A Case Study in the Fern Myriopteris Gracilis (Pteridaceae)

DOES ASEXUALITY CONFER A SHORT TERM ADVANTAGE? A CASE STUDY IN THE FERN MYRIOPTERIS GRACILIS (PTERIDACEAE)

A Thesis by

David Wickell

Bachelor of Science, Wichita State University, 2013

Submitted to the Department of Biological Sciences and the faculty of the Graduate School of Wichita State University in partial fulfillment of the requirements for the degree of Master of Science

July 2015

DOES ASEXUALITY CONFER A SHORT TERM ADVANTAGE? A CASE STUDY IN THE FERN MYRIOPTERIS GRACILIS (PTERIDACEAE)

The following faculty members have examined the final copy of this thesis for form and content, and recommend that it be accepted in partial fulfillment of the requirement for the degree of Master of Science, with a major in Biological Sciences.

______James Beck, Committee Chair

______Mary Liz Jameson, Committee Member

______Craig Torbenson, Committee Member

iii

ACKNOWLEDGEMENTS

I would like to thank James Beck for guiding my research and generally doing his best to prepare me for a career in the biological sciences. Also, I want to thank Mary Liz Jameson for introducing me to bioinformatics and giving me my start in biological research. I am grateful to

Mike Windham and Amanda Grusz for sharing their extensive knowledge of Myriopteris as well as help in the field.

I would also like to thank George Yatskievych (Missouri Botanical Garden) for assistance finding M. gracilis in the field and the herbarium as well as Elizabeth Johnson (Garrett

Herbarium, Natural History Museum of Utah) and Tiana Rehman (Biological Research Institute of Texas) for their assistance in locating herbarium specimens.

Collections from the field were conducted with permission from the New Mexico

Bureau of Land Management, Arizona Bureau of land Management, US National Forest Service,

University of Central Oklahoma, Virginia Department of Conservation and Recreation, Kansas

Department of Wildlife, Parks, and Tourism, Illinois Department of Natural Resources, Texas

Parks and Wildlife Department, Kentucky State Nature Preserves Commission, Minnesota

Department of Natural Resources, and the Missouri Department of Conservation.

Finally, this research would not have been possible without grants from the Kansas

Academy of Science, American Society of Plant Taxonomists and Wichita State University.

ABSTRACT

Asexual taxa are generally seen as evolutionary dead ends, relegated to the tips of phylogenies due to elevated extinction rates. Despite this macroevolutionary disadvantage, there is evidence in some cases that asexual reproduction may provide a short-term benefit.

This is particularly evident in asexual species that display a wider distribution than their sexual relatives. Alternatively, it is possible that such broad distributions are an illusion created by multiple asexual lineages, each occupying a relatively small area. Myriopteris gracilis Fée

(Pteridaceae) is a North American asexual fern species with a particularly large range. In this study we investigate, first, if M. gracilis is exclusively asexual throughout its range and second, whether M. gracilis comprises a single wide-ranging lineage, or multiple, more geographically restricted lineages. Sexuality was assessed by counting spores/sporangium in 502 herbarium specimens from 28 states and provinces in the USA, Canada and Mexico, revealing no cryptic sexual populations. Lineage structure was then assessed with both plastid DNA sequence and

Genotyping By Sequencing (GBS) SNP datasets. The plastid data identified two large, roughly eastern and western, groups. Each group was further subdivided by the GBS data, to reveal a complex distribution of asexual lineages of varying geographic range sizes none of which accounted for the total size of the M. gracilis range. Thus, viewed as a single, continuous distribution, they tend to overstate the success of any one lineage in M. gracilis and by extension, asexuality’s contribution to short-term success in other species.

TABLE OF CONTENTS

Chapter Page

1. BACKGROUND (REVIEW OF LITERATURE) 1

2. INTRODUCTION 10

3. METHODS 14

Field collections and spore counting 14 DNA extraction and plastid sequencing 15 Plastid sequence alignment and analysis 15 Genotyping by sequencing (GBS) 16 GBS filtering and analysis 17

4. RESULTS 19

Geographic distribution of asexual lineages 19 Plastid dataset 19 Genomic dataset 20

5. CONCLUSIONS AND FUTURE DIRECTIONS 22

The absence of a M. gracilis sexual progenitor 22 Lineage diversity and the appearance of short term success 24

REFERENCES 29

APPENDIX 35

Tables 36 Figures 38 Record M. gracilis specimens spore counted 45 M. gracilis specimens submitted to Sanger sequencing and/or GBS 65

LIST OF TABLES

Table Page

1. Primers used for amplification and Sanger sequencing of the plastid trnGR region 36

2. Ranks and stability values of significant clusters resulting from PCOMC analysis 37

vii

LIST OF FIGURES

Figure Page

1. M. gracilis U.S. distribution, noting the location of field collections 38

2. M. gracilis U.S. distribution, noting the location of georeferenced spore-counted individuals 39

3. Plastid trnGR Bayesian 50% consensus phylogram of M. gracilis and six closely- related Myriopteris species 40

4. Plastid trnGR haplotype network 41

5. Geographic distribution of plastid trnGR haplotypes 42

6. Principal coordinates analysis of SNP data indicating significant clusters identified by PCOMC 43

7. Geographic distribution of significant clusters identified by PCOMC 44

viii

CHAPTER 1

BACKGROUND AND REVIEW OF LITERATURE:

Evolutionary biology has long struggled to explain the origin and proliferation of sexual reproduction among multicellular organisms (Stearns 1990). The preponderance of sexual reproduction is especially surprising given the significant costs associated with it. The most cited and perhaps well-known example of these costs is the two-fold demographic cost of sex

(Maynard Smith 1978). While only females are capable of reproducing in a sexual population, every asexual individual is capable of reproduction, allowing asexual populations to effectively double in size every generation. Additionally, sexual reproduction imposes a fitness cost, as females are only able to pass on half of their genes despite the much higher energy cost they incur by reproducing. Even when especially fit genotypes do arise, they are potentially eliminated during meiosis, as both recombination and segregation can disrupt effective combinations of genes that have become ideally suited to a specific environment (Williams

1975). With all else being equal, such significant costs should allow asexuals to outcompete their sexual counterparts. This apparent conflict between the world we observe and the one we would expect has led to the development of several hypotheses that could explain the relative scarcity of asexual species across the tree of life.

The majority of these hypotheses focus on processes that occur over longer evolutionary timescales. Muller’s ratchet hypothesizes that genetic recombination is necessary to remove deleterious mutations from the gene pool (Muller 1964). This is accomplished at multiple stages during meiosis, initially in the pairing of homologous chromosomes, where

1 sequence aberrations can inhibit proper pairing and cause meiosis to fail (Heng 2007).

Additionally, genetic segregation and recombination both concentrate and redistribute deleterious mutations across a population, increasing the efficacy of purifying selection (Barton and Charlesworth 1998). In the absence of recombination, however, an ever-increasing genetic load of deleterious mutations can eventually drive asexual species to extinction (Kondrashov

1988; Lynch et al. 1993). This sort of “mutational meltdown” has been observed in numerous eukaryotic taxa, notably in yeast (Zeyr et al. 2001), protozoans (Bell 1988), Drosophila (Crow and Simmons 1983) and nematodes (Morran 2009). Alternative hypotheses generally focus on asexual species' failure to adapt alongside rapid changes in various environmental factors

(Hakoyama and Iwasa 2004). A popular example is the “Red Queen” hypothesis, where co- evolving parasites exert selective pressure against commonly encountered genotypes. This results in the evolutionary maintenance of sexual reproduction to provide alternative, possibly resistant genotypes (Bell 1982). These dynamics have been demonstrated between reproductively isolated populations of lizards, minnows, snails, nematodes and flax (Moritz et al. 1991; Lively et al. 1990; Lively 1987; Antonovics et al. 2011; Morran et al. 2011; respectively), in which areas experiencing higher parasite loads tend to be inhabited by sexual populations, whereas asexuality is more prevalent in areas with low parasite loads.

Ultimately, all of these models imply that the rarity of asexual taxa is due to an ever increasing probability of extirpation as a result of lowered fitness. Being associated with such high rates of extinction leads to obligate asexual species being viewed as evolutionary dead- ends or “twigs on the tree of life” (Agnarsson et al. 2006; Schwander and Crespi 2009).

Although such views largely rule out the success of asexuality over large evolutionary time

2 scales, they typically don't make predictions regarding the potential short-term advantage of this strategy. In reality, many studies suggest that asexuality may be a successful approach over relatively short evolutionary time scales. Numerous asexual taxa occupy significantly larger distributions and occur at higher latitudes than their closest living relatives, a phenomenon commonly known as geographic parthenogenesis (Glesner and Tilman 1978; Lynch 1984;

Verduijn et al. 2001; Kearney 2005; Hörandl 2006). An array of mechanisms has been proposed to explain this relative geographic success. As mentioned previously, asexuality reduces reproductive costs by simultaneously increasing the mother’s genetic contribution relative to energetic cost, increasing the total number of offspring that can be produced and removing the need to search for a mate (Williams 1975; Maynard-Smith 1978; Van Dijk 2003). Second, while less commonly documented, asexuality can theoretically lead to lucky or “general purpose genotypes” (GPGs) that allow a single lineage to survive and reproduce in a wide range of environments (Lynch 1984). While GPGs have been posited to be the mechanism behind large asexual distributions, this is largely the result of testing a single lineage in a variety of simulated conditions as opposed to field-testing alternative genotypes across a species’ range (Weider

1993; Van Doninck 2002). Finally, asexual mechanisms such as the formation of gemmae in many species of pteridophytes and bryophytes, facilitates rapid local colonization and dominance immediately following periods of disturbance (Kimmerer 1994). These and other benefits may underlie the curious disparity in range sizes between many asexual species and their sexual progenitors, a pattern that lies at the core of the debate regarding near-term success in obligate asexual species.

Asexual species are nearly always polyploids, with a nuclear genome consisting of three or more complete sets of chromosomes. More precisely, while autopolyploid genomes are entirely derived from a single species, allopolyploid genomes contain sets of chromosomes from two or more distinct species obtained via interspecific hybridization. Polyploid formation involves the union of two unreduced diploid (2n) gametes produced in a population of sexual diploids to yield a tetraploid (4n), or the production of a triploid (3n) via the union of an unreduced gamete and a normal haploid gamete. These newly formed polyploids will often be rare, surrounded by their sexual diploids progenitors. The transition to asexuality is therefore seen as a potential adaptation that allows newly formed polyploids to become established among their diploid progenitors, since an appropriate sexual mate with compatible genome structure will likely not exist (Ramsey and Schemsky 1998). Polyploidy and the transition to asexuality are therefore thought to occur simultaneously in species where they are both observed. The link between asexuality and polyploidy is critical here because of the recurrent formation of polypoid lineages–the majority of polyploids are known to result from multiple origins throughout time (Soltis et al. 2009; Beck et al. 2012; Cosendai et al. 2011). Multiple evolutionary origins of polyploids simply require the formation of unreduced gametes by a sexual diploid at any point in its evolutionary history, anywhere throughout its range (Soltis and

Soltis 1993; 1999). Accordingly, the rate at which novel polyploid lineages originate is directly correlated with the production of unreduced gametes by sexual diploids. As a consequence of their polyploid origin, broadly distributed asexual taxa could be continuously derived throughout their sexual progenitors’ evolutionary history, and could therefore comprise a mosaic of multiple, evolutionarily distinct lineages. It is likely that certain asexual lineages will

4 possess distinct phenotypes derived from their respective diploid progenitors. Under the model of “frozen niche variation,” each asexual lineage could therefore “freeze” a portion of the sexual diploid's phenotypic variation, allowing that lineage to thrive under a particular set of conditions (Vrijenhoek 1978). Natural selection acting on these fixed phenotypes could then result in niche partitioning, creating a diverse distribution of asexual lineages, each suited to a distinct subset of the asexual species' total range. Examples of niche partitioning within asexual taxa include Taraxacum (Vavrek et al. 1998; Verduijn 2004), Ranunculus (Horandl 2000), and

Rana tadpoles (Semlitsch 1997). Studies that fail to consider the potential recurrent formation of asexual polyploids therefore risk over-estimating the geographic range of any given asexual lineage, creating an illusion of the short-term success of asexuality.

Over the last several decades, research into the consequences of asexuality has focused almost exclusively on plants. This is not a coincidence, as asexuality is considerably more common in this clade. The primary focus of this research is apomixis (from here on, referred to interchangeably as “apomixis” or “asexuality”), a form of asexuality that results in the formation of unreduced plant seeds/ spores and animal embryos. Apomictic seed will then germinate to produce an adult plant that is genetically identical to its parent. Alternatively, spores must go through an additional gametophyte stage after which the sporophyte develops directly via mitosis from the unfertilized, polyploid gametophyte cells (Walker 1979). While only a handful of apomictic animals are known to exist, apomixis is comparatively common in plants where it is described in more than 400 species in ca. 330 genera of angiosperms (Carman 1997;

Soltis and Soltis 2000). It is especially common in ferns, known from ca. 10% of species (Walker

1979). In ferns, asexuality many confer additional fitness advantages, particularly to those

5 species found in arid environments. First, it has been suggested that apomixis results in an accelerated gametophyte stage, reducing the time spent as minute structures prone to desiccation. Secondly, asexual ferns can reproduce in the near absence of moisture, as apomictic gametophytes do not require a film of water to transmit gametes in the form of motile sperm (Hevly 1963; Moran 2004). These and other potential advantages of fern asexuality perhaps result in the numerous examples of asexual fern species with large distributions compared to their sexual relatives. In this thesis I evaluate one such example–the potential short-term success of the slender lip fern [Myriopteris gracilis Fée (Pteridaceae)].

The slender lip fern is an asexual fern that is typically found growing in crevices on calcareous cliffs and boulders throughout large portions of North America. It is particularly common on limestone and sandstone outcrops in partial to full sun. Outside of its core range in the southwestern U.S., M. gracilis occurs on calcareous rocks as far east as North Carolina and as far north as southeastern Alaska (Windham and Rabe 1993; Rothfels et al. 2012; Wickell unpubl. data). This substantial geographic distribution spans a wide array of climates, and as such is a potentially dramatic example of an extremely successful asexual genotype. However, as noted above it is possible that this large range is misleading, a compilation of several more restricted ranges. This is due to M. gracilis' status as not only asexual, but polyploid (triploid). It is believed to be an autopolyploid, derived from the union of an unreduced gamete with a reduced gamete, both from a single sexual diploid ancestral species (Michael Windham, personal communication). As detailed above, this formation could have occurred repeatedly over time, creating a multitude of genetically distinct lineages at different times and in different portions of the sexual diploid progenitor's range. Under this scenario, M. gracilis’ apparent

6 short-term success could be an illusion, its large geographic range a mosaic of multiple lineages, each with a relatively small distribution. Alternatively, the discovery of a single widespread lineage, or of multiple lineages that each span most or all of the total species' range would demonstrate that a single asexual lineage can experience some form of short term biogeographic success.

Although this pattern of recurrent formation of asexual lineages has been documented in other polyploid species (Beck et al. 2012; Cosendai et al. 2011; King 1993), previous studies have focused on asexual polyploids of hybrid origin for which at least one sexual parental species was extant. In contrast, M. gracilis represents a unique study system, allowing a thorough investigation of apparent success in a widely distributed non-hybrid asexual

(autopolyploid) that appears to have outlived its closest sexual relative. This of course requires establishing that this sexual ancestor is indeed extinct and will initially require a comprehensive search for extant sexual populations. This is important, since the recurrent formation of asexual lineages by cryptic sexual populations undermines the potential geographic success of M. gracilis. Fortunately the search for rare sexual populations can be easily accomplished by conducting spore counts on herbarium material collected from across M. gracilis’ range. The mode of reproduction for any fertile (spore bearing) specimen is easily inferred from the number of spores produced in a single sporangium. Adherence to Döpp-Manton sporogenesis reduces the number of spores per sporangium from 64 to 32 by interrupting the final mitotic division, yielding half as many mother cells containing twice as many chromosomes (Döpp

1939). While proving the complete absence of sexual populations is not possible, failing to find sexual specimens at hundreds of locations throughout the range would strongly establish that

7 cryptic sexual populations are extremely rare and unlikely to have an ongoing effect on asexual lineage diversity in M. gracilis.

Further investigation will focus on the identification of genetically distinct lineages within M. gracilis. A combination of genetic and genomic data will ultimately allow an estimation of the number of lineages and how they are distributed relative to the total species’ range. A "first-generation" genetic dataset will involve sequencing the plastid locus trnGR

(Windham et al. 2009) in all samples. These sequence data can be obtained rapidly and economically and will allow for a rough estimate of the number and distribution of lineages.

This single locus approach will, however, certainly underestimate lineage diversity in M. gracilis.

A "next generation" genomic dataset will therefore subsequently be generated in order to provide a much higher resolution look at lineage diversity. Genotyping by sequencing (GBS) is a relatively simple, rapid, and cost effective tool that can be used to identify single nucleotide polymorphisms at thousands of locations across the genome (Elshire et al. 2011). This is accomplished by using restriction enzymes to arbitrarily cleave the genome at well conserved restriction sites. This yields a "reduced representation library," a consistent pool of fragments from each sample, to which Illumina sequencing adapters and unique barcode sequence are ligated. These libraries are then sequenced in parallel on the Illumina platform, yielding comparable sequence at thousands of short stretches of DNA in all individuals. While GBS has predominantly been applied to sexual species, the genomic fingerprint it provides appears to be ideal for distinguishing clonal lineages. In fact, the high degree of similarity among individuals within any given lineage simplifies the identification of lineages formed at different times due to a theoretically consistent level of genomic differentiation (Reitzel et al. 2013).

Establishing that M. gracilis is a wholly asexual taxon and establishing the diversity and distribution of its lineages will provide insight into a particularly dramatic example of an asexual species that has presumably outlived its diploid progenitor. More broadly, this research will deepen our understanding of the potential short-term success of asexual lineages, and by extension, the overall dominance of sexual reproduction among eukaryotes.

CHAPTER 2

INTRODUCTION

The evolutionary maintenance of sexual reproduction stands as one of the greatest unanswered questions in evolutionary biology. The dominance of sex among eukaryotes is particularly surprising given its numerous disadvantages relative to asexual reproduction. Chief among these are the two-fold demographic and fitness costs of sex. Simply stated, sexual reproduction is maintained in spite of the fact that roughly half of the individuals cannot produce offspring, and those that do pass on only 50% of their genes (Maynard-Smith 1975;

Williams 1975). In contrast, asexual populations can effectively double in size every generation and particularly fit combinations of genes are passed on in their entirety. This obvious contradiction is commonly referred to as the “paradox of sex” (Shields 1982), and multiple hypotheses have been developed in order to explain the rarity of asexuality among multicellular plants and animals.

Most explanations focus on the role of sex and recombination in promoting genetic diversity. Conversely, the failure of asexual lineages is explained by their inherent lack of diversity in combination with an inability to rid themselves of deleterious mutations. The “Red

Queen” and “Muller’s Ratchet” hypotheses are perhaps the best known versions of these ideas.

According to the Red Queen hypothesis, sexual reproduction maintains rare resistant genotypes that can persist in the face of selective pressures imposed on the most common genotypes by parasites and pathogens (Bell 1982; Lively 1987; Antonovics et al. 2011). Muller’s

Ratchet refers to the irreversible accumulation of mutations in asexual lineages and the eventual extinction of these lineages due to mutational meltdown (Muller 1964). Both

10 hypotheses are well documented in a wide range of taxa (lizards: Moritz et al. 1991; minnows:

Lively et al. 1990; snails: Lively 1987; nematodes: Morran et al. 2011; flax: Antonovics et al.

2011; Drosophila: Crow and Simmons 1983), and provide compelling explanations for the relative rarity of asexuality.

Despite this characterization as evolutionary dead ends or “twigs on the tree of life”

(Agnarsson et al. 2006; Schwander and Crespi 2009), there is considerable evidence that the transition to asexuality may confer some degree of short-term success. Asexual species frequently occupy higher latitudes and elevations compared to sexual diploids, a phenomenon known as “geographic parthenogenesis” (Glesner and Tilman 1978; Lynch 1984; Verduijn et al.

2001; Kearney 2005; Hörandl 2006). Certain asexual species also occupy particularly large distributions relative to their sexual progenitors and/or closely related sexual species

(Bierzychudek 1985). Although these large asexual ranges suggest the possibility of a short-term benefit, the recurrent formation of asexual lineages can create the illusion of success. Asexual species are almost always also polyploid (Soltis et al. 2009; Beck et al. 2012; Cosendai et al.

2011), and the recurrent formation of polyploid lineages is quite common–the rule rather than the exception (Soltis and Soltis 1999). As a result of this recurrent formation, an apparently broadly distributed asexual species could harbor a diverse mosaic of lineages, each of which is less geographically successful than the total range would suggest.

A potentially dramatic example of a geographically successful asexual species is the slender lip fern. Myriopteris gracilis Fée (Pteridaceae) is an asexual triploid found growing in crevices on calcareous cliffs and boulders throughout North America. It is an autopolyploid, derived from a single diploid species. Outside of its core range in the southwestern U.S., M.

11 gracilis occurs as far east as North Carolina and as far north as southeastern Alaska (Windham and Rabe 1993; Rothfels et al. 2012; Wickell unpubl. data). This broad distribution is thought to exclusively comprise obligate asexuals, as sexual populations have never been documented.

The slender lip fern, therefore, represents an strong opportunity to investigate the apparent success of a widely distributed non-hybrid asexual polyploid, as the majority of previous investigations have focused on asexual polyploids of hybrid origin in which at least one sexual diploid parent has been described.

We ask two basic questions: 1) Is M. gracilis exclusively asexual? and 2) Does M. gracilis comprise a single successful asexual lineage? Answering the first question will require a comprehensive search for cryptic sexual populations. As an autopolyploid, M. gracilis presumably co-existed with its sexual diploid progenitor for a time, and although these sexual populations may be rare, they may remain extant. Establishing that M. gracilis is exclusively asexual is critical, since the recurrent formation of asexual lineages by cryptic sexuals undermines the idea of a geographically successful asexual species. Fortunately, a rigorous search can be accomplished by conducting spore counts on herbarium specimens. In plants, apomixis refers to a form of asexuality in which the alternation of generations does not involve standard, reductive meiosis or the union of gametes (Nogler 1984). In ferns, a modified version of meiosis produces unreduced spores that germinate and form a similarly unreduced gametophyte. The sporophyte then develops directly from this gametophyte in the absence of fertilization (Walker 1979). The production of viable, unreduced spores in M. gracilis involves a common alternative pathway known as Döpp-Manton sporogenesis (Döpp 1930; Manton). Due to an incomplete mitotic division in the lead-up to meiosis, the Döpp-Manton pathway

12 consistently produces 32 spores in a given sporangium, half the number resulting from the typical sexual pathway. Spore number per sporangium can be quickly ascertained, and the sexuality of any fertile specimen can therefore be readily established. Many such specimens are available, as this commonly collected species is well represented in regional and national herbaria.

Determining whether M. gracilis comprises one or multiple lineages will require genetic and genomic data from individuals across its large range. Lineages will be identified using a clustering approach that groups individual samples based on their genetic similarity in multidimensional space. Assuming that the formation of each lineage captures a distinct portion of the genetic variation initially present in its sexual progenitor, asexual lineages should be genetically distinct from one another, while individuals from the same lineage should be nearly identical. A “first generation” genetic dataset will be obtained by sequencing a highly variable region of the plastid genome. While this single locus dataset will provide only a coarse estimation of lineage diversity, this estimate can be obtained rapidly, economically, and from both freshly-collected and herbarium tissues. A “next generation” genomic dataset will then be generated in order to obtain a fine-scale estimate of lineage diversity. Genotyping by sequencing (GBS) identifies single nucleotide polymorphisms (SNPs) at thousands of locations across the genome by massive parallel sequencing of a reduced representation library (Elshire et al. 2011). This library is generated by digesting genomic DNA with restriction enzymes, and then producing a consistent pool of particular genomic fragments in each sample. Sequencing of this library on the Illumina next generation sequencing platform can subsequently produce up to 180,000,000 short reads on a single lane. Identical reads are aligned to generate millions

13 of tags which can then be aligned to a reference genome or to each other to identify loci in the absence of a reference genome. After alignment, tags are assigned to individual samples and compared to identify or “call” single nucleotide polymorphisms (SNPs). While GBS has predominantly been applied to sexual species, the genomic fingerprint it provides is potentially well-suited for distinguishing clonal lineages (Reitzel et al. 2013).

Establishing that M. gracilis is a wholly asexual taxon and documenting the number and distribution of its lineages will provide insight into a particularly dramatic example of a widely distributed asexual species, insights that will deepen our understanding of the potential short-term success of asexual lineages, and by extension the overall dominance of sexual reproduction among eukaryotes.

CHAPTER 3

METHODS

Field collections and spore counting:

Specimens were collected from across the range of M. gracilis in the United States

(Windham and Rabe 1993; Rothfels et al. 2012; Wickell unpubl. data), including disjunct eastern populations in Kentucky and Virginia (Figure 1; Appendix 1). Prospective collection sites were identified using historical locality data from distributed networks such as SEINet (SEINet 2014), as well as numerous smaller databases maintained by herbaria. At each of 102 sites, material sufficient for voucher specimens was obtained and leaf tissue from a single individual was preserved in silica gel for subsequent molecular analyses. Sexuality was determined for each sample by counting the number of spores per sporangium. One or more mature sporangia were removed intact from the underside of a leaf and placed in a single drop of glycerol with a dissecting needle. Each sporangium was then opened, its contents teased apart, and individual spores counted on a dissecting microscope under low magnification. Additional spore counts were also obtained from 400 herbarium specimens archived in 11 herbaria. Spore counts from herbarium material were combined with those from 102 freshly collected specimens for a total of 502. All successfully spore-counted herbarium specimens were georeferenced using associated locality data, and tissue samples were obtained from select specimens for inclusion in our plastid sequence dataset.

DNA extraction and plastid sequencing:

Genomic DNA was extracted from 102 silica-dried samples using the DNeasy Plant

Minikit (Qiagen, Valencia, CA, USA), and DNA was extracted from 11 herbarium-acquired tissues

15 following the protocol detailed in Beck et al. (2012). A section of the plastid genome spanning a portion of the trnG intron, one of two trnG exons, and nearly half of the trnG-trnR intergenic spacer (herein referred to as trnGR) was PCR-amplified under standard conditions and previously published primers (Table 1) as described in Beck et al. (2010). Amplicons were visualized on a 1% agarose gel to confirm successful amplification before undergoing Sanger sequencing at the University of Chicago Comprehensive Cancer Center DNA Sequencing and

Genotyping Facility.

Plastid sequence alignment and analysis

Sequence data were assembled into contigs and edited with CLC Workbench (CLC Bio

Aarhus, Denmark) prior to manual alignment in Seaview 4 (Galtier et al. 1996). Regions of uncertain alignment were excluded from further analysis. Outgroup choice was guided by a recent phylogenetic analysis and re-circumscription of the genus Myriopteris Fée (Grusz et al.

2014). Ten samples representing all six species of "clade L" (Grusz et al. 2014) were chosen, and one sample of Myriopteris aurea (Poir.) Grusz & Windham was included from outside “clade L” to root the entire dataset. The resulting dataset was analyzed under the Bayesian optimality criterion with MrBayes version 3.2.6 (Ronquist and Huelsenbeck 2003) on the CIPRES Science

Gateway version 3.3 (Miller et al. 2010). The Bayesian analysis assumed a GTR+I+G model of sequence evolution and included two independent runs, each with four chains. Chains were run for ten million generations, with trees were sampled every 100 generations. Convergence was evaluated by plotting the log-likelihood values from each run using Tracer version 1.5 (Rambaut and Drummond 2009). Runs reached convergence within the first 100,000 generations, and trees sampled during the first 2.5 million generations of each run were conservatively excluded

16 before obtaining clade posterior probabilities. Bayesian posterior probabilities above 95% were considered significant. Finally, a haplotype network was generated with TCS version 1.18

(Clement et al. 2000) in order to visualize relationships among the 113 M. gracilis trnGR sequences.

Genotyping by sequencing (GBS):

In preparation for GBS, genomic DNA was quantified using a Quant-iT™ dsDNA HS Assay

(Invitrogen, Carlsbad, CA, USA) on the Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA). All extracts were then visually evaluated by running 100 ng of DNA against a λ DNA-HindIII digest size ladder on a 1% agarose gel. A set of 95 geographically representative samples exhibiting sufficient high quality genomic DNA were chosen for GBS. GBS library optimization/preparation and sequencing were conducted at the Genomic Diversity Facility (GDF) at Cornell University’s

Biotechnology Resource Center. Test libraries were constructed from a single genomic DNA using two restriction enzymes (EcoT221, PstI). Libraries were visualized with a Bio-Rad (Bio-Rad,

Hercules, California, USA) Experion in order to determine which restriction enzyme yielded the library with the smallest number of fragments. EcoT221 was chosen given its slightly smaller fragment pool, one that should result in increased sequencing depth of each fragment. Each sample was pooled with a barcode and common adapter, digested with EcoT22I, and subsequently ligated together with ligase. The barcode adapter contained a 4-8 bp barcode sequence that is subsequently used to identify each sample, allowing subsequent reactions to be carried out in multiplex. All samples were then pooled and purified using a Qiagen (Qiagen,

Valencia, CA) QIAquick PCR Purification Kit). Ligated fragments were then combined with a pair of primers for PCR amplification. In addition to priming amplification, these oligos facilitated

17 the addition of a short (~15 nucleotide) sequence at the 5’ end to bind amplification products to the lanes of the Illumina (Illumina, San Diego, California, USA) flowcell. Following amplification, the resulting reduced representation library was subjected to 100-bp single end sequencing on two lanes of an Illumina HiSeq 2500.

GBS filtering and analysis:

Initial data processing employed the TASSEL-GBS "Discovery" pipeline (Glaubitz et al.

2014). Prior to alignment, TASSEL 4.0 (Bradbury et al. 2007) was used to assemble 64 bp consensus sequences or “tags” by aligning identical reads. Unique tags were identified by searching the raw data for a combination of the restriction site along with DNA barcodes from each sample found in the “master key file.” Unique tags were then merged to create a master file containing tags that were observed five or more times across all FastQ files. A preliminary

M. gracilis genome assembly (Wickell, unpublished data) was indexed using the Burrows-

Wheeler alignment tool (BWA; Li and Durbin 2009), and BWA was subsequently used to align all tags found in the master tag file to the indexed reference genome and export this alignment in

SAM format. Following alignment, BWA was used to convert the SAM file into tags on physical map (TOPM) file that could be used to call SNPs in TASSEL. Additionally, TASSEL was used to output an HDF5 or “tags by taxa” file, used to assign SNPs to individuals according to their DNA barcode. Finally, data from both the TOPM file and the HDF5 file were used to call SNPs in

TASSEL. Tags that mapped to the same location on the reference genome (TOPM) were considered a “locus,” and differences between samples at a given locus represented SNPs. All previously generated data including physical location, read depth, allele frequency, and sequence quality were then combined by TASSEL and exported in the variant call format (VCF)

18 for subsequent analysis. VCF files are text files used to store multiple types of DNA polymorphisms data, including SNPs and associated meta-data (reference position, sequence quality, read depth and allele frequency).

After merging SNPs from each Illumina lane using a custom Python script, the resultant

VCF file was filtered using VCFtools v.0.1.12b (Danecek et al. 2011). Initially, individuals that exhibited missing data at >70% of loci were removed from the data set, resulting in retention of

73 of the original 95 individuals. Multiple VCF files were then generated by filtering individual genotypes (SNPs at a particular locus in a particular sample) at read depths of 5, 7, and 10 reads, where genotypes containing less than the specified number of reads were redefined as

“missing”. Next, loci were filtered according to their proportion of missing data at three levels of “missingness” (5%, 10% and 20 %). Indels (sites where the alternative allele was “-“ or missing) and loci exhibiting more than two alleles were then removed using the custom Python script to yield VCF files that contained exclusively bi-allelic SNP data. Principal coordinates analysis with modal clustering (PCOMC) (Reeves and Richards 2009) was used to identify significant clusters and rank them according to how tightly individuals are associated within each cluster across the entire range of axes defined in a standard principal coordinate analysis

(PCoA). In order to visualize PCO-MC results, a standard PCoA was conducted in NTSYS-PC version 2.11 (Rohlf 2002), and a plot of individual scores on the three most informative PCoA axes was plotted using Python.

CHAPTER 3

RESULTS

Geographic distribution of asexual lineages

Spore counts were obtained from 502 specimens from 25 U.S. states, 1 Canadian province, and 2 states of Mexico (Appendix 1). 497 individuals exhibited 32 spores per sporangium, while five exhibited between 40 and 56 "irregular" spores. These shriveled, misshapen irregular spores, relatively common among Myriopteris asexual triploids (Knobloch

1969), are viewed as the result of some type of meiotic failure and thus also indicative of apomixis. Spore phenotypes therefore established that all 502 specimens were asexual. Locality data sufficient for geo-referencing were available for 384 individuals for M. gracilis (Figure 1).

Low quality, contradictory or non-existent locality data precluded the geo-referencing of 118 individuals, the majority of which were located in the western portion of the range.

Plastid dataset

Extracted DNA concentrations from freshly collected material ranged from 13.7 ng/μl

(CJR4431; Lemhi Co., ID) to 114 ng/μl (PJA 1473; Lincoln Co., NM), with an average of 35.1 ng/μl. DNA extracted from herbarium tissue was not quantified. The plastid trnGR region was successfully amplified and sequenced from 113 tissue samples, including 15 obtained from herbarium specimens (Appendix 2). The total aligned dataset included 1,085 sites, and 63 sites were removed due to uncertain alignment. The Bayesian 50% consensus phylogram (Fig. 3) provides evidence that M. gracilis is monophyletic (1.0 Bayesian Posterior Probability- BPP). As

20 in Grusz et al. (2014), the slender lip fern is placed in a clade along with Myriopteris lanosa

(Michx.) Grusz & Windham and Myriopteris longipila (Baker) Grusz & Windham. Although M. lanosa and M. longipila were sister to one another in the Grusz et al. (2014) topology, M. lanosa and M. gracilis were identified as sister taxa in this analysis, albeit with insufficient support (0.66 BPP). The aligned dataset comprising the 113 M. gracilis individuals included

1,028 sites, with none excluded due to alignment issues. The haplotype network (Fig. 4) provides evidence that 111/113 individuals exhibited one of two major haplotypes that differed at six sites. Two individuals exhibit a rare haplotype that differed from one of the common haplotypes by a single substitution. The geographic array of these three haplotypes is highly structured, as the two common haplotypes occupy the eastern or western portions of the distribution with minimal overlap (Fig. 5). Two exceptions involved individuals exhibiting the

"eastern" haplotype in Chatauqua Co., KS and Weld Co., CO. The two individuals with the rare

"northern" haplotype were both found in Minnesota (Houston and Winona counties).

Genomic dataset

Illumina sequencing of the 95 submitted samples initially recovered 3,389,844 loci.

Alignment to the partial reference genome reduced the number of loci by more than half to

1,062,672. Removal of individuals missing >70% of loci resulted in the retention of 73 individuals. Filtering VCF files at various read depths had a neglible effect on manhattan genetic distance between samples, and a minimum sequence depth of 7 was chosen to maximize the number of loci and minimize the possibility of sequencing error. Consequently, additional filtering for the proportion of missing data was conducted exclusively among loci represented by at least 7 reads. Unlike read depth, missingness had a significant effect on pairwise distance.

In datasets that were filtered at the level of 10% “missingness” (the maximum proportion of missing alleles at an individual locus could not exceed 10%), the number of loci dropped to just

678 and resulted in a distance matrix with a relatively narrow range of 5.1% to 10.4%. The lowest distances (below ca. 7.0%) belonged to individuals within two groups that roughly corresponded to the eastern and western haplotypes while 21 individuals did not have a pairwise distance of less than 7.0% relative to any other individual. At the other extreme, filtering at 30% missingness yielded 27,734 loci, with a broader range of pairwise distances

(2.1% – 11.7%). While at least four groups could be identified as having a distance under 6% between individuals within each group, missing data were primarily concentrated in just five individuals, potentially resulting in lower genetic distances relative to the other samples (4.8% –

9.1%). Finally, filtering at 20% missingness yielded 6,634 bi-allelic SNPs, and resulted in a relatively even distribution of missing data with a range of genetic distances from 2.2% – 10.6%.

Additionally, the distance matrix constructed using this dataset produced a largely bi-modal distribution of pairwise distances, with distinct peaks located near distances of 4.0% and 7.5%.

This is the pattern we would expect if we are comparing individuals from both within (the lower mode) and between (the higher mode) recurrently formed asexual lineages. As a result, this dataset (a maximum read depth of 7 and 20% missingness) was chosen for further analysis.

Four cohesive clusters of individuals are apparent in the plot of individual scores on the three most informative PCoA axes (Fig. 6), and these same visually distinct groups were identified as highly ranked, statistically significant clusters by PCO-MC (Table 2). The most highly-ranked cluster (blue; stability = 84.536) comprised individuals from the Missouri Ozarks, the Driftless Zone (IA, IL, MN, WI), and the disjunct VA population (Fig. 7). All members of this

22 blue cluster exhibited the "eastern" plastid haplotype. The second most highly ranked cluster

(stability = 38.144) comprised the remaining samples, all but 3 of which (Weld Co., CO;

Chatauqua Co., KS; Iowa Co., WI) exhibited the "western" plastid sequence. This large group was further subdivided into highly-ranked clusters. The yellow cluster (8 individuals; stability =

15.464) and the green cluster (6 individuals; stability = 8.247) comprised individuals from the southern tier of the M. gracilis distribution. The next two most highly ranked clusters (stabilities

= 8.247, 6.186) were slight modifications of the yellow and green groups, each involving the exclusion of two samples. Finally, the red cluster comprised 40 or 42 individuals (stability =

4.124 in both instances) broadly distributed in the western and central portions of the range. In instances where PCOMC identified more than one variation of a cluster (e.g. yellow, green and red) as being significant, the cluster with the highest stability value was used for further geographic analysis. In cases where the stability values were the same, the cluster with the most individuals was mapped, this only occurred in the red group. A red-cluster specimen from

Iowa Co., WI was a notable exception to this geographic signal. The remaining (white) individuals were not consistently assigned to any of the preceding clusters. However, PCOMC did identify several statistically significant but relatively low-ranked (stability values < 3.0) variations of the red group that contained up to 8 of these samples.

CHAPTER 5

CONCLUSIONS AND FUTURE DIRECTIONS

The absence of a M. gracilis sexual progenitor

The complete absence of sexuality among the 502 range-wide samples we examined represents strong evidence that the sexual diploid progenitor of M. gracilis no longer exists.

While it is impossible to completely exclude the possibility of rare sexual diploids, our data suggest that if extant, these populations are extremely uncommon. The fact of M. gracilis' wide distribution, in the absence of ongoing genetic contributions from sexual populations, certainly contributes to the notion that asexual species are capable of short term success.

The absence of sexual populations in M. gracilis is particularly conspicuous in light of numerous studies in which cryptic sexual populations have been discovered in species that were previously thought to be entirely asexual. Three prominent examples come from the

"Cheilanthoid" ferns, a monophyletic group of 400-500 species to which the genus Myriopteris belongs (Windham et al. 2009). The smooth cliff-brake (Pellaea glabella Mett. ex Kuhn var. glabella), known from 23 states and two Canadian provinces, was long thought to be completely asexual until sexual populations were discovered in Missouri (Wagner et al. 1965).

In addition to M. gracilis, two other Myriopteris species were once believed to be completely asexual. Myriopteris lindheimeri (Hook.) J. Sm., distributed from the U.S. southwest to central

Mexico, was thought to be a completely asexual triploid species until rare sexual diploid populations were discovered in Arizona (Grusz et al. 2009). Finally, sexual populations of

Myriopteris aurea, an extraordinarily widespread species ranging from the U.S. southwest to

Argentina, were recently discovered from Mexico (J. Beck unpublished data). Non-plant

24 examples include the fungus farming ant Mycoceperus smithii (Forel), where sexual reproduction was inferred from the presence of sperm in females’ reproductive tracts despite the fact that the males of the species have yet to be identified (Rabeling et al. 2011). Ongoing cryptic sexual reproduction was also identified in 11 species of the gall-wasp genus Andricus

(Hartig) by analysis of allozyme and mitochondrial sequence (cytochrome b) allele frequencies, despite the morphological distinctiveness of sexual individuals (Stone et al. 2008).

Sexual progenitors are commonly found at lower latitudes relative to their asexual progeny (Lynch 1984; Kearney 2005; Hörandl 2006), and the observation of increased M. gracilis asexual lineage diversity near the southern limit of its U.S. range (AZ, NM and TX in Fig.

7) suggests that this region may have once harbored a diverse array of sexual populations.

Thus, the possibility remains that rare sexual diploids exist in M. gracilis, and future studies should focus on the southernmost portion of the species’ range in southern NM, AZ, TX and the

Mexican states of Chihuahua and Coahuila. Spore counts for this research were based on collections archived at 11 U.S. herbaria; additional herbaria in Mexico should be examined for possible sexual populations.

Lineage diversity and the appearance of short-term success

While M. gracilis appears to be entirely composed of asexual individuals, both molecular datasets clearly establish that this taxon harbors multiple asexual lineages. The observation of two relatively divergent and strikingly geographically structured plastid haplotypes suggests a historical lack of gene flow between eastern and western portions of the sexual diploid progenitor's range. Asexual lineages arising in each region would then have received one of these divergent plastomes. Although the northern haplotype could be evidence of an additional

25 origin, it could be the result of de novo mutation that occurred following the origin of the aforementioned widespread eastern lineage.

The plastid data alone provide a relatively coarse insight into the recurrent formation of asexual lineages within M. gracilis. The GBS data, however, present information at thousands of points throughout the genome, and as such provide a considerably more detailed picture of lineage diversity. Multiple distinct genetic groups are evident with even a cursory examination of the three-dimensional PCoA plot (Fig. 6), groups that are identified as statistically significant and highly cohesive in multidimensional space by PCO-MC (Table 2). The genetic cohesiveness of these four clusters and their geographic distributions (Fig. 7) provide compelling evidence that M. gracilis is a combination of multiple asexual lineages formed at different times from a sexual ancestor, with each origin capturing and propagating a particular genotype. It should be stressed that our identification of four clusters is undoubtedly an underestimate of true lineage diversity. The relatively modest cohesiveness of the red cluster and the numerous unassigned

(white) individuals clearly indicate that these samples represent additional distinct lineages.

Cyto-nuclear genome patterns also suggest additional complexity. Three individuals from the red cluster (Weld Co., CO; Russell Co., KS; Grant Co., WI) exhibited eastern plastid genomes, suggesting an additional origin from a sexual ancestor with this unique genome combination.

The presence of multiple lineages in M. gracilis joins the many examples of recurrent polyploid formation (Soltis 1999) and adds to a growing consensus on lineage diversity in asexual taxa. The geographic partitioning of the slender lip fern range by multiple asexual lineages is similar to that observed in a wide variety of taxa, including angiosperms

[Taraxacum (Vavrek et al. 1998; Verduijn 2004); Ranunculus (Horandl 2000)], invertebrates

[Campeloma (Johnson 2006); Myzus persicae (Haack et al. 2000, Vorburger et al. 2003)] and vertebrates [Rana (Semlitsch 1997)]. A notable difference in the case of M. gracilis is the lack of a sexual progenitor, whereas the ongoing generation of new asexual lineages is potentially a feature of most other study systems. Indeed, most hypotheses that attempt to explain the distribution of multiple, distinct asexual lineages are concerned with how these lineages co- exist with their sexual parents as opposed to how they persist in the progenitor’s absence.

While this research demonstrated the extent to which asexual taxa are capable of geographic success in the absence of a sexual progenitor, many questions regarding the evolutionary history and formation of novel lineages in M. gracilis remain unanswered. For instance, future research could involve estimating the relative age of individual asexual lineages and how often they are formed. Estimating asexual lineage age would involve generating a rigorous intraspecific nuclear phylogeny and estimating the dates of lineage divergence across this tree. Phylogeny reconstruction of this sort with nuclear data is of course complicated by M. gracilis' status as a polyploid derived from an extinct ancestor. The evolutionary history of individual M. gracilis nuclear genomes therefore departs considerably from a standard dichotomously branching tree, as the initial formation of an asexual lineage could potentially unite and fuse nuclear genomes from different portions of the sexual diploid phylogeny (Birky

1996). Alternatively, a tree reconstructed from plastid sequences offers the opportunity to isolate and reconstruct the evolutionary history of the maternal portion of an asexual lineage's genome. Given the relative lack of information exhibited by the single plastid locus we sequenced, reconstructing a rigorous maternal phylogeny would likely require a whole- plastome sequencing approach.

Returning to the question of whether an obligate asexual is capable of short term success, the answer in the case of the slender lip fern is “yes, but…” Yes, M. gracilis’ geographic distribution is formed completely by asexual individuals, but this total range overstates the success of any of the multiple, recurrently formed lineages identified. The occupation of large portions of the slender lip fern range by individual asexual lineages is nevertheless impressive.

While restricted to the eastern portion of the range, the "blue" lineage ranges from the Ozark

Plateau north into the Driftless zone, with disjunct populations in KY and NC. This range spans almost 1500 km from the northernmost population in Winona Co, MN to the easternmost collection in Pulaski Co., VA. If the blue lineage is indeed the result of a single origin, it is perhaps what many researchers refer to as a "general purpose genotype," capable of surviving in a wide range of conditions despite little genotypic variation (Baker 1974; Lynch 1984).

Similarly, the red lineage occupies an even larger distribution, ranging from Iowa Co., WI to

Coconino Co. Arizona, a distance of roughly 2100 km. However, the red population’s geographic success should be viewed tentatively. The alternative inclusion of individuals from the white cluster along with the eastern plastotype exhibited by the Iowa Co., WI sample suggest that the red cluster harbors multiple lineages. Despite some uncertainty in their precise composition and resultant distribution, both the red and blue lineages appear to have been quite successful when viewed in isolation. On the other hand, their success seems less significant when placed in the context of M. gracilis’ total range. Realistically, M. gracilis is likely an overlapping mosaic of genetically distinct lineages formed at a time when its sexual progenitor occupied a significant portion of its modern distribution.

REFERENCES

REFERENCES Antonovics J, Thrall PH, Burdon JJ and Laine AL. 2011. Partial resistance in the Linum- Melampsora host-pathogen system: does partial resistance make the red queen run slower? Evolution, 65: 512-522.

Beck JB, Allison JR, Pryer KM and Windham MD. 2012. Identifying multiple origins of polyploid taxa: a multilocus study of the hybrid cloak fern (Astrolepis integerrima; Pteridaceae). American Journal of Botany, 99: 1857-1865.

Beck JB, Windham MD and Pryer KM. 2011. Do asexual polyploid lineages lead short evolutionary lives? A case study from the fern genus Astrolepis. Evolution 65: 3217-3229.

Bell G. 1988. Sex and death in the protozoa. Cambridge University Press, New York.

Birky CW. 1996. Heterozygosity, heteromorphy, and phylogenetic trees in asexual eukaryotes. Genetics, 144: 427-437.

Bradbury PJ, Zhang Z, Kroon DE, Casstevens TM, Ramdoss Y, Buckler ES. 2007. TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics, 23: 2633-2635.

Butlin R. 2002. The costs and benefits of sex: new insights from old asexual lineages. Nature Reviews Genetics, 3: 311-312.

Clement M, Posada D and Crandall KA. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology, 9: 1657-1659.

Costa GC, and Schlupp I. 2010. Biogeography of the Amazon molly: ecological niche and range limits of an asexual hybrid species. Global Ecology and Biogeography, 19: 442-451.

Cosendai AC, Rodewald J, and Hörandi E. 2011. Origin and distribution of autopolyploids via apomixis in the alpine species Ranunculus kuepferi (Ranunculaceae). Taxon, 60: 355-364.

Crow JF and Simmons MJ. 1983. The mutation load in Drosophila. Ashburner M, Carson HP, and Thompson JN Jr, eds. The genetics and biology of Drosophila, Vol. 3c. Academic Press, New York: 1-35.

Danecek P, Auton A, Abecasis G, Albers, CA, Banks E, DePristo, MA ... and Durbin R. 2011. The variant call format and VCFtools. Bioinformatics, 27: 2156-2158.

Dopp W. 1939. Cytologische und genetische Untersuchungen innerhalb der Gattung Dryopteris. Planta, 29: 481.

Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, and Mitchell SE. 2011. A robust, simple genotyping by sequencing (GBS) approach for high diversity species. Plos One, 6.

Glesner RR and Tilman D. 1978. Sexuality and the components of environmental uncertainty: clues from geographic parthenogenesis in terrestrial animals. American Naturalist, 112: 659- 673.

Grusz AL, Windham MD and Pryer, KM. 2009. Deciphering the origins of apomictic polyploids in the Cheilanthes yavapensis complex (Pteridaceae). American Journal of Botany, 96: 1636-1645.

Haack L, Simon JC, Gauthier JP, Plantegenest M and Dedryver CA. 2000. Evidence for predominant clones in a cyclically parthenogenetic organism provided by combined demographic and genetic analyses. Molecular Ecology, 9: 2055–2066.

Heng HH. 2007. Elimination of altered karyotypes by sexual reproduction preserves species identity. Genome, 50: 517-524.

Hevly RH. 1963. Adaptations of cheilanthoid ferns to desert environments. Journal of the Arizona Academy of Science, 2: 164-175.

Hörandl E, Greilhuber J, Dobes C. 2000. Isozyme variation and ploidy levels within the apomictic Ranunculus auricomus complex: evidence for a sexual progenitor species in southeastern Austria. Plant Biology, 2: 53–62.

Hörandl E. 2006. The complex causality of geographical parthenogenesis. New Phytologist, 171 525-538.

Johnson SG 2006. Geographic ranges, population structure, and ages of sexual and parthenogenetic snail lineages. Evolution, 60: 1417-1426.

Kearney M. 2005. Hybridization, glaciation and geographical parthenogenesis. Trends in Ecology & Evolution, 20: 495-502.

Kimmerer RW. 1994. Ecological consequences of sexual versus asexual reproduction in Dicranum flagellare and Tetraphis pellucida. The Bryologist, 97: 20-24.

King LM. 1993. Origins of genotypic variation in North American dandelions inferred from ribosomal DNA and chloroplast DNA restriction enzyme analysis. Evolution, 47: 136-151.

Knobloch IW. 1969. The spore pattern in some species of Cheilanthes. American Journal of Botany, 56: 646-653.

Li H, Durbin R. 2009. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25: 1754–1760.

Lively CM. 1987. Evidence from a New Zealand snail for the maintenance of sex by parasitism. Nature, 328: 519-521.

Lynch M. 1984. Destabilizing hybridization, general purpose genotypes and geographic parthenogenesis. Quarterly Review of Biology, 59: 257-290.

Lynch M, Burger R, Butcher D, and Gabriel W. 1993. The mutational meltdown of asexual populations. The Journal of Heredity, 84: 339-344.

Manton, I. 1950. Problems of cytology and evolution in the Pteridophyta. Cambridge University Press.

Miller MA, Pfeiffer W and Schwartz T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments Workshop (GCE), 14 Nov. 2010, New Orleans, LA: 1 - 8.

Morran, LT, BJ Cappy, JL Anderson, and PC Phillips. 2009. Sexual partners for the stressed: Facultative outcrossing in the self-fertilizing nematode Caenorhabditis elegans. Evolution, 63: 1473-1482.

Morran LT, Schmidt OG, Gelarden IA, Parrish RC and Lively CM. 2011. Running with the Red Queen: host-parasite coevolution selects for biparental sex. Science 333: 216-218.

Moran RC. 2004. A Natural History of Ferns. Timber Press, Portland OR.

Moritz C, McCallum H, Donnellan S and Roberts JD. 1991. Parasite loads in parthenogenetic and sexual lizards (Heteronotia binoei): support for the Red Queen hypothesis. Proceedings of the Royal Society of London B: Biological Sciences, 244: 145-149.

Muller HJ. 1925. Why polyploidy is rarer in animals than in plants. American Naturalist, 59: 346- 53.

Muller HJ. 1964. The relation of recombination to mutational advance. Mutation Research, 1: 2- 9.

Nagalingum NS, Schneider H, and Pryer KM. 2007. Molecular phylogenetic relationships and morphological evolution in the heterosporous fern genus Marsilea. Systematic Botany, 32: 16- 25.

Otto SP and Lenormand T. 2002. Resolving the paradox of sex and recombination. Nature Reviews Genetics, 3: 252-261.

Otto SP and Whitton J. 2000. Polyploid incidence and evolution. Annual Review of Genetics, 34: 401–437.

Rabeling C, Gonzales O, Schultz TR, Bacci M, Garcia MV, Verhaagh M ... and Mueller UG. 2011. Cryptic sexual populations account for genetic diversity and ecological success in a widely distributed, asexual fungus-growing ant. Proceedings of the National Academy of Sciences, 108: 12366–12371.

Rambaut A, & Drummond AJ. 2009. Tracer version 1.5. 0. WWW document. URL http://tree. bio. ed. ac. uk/software/tracer/. Accessed 4 July 2015.

Reitzel AM, Herrera S, Layden MJ, Martindale MQ and Shank TM. 2013. Going where traditional markers have not gone before: utility of and promise for RAD sequencing in marine invertebrate phylogeography and population genomics. Molecular Ecology, 22: 2953–2970.

Rohlf, F. J. 2002. NTSYSpc: Numerical Taxonomy System, ver. 2.11. Exeter Publishing Ltd., Setauket, NY.

SOUTHWEST ENVIRONMENTAL INFORMATION NETWORK, SEINet. 2013-2014. http://swbiodiversity.org/seinet/index.php. Accessed from May 2013 to July 2015.

Rothfels CJ, Sigel EM and Windham MD. 2012. Cheilanthes feei T. Moore (Pteridaceae) and Dryopteris erythrosora (D.C. Eaton) Kunze (Dryopteridaceae) new for the flora of North Carolina. American Fern Journal, 102: 184-186.

Schwander T and Crespi BJ. 2009. Twigs on the tree of life? Neutral and selective models for integrating macroevolutionary patterns with microevolutionary processes in the analysis of asexuality. Molecular Ecology, 18: 28-42

Semlitsch RD, Hotz H and Guex GD. 1997. Competition among tadpoles of coexisting hemiclones of hybridogenetic Rana esculenta: support for the Frozen Niche Variation model. Evolution, 51: 1249–1261.

Soltis DE and Soltis PS. 1993. Molecular data and the dynamic nature of polyploidy. Critical Review of Plant Science, 12: 243–73.

Soltis D and, Soltis PS. 1999. Polyploidy: recurrent formation and genome evolution. Trends in Ecology and Evolution, 14: 348–52.

Soltis DE and Soltis PS. 2000. The role of genetic and genomic attributes in the success of polyploids. Proceedings of the National Academy of Sciences, 97: 7051-7057.

Soltis DE, Buggs RJA, Barbazuk WB, Schnable PS and Soltis PS. 2009. On the origins of species: does evolution repeat itself in polyploid populations of independent origin? Cold Spring Harbor Symposia on Quantitative Biology, 74: 215-223.

Shields WM. 1982. Philopatry, inbreeding and the evolution of sex. State University of New York Press, Albany, New York. 103–138.

Stearns SC. 1990. The evolutionary maintenance of sexual reproduction: the solutions proposed for a longstanding problem. Journal of Genetics, 69: 1–10.

Stebbins GL. 1938. Cytological characteristics associated with the different growth habits in the dicotyledons. American Journal of Botany, 25: 189–98.

Stone GN, Atkinson RJ, Rokas A, Aldrey JLN, Melika, G, Acs Z ... and McVean GA. (2008). Evidence for widespread cryptic sexual generations in apparently purely asexual Andricus gallwasps. Molecular Ecology, 17: 652–665.

Van Dijk PJ. 2003. Ecological and evolutionary opportunities of apomixis: insights from Taraxacum and Chondrilla. Philosophical Transactions of the Royal Society B: Biological Sciences, 358: 1113-1121.

Van Doninck K, Schon I, De Bruyn L and Martens K. 2002. A general purpose genotype in an ancient asexual. Oecologia, 132: 205-212.

Vavrek JMC, McGraw JB and Yang HS. 1998. Within-population variation in demography of Taraxacum officinale (Asteraceae): differential genotype response and effect on interspecific competition. American Journal of Botany, 85: 947–954.

Verduijn MH, Van Dijk PJ and Van Damme JMM. 2004. Distribution, phenology and demography of sympatric sexual and asexual dandelions (Taraxacum officinale s.l.): geographic parthenogenesis on a small scale. Biological Journal of the Linnean Society, 82: 205-218.

Vorburger C, Lancaster M, and Sunnucks P. 2003. Environmentally related patterns of reproductive modes in the aphid Myzus persicae and the predominance of two ‘‘superclones’’ in Victoria, Australia. Molecular Ecology, 12: 3493–3504.

Vrijenhoek RC. 1978. Coexistence of clones in a heterogeneous environment. Science, 199: 549- 552.

Vrijenhoek RC. 1998. Animal clones and diversity. Bioscience, 48(8): 617-628.

Walker TG. 1979. The cytogenetics of ferns. AF Dyer ed. The experimental biology of ferns. Academic Press, London: 87-132.

Weider LJ. 1993. A test of the “general purpose” genotype hypothesis: differential tolerance to salinity stress among Daphnia clones. Evolution, 47: 965-969.

Windham MD, Huiet L, Schuettpelz E, Grusz AL, Rothfels C, Beck J, Yatskievych G and Pryer KM. 2009. Using plastid and nuclear DNA sequences to redraw generic boundaries and demystify species complexes in cheilanthoid ferns. American Fern Journal, 99: 128-132.

Zeyl C, Mizesko M and De Visser JAGM. 2001. Mutational meltdown in laboratory yeast populations. Evolution, 55: 909-917.

APPENDIX

TABLE 1. PRIMERS USED FOR AMPLIFICATION AND SANGER SEQUENCING OF THE PLASTID TRNGR REGION.

DNA region Primer 5’-3’ primer sequence Primer source trnGR TRNG1F GCGGGTATAGTTTAGTGGTAA Nagalingum et al. 2007 trnGR TRNR22R CTATCCATTAGACGATGGACG Nagalingum et al. 2007

TABLE 2. THE EIGHT MOST COHESIVE, STATISTICALLY SIGNIFICANT CLUSTERS OF INDIVIDUALS IDENTIFIED BY PCO-MC ANALYSIS OF 6,634 SNPS IN 73 MYRIOPTERIS GRACILIS INDIVIDUALS. EXCEPT WHERE INDICATED BY (*), CLUSTERS CORRESPOND TO THE PCOA PRESENTED IN FIGURE 6. SPECIMEN IDS CORRESPOND TO APPENDIX 2.

Rank: Cluster: Stability Specimen IDs: value: 1 Blue 84.536% DW05, DW14, JB_1311, JB_1313, JB_1316, JB_1317, JB_1319, JB_1321, JB_1323, JB_1327, JB_1328, JB_1449, JB_1452, JB_1453

2 All except blue 38.144% CJR2496, DW01, DW02, DW03, DW04, DW18, DW24, DW25, DW26, DW27, DW28, DW30, DW31, DW32, DW34, DW35, DW37, DW38, DW39, DW40, DW41, DW43, DW44, DW45, DW46, DW48, DW50, DW51, DW53, DW56, DW57, JB_1312, JB_1329, JB_1339, JB_1344, JB_1353, JB_1371, JB_1374, JB_1379, JB_1381, JB_1386, JB_1395, JB_1400, JB_1405, JB_1409, JB_1410, JB_1435, JB_1442, JB_1443, JB_1445, MW4262, PJA_1331, PJA_1377, PJA_1406, PJA_1411, PJA_1430, PJA_1431, PJA_1437, PJA_1452 3 Yellow 15.464% CJR2496, DW30, JB_1405, JB_1410, JB_1435, PJA_1377, PJA_1406, PJA_1437

4 Yellow* 8.247% DW30, JB_1405, JB_1410, PJA_1377, PJA_1406, PJA_1437

5 Green 8.247% DW31, JB_1329, JB_1339, JB_1344, JB_1400, JB_1409 6 Green* 6.186% DW31, JB_1339, JB_1344, JB_1400 7 Red 4.124% DW01, DW02, DW03, DW04, DW18, DW25, DW28, DW34, DW35, DW37, DW38, DW39, DW40, DW 41, DW43, DW44, DW45, DW46, DW48, DW50, DW51, DW53, DW56, DW57, JB_1312, JB_1353, JB_1371, JB_1374, JB_1379, JB_1386, JB_1395, JB_1442, JB_1443, JB_1445, MW4262, PJA_1331, PJA_1411, PJA_1430 8 Red* 4.124% DW01, DW03, DW04, DW18, DW25, DW28, DW34, DW35, DW37, DW38, DW39, DW40, DW43, DW44, DW45, DW46, DW48, DW50, DW51, DW53, DW56, DW57, JB_1312, JB_1353, JB_1371, JB_1374, JB_1379, JB_1386, JB_1395, JB_1442, JB_1443, JB_1445, MW4262, PJA_1331, PJA_1411, PJA_1430 none White none DW24, DW26, DW27, DW32, JB_1381, PJA_1431, PJA_1452

Figure 1. Myriopteris gracilis’ U.S. county-level distribution (green). Counties in which at least one sample was obtained for genetic analysis are shown in yellow. Distribution map adapted from Biota of North America Program.

Figure 2. Location of 384 spore-counted individuals that could be confidently georeferenced. Myriopteris gracilis’ U.S. county-level distribution is shown in green. All individuals exhibited 32 spores per sporangium, indicating asexuality. Distribution map adapted from Biota of North America Program.

Figure 3. Bayesian 50% consensus phylogram resulting from analysis of the trnGR plastid sequence dataset in Myriopteris gracilis and related species. Bayesian posterior probabilities are indicated above branches.

North West: n = 2 n = 83

East n = 28

Figure 4. Haplotype network generated using trnGR sequence data obtained from 113 Myriopteris gracilis individuals.

Figure 5. Geographic distribution of plastid haplotypes (colors correspond to Fig 4) in the context of Myriopteris gracilis’ U.S. county-level distribution is shown in green. Distribution map adapted from Biota of North America Program.

A B

C D

Figure 6. Results of PCoA and PCO-MC analysis of 6,634 SNPs in 73 Myriopteris gracilis individuals. A-C. Three alternative rotations of the plot of scores on the three principal components. Colors indicate clusters discussed in the text and detailed in Table 2. D. Colored boxes correspond to clusters #1, 2, 3, 5, 7 discussed in the text and mapped in Fig. 7. Populations in white indicate individuals that were not consistently assigned to any cluster.

Figure 7. Geographic distribution of clusters identified by PCO-MC analysis of 6,634 SNPs in 73 Myriopteris gracilis individuals in the context of M. gracilis’ U.S. county-level distribution. Colors are discussed in the text and detailed in Table 2. Distribution map adapted from Biota of North America Program.

APPENDIX 1

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta BRIT USA Alaska Haines Collected along the trail to Battery Point about 59.214293 -135.382179 J.&C. Taylor 30228 32 1 mile S. Of Portage Cove Campground. US USA Arizona Apache Navajo Reservation, Bear Canyon, 12 mi S. Of 35.535 -109.53 Demaree 38506 32 Ganado WICH USA Arizona Cochise Coronado National Forest, Copper Canyon, 31.36385 -110.298 Wickell 31 32 near Eighty Spring, just N. Of W. Montezuma Canyon Rd. US USA Arizona Cochise Chiricahua mts.; tuff cliff 31.909913 -109.25153 Maxon 1964 32 WICH USA Arizona Cochise Coronado National Forest, Along FR42 just S. 31.91875 -109.23016 Wickell 30 32 Of Paradise. KSC USA Arizona Cochise Chiricahua mts.; paradise falls 31.934245 -109.219557 Blumer 1332 32 WICH USA Arizona Coconino E side of Hwy 87, 6.7 mi N. Of jnct. With Hwy 34.50305 -111.36298 J. B. Beck 1372 32 260. US USA Arizona Coconino Dry wash battleground mont. 34.5461374 -111.2206923 Phillips 2984 32 WICH USA Arizona Coconino Oak Creek Canyon, just east of the bridge on 34.88409 -111.73768 Wickell 34 32 highway 89A, south of the highway. US USA Arizona Coconino Walnut Canyon, 3 mi E. Of National Mont. 35.17 -111.47 Little 4795 32 WICH USA Arizona Coconino Flagstaff; trail along Rio de Flag. 35.18726 -111.64319 J. B. Beck 1374 32 US USA Arizona Coconino Flagstaff 35.198 -111.651 Whitehead 2049 32 WICH USA Arizona Coconino Coconino NF, Mt Elden, N.W. of Flagstaff 35.2311 -111.58921 Wickell 35 32 ranger's station. US USA Arizona Coconino Near rim of Grand Canyon, "hotel to Hopi 36.075 -112.156 Blake 9820 32 Point" US USA Arizona Coconino Grand canyon data deficient Hitchcock 33 32 US USA Arizona Coconino Along Little Colorado River 5 mi below data deficient Goldman 2867 32 Cameron WICH USA Arizona Gila Tonto natural bridge sp. 34.31948 -111.45787 J. B. Beck 1371 32 WICH USA Arizona Santa Cruz Coronado National Forest, near Onyx Cave, just 31.71649 -110.76922 Wickell 32 32 N. Of Gardner Canyon Rd., ca. 6mi. W. Of AZ- 83. WICH USA Arizona Yavapai NE outskirts of Rimrock on the S. Rim of Beaver 34.645 -111.76 Alexander 1411 32 Creek, 0.5 mi. S.W. of Montezuma Well, 1.8 mi N. Of Russell spring. BRIT USA Arkansas Baxter Norfolk data deficient D. Demaree 3088 32 BRIT USA Arkansas Baxter Ca. 5 mi. E. Of mt. Home. Cranfield rec. Area of data deficient B.L. Lipscomb 1639 32 norfork lake. Limestone bluffs of lake. BRIT USA Arkansas Benton Ozark Mountain Region: Vicinity of Sulphur 36.486913 -94.454915 D. Demaree 4975 32 Springs, 22 mi. WNW of Rogers. Elev. About 900 ft. MO USA Arkansas Boone Harrison data deficient Palmer 6906 32 WICH USA Arkansas Boone E side of Long Creek, just W. Of Tower Rd. 36.42072 -93.293 J. B. Beck 1339 32 MO USA Arkansas Carroll Bluff of White River, Beaver 36.474 MISSING Palmer 29312 32 BRIT USA Arkansas Clark NE of Amity, dry ledges, T5S R22W S9 data deficient J.H. Peck 09-461 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta BRIT USA Arkansas Cleburn On Sugarloaf, S.E. of Heber Springs, off Hwy 5, 36.084127 -92.163401 J.H. Peck 09-605 32 dry rock ledges, N. Facing side BRIT USA Arkansas Hot Spring Dry rock ledges, up high above US 7 along 34.40002 -93.092682 J.H. Peck 09-455 32 Fourche O'Loupe Creek WICH USA Arkansas Izard E of River Rd., 3.9 km S.E. of Guion. 35.89976 -91.91287 J. B. Beck 1344 32 US USA Arkansas Izard Croker springs 36.107924 -91.895342 Demaree 17038 32 BRIT USA Arkansas Sharp SW ¼, N.W. ¼, S25, T17N, R5W, West facing data deficient W.D. Crank 02004 32 cliff along Strawberry River NCU USA Arkansas Stone Vicinity of Gunner Pool Rec. Area, Sec 30 T16N 35.99147 -92.211031 Redfearn 31695 32 R12W MO USA Arkansas Washington Savoy 36.102 -94.334 Demaree s.n. 32 RM Canada British E shore of Columbia Lake 50.2 -115.817 32 Columbia RM Canada British Canoe Creek Indian Reserve, ca. 32 mi N.W. of 51.433 -122.1 Calder 17813 32 Columbia Clinton US Canada British Ca. 7.5 mi ssw of alkali lake po; 51 42 n. 122 18 51.7 -122.3 Calder 17104 32 Columbia w US USA California Inyo Death valley nat. Monument, pinon mesa 36.237 -117.118 Reveal 1784 32 DUKE USA California Inyo Wyman canyon 37.351 -117.999 Lloyd 2823 32 RM USA California San Providence mts., mitchell's canyon 34.941 -115.514 Beal 612 32 Bernardino US USA California San Gilroy canyon, providence mts. 34.967 -115.514 Jepson 18239 32 Bernardino US Mexico Chihuahua Ca. 5.5 mi n.w. of parral 26.983276 -105.726342 Correll 22718 32 US Mexico Chihuahua Above Rancho el Almagre 29.095777 -104.26928 Johnston 1205 32 US Mexico Chihuahua Los Lamentos Mts., E. Of Villa Ahumada 30.696973 -106.709032 Knobloch 229 32 US Mexico Chihuahua Samalayuca 31.340772 -106.468684 Knobloch 409 32 US Mexico Chihuahua 1 mi E. Of rt. 45, 6 mi N. Of Samalayuca 31.410498 -106.4432 Correll 22635 32 MO Mexico Chihuahua SE side of Sierra Mula, ca. 5 mi S. Of Juarez 31.636283 -106.505953 Correll 23314 32 US Mexico Coahuila Chojo Grande, 27 mi S.E. of Saltillo 25.281954 -100.533543 Palmer 374 32 US Mexico Coahuila Just S. Of San Jose (base of Sierra de las Cruces) 28.010467 -103.73811 Johnston 981 32 WICH USA Colorado Baca Sand Creek Canyon west of county Rd. 13 37.02793 -102.8398 Wickell 20 32 about 22 mi S. Of Pritchett. WICH USA Colorado Baca Sand Creek Canyon just east of county Rd. 13 37.02551 -102.83738 Wickell 19 32 about 22 mi S. Of Pritchett. WICH USA Colorado Baca Sand Creek Canyon, 3.2 mi. S. Of Co. Rd. J, just 37.000392 -102.49553 Wickell 43 32 west of Sand Creek Canyon Rd. (Co. Rd 13). COLO USA Colorado Baca Mouth of Sand Creek Canyon; just N. Of OK 37.003375 -102.843901 Weber 3291 32 line RM USA Colorado Baca Picture canyon: pasture 2a 37.006391 -102.757899 Weber 18749 32 CS USA Colorado Baca Sand Creek Canyon 25 mi S. Of Pritchett 37.017631 -102.843901 Harrington 2539 32 CS USA Colorado Baca Sand Creek Canyon 25 mi S. Of Pritchett 37.017631 -102.843901 Harrington 3367 32 KANU USA Colorado Baca 3 mi W. 20 mi S. Of Pritchett 37.051889 -102.951708 Stephens 21867 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta COLO USA Colorado Bent S end of John Martin Reservoir; T23S R50W 38.050795 -102.976767 Clark 722 32 S.W. 1/4 SEC 19 CS, COLO USA Colorado Boulder S side of Gunbarrel Hill, 8 mi N.E.of Boulder 40.065067 -105.199849 Weber 3274 32 COLO USA Colorado Boulder Heil valley ranch open space; t3n r70w s30 40.177562 -105.17882 Scully 292 32 se1/4 COLO USA Colorado Boulder Lyons 40.224631 -105.271536 Andrews s.n. 32 WICH USA Colorado Boulder Heil Valley Open Space, ca. 200 yds up slope 40.20292 -105.26808 J. B. Beck 1442 32 from Picture Rock Trail WICH USA Colorado Chaffee San Isabel NF, "Limestone Ridge", high above 38.665783 -106.04051 Wickell 45 32 the road, access from Co. Rd.305 N.W. of Hwy. 24,ca. 0.5 mi. N. Of Highway/ENE of Co. Rd.305. RM USA Colorado Delta Needle Rock, south and east slopes to north 38.724057 -107.549593 Hartman 56541 32 side, rock face, ca 3.5 mi N.E.of Crawford. WICH USA Colorado Eagle Rifle Mountain Park, along E. Side of Co. Rd. 39.610628 -107.08939 Wickell 47 32 217 adjacent to climbing area 2.7 mi. N. Of Rifle Mtn. Hatchery/end of CO-325. WICH USA Colorado Eagle Rifle Mountain Park, along "Koper's Trail", NNE 39.721898 -106.65228 Wickell 46 32 of parking area on Co. Rd. 217, 3.2 mi. N. Of Rifle Mtn. Hatchery/end of CO-325. COLO USA Colorado Eagle Deep Creek, ca. 14 air mi W. Of Eagle 38.855283 -107.401069 Hartman 24830 32 COLO USA Colorado El Paso Chiann canyon 38.790553 -104.899705 Jones s.n. 32 DUKE USA Colorado El Paso Ute pass, manitou springs 38.870186 -104.930127 Drouet 4104 32 COLO USA Colorado El Paso Douglas canyon data deficient Walker s.n. 32 KANU USA Colorado Elbert Ca. 9 mi n.w. limon t7s r57w s34 n1/2 39.374118 -103.809915 Brooks 14810 32 WICH USA Colorado Fremont Sand Gulch, ca. 0.75 mi. Due N. Of Sand Gulch 38.40124 -105.29572 Wickell 44 32 Campground, near the end of unnamed dirt Rd. 1.1 mi. W. Off of Co. Rd. 9. COLO USA Colorado Fremont Wet mts.; sangre de christo range; spring gulch 38.333375 -105.810798 Hartman 66580 32 COLO USA Colorado Fremont Wet Mts.; ca. 2 mi up Box Canyon, ca. 5 air mi 38.458159 -105.930569 Elliott 10471 32 S.E. of Salida on S. Side of US 50 COLO USA Colorado Fremont Lower portion of Phantom Canyon on hwy to 38.485576 -105.122387 Weber 14438 32 Cripple Creek; between Pueblo and Canyon City COLO USA Colorado Fremont Shelf Rd. Area near Red Canyon; T16S R70W 38.664955 -105.22714 Abbott 95-12 32 COLO USA Colorado Fremont 5 Points Rec. Area; 6 mi W. Of Parkdale data deficient Mead 50911-25 32 KANU USA Colorado Garfield Main Elk creek from trailhead to just beyond 39.692097 -107.583968 Hartman 25848 32 confluence with Deep Creek; ca. 15 air mi N.E.of Rifle; T4S R91W S15 CS USA Colorado Gunnison E side of the canyon of the Lake Fork, a few mi 38.377865 -107.243582 Barrell 47-60 32 N. Of Gateview COLO USA Colorado Gunnison Curecanti NRA; S. From Gateview campground 38.436111 -107.280477 Lederer 03-115 32 along Lake Fork of Gunnison River

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta COLO USA Colorado Gunnison Curecanti nra; pine creek trail 38.442884 -107.336582 Hogan 4202 32 COLO USA Colorado Gunnison Black Canyon along Cimarron Cr. 38.558368 -107.687402 Hall 634 32 COLO USA Colorado Larimer Brackenbury Natural Area; T10N R70W Sec 35; 40.796073 -105.19942 Jennings 88-24 32 E. Of Livermore and W. Of Colorado Lien Co. Operations CS USA Colorado Larimer Owl Canyon, ca. 2 mi from the beginning of the 40.799167 -105.183056 Ackerfield 1084 32 trail on N. Slope; 40 47 57 N. 105 10 59 W CS USA Colorado Larimer Owl Canyon, 20 mi N. Of Fort Collins 40.88341 -105.204098 Harrington 971 32 RM USA Colorado Larimer T12n r75 w. S23; also s26 data deficient Hill 717 32 WICH USA Colorado Larimer N side of Buckhorn Rd., 2.5 road miles N.W. of 40.50657 -105.23949 J. B. Beck 1443 32 Masonville. COLO USA Colorado Las Animas Top of Cobert Mesa; T35S R55W SEC 9/16 37.00783 -103.539804 Clark 69 32 COLO USA Colorado Las Animas Mesa N. Of Pamena Gap and OV Mesa 37.052544 -105.003569 Clark 2484 32 between the Purgatoire River and Chacuaco Creek; COLO USA Colorado Las Animas Wet Mts.; Tercio Ranch; ca. 7 air mi S. Of 37.072457 -105.02104 Elliott 7480 32 Stonewall COLO USA Colorado Las Animas S side of Mesa de Maya near western end 37.109408 -103.735707 Rogers 6092 32 COLO USA Colorado Las Animas Ca. 30 mi ene of trinidad along trinchera creek 37.421163 -103.824627 Shushan s.n. 32 COLO USA Colorado Las Animas Along Purgatoire River; T30S R59W 37.424771 -104.007314 Cooper 1454 32 CS USA Colorado Las Animas N facing canyon wall of spring Canyon, near 37.4618568 -103.8318256 Galatowitsch 911 32 the Purgatory River R57W T30S S6 COLO USA Colorado Las Animas Pinyon Canyon Maneuver Site; Stage Canyon 37.498611 -104.174704 Kelso 01-81 32 tributary of Bent Canyon COLO USA Colorado Las Animas Pinyon Canyon Maneuver Site; N. End of Spring 37.498611 -104.174704 Kelso 99-49 32 Canyon COLO USA Colorado Las Animas Lockwood Canyon; Purgatoire River Valley, 37.512621 -103.788226 Cooper 1467 32 seeps at base of Dakota Sandstone Cliff; T29N R57E WICH USA Colorado Mesa Uniweap Canyon, Nancy Hanks Gulch just W. 39.332972 -108.66577 Wickell 48 32 Of CO-141. COLO USA Colorado Mesa Uncompahgre Plateau; T15S R100W 26; Fair 38.7192798 -108.5367122 Siplivinsky 4207 32 Creek Canyon between Unaweap and Cold Spr. Ranger Station CS USA Colorado Mesa Off Hwy 141, cliffs at back of Nancy Hanks 38.797222 -108.446944 White 49 32 Gulch; 38 47 50 N; 108 26 49 W COLO USA Colorado Mesa Colorado NM; T12S R101W S30NW; Nmost 38.986684 -108.726328 Siplivinsky 3812 32 branch of head of No Thoroughfare Canyon COLO USA Colorado Mesa Colorado NM; mouth of No Thoroughfare 39.0343 108.352 Siplivinsky 3308 32 Canyon; T1S R1W COLO USA Colorado Mesa Colorado NM; first large canyon W. Of Fruita 39.0703 108.4352 Weber 3870 32 Canyon COLO USA Colorado Mesa Unaweap canyon, nancy hanks gulch;t15s 38.7627522 -108.5368433 Siplivinsky 1538 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta r100w s11w & 10e CS, COLO USA Colorado Moffat Dinosaur NM; ca. 0.2 mi E. Of confluence of 40.485604 -108.689168 O'Kane 2827a 32 Blind Canyon/Johnson Canyon; T6N R101 W. S14 N.E.1/4 of S.E. 1/4 CS USA Colorado Moffat Sand Canyon, 17 mi N. Of Artesia 40.528023 -108.966719 Harrington 8151 32 CS USA Colorado Moffat Dinosaur NM, 0.5 mi ENE of Hacking Springs; 40.5733452 -108.9967360 Kelley 88-91 32 T7N R103W S8 SE/4 SW/4 NE/4 CS USA Colorado Moffat Near Antelope Springs on Blue Mts. 40.95365 -108.924564 Harrington 1459 32 COLO USA Colorado Montezuma Cliff Canyon, tributary to Marcos? Canyon, 37.0903 -108.275 Eastwood 32 Mesa Verde CS USA Colorado Montezuma Spruce tree cliff tower, mesa verde np 37.176492 -108.496906 Bethel s.n. 32 CS USA Colorado Montezuma Mesa verde np 37.231969 -108.458601 Bethel s.n. 32 COLO USA Colorado Montrose BCGNP; upper part of SOB draw 38.558167 -107.677523 Lederer 04-33 32 RM USA Colorado Montrose Ca 19 air mi W. Of Naturita, at mouth of Spring data deficient Moore 6385 32 Canyon and surrounding areas northside of Dolores River COLO USA Colorado Otero Devil's Canyon, Hall Ranch; ca. 1 mi W. Of Hwy data deficient Hazlett 13217 32 350 KANU USA Colorado Pueblo 29 mi W. Of Walsenburg (Walsenburg in 37.632179 -105.556741 Stephens 22272 32 Huerfano Co.) COLO USA Colorado Pueblo Panther Creek drainage data deficient Christie 01-183 32 COLO USA Colorado Rio Blanco data deficient Robbins 7046 32 COLO USA Colorado Routt Ca 16.5 air mi S.E. of Yampa, ca. 4 air mi NNE of 39.986459 -106.768239 Nelson 17883 32 mccoy UTC USA Colorado San Miguel SW of Naturita along CO 141 38.119468 -108.503893 M.D. Windam 32 CS USA Colorado San Miguel Upper Dolores River Drainage; East Island 38.1389022 -108.9758963 Moore 4419 32 Mesa Spring; County Rd. Z1, ca. 24 air mi S.W. of Nucla; T45N R19W S21 COLO USA Colorado Weld Pawnee Natl. Grassland; 20 mi N. Of 40.9124701 -103.6205237 Lederer 4510 32 Stoneham; T11N R56W S22 WICH USA Colorado Weld Pawnee National Grassland; Dave's Draw, 2.1 40.8131 -104.03031 J. B. Beck 1445 32 road miles E. Of CR107 on unamed side road. RM USA Idaho Clark Targhee NF, southern Beaverhead Range, 44.2956929 -112.746194 Markow 11116 32 Crooked Creek Canyon; T11N R32E S7 US USA Idaho Lemhi Ca. 4 mi s. Of lemhi 45.036777 -113.919321 Hitchcock 9219 32 WICH USA Idaho Lemhi data deficient Rothfels 4431 32 WICH USA Illinois Calhoun 4.3 mi S. Of Harden on Rd. 1720E. 39.08507 -90.61519 Wickell 13 32 MO USA Illinois Calhoun Titus Landing, 2 mi N.W. of Batchtown 39.051 -90.677 Moran 1435 32 MO USA Illinois Calhoun 2 mi S. Of Hardin 39.127 -90.618 Hubricht B725 32 WICH USA Illinois Carroll Mississippi Palisades State Park; near High 42.15238 -90.1771 J. B. Beck 1328 32 Point Trail. US USA Illinois Jackson Grand tower 37.626 -89.498 Benedict s.n. 32 DUKE USA Illinois Jo Daviess 1 mi W. Of Portage 42.383 -90.472 Lansing 4110 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta WICH USA Illinois Joe Daviess Along Mississippi River, 0.6 km N.W. of jnct. 42.41084 -90.4988 J. B. Beck 1327 32 Red Gates Rd. With BNSF RR. NCU USA Illinois Monroe S of Fults, T4S, R10W data deficient Bailey 2827 32 MO USA Illinois Pike Blue Creek, 3 mi N. Of Florence 39.66 -90.629 Moran 1425 32 MO USA Illinois Union 3 mi N. Of Wolf Lake 37.547 -89.439 Tryon 4654 32 NCU USA Illinois Union 2.75 mi N.E.of mcclure data deficient Ozment 32 BRIT USA Iowa Alamakee Near Waterville, on dolomite, the Oneota data deficient W.H. Welch 9880 32 limestone KSC USA Iowa Allamakee SW of Harper's Ferry, bluffs 100 m S.W. of jnct. 43.155356 -91.181043 Freeman 1722 32 X42 and IA364 KANU USA Iowa Allamakee Ca. 0.2 mi s.w. of jct of allamakee x42/x52; s.w. 43.345873 -91.215301 Freeman 2365 32 of harper's ferry WICH USA Iowa Allamakee Ca. 0.3 km N.W. of jnct. Of Hwys X42/X52(364) 43.20242 -91.15838 J. B. Beck 1326 32 in Harper's Ferry. US USA Iowa Clayton Buck creek t93 r3 s28 42.8414707 -91.2010348 Hartley 8631 32 US USA Iowa Dubuque Near Dubuque 42.497669 -90.664723 Mertz s.n. 32 WICH USA Kansas Barber Along Aetna Rd., 2.7 mi S. Of Salt Fork 37.03151 -98.96744 Wickell 01 32 Arkansas River. KANU USA Kansas Barber 3.5 mi S. Of Aetna, Canyon in Gypsum Hills 37.04956 -99.037812 McGregor14506 32 KANU USA Kansas Barber NE 1/4 sec22 T34S R16W Swartz Canyon ca 4 37.083119 -99.065462 Freeman 4102 32 mi W. Of Aetna KANU USA Kansas Chautauqua T34s r10e e. Central part of sec36 37.04545 -96.237157 Lathrop 2330 32 KANU USA Kansas Chautauqua 4 mi N. 1 mi E. Of Elgin 37.048601 -96.264531 McGregor 12345 32 KANU USA Kansas Chautauqua T33S R10E NW1/4 of NE1/4 sec12 37.200151 -96.268994 Lathrop 2338 32 WICH USA Kansas Chautauqua NE of Elgin, rocky slope above Cedar Creek, W. 37.04608 -96.26504 J. B. Beck 1329 32 Of rd. 16, 2.7 mi N. Of jnct. With Bronco Rd. KANU USA Kansas Comanche 12.5 me S, 16 mi E. Jct US Hwys 160 and 183 in 37.10363 -99.0381 Morse 10795 32 Coldwater; 37.10363 N. 99.03810 W KANU USA Kansas Ford 6 mi N.W. Spearville 37.910549 -99.847539 McGregor 10928 32 WICH USA Kansas Hodgeman “Horse Thief Canyon” 2.4 mi. S. Of K-156, E. 38.0351 -100.04227 Wickell 02 Irregular Side of 210 Rd. KANU USA Kansas Hodgeman 10 s.e. jetmore 37.969914 -99.788831 McGregor 10935 32 US USA Kansas Hodgeman 10 mi W, 1.5 mi S. Jetmore 38.021252 -100.103143 McGregor 5179 32 KSC USA Kansas Lincoln data deficient Lauty? s.n. 32 WICH USA Kansas Ottowa "Rock City"; 2.6 mi S.W. of Minneapolis; at jnct 39.09098 -97.73589 J. B. Beck 1386 32 of Ivy and N. 105th roads. KSC USA Kansas Ottowa Rocks at "Rock City" 39.09085 -97.7354 Hitchcock s.n. 32 KANU USA Kansas Ottowa Rock City 3 mi S.W. Minneapolis 39.09085 -97.7354 Humfeld 417 32 KANU USA Kansas Ottowa 2 mi S, 1.5 mi W. Minneapolis 39.09085 -97.7354 Stephens 4868 32 WICH USA Kansas Russell Wilson Lake State Park (west end). Near south 38.98151 -98.72195 Wickell 04 32 end of 192 St. Bridge over Saline river. KANU USA Kansas Russell 3.5 mi N. 1 mi W. Dorrance 38.896511 -98.620332 Roth 65 32 KANU USA Kansas Russell Wilson lake wma 38.9812 n. 98.7227 w 38.9812 -98.7227 Morse 15444 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta KSC USA Kansas Russell 2 mi E. Of Lucas SW1/4 sec 36 T11S R11W 39.052818 -98.47171 Hulbert 4346 32 KANU USA Kansas Scott Ne1/4 se1/4 nw1/2 s2 t16 s. R 32 w 38.6926554 -100.8255341 Roth 170 32 WICH USA Kansas Stanton 2.4 mi N. Of US 160 on S. Road X. 37.51848 -101.99699 Wickell 18 32 KANU USA Kansas Stanton 2 mi N. 2.5 mi E. Saunders 37.522082 -102.009093 McGregor 16115 32 US USA Kentucky Bullitt Cedar barrens near Cedar Grove 37.972 -85.631 Reed 20020 32 WICH USA Kentucky Bullitt Ledges N. Of Cedar Creek, just S. Of Ridge Rd. 37.99373 -85.63099 J. B. Beck 1446 32 (KY 1442), ca. 2 road mi from jnct. With KY 480. MO USA Minnesota Houston Bluff above Jefferson School House, Jefferson 43.562334 -91.282505 Rosendahl 6699 32 Twnsp. WICH USA Minnesota Houston Bluff along Hwy 26 at jnct. With rd. 249. 43.58746 -91.2804 J. B. Beck 1324 32 DUKE USA Minnesota Winona Whitewater st. Pk. 44.054246 -92.054117 Schuster 38476 32 WICH USA Minnesota Winona Whitewater state park; "chimney rock." 44.05446 -92.042 J. B. Beck 1323 32 DUKE USA Minnesota Winona Whitewater st. Pk. 44.068316 -92.042194 Schuster A5026 32 BRIT USA Minnesota Winona Elba. Crevices in limestone cliffs data deficient G.B. Ownbey 5114 32 MO USA Missouri Barry Eagle rock 36.550845 -93.756585 Bush 803 32 KANU USA Missouri Barry 1 mi S. Of Jenkins 36.764415 -93.681324 Brooks 521 32 KANU USA Missouri Barry 1 mi S. Of Jenkins 36.764415 -93.681324 Stephens 20040 32 MO USA Missouri Barry Ca. 100 m n.e.of junct. Sr 39 and 248; t24n 36.773931 -93.666728 Yatskievych 88-57 32 r25w s19 sw1/4 se1/4 MO USA Missouri Callaway T46N R9W S1 2 mi N.E.of Ham's Prairie 38.799747 -91.878953 Steyermark 26222 32 KANU USA Missouri Camden Haliatowka? data deficient Harris s.n. 32 MO USA Missouri Carter Current River near Van Buren 36.993641 -91.020273 Palmer 19485 32 MO USA Missouri Cedar NE of Stockton 37.731489 -93.74201 Steyermark 13476 32 MO USA Missouri Dallas 2 mi S.W. of Windyville 37.688117 -92.950347 Steyermark 13741 32 MO USA Missouri Dent 3 mi N.E.of Edgar Springs 37.744742 -91.80852 Steyermark 25474 32 MO USA Missouri Franklin Union 38 26 00N 91 01 12W 38.433333 -91.02 Holmberg 130 32 WICH USA Missouri Franklin City of Union, clearview city park, cliff just N. 38.43257 -91.01966 J. B. Beck 1453 32 Of Bourbeuse River bridge on N. Bend Rd. WICH USA Missouri Hickory 0.2 mi N.E.of Hermitage, near Pomme de Terre 37.94325 -93.30644 Wickell 11 32 River, 0.2 mi S. Of US-54. MO USA Missouri Howell 8 mi S.W. of Willow Springs T026N R010W S08 36.9466611 -92.0647832 Summers 4530 32 SW4 MO USA Missouri Jefferson S of Hillsboro; 38 10 N. 90 42 W 38.166667 -90.7 Miller 4989 32 MO USA Missouri Jefferson Ca. 1 mi e. Of cedar hill along hwy. Bb 38.332298 -90.613757 Davidse 3457 32 WICH USA Missouri Jefferson Ca. 1 road mi E. Of Cedar Hill on hwy. BB. 38.34424 -90.62851 J. B. Beck 1452 32 MO USA Missouri Laclede 15 mi S.E. of Lebanon T033N R014W S16 37.573086 -92.486774 Summers 4605 32 WICH USA Missouri Lincoln Cuivre River State Park, off Cheatham Rd., 0.8 39.01631 -90.94393 Wickell 05 32 mi N. Of Frenchman's Bluff Rd. KANU USA Missouri McDonald 1 mi S.W. of Noel 36.523273 -94.511975 McGregor 3652 32 KANU USA Missouri McDonald 1 mi S.E. of Noel 36.531985 -94.469731 McGregor 3654 32 MO USA Missouri Miller Between Sudheimer and Iberia 38.112021 -92.251299 Steyermarck 13039 32 MO USA Missouri Moniteau T44N R14W S16,17 3.5 mi S. Of mcgirk 38.563024 -92.470573 Steyermarck 24816 32 MO USA Missouri Montgomery MO river between Bluffton and Rhineland 38.705305 -91.565515 Steyermark 15753 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta WICH USA Missouri Montgomery Above the Katy Trail just N. Of M-94, 0.6 mi. E. 38.70476 -91.61449 Wickell 06 32 Of Bluffton. WICH USA Missouri Montgomery Above the Katy Trail just N. Of M-94, 0.6 mi. E. 39.70476 -91.61449 Wickell 07 32 Of Bluffton. MO USA Missouri Morgan Lake of the Ozarks at Riverview 38.738687 -90.207499 Steyermark 20604 32 WICH USA Missouri Osage Painted Rock Conservation Area off M-133, E. 38.40958 -92.11478 Wickell 08 32 Side of the Missouri river. WICH USA Missouri Osage Painted Rock Conservation Area off M-133, E. 38.40958 -92.11478 Wickell 09 32 Side of the Missouri river. KSC USA Missouri Ozark N Fork of White River, near Tecumseh 36.593341 -92.279688 Palmer 32892 32 MO USA Missouri Ozark Cloud 9 Resort; ca. 2 mi W. Of Caulfied; 36 40 36.669722 -92.143611 Yatskievych 08-02 32 11 N. 92 08 37 W WICH USA Missouri Phelps Gasconade River, S.E. of Jerome, near Highway 37.9183 -91.97619 Wickell 10 32 D bridge, W. Side of Highway D, S. Side of the river. BRIT USA Missouri Phelps Southeast slope along Meramec River 1 mi. data deficient Spellman S-258 32 From Meramec Park (Meramec Spring Park) outside of St. James, MO on Hwy 8. From rock outcrop on steep slope. MO USA Missouri Pike Falicon, near Clarksville 39.350361 -90.944837 Davis s.n. 32 MO USA Missouri Pike Near Clarksville, Falicon Farm 39.350361 -90.944837 Davis s.n. 32 MO USA Missouri Pike Clarksville 39.350361 -90.944837 Davis s.n. 32 MO USA Missouri Polk 2 mi N.E.of Rondo T35N R23W S18 37.791337 -93.414027 Steyermark 24102 32 MO USA Missouri Ralls Hannibal 39.69639 -91.364285 Davis s.n. 32 MO USA Missouri Shannon Monteur? Monteer? 36.990128 -91.575232 Bush 5338 32 DUKE USA Missouri Shannon Alley Springs, W. Of Eminence 37.148328 -91.450842 Anderson 12463 32 WICH USA Missouri Shannon Along N. Side of CR 19-203, off M-19 ca. 1 mi 37.16942 -91.33294 Wickell 14 32 N.E.of Eminence. MO USA Missouri Shannon Falls of steep bluffs data deficient Bush 2003 32 MO USA Missouri St. Charles 3 km E. Of town on MO Rt. 94 N38 35 W90 51 38.581486 -90.842606 Busey 122 32 MO USA Missouri St. Francois 5 mi N. Of East Bonne Terre 38.021793 -90.540317 Steyermark 414 32 WICH USA Missouri St. Louis Emmenegger Park at the top of unpaved trail. 38.55071 -90.43544 Wickell 12 32 MO (2 dupes) USA Missouri St. Louis Rocks opposite St. Paul 38.898865 -90.627554 Eggert s.n. 32 MO USA Missouri St. Louis data deficient Eggert s.n. 32 KSC USA Missouri Stone Near Sentry (Gentry?) Cave, James River 36.796274 -93.465656 Prince 44 32 MO USA Missouri Taney Ozark Underground Laboratory; 4 mi N.E.of 36.563889 -92.809444 Holmberg 1516 32 Protem; 36 33 50 N. 92 48 34 MO, OKLA USA Missouri Taney Branson 36.693819 -93.276893 Bush 5370 32 MO USA Missouri Taney Swan 36.795179 -93.063021 Bush 4206 32 MO USA Missouri Texas Houston 37.336657 -91.961538 Emig 180 32 MO USA Missouri Warren 7 mi S. Of Warrenton 38.665877 -91.146919 Marvin 416 32 MO USA Missouri Washington Old mines, limestone cliffs data deficient Kellogg s.n. 32 MO USA Missouri Wayne T28N R5E S13 1 mi E. Of Greenville 37.125697 -90.474865 Steyermark 11277 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta MO USA Missouri Webster T32N R18W S33 2 mi S.W. of Forkner's Hill 37.4486613 -92.9179326 Steyermark 23838 32 RM USA Montana Carbon Ca 2 mi W. Of Red Lodge 45.186 -109.288 Evert 19045 32 UNR USA Montana Cascade Great falls data deficient C. L. Shear s.n 32 US USA Montana Gallatin Bozeman 45.68 -111.039 Blankenship 635 32 RM USA Montana Lewis & Clark Big Belt Mountains: Refrigerator Gulch: ca 0.5 46.8556921 -111.7354329 Lesica 3474 32 mi from Beaver Creek Road; T13N R1W S28 RM USA Montana Madison Ruby range: laurin canyon; t6s r5w s9 sw1/4 45.317452 -112.261918 Lackschewitz 10245 32 UNR USA Montana Madison Ruby range: laurin canyon. 45.350597 -112.191196 Klaus H. Lackschewitz, Irregular Roger Rosentheter 10245 UNR USA Montana Madison Gravelly Range: Devil's Lane, 1 mi S. Of data deficient C. Leo Hitchcock, C. V. Irregular Crockett Lake Muhlick 12499 US USA Montana Meagher Castle Mts, above and W. Of 4 Mile Ranger 45.342531 -110.234329 Hitchcock 15910 32 Station RM USA Montana Stillwater Ca 4 mi S. Of Nye 45.383743 -109.806683 Evert 24231 32 RM USA Montana Sweet Grass Ca. 23 mi ssw of big timber, just w. Of east 45.959504 -110.136076 Evert 15703 32 boulder river; t3n r13e s32 WICH USA Nebraska Keith Cedar Point Biological Station, Cedar Point Dr. 41.208982 -101.64645 Wickell 58a 32 Ca. 1mi. E. Of NE-61, along trail leading S.E. away from dormitories. WICH USA Nebraska Keith Cedar Point Biological Station, Cedar Point Dr. 41.208982 -101.64645 Wickell 58b 32 Ca. 1mi. E. Of NE-61, along trail leading S.E. away from dormitories. WICH USA Nebraska Red Willow Ca. 6 air miles s.w. of Mccook, 3.5 mi w. Of us- 40.13578 -100.68199 Wickell 03 Irregular 83. OKLA USA Nebraska Scotts Bluff 1.5 mi W, 5.5 mi S. Of Melbeta 41.701 -103.49 Brooks 364 32 KANU USA Nebraska Scotts Bluff 1.5 mi W. 5 mi S. Of Melbeta 41.707 -103.487 Stephens 5481 32 OKLA, DUKE USA Nevada Clark Charleston Mts, Kyle Canyon at bridge 36.265591 -115.590855 Clokey 5372 32 US USA Nevada Clark Southern rd. To clark canyon, slope of n.w. 36.32453 -115.788885 Beatley s.n. 32 spring mts. US USA Nevada Clark Lee canyon, charleston mts. 36.354398 -115.64008 Heller 11062 32 UNR USA Nevada Clark In Deadman Canyon, ca 1 or 2 km above the 36.564533 -115.281717 Arthur Cronquist 11930 32 mouth. West side of the Sheep Mts. Ca 50 km airline north (and a bit west) of Las Vegas. UNR USA Nevada Clark Bunkerville Ridge, north side of Virgin 36.665413 -114.15346 James W. Grimes 2000 32 Mountains. Approx. 6 miles south of the Virgin River on the first road into the hills after the Riverside Bridge. DUKE USA Nevada Clark Charleston mts., fletcher canyon data deficient Clokey 8242 32 WICH USA Nevada Clark Olcott Peak near mountain springs, Shady data deficient H.D. Ripley & R.C. Barnaby 32 limestone cliff, 5200 ft 2737 UNR USA Nevada Clark Canyon E. Of mountain Springs Charleston data deficient I. W. Clokey 8243 32 [Spring] Mtns US USA Nevada Clark Desert game range data deficient Allen 6 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta UNR USA Nevada Clark Charleston Mts. Canyon east of Mountain data deficient I. W. Clokey 8244 Irregular Springs. UNR USA Nevada Lincoln Near Elgin in Meadow Valley between the 37.356203 -114.539598 LM Shultz; JS Shultz; T.K. 32 Clover and Delamar Mtns Lowrey 1651 RM USA Nevada Lincoln Clover Mts., Pennsylvania Canyon, 2 rd. Miles 37.367838 -114.537798 Tiehm 11015 32 N.E.of Elgin on road to Ella Mts.; T7S R66E S6 UNR USA Nevada Lincoln Condor Canyon area of Meadow Valley Wash 37.830712 -114.370772 A Tiehm; M Williams 6589 32 N. Of Panaca US USA Nevada Nye Rd to Antelope Resevoir, 2.7 air mi W. Of 37.573971 -116.131182 Reveal 1835 32 Belted Peak? UNR Nevada Nye Grant Range, Grant Canyon on the west side of 38.43446 -115.521534 Arnold Tiehm 8286 32 the range, 2.6 road miles east of the Nyala road. US USA Nevada Nye Willow creek, quick canyon range 39.133689 -117.590879 Maguire 25294 32 UNR USA Nevada Nye Cherry creek summi data deficient B. Welsh 546 32 UNR USA Nevada White Pine One mile up Horse Canyon. data deficient B. F. Harrison 11640 32 UTC USA New Archuleta NW of Pagosa Springs in Piedra River Valley ca. 35.010231 -108.071166 M.D. Windam 3384 32 Mexico 0.54 km S.E. of the highest point on Ice Cave Ridge WICH USA New Bernalillo Cibola National Forest, 4.6 mi. S. Of Tijeras 35.03097 -106.36234 Wickell 27 32 Mexico along NM-337. Along trail S. Of the highway. WICH USA New Bernalillo Embudito Canyon, E. Of Albuquerque, ca. 0.8 35.13417 -106.47464 Wickell 40 32 Mexico mi. Up main trail. WICH USA New Cibola Cibola NF, Pole canyon, just N. Of FR 180. 32.21846 -107.9623 Wickell 38* 32 Mexico WICH USA New Cibola El Mal Pais Cons. Area, along N. Side of NM- 35.08249 -107.77635 Wickell 39 32 Mexico 117 on W. Side of I-40, 1 mi. S. Of Grants. WICH USA New Cibola Cibola NF, Pole canyon, just N. Of FR 180. 35.21845 -107.96207 Wickell 37* 32 Mexico US USA New Colfax Vicinity of Ute Park 36.54026 -105.108789 Standley 14596 32 Mexico NMC USA New DeBaca 9.25 rd km E. Of US Hwy 285 on rd A-5 34 02.80 -104 42.93 Spellenberg 12423 32 Mexico NMC USA New Dona Ana Little Mt. Near Las Cruces 32.121982 -106.792186 Wooton s.n. 32 Mexico US USA New Dona Ana Bishop's cap 32.1903 -106.6036 Wooton s.n. 32 Mexico US USA New Dona Ana Tortugas mt. 32.293699 -106.69757 Wooton s.n. 32 Mexico US USA New Dona Ana Tortugas mt. 32.293699 -106.69757 Wooton s.n. 32 Mexico NMC USA New Dona Ana Organ mts. 32.357053 -106.547912 Wooton s.n. 32 Mexico

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta NMC USA New Dona Ana Organ mts. 32.357053 -106.547912 Wooton s.n. 32 Mexico WICH USA New Dona Ana 32.365789 -106.57014 Alexander 1452 32 Mexico NMC USA New Eddy Upper dark canyon, guadalupe mts. Utm 13 32.1057706 -104.7281840 Alexander 120 32 Mexico 525645e 3552192n DUKE USA New Eddy Turkey Canyon, 2.5 air mi E. Of Queen, 32 32.18455 -104.7094 Worthington 35037 32 Mexico 11.073 N. 104 42.564 W OKLA USA New Eddy Sitting bull falls 32.24458 -104.697305 Stanford 1112 32 Mexico DUKE USA New Eddy 7.2 mi W. Of Three Forks 32.3371 104.9058 32.3371 -104.9058 Alexander 1129 32 Mexico US USA New Grant Burro mts. 32.613641 -108.431822 Rusby "G" 32 Mexico DUKE USA New Grant Gila nf; gallinas canyon; 32 53 33 107 50 11 32.8925 -107.8363889 Metzgar 126 32 Mexico WICH USA New Grant W side of the Black Range ca. 100 ft up a 33.0458 -108.0968 Alexander 1377 32 Mexico tributary of Rocky Canyon, 4.1 mi. ENE of the Lake Roberts Dam, 14.3 mi. W. Of mcknight Peak US USA New Grant Vicinity of falls, Mogollon Creek 33.1751667 -108.65265 Maguire 11996 32 Mexico WICH USA New Guadalupe Santa Rosa SP, along Canyon Overlook trail. 35.02691 -104.6841 Wickell 41 32 Mexico WICH USA New Harding Head of Mills Canyon. 36.07068 -104.35051 J. B. Beck 1353 32 Mexico WICH USA New Lincoln 33.599072 -105.44261 Alexander 1437 32 Mexico NMC USA New Lincoln 26 mi S.E. of Corona 33.9652778 -105.3075 Alexander 374 32 Mexico US USA New Lincoln Gilmore's ranch data deficient Wooton 3591 32 Mexico NMC USA New Luna Rattlesnake Canyon T21S, R8W, S.E. 1/4 of S.E. 32.502958 -107.706884 Columbus 1237 32 Mexico 1/4, sec 6 WICH USA New Luna NE Cooks Range, in a ravine 0.2 mi. S.W. of 32.5495 -107.7207 Alexander 1430 32 Mexico Riley Spring, 1.1 mi. N.E.of Cookes Peak WICH USA New McKinley Cibola NF, along NM 400,3.75 air mi. N.W. of 35.42199 -108.55022 Wickell 36 32 Mexico mcgaffee. NMC USA New McKinley Ca. 4 air mi s.w. pueblo alto trading post; t20n 35.92183 -107.631561 Reitzel 4175 32 Mexico r7w west 1/2 of sec 31 WICH USA New Otero West base of Guadalupe mountains east of 32.4786 -105.1369 Alexander 1331 32 Mexico Pinon Creek, 2.9 mi. S. Of Chaves County line, 1.7 mi ENE of Tanner Ranch

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta NMC USA New Otero 13 mi S. Of Alamagordo near mouth of Dog 32.7489529 -105.9116883 Alexander 41 32 Mexico Canyon UTM 13 41 45 92 E, 36 23 824 N NMC USA New Otero Dog canyon 32.75155 -105.909196 Castetter 8419 32 Mexico DUKE USA New Otero Lincoln nf; silver springs canyon; 32 59.912 105 32.9985333 -105.6612667 Worthington 35917 32 Mexico 39.676 WICH USA New Rio Arriba Cerrito de la Ventana, ca. 1.4 km N.E.of Abiquiv 36.22631 -106.3364 J. B. Beck 1395 32 Mexico School WICH USA New San Miguel Lincoln National Forest, just south of 12-60 32.62649 -105.67914 Wickell 25 32 Mexico Electrum cir. US USA New San Miguel 8 mi S.E. of Las Vegas 35.514343 -105.13921 Arsene 17382 32 Mexico US USA New San Miguel Old pecos ruins (pecos nat. Historical park?) 35.537242 -105.681563 Standley 4985 32 Mexico DUKE USA New San Miguel Pecos river nf; winson's ranch 35.550385 -105.667632 Standley 4145 32 Mexico WICH USA New Sandoval Cibola National Forest, W. Side of NM-165, 4.5 35.2785 -106.41038 Wickell 26 32 Mexico mi S. Of Placitas. US USA New Santa Fe Canyon one mi S.E. of Santa Fe 35.678634 -105.886243 Heller 3563 32 Mexico NMC USA New Sierra W face of Caballo Mts., 8.6 mi by winding rd. E. 32.853994 -107.220653 Spellenberg 3930 32 Mexico Of Caballo Dam on the Rio Grande DUKE USA New Sierra S percha creek; 32 54 57 107 36 18 32.9158333 -107.605 Metzgar 124 32 Mexico WICH USA New Sierra E side of the Black Range on the S. Side of 32.916 -106.6045 Alexander 1406 32 Mexico Percha Creek, S. Of NM-152, 2.0 mi. W. Of Hillsboro, 5.9 mi. E. Of Kingston. WICH USA New Sierra Northern San Andres Mountains in upper 33.3159 -106.5445 Alexander 1431 32 Mexico Thurgood Canyon, 1.4 miles NNW of Salinas Peak, 2.7 miles WSW of the peak of Silver Top Mountain WICH USA New Sierra S end of Fra Cristobal range on Armendaris 33.3216 -107.0081 Alexander 1309 32 Mexico Ranch, 0.2 mi N.E.of Massacre Gap, 1.7 mi. S. Of Red Gap DUKE USA New Sierra data deficient Metcalfe 951? 32 Mexico WICH USA New Socorro Cibola National Forest, Magdalena mtns., near 34.00944 -107.14233 Wickell 28 32 Mexico 6 mi marker on FR235 in “Water Canyon." NMC USA New Socorro 15 mi N. Of Winston 33.5694444 -107.5944444 Alexander 448 32 Mexico NMC USA New Socorro NW of the Mogollon Mts. 33.756315 -108.781529 Birr? s.n. 32 Mexico US USA New Socorro Socorro 34.048179 -106.944621 Vasey s.n. 32 Mexico

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta US USA New Socorro Spur Ranch near Rio San Francisco data deficient Hough 32 Mexico KANU USA New Torrence 8 mi S.E. Cedarvale 34.285304 -105.623639 Stephens 25996 32 Mexico US USA New Union 1 mi E. 7 mi N. Moses 36.772717 -103.08099 Brooks 491 32 Mexico WICH USA New Union Clayton Lake State Park, about 1000 ft west of 36.57255 -103.30538 Wickell 24 32 Mexico the parking lot just north of the park road. NMC USA New Valencia Just E. Of Laguna Indian Reservation boundary 34.711138 -107.543993 Spellenberg 4909 32 Mexico in Blue Water Canyon, ca. 13 air mi SSE of Acoma Pueblo; bounday of secs. 25-36, T6N, R7W NMC USA New Valencia Ca. 28 mi s. Of grants at southern tip of grants 34.755153 -107.982273 Spellenberg 5136 32 Mexico malpais DUKE USA North Durham Eno river 36.095 -78.813 Blomquist 1649 32 Carolina WICH USA Oklahoma Caddo 1.5 mi E. Of Cement on OK-277N. 34.92418 -98.11203 Wickell 15 32 WICH USA Oklahoma Cimarron 1.7 mi. E. Of kenton on e0075/ok-325. 36.9045 -102.93392 Wickell 23 32 OKLA USA Oklahoma Cimarron 1.8 mi W. Of Kenton 36.901175 -102.999941 Waterfall 17118 32 OKLA USA Oklahoma Cimarron Near Kenton 36.912157 -102.970415 Stevens 500 32 US USA Oklahoma Cimarron 3 mi N. Of Kenton 36.956476 -102.960827 Rogers 4749 32 KANU USA Oklahoma Cimarron 11 mi E. 5 mi N. Of Kenton 36.959631 -102.763907 Brooks 488 32 US USA Oklahoma Cimarron Hallock Ranch near New Regnier PO 36.995509 -102.857954 Greene s.n. 32 KANU USA Oklahoma Comanche 11 mi N. Of Medicine Park 34.846635 -98.539222 Stephens 20340 32 OKLA USA Oklahoma Murray Arbuckle Mts. Near Turner Falls 34.424948 -97.148164 Demaree 12565 32 US USA Oklahoma Murray Arbuckle mts. 34.441495 -97.081682 Nice s.n. 32 WICH USA Oklahoma Murray Turner Falls Park, slope above Honey Creek on 34.42807 -97.14711 J. B. Beck 1435 32 road to Turner Falls KANU USA Oklahoma Osage 6 mi E. Of Hominy 36.402909 -96.23305 Brooks 2635 32 OKLA USA Oklahoma Osage 2.8 mi N. Of Avant 36.528571 -96.060683 Stratton 1653 32 OKLA USA Oklahoma Rogers data deficient Greene s.n. 32 OKLA, US USA Oklahoma Woods Near Fairvalley 36.772374 -99.037377 Stevens 1662 32 WICH USA Oklahoma Woodward Selman Living Laboratory, 9.3 mi. S.W. of 36.733394 -99.2325 Wickell 16 32 Freedom off Rd. E21. WICH USA Oklahoma Woodward Alabaster Caverns State Park. Owl cave, W. Of 36.69858 -99.14497 Wickell 17 32 Park Rd. 10. KANU USA Oklahoma Woodward 1 mi S. Of Freedom along tunnel of natural 36.753619 -99.117518 Springer 32 bridge OKLA USA Oklahoma Woodward Salem cave data deficient Smith s.n. 32 KANU USA South Custer 12 mi S. Of Hermosa 43.664519 -103.287646 Stephens 6167 32 Dakota KANU USA South Custer Black Hills NF; FR 458, 0.7 N. Jct. W Hwy 16 44.354296 -103.930861 Morse 552 32 Dakota T43N R2E E1/2 sec4 and N1/2 sec3

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta KANU USA South Custer 6 mi N.E.of Dewey 45.253622 -100.876565 Stephens 16525 32 Dakota US USA South Custer "Flora of the Black Hills" data deficient Rydberg 1189 32 Dakota KANU USA South Fall River 9 mi S.W. Hot Springs 43.308941 -103.568165 Brooks 76 32 Dakota US USA South Fall River 7 mi S.W. of Hot Springs 43.360383 -103.546683 Stephens 5797 32 Dakota US USA South Fall River Near Minnekahta? 43.422318 -103.713868 Over 15896 32 Dakota KANU USA South Harding 6 mi N. 6 mi W. Ludlow 45.904703 -103.489004 Brooks 425 32 Dakota KANU USA South Lawrence 2 mi S, 8 mi W. Of Nahant; Crooks Tower 44.156043 -103.918321 Stephens 35917 32 Dakota KANU USA South Lawrence 2 mi S. Of Cheyenne Crossing 44.271048 -103.843681 Stephens 7475 32 Dakota KANU USA South Lawrence Little Spearfish Trailhead, just above Timon 44.328219 -103.990891 Brooks 15558 32 Dakota Campground; T4S R1E sec3 s0.5 RM USA South Lawrence Iron Creek Canyon, ca 0.5 mi S.W. of Spearfish 44.3728 -103.9231 Van Bruggen 46-1989 32 Dakota Creek Road. US USA South Lawrence Deadwood 44.377045 -103.720123 Ball 1689 32 Dakota DUKE USA South Lawrence Deadwood 44.377045 -103.720123 Salmon 13 32 Dakota KANU USA South Meade 3 mi S. Of Piedmont; Stagebarn Canyon 44.1233 -103.2153 Larson 6566 32 Dakota KANU USA South Pennington 6 mi E. Of Sheridan Lake 43.988121 -103.395265 Stephens 7134 32 Dakota US USA South Pennington 3.5 mi N.W. of Deerfield 44.051817 -103.879706 Stephens 7362 32 Dakota US USA South Pennington Rapid canyon 44.064893 -103.430983 Over 1678 32 Dakota BRIT USA South Pennington Roadside picnic area along rt. 40, 5 mi. W. Of 44.080503 -103.335649 R.G. Stolze 288 32 Dakota Rapid City. KSC USA South Pennington 1.5 mi S.W. of the Black Fox Campground, ca. 7 44.13459 -103.864234 Freeman 1627 32 Dakota mi N. Of Rochford, W1/2 sec 15 T2N R2E BRIT USA Texas Bandera Gunsight Mountain Ranch, 1.3 miles N.W. of 29.6446 -99.28903 C. M. Rowell 32 Tarpley, along Williams Creek. BRIT USA Texas Brewster On north slopes of Cathedral Mountain 30.00034 -103.63324 B. H. Warnock 32 eighteen miles south of Alpine. BRIT USA Texas Brewster About 28 miles east of Alpine. 30.37763 -103.22509 D. S. Correll 32 BRIT USA Texas Brewster North slope and summit of Old Blue Mt., Glass 30.40861 -103.30267 D. S. Correll 32 Mountains.

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta WICH USA Texas Collingsworth Low caprocked hills on N. Side of Hwy 9, ca. 1.7 35.05146 -100.31167 J. B. Beck 1400 32 mi W. Of Samnorwood. OKLA USA Texas Crosby White River at Silver Falls, 4 mi E. Of Crosbyton 33.661594 -101.151157 Blassingame 921 32 OKLA USA Texas Crosby Crosbyton, silver falls 33.665693 -101.159879 Studhalter 1169 32 US USA Texas Crosby Vicinity of Silver Falls, ca. 7 mi E. Of Crosbyton 33.667336 -101.093684 Correll 15145 32 WICH USA Texas Crosby Silver Falls rest area, Hwy 82 E. Of Crosbyton. 33.6653 -101.15964 J. B. Beck 1405 32 US USA Texas Culberson Mckittrick canyon 31.5845 -104.4517 Moore 3536 32 DUKE USA Texas Culberson S side of Guadalupe Mts. NP; 31.86234 31.86234 -104.83051 Rothfels 2496 32 104.83051 BRIT USA Texas Culberson Upper slopes of Pine Top Mountain; 31.91801 -104.847236 B. H. Warnock 32 Guadalupe Mountains. Alt. 8200 feet. BRIT USA Texas Culberson Victoria canyon, sierra diablo mountains. 31.97001 -104.78864 D. S. Correll 32 BRIT USA Texas Culberson South Fork of mckittrick Canyon, Guadalupe 31.98558 -104.769581 D. S. Correll 32 Mts. WICH USA Texas Culberson data deficient Rothfels 2496 32 BRIT USA Texas Deaf Smith South bridwell ranch. data deficient F. R. Waller 32 BRIT USA Texas Deaf Smith South bridwell ranch. data deficient F. R. Waller 32 BRIT USA Texas Edwards 2 miles south of Seven Hundred Springs. 30.24196 -99.926442 D. S. Correll 32 KSC USA Texas El Paso El paso 31.790278 -106.423333 G N. Vasey s.n. 32 US USA Texas El Paso El paso 31.790278 -106.423333 Vasey 561 32 BRIT USA Texas Hansford Paloduro Creek, about 10 miles north of data deficient D. S. Correll 32 Spearman. OKLA USA Texas Hockley 3 mi W. Of Anton 33.814846 -102.215899 Blassingame 948 32 DUKE USA Texas Howard Big spring state park; 32.2303 101.4961 32.2303 101.4961 Rothfels 2470 32 US USA Texas Howard Big spring 32.231086 -101.486674 Hitchcock s.n. 32 WICH USA Texas Howard Big Spring State Park, clifface W. Of SP road 8. 32.23023 -101.4962 J. B. Beck 1410 32 DUKE USA Texas Hudspeth Sierra blanca 31.172713 -105.357023 Fisher s.n. 32 BRIT USA Texas Hutchinson Lake Meredith National Recreation Area 35.72426 -101.554937 G. L. Nesom 32 (LAMR) area of large canyon west of Shooting Range, immediately W. Of Spring Canyon (proper), off larger canyon along steep, rocky drainage. US USA Texas Jeff Davis Little aguja canyon 30.5514 -103.4937 Moore 3095 32 US USA Texas Jeff Davis Near Ft. Davis 30.5964 -103.927084 Palmer 32185 32 WICH USA Texas Lubbock Buffalo Springs Lake, canyon rim on S. Side of 33.52854 -101.72334 J. B. Beck 1408 32 Lake. WICH USA Texas Ochiltree N of Wolf Creek County Park access road 36.23234 -100.65237 Wickell 42 32 (county road U), ca. 4 mi. From U.S. 83. OKLA USA Texas Ochiltree Wolf Creek 12 mi S.E. of Perryton on US 83 36.256732 -100.768153 Wallis 7896 32 BRIT USA Texas Ochiltree Wolf Creek 12 mi. S.E. of Perryton on U.S. 83 & 36.256732 -100.768153 C. S. Wallis 32 5 mi. E. Of hwy. BRIT USA Texas Ochiltree Wolf Creek valley at Route #83, along rim rock. 36.256732 -100.768153 D. S. Correll 32 BRIT USA Texas Pecos Glass Mts., about 26 mi. Northeast of 30.359 -103.5442 R. McVaugh 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta Marathon, near gap crossed by highway. US USA Texas Pecos NE side of Sierra Madre, ca. 25 mi S. Of Fort 30.501786 -102.937015 McVaugh 10676 32 Stockton OKLA USA Texas Pecos 12.5 mi W. Of Iraan on TX 29 30.894565 -102.167383 Blassingame 1214 32 BRIT USA Texas Potter Where highway #287 crosses John Rey Creek. data deficient D. S. Correll 32 WICH USA Texas Potter Jnct. Of Hwy 87 and John Ray Creek. 35.5514 -101.94 J. B. Beck 1381 32 BRIT USA Texas Presidio 4 miles south of Shafter; shallow draw in 29.78603 -104.30589 R. McVaugh 32 limestone hills. BRIT USA Texas Presidio Cibolo Creek near Cieniguita, 10 miles 29.93572 -104.46014 B. H. Warnock 32 northwest of Shafter. WICH USA Texas Randall Palo Duro Canyon SP; ca. 0.6 mi S.W. (up slope) 34.9245 -101.64142 J. B. Beck 1379 32 of turnaround at S. End of park road 5. US USA Texas Randall Palo duro canyon 34.931542 -101.643111 Ball 1707 32 WICH USA Texas Scurry Cliffs on W. Side of Hwy 1269 where it summits 32.95824 -101.14777 J. B. Beck 1409 32 the plateau. BRIT USA Texas Sterling Edwards Plateau outlier. S.W. 1/4 sec. 72, 30.99339 -101.00288 R. W. Pohl 32 S.P.R.R. Block 18 OKLA USA Texas Terrell 3 mi E. Of Sanderson on US 90 30.093121 -102.365676 Blassingame 1012 32 BRIT USA Texas Uvalde John garner state park. data deficient D. S. Correll 32 OKLA USA Texas Winkler Along Concho Bluff, 20 mi N.E.of Kermit 31.953327 -102.831738 Collins 1273 32 BRIT USA Texas Winkler Along Concho Bluff, 20 miles northeast of data deficient T. Collins 32 Kermit. UTC USA Utah Beaver Wah wah mine data deficient WP Cottam 9061 32 UTC USA Utah Cache Crevices of rock near mouth of Logan Cyn 41.73999 -111.787194 R Seiler 1272 32 UTC USA Utah Cache Above tony lake, logan? Cyn data deficient S Flowers 3104 32 UTC USA Utah Carbon Price cyn data deficient S Flowers 3105 32 UTC USA Utah Carbon Cliffs above Sunnyside data deficient S. Flowers 32 UTC USA Utah Daggett Flaming gorge data deficient S Flowers, Hall & Groves 32 221 RM USA Utah Duchesne 0.75 N.E.of Aspen campground, N. Fork 40.506034 -110.838674 Huber 3588 32 Duchesne Drainage; T1N R9W S7 SW1/4 of N.W. 1/4 WICH USA Utah Emery "Coal Cliffs" area, W. Of Co. Rd. 912, ca. 1.5 mi. 38.93321 -110.43046 Wickell 51 32 N. Of I-70.

UTC USA Utah Emery San raphael swell 38.821565 -110.676696 B Wellard 32

UTC USA Utah Emery San rafael swell 38.821565 -110.676696 WP Cottam 5609 32 UTC USA Utah Emery San rafael river 38.83533 -110.368927 S Flowers 3100 32 UTC USA Utah Emery San Rafael Swell in Buckhorn Wash. BLM 39.060366 -110.687783 PS Cheney 32 Bottleneck Peak Quad UTC USA Utah Emery On S. Side of road in Buckhorn Wash, 20.8 mi 39.08099 -110.660202 MD Rector 32 E. Of Hwy 10 just S. Of Buckhorn Wash Petroglyph Panel parking area UTC USA Utah Emery Buckhorn gulch 39.08113 -110.660242 S Flowers 3098 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta WICH USA Utah Emery Six miles southeast of Castle Dale, near 39.16253 -110.93485 R. McVaugh 14588 32 junction of Cottonwood Creek and Rock Canyon wash. UTC USA Utah Garfield Dry Lake, 10 mi S. Panguitch Lake 37.55253 -112.59567 WP Cottam 32 UTC USA Utah Garfield East Fault Mtns 5 mi N. Of Escalante 37.85061 -111.60606 Cottam 6496 32 UTC USA Utah Garfield Henry mtns, sawmill basin, mt. Ellen 38.1162 -110.771656 S Flowers 2304 32 UTC USA Utah Iron Cedar cyn 37.5907 -112.90185 Cottam 6715 32 UTC USA Utah Kane Buckskin Gulch W. Of the Cockscomb 37.01978 -112.03564 B Franklin & M Stolhand 32 7632 UTC USA Utah Kane By Ss. Cliffs [sic] Kanab Cyn 37.12981 -112.54237 S. Flowers 32 UTC USA Utah Mohave Saddle Horse Springs, Devil's Bath Tub, Cyn E. data deficient WP Cottam 12974 32 Of Toroweap Point UTC USA Utah Salt Lake City creek cyn 40.77807 -111.88483 S Flowers 3103 32 UTC USA Utah San Juan S. Side of kayne gulch ca. 2.57km ene of it's 37.51206 -109.941364 M.D. Windam 32 confluence with grand gulch. Blm kane gulch quad WICH USA Utah San Juan Natural Bridge National Park near base of 37.58241 -110.014646 J.&C. Taylor 29580 32 Owachoma Natural Bridge UTC USA Utah San Juan Abajo mtns.,devil canyon 37.5948 -109.25196 S Flowers 2363 32 UTC USA Utah San Juan Devil's cyn 37.5948 -109.25196 S Flowers 3263A 32 UTC USA Utah San Juan Devil's cyn 37.5948 -109.25196 S Flowers 3263 32 UTC USA Utah San Juan Natural Bridges NM, Trail to Kachina Bridge 37.60505 -110.02904 S Flowers 2393 32 UTC USA Utah San Juan Elk Ridge near Gooseberry Ranger Station 37.8167 -109.75859 S Flowers 2372 32 UTC USA Utah San Juan White Canyon near Carolina Bridges 37.85273 -110.40758 DEH &HM. D. Windham 32 UTC USA Utah San Juan Armstrong and White Cyns near the Natural 37.85273 -110.40758 PA Rydberg & AO Garret 32 Bridges 9414 RM USA Utah San Juan Cliff 0.5 mi S. Of Warner Ranger Station 38.510027 -109.276469 Maguire 4342 32 UTC USA Utah San Juan Recapture canyon data deficient S Flowers 3099 32 UTC USA Utah San Juan Near verdure data deficient S Flowers 3102a 32 WICH USA Utah Sevier Fishlake National Forest, 2nd canyon (ca. 1.5 38.577992 -112.39938 Wickell 49 32 mi.) Traveling E. On forest Rd. 007 (Collier Rd.), 7.4 mi. From I-70. UTC USA Utah Sevier Wasatch Plateau, 30 miles E. Of Salina, UT. 37.78515 -109.3483 B. Albee 4853 32 Side canyon entering North Fork of Quitchupah Creek from the north.; 0 CS USA Utah Uintah Ashley NF; Uintah Mts.; Brownie Canyon; T2S 38.618078 -109.789994 Goodrich 17715 32 R19E Sec 15 S.E. 1/4 18 mi N.W. of Vernal UTC USA Utah Uintah USM, Ashley NF, Uintah Mtns, Red Pine Cyn of data deficient S Goodrich 15706 32 White Rocks Cyn, 22 mi. N.W. from Vernal UTC USA Utah Washington Along a tributary of Bulldog Cyn. In the Beaver 37.060714 -113.762974 M.D. Windam 2039 32 Dam Mts ca 8.75 km S.W. of the summit of Jarvis Peak UTC USA Utah Washington Beaver dam mtns data deficient R Seiler 1242 32

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta UTC USA Utah Washington Beaver Dam Mtns, Cedar Pocket Wash, W. 37.039313 -113.80112 GI Baird 2545 32 Slope of wash, near bottom WICH USA Utah Wayne Dixie National Forest, on W. Side of forest Rd. 38.382143 -110.69116 Wickell 50 32 523 on the way to Coleman Reservoir. UTC USA Utah Wayne Fruita data deficient Cottam 4479 32 UTC USA Utah Zion NP data deficient HM Woodbury 32 US USA Virginia Pulaski Claytor lake state park 37.054 -80.63 Wieboldt 3976 32 WICH USA Virginia Pulaski Claytor Lake SP; rock outcrop extending into 37.05756 -80.63499 J. B. Beck 1449 32 Claytor Lake, ca. 0.1 mi S.W. of end of Bear Drive. WICH USA Wisconsin Crawford Bluffs along S. Side of Hwy 27, 1 km E. Of jnct. 43.05202 -91.12906 J. B. Beck 1319 32 With Hwy 35 in Prairie Du Chein. OKLA, DUKE, USA Wisconsin Dane 2 mi E. Of Cross Plains 43.111855 -89.594928 Tryon 4349 32 US WICH USA Wisconsin Grant Mississippi River bluffs ca. 0.1 km E. Of 42.68267 -90.84962 J. B. Beck 1316* 32 Mccartney. KSC USA Wisconsin Grant Boscobel 43.135065 -90.703322 Hasle? s n. 32 WICH USA Wisconsin Grant Mississippi River bluffs ca. 0.1 km E. Of 42.68267 -90.84962 J. B. Beck 1317* 32 Mccartney. WICH USA Wisconsin Iowa Cliffs ca. 0.5 km W. Of Cook Rock Rd. 43.14938 -89.99585 J. B. Beck 1312 32 WICH USA Wisconsin Pierce Bluffs along E. Side of Hwy 35, 0.8 road miles 44.63644 -92.59144 J. B. Beck 1321 32 N. Of jnct. With Co. Hwy O. WICH USA Wisconsin Richland "Cedar Point," ca. 0.5 (air) km N.E.of jnct. Of 43.22343 -90.63665 J. B. Beck 1313 32 Hwy W. And Winding Way Drive. WICH USA Wisconsin Sauk Loddes Mill Bluff on N. Side of Hwy 60 at jnct. 43.26054 -89.80601 J. B. Beck 1311 32 With Baum Rd. US USA Wisconsin Vernon Wheatland township; t11 r7 s3 43.4588296 -91.1977106 Hartley 2028 32 WICH USA Wisconsin Vernon Wildcat Mt. State Park, lookout on Hemlock 43.6833 -90.58415 J. B. Beck 1306 32 Trail RM USA Wyoming Albany Laramie mountains: telephone canyon; t15n 41.274049 -105.512548 Porter 458 32 r72w s22 RM USA Wyoming Albany T17N R72W S34, 35 Roger Canyon, ca. 6 air mi 41.417371 -105.611082 Struttmann 31 32 N. Of Laramie city limits RM USA Wyoming Big Horn NE side of sheep mountain, ca. 11 air mi N. Of 44.80425 -107.998552 Evert 10785 32 Greybull RM USA Wyoming Big Horn Ca 16 air mi N.E.of Lovell 44.980342 -108.413286 Nelson 5438 32 RM USA Wyoming Crook Ca. 16 a mi ese of sundance 44.304933 -104.126726 Nelson 9311 32 KANU USA Wyoming Crook 2.5 mi W. 3 mi N. Sundance 44.445056 -104.398711 Stephens 39727 32 RM USA Wyoming Crook Devils tower nm 44.585699 -104.714139 Marriott 714 32 RM USA Wyoming Fremont Wind River Canyon, near upper campground, 43.2441 -108.1012 Hammel 519 32 old dam site. UNR USA Wyoming Fremont Wind River Canyon, near upper campground, data deficient Barry Hammel 519 32 old dam site

APPENDIX 1 (continued)

Herbarium Country State County Locality Latitude Longitude Collector Spore Counta RM USA Wyoming Goshen Ca. 10 mi n.e.of guernsey 42.392023 -104.692204 Nelson 28102 32 RM USA Wyoming Hot Springs Ca. 30 air mi n. Of thermopolis 44.153144 -108.305383 Marriott 11361 32 RM USA Wyoming Johnson North Fork Crazy Woman Creek, ca 13 air mi 44.157517 -106.934377 Hartman 9657 32 S.W. of Buffalo RM USA Wyoming Johnson Ca 13 air mi S.W. of Buffalo 44.157517 -106.934377 Nelson 6825 32 WICH USA Wyoming Laramie Hynd's camp E. Of Hynd's Lodge Rd. Off of WY- 41.743043 -104.42833 Wickell 57 32 210 (Happy Jack Rd). WICH USA Wyoming Laramie Hynd's camp E. Of Hynd's Lodge Rd. Off of WY- 41.503136 -104.34081 Wickell 56 32 210 (Happy Jack Rd). RM USA Wyoming Laramie 1 mi N.W. of Granite Springs Reservoir 41.194221 -105.257484 Dorn 1469 32 RM USA Wyoming Lincoln Ca 5.7 air mi W. Of La Barge 42.264098 -110.311074 Nelson 26306 32 WICH USA Wyoming Natrona Alcova Reservoir, at the end of Lakeshore Dr. 42.746832 -106.5142 Wickell 52 32 US USA Wyoming Natrona Platte canyon 42.2832 -106.4706 Goodding 127 32 RM USA Wyoming Natrona Garfield Peak and N.E.slope 42.782378 -107.263602 Hartman 13017 32 US USA Wyoming Niobrara Ca. 8.3 air mi s. Of manville, ca. 10.7 air mi s.w. 42.671834 -104.610983 Nelson 25251 32 of lusk RM USA Wyoming Park Ca 22 mi W. Of Cody, on the Chinese Wall. 44.580197 -109.612756 Evert 6898 32 WICH USA Wyoming Park On limestone cliffs, S.W. side of Rattlesnake 44.582222 -109.31673 E.F. Evert 32 Mtn., above Red Spring, ca. 15 mi. W. Of Cody, elev. 6200 ft., T53N, R103W, NW1/4, S33 RM USA Wyoming Platte Head of Webb Canyon 42.371291 -104.727351 Nelson 25367 32 RM USA Wyoming Platte Ca. 0.3 mi e. Of broom creek on patten creek 42.4758 -104.730183 Nelson 27441 32 or county rd. 208, ca. 12.8 air mi n. Of Guernsey, 13.5 air mi ese of Glendo RM USA Wyoming Sheridan Ca 15.5 air mi W. of Sheridan 44.801327 -107.340914 Nelson 3244 32 RM USA Wyoming Sheridan Ca. 16 air mi w. of parkman 44.928714 -107.702433 Hartman 9530 32 RM USA Wyoming Sublette Ca 15 air mi S.W. of Big Piney 42.395573 -110.292485 Hartman 43648 32 RM USA Wyoming Sublette Adjacent to upper Green River Lake, ca. 28 air 43.279455 -109.825566 Fertig 2711 32 mi N. Of Pinedale, T38N R108W S9 RM USA Wyoming Sweetwater North facing slope of Dry Canyon, ca 2 air mi 41.256646 -109.065253 Ward 3299 32 W. of Pio Reservoir; ca 6 air mi NNE of Potter Mountain; ca 27.5 air mi SSE of Rock Springs. RM USA Wyoming Washakie Confluence of Leigh and Tensleep creeks. 44.077967 -107.313515 Lichvar 1942 32 US USA Wyoming Washakie 9 mi E. Of Tensleep 44.099791 -107.287527 Stolze 539 32 RM USA Wyoming Weston Clifton Canyon above Lost Canyon 43.631478 -104.116071 Marriott 8806 32 KANU USA Wyoming Weston US Hwy 16 W. Of Redbird Draw, ca. 8 air miles 43.758697 -104.081826 Marriott 1619 32 S.E. of Newcastle

Appendix 1. Specimens from which spore count data was obtained. aThe number of spores per sporangium. "Irregular" denotes specimens in which >32 abortive spores were observed.

APPENDIX 2

Sample Collector Herbarium Country State County Locality Longitude Latitude ID JB1859P Goodrich 17715 CS USA Utah Uintah Ashley NF; Uintah Mts.; Brownie Canyon; T2S R19E Sec 15 SE 38.61808 -109.79 1/4 18 mi NW of Vernal JB1862P Worthington DUKE USA New Mexico Eddy Turkey Canyon, 2.5 air mi E of Queen, 32 11.073 N 104 42.564 32.18455 -104.7094 35037 W JB1863P Alexander 1129 DUKE USA New Mexico Eddy 7.2 mi W of Three Forks 32.3371 104.9058 32.3371 -104.9058 JB1868P Morse 10795 KANU USA Kansas Comanche 12.5 me S, 16 mi E jct US Hwys 160 and 183 in Coldwater; 37.10363 -99.0381 37.10363 N 99.03810 W JB1870P Morse 552 KANU USA South Custer Black Hills NF; FR 458, 0.7 N jct. w Hwy 16 T43N R2E E1/2 sec4 44.3543 -103.9309 Dakota and N1/2 sec3 JB1879P Alexander 374 NMC USA New Mexico Lincoln 26 mi SE of Corona 33.96528 -105.3075 JB1890P Calder 17813 RM Canada British Columbia Canoe Creek Indian Reserve, ca. 32 mi NW of Clinton 51.433 -122.1 JB1894P Markow 11116 RM USA Idaho Clark Targhee NF, southern Beaverhead Range, Crooked Creek 44.29569 -112.7462 Canyon; T11N R32E S7 JB1895P Evert 19045 RM USA Montana Carbon ca 2 mi W of Red Lodge 45.186 -109.288

JB1896P Lesica 3474 RM USA Montana Lewis & Clark Big Belt Mountains: Refrigerator Gulch: ca 0.5 mi from Beaver 46.85569 -111.7354 Creek Road; T13N R1W S28 JB1900P Tiehm 11015 RM USA Nevada Lincoln Clover Mts., Pennsylvania Canyon, 2 rd. miles NE of Elgin on 37.36784 -114.5378 road to Ella Mts.; T7S R66E S6 JB1901P Huber 3588 RM USA Utah Duchesne 0.75 NE of Aspen campground, N fork Duchesne Drainage; T1N 40.50603 -110.8387 R9W S7 SW1/4 of NW 1/4 JB1908P Nelson 28102 RM USA Wyoming Goshen ca. 10 mi NE of Guernsey 42.39202 -104.6922

JB1918P Fertig 2711 RM USA Wyoming Sublette adjacent to upper Green River Lake, ca. 28 air mi N of Pinedale, 43.27946 -109.8256 T38N R108W S9 JB1940P Ackerfield 1084 CS USA Colorado Larimer Owl Canyon, ca. 2 mi from the beginning of the trail on N 40.79917 -105.1831 slope; 40 47 57 N 105 10 59 W JB1456P J. B. Beck 1456 WICH USA Missouri McDonald Town of Noel, cliffs above W side of Hwy 59, just N of Elk River 36.54832 -94.4946 Bridge. CJR2496P,G* Rothfels2496 WICH USA Texas Culberson South side of Hwy 62, ~2mi before boundary of Guadalupe 31.88184 -104.818 Mountains National Park. CJR4431P,G Rothfels4431 WICH USA Idaho Lemhi ca. 4 mi S of Lemhi 44.97583 -113.979

CRB30626P,G CRB30626 WICH Canada British Thompson-Nicola 50.81885 -120.293 Columbia DW01P,G* Wickell 01 WICH USA Kansas Barber Along Aetna Rd., 2.7 mi S of Salt Fork Arkansas River. 37.03151 -98.9674 DW02P,G* Wickell 02 WICH USA Kansas Hodgeman “Horse Thief Canyon” 2.4 mi. S. of K-156, E. side of 210 Rd. 38.0351 -100.042 DW03P,G* Wickell 03 WICH USA Nebraska Red Willow ca. 6 air miles SW of McCook, 3.5 mi W of US-83 40.13578 -100.682 DW04P,G* Wickell 04 WICH USA Kansas Russell Wilson Lake State Park (west end). Near south end of 192 St. 38.98151 -98.722 bridge over Saline river. 65

APPENDIX 2 (continued)

Sample Collector Herbarium Country State County Locality Longitude Latitude ID DW05P,G* Wickell 05 WICH USA Missouri Lincoln Cuivre River State Park, off Cheatham Rd., 0.8 mi N of 39.01631 -90.9439 Frenchman's Bluff Rd. DW06P,G Wickell 06 WICH USA Missouri Montgomery Above the Katy Trail just N of M-94, 0.6 mi. E of Bluffton. 38.70476 -91.6145 DW07P,G Wickell 07 WICH USA Missouri Montgomery Above the Katy Trail just N of M-94, 0.6 mi. E of Bluffton. 39.70476 -91.6145 DW08P,G Wickell 08 WICH USA Missouri Osage Painted Rock Conservation Area off M-133, E. side of the 38.40958 -92.1148 Missouri river. DW09P,G Wickell 09 WICH USA Missouri Osage Painted Rock Conservation Area off M-133, E. side of the 38.40958 -92.1148 Missouri river. DW10P,G Wickell 10 WICH USA Missouri Phelps Gasconade River, SE of Jerome, near Highway D bridge, W side 37.9183 -91.9762 of Highway D, S side of the river. DW11P,G Wickell 11 WICH USA Missouri Hickory 0.2 mi NE of Hermitage, near Pomme de Terre River, 0.2 mi S 37.94325 -93.3064 of US-54 DW12P,G Wickell 12 WICH USA Missouri St. Louis Emmenegger Park at the top of unpaved trail. 38.55071 -90.4354 DW13P,G Wickell 13 WICH USA Illinois Calhoun 4.3 mi S of Harden on rd 1720E 39.08507 -90.6152 DW14P,G* Wickell 14 WICH USA Missouri Shannon Along N side of CR 19-203 off M-19 ~1 mi NE of Eminence 37.16942 -91.3329 DW15P,G Wickell 15 WICH USA Oklahoma Caddo 1.5 mi E of Cement on OK-277N 34.92418 -98.112 DW16P,G Wickell 16 WICH USA Oklahoma Woodward Selman Living Laboratory, 16 km SW of Freedom off Rd. E21 36.73339 -99.2325 DW17P Wickell 17 WICH USA Oklahoma Woodward Alabaster Caverns State Park. Owl cave, W of Park Rd. 10 36.69858 -99.145 DW18P,G* Wickell 18 WICH USA Kansas Stanton 2.4 mi N of US 160 on S road X. 37.51848 -101.997 DW19P Wickell 19 WICH USA Colorado Baca Sand Creek Canyon just east of county Rd. 13 about 22 mi S of 37.02551 -102.837 Pritchett DW20P Wickell 20 WICH USA Colorado Baca Sand Creek Canyon west of county Rd. 13 about 22 mi S of 37.02793 -102.84 Pritchett DW23P,G Wickell 23 WICH USA Oklahoma Cimarron 1.7 mi. E of Kenton on E0075/OK-325 36.9045 -102.934 DW24P,G* Wickell 24 WICH USA New Mexico Union Clayton Lake State Park, about 1000 ft west of the parking lot 36.57255 -103.305 just north of the park road. DW25P,G* Wickell 25 WICH USA New Mexico San Miguel Lincoln National Forest, just south of 12-60 Electrum cir. 32.62649 -105.679 DW26P,G* Wickell 26 WICH USA New Mexico Sandoval Cibola National Forest, W side of NM-165, 4.5 mi S of Placitas. 35.2785 -106.41 DW27P,G* Wickell 27 WICH USA New Mexico Bernalillo Cibola National Forest, 4.6 mi. S of Tijeras along NM-337. Along 35.03097 -106.362 trail S of the highway. DW28P,G* Wickell 28 WICH USA New Mexico Socorro Cibola National Forest, Magdalena mtns., near 6 mi marker on 34.00944 -107.142 FR235 in “Water Canyon” DW30P,G* Wickell 30 WICH USA Arizona Cochise Along FR42 just S of Paradise, Coronado NF 31.91875 -109.23

DW31P,G* Wickell 31 WICH USA Arizona Cochise Coronado National Forest, Copper Canyon 31.36385 -110.298

APPENDIX 2 (continued)

Sample Collector Herbarium Country State County Locality Longitude Latitude ID DW32P,G* Wickell 32 WICH USA Arizona Santa Cruz Near Onyx Cave 31.71649 -110.769 DW34P,G* Wickell 34 WICH USA Arizona Coconino Oak Creek Canyon, just east of the bridge on highway 89A, 34.88409 -111.738 south of the highway. DW35P,G* Wickell 35 WICH USA Arizona Coconino Coconino NF, N of Flagstaff 35.2311 -111.589

DW36P Wickell 36 WICH USA New Mexico McKinley Cibola NF, along NM 400,3.75 air mi. NW of McGaffee 35.42199 -108.55 DW37P,G* Wickell 37P WICH USA New Mexico Cibola Cibola NF, Pole canyon, just N of FR 180 35.21845 -107.962 DW38P,G* Wickell 38P WICH USA New Mexico Cibola Cibola NF, Pole canyon, just N of FR 180 32.21846 -107.962 DW39P,G* Wickell 39 WICH USA New Mexico Cibola El Mal Pais CA 35.08249 -107.776 DW40P,G* Wickell 40 WICH USA New Mexico Bernalillo Embudito Canyon, E of Albuquerque, ca. 0.8 mi. up main trail. 35.13417 -106.475 DW41P,G* Wickell 41 WICH USA New Mexico Guadalupe Santa Rosa SP, Canyon Overlook trail. 35.02691 -104.684 DW42P,G Wickell 42 WICH USA Texas Ochiltree N of Wolf Creek County Park access road (county road U), ca. 4 36.23234 -100.652 mi. from U.S. 83. DW43P,G* Wickell 43 WICH USA Colorado Baca Sand Creek Canyon, 3.2 mi. S of Co. Rd. J, just west of Sand 37.00039 -102.496 Creek Canyon Rd. (Co. Rd 13). DW44P,G* Wickell 44 WICH USA Colorado Fremont Sand Gulch, ca. 0.75 mi. due N of Sand Gulch Campground, 38.40124 -105.296 near the end of unnamed dirt Rd. 1.1 mi. W off of Co. Rd. 9. DW45P,G* Wickell 45 WICH USA Colorado Chaffee San Isabel NF, "Limestone Ridge", high above the road, access 38.66578 -106.041 from Co. Rd.305 NW of Hwy. 24,ca. 0.5 mi. N of Highway/ENE of Co. Rd.305. DW46P,G* Wickell 46 WICH USA Colorado Eagle Rifle Mountain Park, along "Koper's Trail", NNE of parking area 39.7219 -106.652 on Co. Rd. 217, 3.2 mi. N of Rifle Mtn. Hatchery/end of CO-325. DW47P Wickell 47 WICH USA Colorado Eagle Rifle Mountain Park, along E side of Co. Rd. 217 adjacent to 39.61063 -107.089 climbing area 2.7 mi. N of Rifle Mtn. Hatchery/end of CO-325. DW48P,G* Wickell 48 WICH USA Colorado Mesa Uniweap Canyon, Nancy Hanks Gulch just W of CO-141. 39.33297 -108.666 DW49G Wickell 49 WICH USA Utah Sevier Fishlake National Forest, 2nd canyon (ca. 1.5 mi.) traveling E on forest Rd. 007 -112.399 (Collier Rd.), 7.4 mi. from I-70. DW50P,G* Wickell 50 WICH USA Utah Wayne Dixie National Forest, on W side of forest Rd. 523 on the way 38.38214 -110.691 to Coleman Reservoir. DW51P,G* Wickell 51 WICH USA Utah Emery "Coal Cliffs" area, W of Co. Rd. 912, ca. 1.5 mi. N of I-70. 38.93321 -110.43 DW52P,G Wickell 52 WICH USA Wyoming Natrona Alcova Reservoir, at the end of Lakeshore Dr. 42.74683 -106.514 DW53P,G* Wickell 53 WICH USA Wyoming Goshen W of Hell Gap archeology site N. of CR 202/ Whalen Cyn Rd. 41.21827 -106.095 DW56P,G* Wickell 56 WICH USA Wyoming Laramie Hynd's camp E of Hynd's Lodge Rd. off of WY-210 (Happy Jack 41.50314 -104.341 Rd). DW57P,G* Wickell 57 WICH USA Wyoming Laramie Hynd's camp E of Hynd's Lodge Rd. off of WY-210 (Happy Jack 41.74304 -104.428 Rd).

APPENDIX 2 (continued)

Sample Collector Herbarium Country State County Locality Longitude Latitude ID DW58aP Wickell 58a WICH USA Nebraska Keith Cedar Point Biological Station, Cedar Point Dr. ca. 1mi. E of NE- 41.20898 -101.646 61, along trail leading SE away from dormitories. JB 1306P,G J. B. Beck 1306 WICH USA Wisconsin Vernon Wildcat Mt. State Park, lookout on Hemlock Trail 43.6833 -90.5842 JB1311P,G* J. B. Beck 1311 WICH USA Wisconsin Sauk Loddes Mill Bluff on N side of Hwy 60 at jnct. With Baum Rd. 43.26054 -89.806 JB1312P,G* J. B. Beck 1312 WICH USA Wisconsin Iowa Cliffs ca. 0.5 km W of Cook Rock Rd. 43.14938 -89.9959 JB1313P,G* J. B. Beck 1313 WICH USA Wisconsin Richland "Cedar Point," ca. 0.5 (air) km NE of jnct. of Hwy W and 43.22343 -90.6367 Winding Way Drive. JB 1316P,G* J. B. Beck 1316P WICH USA Wisconsin Grant Mississippi River bluffs ca. 0.1 km E of McCartney. 44.63644 -90.8496 JB 1317P,G* J. B. Beck 1317P WICH USA Wisconsin Grant Mississippi River bluffs ca. 0.1 km E of McCartney. 44.05446 -90.8496 JB 1319P,G* J. B. Beck 1319 WICH USA Wisconsin Crawford Bluffs along S side of Hwy 27, 1 km E of jnct. With Hwy 35 in 43.58746 -91.1291 Prairie Du Chein. JB 1321P,G* J. B. Beck 1321 WICH USA Wisconsin Pierce Bluffs along E side of Hwy 35, 0.8 road miles N of jnct. With Co. 43.20242 -92.5914 Hwy O. JB 1323P,G* J. B. Beck 1323 WICH USA Minnesota Winona Whitewater State Park; "Chimney Rock." 42.41084 -92.042 JB 1324P,G J. B. Beck 1324 WICH USA Minnesota Houston Bluff along Hwy 26 at jnct. With rd. 249. 42.15238 -91.2804 JB 1326P,G J. B. Beck 1326 WICH USA Iowa Allamakee Ca. 0.3 km NW of jnct. of Hwys X42/X52(364) in Harper's Ferry. 37.04608 -91.1584 JB 1327P,G* J. B. Beck 1327 WICH USA Illinois Joe Daviess Along Mississippi River, 0.6 km NW of jnct. Red Gates Rd. with 36.42072 -90.4988 BNSF RR. JB 1328P,G* J. B. Beck 1328 WICH USA Illinois Carroll Mississippi Palisades State Park; near High Point Trail. 35.89976 -90.1771 JB 1329P,G* J. B. Beck 1329 WICH USA Kansas Chautauqua NE of Elgin, rocky slope above Cedar Creek, W of rd. 16, 2.7 mi 36.07068 -96.265 N of jnct. With Bronco Rd. JB 1339P,G* J. B. Beck 1339 WICH USA Arkansas Boone E side of Long Creek, just W of Tower Rd. 34.31948 -93.293

JB 1344P,G* J. B. Beck 1344 WICH USA Arkansas Izard E of River Rd., 3.9 km SE of Guion. 34.50305 -91.9129 JB 1353P,G* J. B. Beck 1353 WICH USA New Mexico Harding Head of Mills Canyon. 35.18726 -104.351 JB 1371P,G* J. B. Beck 1371 WICH USA Arizona Gila Tonto Natural Bridge SP. 34.9245 -111.458

JB 1372P J. B. Beck 1372 WICH USA Arizona Coconino E side of Hwy 87, 6.7 mi N of jnct. With Hwy 260. 35.5514 -111.363 JB 1374P,G* J. B. Beck 1374 WICH USA Arizona Coconino Flagstaff; trail along Rio de Flag. 39.09098 -111.643 JB 1379P,G* J. B. Beck 1379 WICH USA Texas Randall Palo Duro Canyon SP; ca. 0.6 mi SW (up slope) of turnaround at 36.22631 -101.641 S end of park road 5. JB 1381P,G* J. B. Beck 1381 WICH USA Texas Potter Jnct. of Hwy 87 and John Ray Creek. 35.05146 -101.94 JB 1386P,G* J. B. Beck 1386 WICH USA Kansas Ottowa "Rock City"; 2.6 mi SW of Minneapolis; at jnct of Ivy and N 33.6653 -97.7359 105th roads.

APPENDIX 2 (continued)

Sample Collector Herbarium Country State County Locality Longitude Latitude ID JB 1395P,G* J. B. Beck 1395 WICH USA New Mexico Rio Arriba Cerrito de la Ventana, ca. 1.4 km NE of Abiquiv School 33.52854 -106.336 JB 1400P,G* J. B. Beck 1400 WICH USA Texas Collingsworth Low caprocked hills on N side of Hwy 9, ca. 1.7 mi W of 32.95824 -100.312 Samnorwood. JB 1405P,G* J. B. Beck 1405 WICH USA Texas Crosby Silver Falls rest area, Hwy 82 E of Crosbyton. 32.23023 -101.16 JB 1408P J. B. Beck 1408 WICH USA Texas Lubbock Buffalo Springs Lake, canyon rim on S side of Lake. 34.42807 -101.723 JB 1409P,G* J. B. Beck 1409 WICH USA Texas Scurry Cliffs on W side of Hwy 1269 where it summits the plateau. 40.20292 -101.148 JB 1410P,G* J. B. Beck 1410 WICH USA Texas Howard Big Spring State Park, clifface W of SP road 8. 40.50657 -101.496 JB 1435P,G* J. B. Beck 1435 WICH USA Oklahoma Murray Turner Falls Park, slope above Honey Creek on road to Turner 40.8131 -97.1471 Falls JB 1442P,G* J. B. Beck 1442 WICH USA Colorado Boulder Heil Valley Open Space, ca. 200 yds up slope from Picture Rock 37.99373 -105.268 Trail JB 1443P,G* J. B. Beck 1443 WICH USA Colorado Larimer N side of Buckhorn Rd., 2.5 road miles NW of Masonville. 37.05756 -105.239 JB 1445P,G* J. B. Beck 1445 WICH USA Colorado Weld Pawnee National Grassland; Dave's Draw, 2.1 road miles E of 38.34424 -104.03 CR107 on unamed side road. JB 1446P,G J. B. Beck 1446 WICH USA Kentucky Bullitt Ledges N of Cedar Creek, just S of Ridge Rd. (KY 1442), ca. 2 38.43257 -85.631 road mi from jnct. with KY 480. JB 1449P,G* J. B. Beck 1449 WICH USA Virginia Pulaski Claytor Lake SP; rock outcrop extending into Claytor Lake, ca. 37.05756 -80.635 0.1 mi SW of end of Bear Drive. JB 1452P,G* J. B. Beck 1452 WICH USA Missouri Jefferson Ca. 1 road mi E of Cedar Hill on hwy. BB. 33.3216 -90.6285 JB 1453P,G* J. B. Beck 1453 WICH USA Missouri Franklin City of Union, Clear View city park, cliff just N of Bourbeuse 32.4786 -91.0197 River bridge on N Bend Rd. MW4262P,G* M. D. Windham WICH USA Nevada 4262 PJA 1309P Alexander 1309 WICH USA New Mexico Sierra S end of Fra Cristobal range on Armendaris Ranch, 0.2 mi NE of 32.916 -107.008 Massacre Gap, 1.7 mi. S of Red Gap PJA 1331P,G* Alexander 1331 WICH USA New Mexico Otero West base of Guadalupe mountains east of Pinon Creek, 2.9 34.645 -105.137 mi. S of Chaves County line, 1.7 mi ENE of Tanner Ranch PJA 1377P,G* Alexander 1377 WICH USA New Mexico Grant W side of the Black Range ca. 100 ft up a tributary of Rocky 32.5495 -108.097 Canyon, 4.1 mi. ENE of the Lake Roberts Dam, 14.3 mi. W of McKnight Peak PJA 1406P,G* Alexander 1406 WICH USA New Mexico Sierra E side of the Black Range on the S side of Percha Creek, S of 33.3159 -106.605 NM-152, 2.0 mi. W of Hillsboro, 5.9 mi. E of Kingston. PJA 1411P,G* Alexander 1411 WICH USA Arizona Yavapai NE outskirts of Rimrock on the S rim of Beaver Creek, 0.5 mi. 33.59907 -111.76 SW of Montezuma Well, 1.8 mi N of Russell spring. PJA 1430P,G* Alexander 1430 WICH USA New Mexico Luna NE Cooks Range, in a ravine 0.2 mi. SW of Riley Spring, 1.1 mi. 32.36579 -107.721 NE of Cookes Peak PJA 1431P,G* Alexander 1431 WICH USA New Mexico Sierra Northern San Andres Mountains in upper Thurgood Canyon, 33.3159 -106.545 1.4 miles NNW of Salinas Peak, 2.7 miles WSW of the peak of 69

APPENDIX 2 (continued)

Sample Collector Herbarium Country State County Locality Longitude Latitude ID Silver Top Mountain PJA 1437P,G* Alexander 1437 WICH USA New Mexico Lincoln Carrizozo Malpais in Valley of Fires State Park, S. side of US 33.6819 -105.9252 Hwy. 380, 3.9 mi. W. of Carrizozo. PJA 1452P,G* Alexander 1452 WICH USA New Mexico Dona Ana White Sands Missile Range: S.E. San Andreas Mtns, in 32.4982 -106.5059 "Wheelless Barrow Draw", 1.5 mi. W.S.W. of the Black Mountain highpoint, 2.1 mi. E of Bear peak.

Appendix 2. Specimens subjected to genetic and/or genomic analyses.

P Plastid sequence obtained; G Sample subjected to GBS; G* GBS data analyzed using PCoa/PCOMC