.73 %Genome 1.15 0.001 1.06 to 1.25 1.01 0.53 0.98 to 1.07 Inst. panMPS 1.49 0.52 0.45 to 5.39 0.8 9.93 0.02 1.47 to 85.45 0.78 Preop PSA 1.03 0.21 1.00 to 1.09 1.1 0.06 1.01 to 1.24 %Genome 1.14 0.004 1.05 to 1.25 1.02 0.5 0.98 to 1.08 Inst. panMPS 3.7 0.03 1.2 to 11.93 0.76 8.6 0.04 1.25 to 90.53 0.74 Biopsy 2.2 0.21 0.59 to 7.1 1.35 0.78 0.17 to 13.8 Gleason Preop PSA 1.04 0.05 1.01 to 1.09 1.11 0.09 1.01 to 1.28 panMPS 4.71 0.01 1.66 to 14.48 0.75 4.47 0.13 0.70 to 36.93 0.71 Biopsy 2.24 0.17 0.66 to 6.97 0.93 0.95 0.12 to 8.55 Gleason Clinical Stage 1.88 0.17 0.77 to 4.76 2.8 0.26 0.51 to 22.16 panMPS 1.29 0.71 0.34 to 4.99 0.85 6.88 0.03 1.27 to 45.95 0.77 8.69×10- 12.71 to Path Gleason 47.21 4.91 0.06 1.08 to 35.13 8 224.2 Path Stage 2.87 0.08 0.87 to 9.88 0.56 0.42 1.13 to 2.31 panMPS 3.56 0.03 1.16 to 11.62 0.78 6.97 0.04 0.94 to 77.9 0.76 Biopsy 2.15 0.22 0.59 to 6.97 1.07 0.08 0.11 to 11.94 Gleason Clinical Stage 1.41 0.48 0.54 to 3.71 2.73 0.46 0.46 to 22.54 Preop PSA 1.04 0.07 1.01 to 1.08 1.11 0.29 1.01 to 1.29 panMPS 3.5 0.03 1.16 to 11.2 0.79 5.68 0.13 0.66 to 68.5 0.76 Biopsy 2.2 0.22 0.60 to 7.51 1.34 0.82 0.12 to 31.9 Gleason Clinical Stage 1.37 0.52 0.52 to 3.61 2.39 0.37 0.38 to 20.3 Preop PSA 1.04 0.06 1.01 to 1.09 1.1 0.13 0.99 to 1.27 3.85×10-104 to Age 0.51 0.35 0.13 to 2.49 7.85×106 0.99 NA S3 Table. Cox proportional hazards model of panMPS and its association with metastasis-free survival for prostate cancer based on panMPS and clinical variables MSK Prostate CA (n=222, mPT=25, Cohort Duke Prostate CA (n=76, mPT=37, iPT=39) iPT=197) Hazard Conc Hazard Conc Variables 95% CI P 95% CI P Ratio -indx Ratio -indx Univariate panMPS 4.2 1.67 to 10.4 0.7 0.002 3.9 1.48 to 10.4 0.63 0.01 7.60×1 Preop PSA 1.01 1.00 to 1.01 0.63 1 0.97 to 1.03 0.51 0.98 0-5 Biopsy Gleason 3.11 1.24 to 7.83 0.73 0.02 1.63 0.71 to 3.72 0.65 0.25 Clinical Stage 1.75 0.78 to 3.91 0.65 0.17 0.48 0.21 to 1.09 0.64 0.08 9.90×1 Path Gleason 17.34 7.63 to 39.4 0.97 1.67 0.84 to 3.34 0.71 0.14 0-12 Path Stage 3.99 1.67 to 9.58 0.82 0.002 0.61 0.23 to 1.57 0.57 0.3 3.30×1 %Genome Inst. 1.11 1.07 to 1.16 0.67 1.01 0. 99 to 1.02 0.66 0.2 0-7 Multivariate panMPS 4.31 1.72 to 10.8 0.74 0.002 3.52 1.18 to 10.5 0.71 0.02 Preop PSA 1.01 1.00 to 1.01 0.0002 0.99 1.02 to 1.12 0.7 panMPS 3.77 1.49 to 9.51 0.72 0.005 3.13 1.06 to 9.29 0.66 0.04 Biopsy Gleason 2.18 0.83 to 5.69 0.1 1.86 0.88 to 3.93 0.1 panMPS 4.59 1.83 to 11.6 0.71 0.001 2.25 0.62 to 8.17 0.6 0.22 Clinical Stage 1.81 0.81 to 4.03 0.15 1.86 0.79 to 4.34 0.15 panMPS 1.79 0.69 to 4.65 0.86 0.23 2.97 0.94 to 9.41 0.64 0.06 2.74×1 Path Gleason 14.34 5.96 to 34.5 1.29 0.62 to 2.69 0.5 0-9 panMPS 2.96 1.19 to 7.33 0.76 0.02 3.19 1.05 to 9.64 0.62 0.04 Path Stage 3.03 1.22 to 7.55 0.02 0.73 0.27 to 1.91 0.5 panMPS 1.37 0.47 to 3.97 0.71 0.56 3.26 1.08 to 9.8 0.62 0.04 %Genome Inst.
Load more

Recommended publications
  • RNA-Binding Protein Hnrnpll Regulates Mrna Splicing and Stability During B-Cell to Plasma-Cell Differentiation
    RNA-binding protein hnRNPLL regulates mRNA splicing and stability during B-cell to plasma-cell differentiation Xing Changa,b, Bin Lic, and Anjana Raoa,b,d,e,1 Divisions of aSignaling and Gene Expression and cVaccine Discovery, La Jolla Institute for Allergy and Immunology, La Jolla, CA 92037; bSanford Consortium for Regenerative Medicine, La Jolla, CA 92037; and dDepartment of Pharmacology and eMoores Cancer Center, University of California at San Diego, La Jolla, CA 92093 Contributed by Anjana Rao, December 2, 2014 (sent for review July 20, 2014) Posttranscriptional regulation is a major mechanism to rewire the RBP-binding sites, thus validating the specificity of RBP binding transcriptomes during differentiation. Heterogeneous nuclear to coprecipitating RNAs and mapping RBP-binding sites on the RNA-binding protein LL (hnRNPLL) is specifically induced in terminally validated RNAs at close to single-nucleotide resolution (8). differentiated lymphocytes, including effector T cells and plasma Heterogeneous nuclear RNA-binding proteins (hnRNPs) is cells. To study the molecular functions of hnRNPLL at a genome- the term applied to a collection of unrelated nuclear RBPs. wide level, we identified hnRNPLL RNA targets and binding sites in hnRNPLL was identified through a targeted lentiviral shRNA plasma cells through integrated Photoactivatable-Ribonucleoside- screen for regulators of CD45RA to CD45RO switching during Enhanced Cross-Linking and Immunoprecipitation (PAR-CLIP) and memory T-cell development (9) and independently through RNA sequencing. hnRNPLL preferentially recognizes CA dinucleo- two separate screens performed by different groups for exclusion tide-containing sequences in introns and 3′ untranslated regions of CD45 exon 4 in a minigene context (10) and for altered CD44 (UTRs), promotes exon inclusion or exclusion in a context-dependent and CD45R expression on T cells in N-ethyl-N-nitrosourea manner, and stabilizes mRNA when associated with 3′ UTRs.
    [Show full text]
  • Non-Canonical Notch Signaling During Early Heart Development
    Non-Canonical Notch Signaling During Early Heart Development By Matthew Miyamoto A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Master of Science Baltimore, Maryland May 2017 ©2017 Matthew Miyamoto All Rights Reserved Abstract: The canonical Notch signaling pathway has been studied extensively and plays a key role during embryonic development. Recent evidence points to the existence of a non-canonical function of the Notch protein. Elucidation of a non-canonical Notch signaling pathway would significantly alter how the Notch protein is viewed in biological systems. Perhaps more importantly, the identification of downstream effectors could lead to discovery of novel gene networks functioning throughout development. One potential downstream effector of non-canonical Notch is Numb, which interacts with Notch during development. We provide evidence of the existence of a non-canonical pathway in both the embryonic stem cell and during early heart development. By developing two models that alter either the Notch protein or the canonical Notch signaling pathway, we studied non-canonical Notch signaling in vitro and in vivo. Upon overexpression of a tethered form of Notch, which cannot initiate canonical Notch signaling, we observed remarkable apoptosis in embryonic stem cells. Furthermore, Notch overexpression during early heart development led to decreased heart size due to decreased myocyte proliferation when the essential transcription factor to canonical Notch signaling, RBP-j, was knocked out. Similar phenotypes observed in a Numb knockout setting led us to hypothesize that an interaction between Numb and Notch is involved in heart development. Elucidation of a non-canonical Notch signaling pathway may lead to not only a better understanding of congenital heart disease, but also development of other organ systems, as well.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • 4-6 Weeks Old Female C57BL/6 Mice Obtained from Jackson Labs Were Used for Cell Isolation
    Methods Mice: 4-6 weeks old female C57BL/6 mice obtained from Jackson labs were used for cell isolation. Female Foxp3-IRES-GFP reporter mice (1), backcrossed to B6/C57 background for 10 generations, were used for the isolation of naïve CD4 and naïve CD8 cells for the RNAseq experiments. The mice were housed in pathogen-free animal facility in the La Jolla Institute for Allergy and Immunology and were used according to protocols approved by the Institutional Animal Care and use Committee. Preparation of cells: Subsets of thymocytes were isolated by cell sorting as previously described (2), after cell surface staining using CD4 (GK1.5), CD8 (53-6.7), CD3ε (145- 2C11), CD24 (M1/69) (all from Biolegend). DP cells: CD4+CD8 int/hi; CD4 SP cells: CD4CD3 hi, CD24 int/lo; CD8 SP cells: CD8 int/hi CD4 CD3 hi, CD24 int/lo (Fig S2). Peripheral subsets were isolated after pooling spleen and lymph nodes. T cells were enriched by negative isolation using Dynabeads (Dynabeads untouched mouse T cells, 11413D, Invitrogen). After surface staining for CD4 (GK1.5), CD8 (53-6.7), CD62L (MEL-14), CD25 (PC61) and CD44 (IM7), naïve CD4+CD62L hiCD25-CD44lo and naïve CD8+CD62L hiCD25-CD44lo were obtained by sorting (BD FACS Aria). Additionally, for the RNAseq experiments, CD4 and CD8 naïve cells were isolated by sorting T cells from the Foxp3- IRES-GFP mice: CD4+CD62LhiCD25–CD44lo GFP(FOXP3)– and CD8+CD62LhiCD25– CD44lo GFP(FOXP3)– (antibodies were from Biolegend). In some cases, naïve CD4 cells were cultured in vitro under Th1 or Th2 polarizing conditions (3, 4).
    [Show full text]
  • A Mouse Model for Human Short-Stature Syndromes Identifies Shox2 As an Upstream Regulator of Runx2 During Long-Bone Development
    A mouse model for human short-stature syndromes identifies Shox2 as an upstream regulator of Runx2 during long-bone development John Cobb*, Andre´ e Dierich†, Yolande Huss-Garcia†, and Denis Duboule*‡ *Department of Zoology and Animal Biology and National Research Center ‘‘Frontiers in Genetics,’’ Sciences III, University of Geneva, Quai Ernest Ansermet 30, 1211 Geneva 4, Switzerland; and †Institut de Ge´ne´ tique et de Biologie Mole´culaire et Cellulaire͞Institut Clinique de la Souris, Centre National de la Recherche Scientifique͞Institut National de la Sante´et de la Recherche Me´dicale͞Universite´Louis Pasteur͞Colle`ge de France, BP 10142, 67404 Strasbourg, France Edited by Pierre Chambon, Institut de Ge´ne´ tique et de Biologie Mole´culaire, Strasbourg, France, and approved January 11, 2006 (received for review December 7, 2005) Deficiencies or mutations in the human pseudoautosomal SHOX wall up to the hand plate (8), from which it is excluded, thus gene are associated with a series of short-stature conditions, recapitulating the expression of both human SHOX and SHOX2 including Turner syndrome, Leri–Weill dyschondrosteosis, and and further suggesting that it displays a function in developing Langer mesomelic dysplasia. Although this gene is absent from the limbs related to that of its two human counterparts. mouse genome, the closely related paralogous gene Shox2 dis- We identified Shox2 as a candidate target gene of HOXD plays a similar expression pattern in developing limbs. Here, we proteins in developing distal limbs by using a microarray screen report that the conditional inactivation of Shox2 in developing (9). Shox2 appeared up-regulated in the presumptive digit do- appendages leads to a strong phenotype, similar to the human main after deletion of the Hoxd gene cluster, indicating a conditions, although it affects a different proximodistal limb seg- potential repressive effect of Hoxd genes on Shox2 transcription ment.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Role of CREB/CRTC1-Regulated Gene Transcription During Hippocampal-Dependent Memory in Alzheimer’S Disease Mouse Models
    ADVERTIMENT. Lʼaccés als continguts dʼaquesta tesi queda condicionat a lʼacceptació de les condicions dʼús establertes per la següent llicència Creative Commons: http://cat.creativecommons.org/?page_id=184 ADVERTENCIA. El acceso a los contenidos de esta tesis queda condicionado a la aceptación de las condiciones de uso establecidas por la siguiente licencia Creative Commons: http://es.creativecommons.org/blog/licencias/ WARNING. The access to the contents of this doctoral thesis it is limited to the acceptance of the use conditions set by the following Creative Commons license: https://creativecommons.org/licenses/?lang=en Institut de Neurociències Universitat Autònoma de Barcelona Departament de Bioquímica i Biologia Molecular Unitat de Bioquímica, Facultat de Medicina Role of CREB/CRTC1-regulated gene transcription during hippocampal-dependent memory in Alzheimer’s disease mouse models Arnaldo J. Parra Damas TESIS DOCTORAL Bellaterra, 2015 Institut de Neurociències Departament de Bioquímica i Biologia Molecular Universitat Autònoma de Barcelona Role of CREB/CRTC1-regulated gene transcription during hippocampal-dependent memory in Alzheimer’s disease mouse models Papel de la transcripción génica regulada por CRTC1/CREB durante memoria dependiente de hipocampo en modelos murinos de la enfermedad de Alzheimer Memoria de tesis doctoral presentada por Arnaldo J. Parra Damas para optar al grado de Doctor en Neurociencias por la Universitat Autonòma de Barcelona. Trabajo realizado en la Unidad de Bioquímica y Biología Molecular de la Facultad de Medicina del Departamento de Bioquímica y Biología Molecular de la Universitat Autònoma de Barcelona, y en el Instituto de Neurociencias de la Universitat Autònoma de Barcelona, bajo la dirección del Doctor Carlos Saura Antolín.
    [Show full text]
  • High-Resolution Analysis of Chromosomal Breakpoints and Genomic Instability Identifies PTPRD As a Candidate Tumor Suppressor Gene in Neuroblastoma
    Research Article High-Resolution Analysis of Chromosomal Breakpoints and Genomic Instability Identifies PTPRD as a Candidate Tumor Suppressor Gene in Neuroblastoma Raymond L. Stallings,1 Prakash Nair,1 John M. Maris,2 Daniel Catchpoole,3 Michael McDermott,4 Anne O’Meara,5 and Fin Breatnach5 1Children’s Cancer Research Institute and Department of Pediatrics, University of Texas Health Science Center at San Antonio, San Antonio, Texas; 2Division of Oncology, Children’s Hospital of Philadelphia and Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania; 3The Tumor Bank, Children’s Hospital at Westmead, Sydney, New South Wales, Australia; and Departments of 4Pathology and 5Oncology, Our Lady’s Hospital for Sick Children, Dublin, Ireland Abstract and death from disease. Patient age, tumor stage, and several Although neuroblastoma is characterized by numerous different genetic abnormalities are important factors that influence clinical outcome. Loss of 1p and 11q, gain of 17q, and amplification recurrent, large-scale chromosomal imbalances, the genes MYCN targeted by such imbalances have remained elusive. We have of the oncogene are particularly strong genetic indicators of poor disease outcome (2–5). Two of these abnormalities, loss of 11q applied whole-genome oligonucleotide array comparative MYCN genomic hybridization (median probe spacing 6 kb) to 56 and amplification, form the basis for dividing advanced- stage neuroblastomas into genetic subtypes due to their rather neuroblastoma tumors and cell lines to identify genes involved with disease pathogenesis. This set oftumors was selected for striking inverse distribution in tumors (6, 7). Many other recurrent having either 11q loss or MYCN amplification, abnormalities partial chromosomal imbalances, including loss of 3p, 4p, 9p, and that define the two most common genetic subtypes of 14q and gain of 1q, 2p, 7q, and 11p, have been identified by metastatic neuroblastoma.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]