DOCSLIB.ORG

Isoform-Specific Subcellular Localization and Function of Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isoform-Specific Subcellular Localization and Function of Protein RESEARCH ARTICLE Isoform-specific subcellular localization and function of protein kinase A identified by mosaic imaging of mouse brain Ronit Ilouz1*, Varda Lev-Ram1, Eric A Bushong2, Travis L Stiles3, Dinorah Friedmann-Morvinski4,5, Christopher Douglas3, Jeffrey L Goldberg3, Mark H Ellisman2,6, Susan S Taylor1,7* 1Department of Pharmacology, University of California, San Diego, La Jolla, United States; 2Center for Research in Biological Systems, National Center for Microscopy and Imaging Research, University of California, San Diego, San Diego, United States; 3Department of Ophthalmology, Shiley Eye Center, University of California, San Diego, La Jolla, United States; 4Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, United States; 5Department of Biochemistry and Molecular Biology, George S Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel; 6Department of Neurosciences, University of California, San Diego School of Medicine, La Jolla, United States; 7Department of Chemistry and Biochemistry, University of California, San Diego, La Jolla, United States Abstract Protein kinase A (PKA) plays critical roles in neuronal function that are mediated by different regulatory (R) subunits. Deficiency in either the RIb or the RIIb subunit results in distinct neuronal phenotypes. Although RIb contributes to synaptic plasticity, it is the least studied isoform. Using isoform-specific antibodies, we generated high-resolution large-scale immunohistochemical *For correspondence: rilouz@ mosaic images of mouse brain that provided global views of several brain regions, including the ucsd.edu (RI); [email protected] (SST) hippocampus and cerebellum. The isoforms concentrate in discrete brain regions, and we were able to zoom-in to show distinct patterns of subcellular localization. RIb is enriched in dendrites and Competing interests: The co-localizes with MAP2, whereas RIIb is concentrated in axons. Using correlated light and electron authors declare that no microscopy, we confirmed the mitochondrial and nuclear localization of RIb in cultured neurons. To competing interests exist. show the functional significance of nuclear localization, we demonstrated that downregulation of Funding: See page 20 RIb, but not of RIIb, decreased CREB phosphorylation. Our study reveals how PKA isoform specificity is defined by precise localization. Received: 10 May 2016 DOI: 10.7554/eLife.17681.001 Accepted: 03 January 2017 Published: 12 January 2017 Reviewing editor: Mary B Kennedy, California Institute of Introduction Technology, United States Precise spatiotemporal regulation of signaling molecules is central to the intricacies of signal trans- duction. cAMP-dependent protein kinase (PKA), which is ubiquitously expressed in every mammalian Copyright Ilouz et al. This cell, regulates numerous signaling pathways and is critical for many neuronal functions. These include article is distributed under the learning and memory (Kandel, 2012) and multiple forms of synaptic plasticity (Abel et al., 1997; terms of the Creative Commons Attribution License, which Yasuda et al., 2003). Pharmacological or genetic inhibition of PKA severely affects the induction of permits unrestricted use and hippocampal long-term potentiation and inhibits synaptic plasticity and long-lasting memory redistribution provided that the (Abel et al., 1997). A reduction in PKA signaling contributes to the etiology of several neurodegen- original author and source are erative diseases, including Alzheimer’s disease and Parkinson’s disease (Dagda and Das Banerjee, credited. 2015; Howells et al., 2000). Phosphorylation mediated by cAMP signaling is critically involved in Ilouz et al. eLife 2017;6:e17681. DOI: 10.7554/eLife.17681 1 of 23 Research article Cell Biology Neuroscience cell growth, differentiation, apoptosis, synaptic release of neurotransmitters and gene expression (Skalhegg and Tasken, 2000), and a large part of the functional diversity of this kinase results from isoform diversity. Eukaryotic cells express multiple forms of PKA regulatory (R) and catalytic (C) subu- nits. PKA holoenzyme consists of an R-subunit dimer bound to two C- subunits (R2C2). The biochemi- cal and functional features of PKA holoenzymes are largely determined by the structure and the biochemical properties of the regulatory subunits (Ilouz et al., 2012; Taylor et al., 2012; Zhang et al., 2012). There are two classes of R-subunits, RI and RII, which are classified into a and b subtypes (Døskeland et al., 1993; McKnight et al., 1988). Each isoform is encoded by a unique gene and preferentially expressed in different cells and tissues. RIa and RIIa are ubiquitously expressed in every cell, whereas RIb and RIIb expression is more tissue restricted (Cadd and McKnight, 1989). RIb is expressed in brain and spinal cord (Cadd and McKnight, 1989). RIIb is predominantly expressed in brain, endocrine, fat, liver and reproductive tissues (Cadd and McKnight, 1989; Jahnsen et al., 1986). The four R-subunits are functionally non-redundant. Depletion of either the RIb or the RIIb gene in mice resulted in specific neuronal defects. RIIb knockout mice display defects in motor behavior and loss of PKA-mediated neuronal gene expression (Brandon et al., 1998). Hippocampal slices from RIb null mice show a severe deficit in long-term depression and depotentiation at the Schaffer collateral–CA1 synapse. Despite a compensatory increase in the RIa protein levels, hippocampal function was not rescued (Brandon et al., 1995). The composition and specific structural and biochemical properties of PKA holoenzymes (R2C2) account, in part, for differential cellular responses to discrete extracellular signals that activate adenylate cyclase (Taylor et al., 2012). Space-restricted kinase activation provides an extra layer of specificity in PKA signaling. PKA is typically targeted at specific intracellular microdomains through interactions with A-Kinase Anchoring Proteins (AKAPs). Many AKAPs have been identified together with their specific requirements for selective binding to regulatory subunits (Sarma et al., 2010; Wong and Scott, 2004). This spatio-temporal regulation determines the access of proteins to interacting binding partners. AKAPs provide a control mechanism that directs, integrates and locally attenuates the cAMP-initiated cascade. The hallmark signature motif of the AKAPs is an amphipathic helix that binds tightly to the dimerization and docking (D/D) domain of the R-subunits. Recently, a point mutation in the D/D domain of the RIb gene has been associated with a new neurodegenera- tive disease that presents with dementia and Parkinsonism, characterized by specific and abundant accumulation of RIb in neuronal inclusions (Wong et al., 2014). Rigorous cellular characterization of protein localization is a necessary step if we aim to under- stand PKA function in a physiological context. To date, relatively few efforts have attempted to define the subcellular localization of endogenous proteins systematically using imaging-based tech- niques. Currently, RIb, the isoform that has a unique role in synaptic plasticity (Brandon et al., 1995) and has been associated with a neurodegenerative disease, is the least-studied PKA isoform. RIb spatial localization has not been systematically studied due to antibody cross-reactivity with RIa. Furthermore, most of the available RIIb localization data are focused on specific regions of interest; thus the global context of the protein localization is lost. Subcellular cAMP signaling domains are defined by the distinct environments within cellular organelles. The dogma of cAMP-PKA signaling in the nucleus states that, upon cAMP-induced acti- vation of the cytosolic PKA holoenzyme, the C-subunit dissociates from the R-subunit in an isoform- specific manner and translocates into the nucleus by diffusion (Harootunian et al., 1993). Contradic- tory, reports have increasingly proposed the existence of resident pools of nuclear PKA holoenzyme (Jarnaess et al., 2009; Sample et al., 2012; Zippin et al., 2004). While the necessity of a proper nuclear PKA activity for neuronal function is well-documented, neither the existence of PKA R-subu- nits nor their physiological role within the nucleus has been well-studied. In this study, we generated high-resolution large-scale mosaic images of several mouse brain sli- ces using RIb- and RIIb-specific antibodies. As RIb is the least-studied isoform at the protein level, we focused our analyses on brain regions where we expected RIb to be predominant on the basis of its mRNA expression profiles and its predicted functional importance from RIb(–/–) mice. The use of large-scale immunohistochemical brain maps allows us to gain an overview of the RIb and RIIb pro- tein distributions over large areas and then to zoom in to obtain higher-resolution views in order to investigate subcellular features. We found that each regulatory isoform is predominant in distinct brain regions and were able to identify unique and consistent patterns of distribution within the Ilouz et al. eLife 2017;6:e17681. DOI: 10.7554/eLife.17681 2 of 23 Research article Cell Biology Neuroscience hippocampus and the cerebellum. RIb is concentrated in dendrites, and co-localizes with MAP2, whereas RIIb is concentrated in axons. We confirmed the RIb subcellular distribution that emerged from the mosaic images using the mini-Singlet Oxygen Generator (miniSOG), a probe that allowed us to do correlated light and electron microscopy. We found RIb in the mitochondria,
Load more

Recommended publications
  • Gpr161 Anchoring of PKA Consolidates GPCR and Camp Signaling
    Gpr161 anchoring of PKA consolidates GPCR and cAMP signaling Verena A. Bachmanna,1, Johanna E. Mayrhofera,1, Ronit Ilouzb, Philipp Tschaiknerc, Philipp Raffeinera, Ruth Röcka, Mathieu Courcellesd,e, Federico Apeltf, Tsan-Wen Lub,g, George S. Baillieh, Pierre Thibaultd,i, Pia Aanstadc, Ulrich Stelzlf,j, Susan S. Taylorb,g,2, and Eduard Stefana,2 aInstitute of Biochemistry and Center for Molecular Biosciences, University of Innsbruck, 6020 Innsbruck, Austria; bDepartment of Chemistry and Biochemistry, University of California, San Diego, CA 92093; cInstitute of Molecular Biology, University of Innsbruck, 6020 Innsbruck, Austria; dInstitute for Research in Immunology and Cancer, Université de Montréal, Montreal, QC, Canada H3C 3J7; eDépartement de Biochimie, Université de Montréal, Montreal, QC, Canada H3C 3J7; fOtto-Warburg Laboratory, Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; gDepartment of Pharmacology, University of California, San Diego, CA 92093; hInstitute of Cardiovascular and Medical Sciences, University of Glasgow, Glasgow, G12 8QQ, United Kingdom; iDepartment of Chemistry, Université de Montréal, Montreal, QC, Canada H3C 3J7; and jInstitute of Pharmaceutical Sciences, Pharmaceutical Chemistry, University of Graz, 8010 Graz, Austria Contributed by Susan S. Taylor, May 24, 2016 (sent for review February 18, 2016; reviewed by John J. G. Tesmer and Mark von Zastrow) Scaffolding proteins organize the information flow from activated G accounts for nanomolar binding affinities to PKA R subunit dimers protein-coupled receptors (GPCRs) to intracellular effector cascades (12, 13). Moreover, additional components of the cAMP signaling both spatially and temporally. By this means, signaling scaffolds, such machinery, such as GPCRs, adenylyl cyclases, and phosphodiester- as A-kinase anchoring proteins (AKAPs), compartmentalize kinase ases, physically interact with AKAPs (1, 5, 11, 14).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1
    BIOLOGY OF REPRODUCTION 78, 184–192 (2008) Published online before print 10 October 2007. DOI 10.1095/biolreprod.107.062943 Identification and Characterization of RHOA-Interacting Proteins in Bovine Spermatozoa1 Sarah E. Fiedler, Malini Bajpai, and Daniel W. Carr2 Department of Medicine, Oregon Health & Sciences University and Veterans Affairs Medical Center, Portland, Oregon 97239 ABSTRACT Guanine nucleotide exchange factors (GEFs) catalyze the GDP for GTP exchange [2]. Activation is negatively regulated by In somatic cells, RHOA mediates actin dynamics through a both guanine nucleotide dissociation inhibitors (RHO GDIs) GNA13-mediated signaling cascade involving RHO kinase and GTPase-activating proteins (GAPs) [1, 2]. Endogenous (ROCK), LIM kinase (LIMK), and cofilin. RHOA can be RHO can be inactivated via C3 exoenzyme ADP-ribosylation, negatively regulated by protein kinase A (PRKA), and it and studies have demonstrated RHO involvement in actin-based interacts with members of the A-kinase anchoring (AKAP) cytoskeletal response to extracellular signals, including lyso- family via intermediary proteins. In spermatozoa, actin poly- merization precedes the acrosome reaction, which is necessary phosphatidic acid (LPA) [2–4]. LPA is known to signal through for normal fertility. The present study was undertaken to G-protein-coupled receptors (GPCRs) [4, 5]; specifically, LPA- determine whether the GNA13-mediated RHOA signaling activated GNA13 (formerly Ga13) promotes RHO activation pathway may be involved in acrosome reaction in bovine through GEFs [4, 6]. Activated RHO-GTP then signals RHO caudal sperm, and whether AKAPs may be involved in its kinase (ROCK), resulting in the phosphorylation and activation targeting and regulation. GNA13, RHOA, ROCK2, LIMK2, and of LIM-kinase (LIMK), which in turn phosphorylates and cofilin were all detected by Western blot in bovine caudal inactivates cofilin, an actin depolymerizer, the end result being sperm.
    [Show full text]
  • Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G 12
    The Journal of Neuroscience, August 15, 2002, 22(16):6863–6875 Glycogen Synthase Kinase-3 Is Activated in Neuronal Cells by G␣ ␣ 12 and G 13 by Rho-Independent and Rho-Dependent Mechanisms C. Laura Sayas, Jesu´ s Avila, and Francisco Wandosell Centro de Biologı´a Molecular “Severo Ochoa”, Consejo Superior de Investigaciones Cientı´ficas, Universidad Auto´ noma de Madrid, Cantoblanco, Madrid 28049, Spain ␣ ␣ ␣ ␣ Glycogen synthase kinase-3 (GSK-3) was generally considered tively active G 12 (G 12QL) and G 13 (G 13QL) in Neuro2a cells a constitutively active enzyme, only regulated by inhibition. induces upregulation of GSK-3 activity. Furthermore, overex- Here we describe that GSK-3 is activated by lysophosphatidic pression of constitutively active RhoA (RhoAV14) also activates ␣ acid (LPA) during neurite retraction in rat cerebellar granule GSK-3 However, the activation of GSK-3 by G 13 is blocked by neurons. GSK-3 activation correlates with an increase in GSK-3 coexpression with C3 transferase, whereas C3 does not block ␣ tyrosine phosphorylation. In addition, LPA induces a GSK-3- GSK-3 activation by G 12. Thus, we demonstrate that GSK-3 is ␣ ␣ mediated hyperphosphorylation of the microtubule-associated activated by both G 12 and G 13 in neuronal cells. However, ␣ protein tau. Inhibition of GSK-3 by lithium partially blocks neu- GSK-3 activation by G 13 is Rho-mediated, whereas GSK-3 ␣ rite retraction, indicating that GSK-3 activation is important but activation by G 12 is Rho-independent. The results presented not essential for the neurite retraction progress. GSK-3 activa- here imply the existence of a previously unknown mechanism of ␣ tion by LPA in cerebellar granule neurons is neither downstream GSK-3 activation by G 12/13 subunits.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Protein Kinases Phosphorylation/Dephosphorylation Protein Phosphorylation Is One of the Most Important Mechanisms of Cellular Re
    Protein Kinases Phosphorylation/dephosphorylation Protein phosphorylation is one of the most important mechanisms of cellular responses to growth, stress metabolic and hormonal environmental changes. Most mammalian protein kinases have highly a homologous 30 to 32 kDa catalytic domain. • Most common method of reversible modification - activation and localization • Up to 1/3 of cellular proteins can be phosphorylated • Leads to a very fast response to cellular stress, hormonal changes, learning processes, transcription regulation .... • Different than allosteric or Michealis Menten regulation Protein Kinome To date – 518 human kinases known • 50 kinase families between yeast, invertebrate and mammaliane kinomes • 518 human PKs, most (478) belong to single super family whose catalytic domain are homologous. • Kinase dendrogram displays relative similarities based on catalytic domains. • AGC (PKA, PKG, PKC) • CAMK (Casein kinase 1) • CMGC (CDC, MAPK, GSK3, CLK) • STE (Sterile 7, 11 & 20 kinases) • TK (Tryosine kinases memb and cyto) • TKL (Tyrosine kinase-like) • Phosphorylation stabilized thermodynamically - only half available energy used in adding phosphoryl to protein - change in free energy forces phosphorylation reaction in one direction • Phosphatases reverse direction • The rate of reaction of most phosphatases are 1000 times faster • Phosphorylation occurs on Ser/The or Tyr • What differences occur due to the addition of a phosphoryl group? • Regulation of protein phosphorylation varies depending on protein - some turned on or off
    [Show full text]
  • Mir-17-92 Fine-Tunes MYC Expression and Function to Ensure
    ARTICLE Received 31 Mar 2015 | Accepted 22 Sep 2015 | Published 10 Nov 2015 DOI: 10.1038/ncomms9725 OPEN miR-17-92 fine-tunes MYC expression and function to ensure optimal B cell lymphoma growth Marija Mihailovich1, Michael Bremang1, Valeria Spadotto1, Daniele Musiani1, Elena Vitale1, Gabriele Varano2,w, Federico Zambelli3, Francesco M. Mancuso1,w, David A. Cairns1,w, Giulio Pavesi3, Stefano Casola2 & Tiziana Bonaldi1 The synergism between c-MYC and miR-17-19b, a truncated version of the miR-17-92 cluster, is well-documented during tumor initiation. However, little is known about miR-17-19b function in established cancers. Here we investigate the role of miR-17-19b in c-MYC-driven lymphomas by integrating SILAC-based quantitative proteomics, transcriptomics and 30 untranslated region (UTR) analysis upon miR-17-19b overexpression. We identify over one hundred miR-17-19b targets, of which 40% are co-regulated by c-MYC. Downregulation of a new miR-17/20 target, checkpoint kinase 2 (Chek2), increases the recruitment of HuR to c- MYC transcripts, resulting in the inhibition of c-MYC translation and thus interfering with in vivo tumor growth. Hence, in established lymphomas, miR-17-19b fine-tunes c-MYC activity through a tight control of its function and expression, ultimately ensuring cancer cell homeostasis. Our data highlight the plasticity of miRNA function, reflecting changes in the mRNA landscape and 30 UTR shortening at different stages of tumorigenesis. 1 Department of Experimental Oncology, European Institute of Oncology, Via Adamello 16, Milan 20139, Italy. 2 Units of Genetics of B cells and lymphomas, IFOM, FIRC Institute of Molecular Oncology Foundation, Milan 20139, Italy.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Protein Kinase C As a Paradigm Alexandra C
    Biochem. J. (2003) 370, 361–371 (Printed in Great Britain) 361 REVIEW ARTICLE Regulation of the ABC kinases by phosphorylation: protein kinase C as a paradigm Alexandra C. NEWTON1 Department of Pharmacology, University of California at San Diego, La Jolla, CA 92093-0640, U.S.A. Phosphorylation plays a central role in regulating the activation down-regulation of PKC as a paradigm for how these sites and signalling lifetime of protein kinases A, B (also known as control the function of the ABC kinases. Akt) and C. These kinases share three conserved phosphorylation motifs: the activation loop segment, the turn motif and the Key words: phosphoinositide 3-kinase, phosphoinositide-depen- hydrophobic motif. This review focuses on how phosphorylation dent kinase-1 (PDK-1), phosphorylation motif, protein kinase A at each of these sites regulates the maturation, signalling and (PKA), protein kinase B (PKB)\Akt, protein kinase C (PKC). INTRODUCTION by phosphorylation as a paradigm for control of ABC kinase function by phosphorylation. Almost half a century ago Krebs, Graves and Fischer reported b that the first discovered protein kinase, phosphorylase kinase, ARCHITECTURE OF ABC KINASES was, itself, activated by phosphorylation [1]. Two decades later, Fischer and colleagues showed that the kinase that phosphory- Protein kinases A, B\Akt and C have in common a conserved lates phosphorylase kinase, later named protein kinase A (PKA), kinase core whose function is regulated allosterically by a was also phosphorylated [2]. Reversible control by phosphory- corresponding regulatory moiety (Figure 1). In the case of PKA, lation\dephosphorylation is now firmly established as a fun- the regulatory moiety is a separate polypeptide, whereas the damental mechanism for regulating the function of most of the regulatory determinants are on the same polypeptide as the 500 or so members of the mammalian protein kinase superfamily.
    [Show full text]
  • AMP-Activated Protein Kinase: the Current Landscape for Drug Development
    REVIEWS AMP-activated protein kinase: the current landscape for drug development Gregory R. Steinberg 1* and David Carling2 Abstract | Since the discovery of AMP-activated protein kinase (AMPK) as a central regulator of energy homeostasis, many exciting insights into its structure, regulation and physiological roles have been revealed. While exercise, caloric restriction, metformin and many natural products increase AMPK activity and exert a multitude of health benefits, developing direct activators of AMPK to elicit beneficial effects has been challenging. However, in recent years, direct AMPK activators have been identified and tested in preclinical models, and a small number have entered clinical trials. Despite these advances, which disease(s) represent the best indications for therapeutic AMPK activation and the long-term safety of such approaches remain to be established. Cardiovascular disease Dramatic improvements in health care coupled with identifying a unifying mechanism that could link these (CVD). A term encompassing an increased standard of living, including better nutri- changes to multiple branches of metabolism followed diseases affecting the heart tion and education, have led to a remarkable increase in the discovery that the AMP-activated protein kinase or circulatory system. human lifespan1. Importantly, the number of years spent (AMPK) provided a common regulatory mechanism in good health is also increasing2. Despite these positive for inhibiting both cholesterol (through phosphoryla- Non-alcoholic fatty liver disease developments, there are substantial risks that challenge tion of HMG-CoA reductase (HMGR)) and fatty acid (NAFLD). A very common continued improvements in human health. Perhaps the (through phosphorylation of acetyl-CoA carboxylase disease in humans in which greatest threat to future health is a chronic energy imbal- (ACC)) synthesis8 (BOx 1).
    [Show full text]
  • GPCR Signaling Inhibits Mtorc1 Via PKA Phosphorylation of Raptor
    RESEARCH ARTICLE GPCR signaling inhibits mTORC1 via PKA phosphorylation of Raptor Jenna L Jewell1,2,3*, Vivian Fu4,5, Audrey W Hong4,5, Fa-Xing Yu6, Delong Meng1,2,3, Chase H Melick1,2,3, Huanyu Wang1,2,3, Wai-Ling Macrina Lam4,5, Hai-Xin Yuan4,5, Susan S Taylor4,7, Kun-Liang Guan4,5* 1Department of Molecular Biology, University of Texas Southwestern Medical Center, Dallas, United States; 2Harold C Simmons Comprehensive Cancer Center, University of Texas Southwestern Medical Center, Dallas, United States; 3Hamon Center for Regenerative Science and Medicine, University of Texas Southwestern Medical Center, Dallas, United States; 4Department of Pharmacology, University of California, San Diego, La Jolla, United States; 5Moores Cancer Center, University of California San Diego, La Jolla, United States; 6Children’s Hospital and Institutes of Biomedical Sciences, Fudan University, Shanghai, China; 7Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, United States Abstract The mammalian target of rapamycin complex 1 (mTORC1) regulates cell growth, metabolism, and autophagy. Extensive research has focused on pathways that activate mTORC1 like growth factors and amino acids; however, much less is known about signaling cues that directly inhibit mTORC1 activity. Here, we report that G-protein coupled receptors (GPCRs) paired to Gas proteins increase cyclic adenosine 3’5’ monophosphate (cAMP) to activate protein kinase A (PKA) and inhibit mTORC1. Mechanistically, PKA phosphorylates the mTORC1 component Raptor on Ser 791, leading to decreased mTORC1 activity. Consistently, in cells where Raptor Ser 791 is mutated to Ala, mTORC1 activity is partially rescued even after PKA activation. Gas-coupled GPCRs *For correspondence: stimulation leads to inhibition of mTORC1 in multiple cell lines and mouse tissues.
    [Show full text]
  • The Control of Phosphorylase Phosphatase by Camp-Dependent Protein Kinase
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Volume 82, number 2 FEBS LETTERS October 1977 THE CONTROL OF PHOSPHORYLASE PHOSPHATASE BY CAMP-DEPENDENT PROTEIN KINASE Pi1 GERGELY and Gyijrgy BOT Institute of Medical Chemistry, University of Medicine, H-4026 Debrecen, Bern t& 18/B, Hungary Received 22 July 1977 1. Introduction tissues which inhibits the phosphatase reaction is heat- stable [ 11 ,121. This heat-stable inhibitor protein is The enzymes of glycogen metabolism are regulated phosphorylated by CAMP-dependent protein kinase by interconversion between phosphorylated and dephos- [ 131. Recently, T&h et al. demonstrated the reversible phorylated forms. Contrary to our well-defined knowl- phosphorylation and dephosphorylation of this heat- edge of the phosphorylation processes of different stable inhibitor protein in vivo [ 143. Huang and Glins- enzymes and their role in glycogen breakdown and mann demonstrated the existence of two heat-stable synthesis, the phosphatases catalyzing the reverse inhibitor proteins for phosphatase [ 15,161. processes are only now being understood. The regula- Enzymic chemical modification of phosphorylase tion of dephosphorylation reactions is still unclear. phosphatase has not been established as a means of Phosphorylase phosphatase converts ‘active’ phos- regulation [ 171. phorylase a (EC 2.4.1.1) into ‘inactive’ phosphorylase In the present communication the effect of CAMP- b by cleavage of the phosphate groups from the serine dependent protein kinase on the phosphatase reaction residues. For the control of phosphorylase phospha- (i.e., on the dephosphorylation of phosphorylase a) tase the following mechanisms are possible: has been investigated.
    [Show full text]