DOCSLIB.ORG

Y and Y L Arginine Transporters in Neuronal Cells Expressing Tyrosine

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Y and Y L Arginine Transporters in Neuronal Cells Expressing Tyrosine View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Biochimica et Biophysica Acta 1745 (2005) 65–73 http://www.elsevier.com/locate/bba Y+ and y+L arginine transporters in neuronal cells expressing tyrosine hydroxylase S.Y. Bae, Q. Xu, D. Hutchinson, C.A. Colton* Division of Neurology, Box 2900, Bryan Research Bldg, Duke University Medical Center, Durham, NC 27710, United States Received 23 August 2004; received in revised form 28 December 2004; accepted 28 December 2004 Available online 25 February 2005 Abstract Arginine is a semi-essential amino acid that serves as sole substrate for enzymes involved in diverse cell processes including redox balance via nitric oxide synthase (NOS) and cell proliferation via arginase. Neurons that express nNOS require intracellular arginine to generate nitric oxide (NO). Using a TH+ neuronal cell line (CAD cells), we show that neuronal NO production is largely dependent on extracellular arginine. Although a small intracellular pool exists in CAD cells, the lack of mRNA for argininosuccinate synthase (AS), a rate limiting enzyme for arginine recycling, suggests that intracellular pools are not re-supplied by this mechanism in this sub-class of neurons. Rather, arginine is taken up from the extracellular media by two primary transport systems, the y+ and the y+L systems. The expression of CAT1, CAT3, y+LAT1 and y+LAT2 mRNAs supports the presence of each system. CAD cell arginine transport is depressed by increased extracellular K+ levels and demonstrates that variations in membrane potential control neuronal arginine uptake. Short term exposure to the oxidizing agents, rotenone and Angeli’s salt, but not FeSO4, increases arginine transport. The regulation of arginine uptake by physiological factors suggests that arginine supply adapts in a moment-to-moment fashion to the changing needs of the neuron. D 2005 Elsevier B.V. All rights reserved. Keywords: Arginine transport; Neuronal nitric oxide synthase; Cationic amino acid transporter; Citrulline–NO cycle; Rotenone; Nitroxyl 1. Introduction in the CNS and are thought to be co-localized with arginine uptake mechanisms that provide arginine to intracellular Arginine is a semi-essential amino acid and is a key stores [3–6]. Arginine uptake has been reported in synapto- component of multiple biochemical pathways, including somes and in primary cultures of neurons, microglia and protein synthesis, the urea cycle, polyamine synthesis and astrocytes [7–14]. In addition, mRNA expression has been nitric oxide production. As a result, arginine is involved in observed in the brain for members of the cationic amino acid diverse cellular processes ranging from redox balance to cell transporter family (CAT1, CAT2B and CAT3) that generate cycle [1]. The impact of arginine metabolism on the y+ transport activity [3,15–17]. The y+ transport system is the physiological functions of a cell depends on the pattern of most common, specific uptake system for arginine in cells enzymes that utilize arginine at any one time and the and is one of at least 4 arginine transport systems, including intracellular availability of arginine mediated by arginine y+,L, B0,+ and the b0,+. The characterization and identifica- transport proteins. Not all cells are created equal in this tion of these systems are based on kinetics, dependence on regard and cell and tissue specific patterns of enzyme and Na+ and specificity for cationic amino acids [18,19]. The y+, transport protein expression and activity provide unique the y+,L and the b0,+ systems are Na+ independent while the functional profiles for arginine utilization [1,2]. B0,+ system is Na+ dependent. Nitric oxide synthase (NOS), arginase 1 (AGI) and The paucity of information on neuronal arginine uptake arginase II (AGII) are the primary enzymes that use arginine mechanisms prompted us to examine arginine uptake in a neuronal cell model that expresses both arginase I and II and * Corresponding author. Tel.: +1 919 668 2758; fax: +1 919 684 6514. nNOS. We have used the CAD cell line, a variant of a CNS E-mail address: [email protected] (C.A. Colton). monoaminergic neuronal cell line [20]. CAD cells undergo 0167-4889/$ - see front matter D 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.bbamcr.2004.12.006 66 S.Y. Bae et al. / Biochimica et Biophysica Acta 1745 (2005) 65–73 morphological differentiation to resemble a CNS neuron buffer was then replaced with uptake buffer containing upon serum deprivation including the generation of long, various concentrations of l-arginine (from 3 AM to 1 mM) neuronal-like processes with varicosities typical of catecho- plus [3H] l-arginine (0.05 ACi/ml [3H] l-arginine per 10 AM laminergic neurons [21]. In addition, we have previously arginine specific activity). Uptake was followed for 4 min at shown that NO production can be accurately measured from 37 8C and stopped by washing with ice cold uptake buffer intact CAD cells, thus allowing us to examine the direct containing 10 mM TRIS, 10 mM HEPES and 137 mM NaCl relationship between extracellular arginine levels and NO at pH 7.4. Uptake time was pre-determined in separate production by nNOS [22]. Our data demonstrate that CAD control studies by measuring specific uptake as a function of cell NO production is dependent on extracellular arginine. time. Uptake for 4 min was chosen as the experimental time We also show that y+,L and y+ transport systems are the point and was within the linear region of the curve. Cells were predominant form of arginine uptake mechanisms. Further- then lysed in 1.0% Triton X-100 plus 0.05% NaN3 and more, the transport of arginine in this neuronal cell line is radioactivitymeasuredbyliquidscintillationcounting. altered by membrane potential and redox factors. Specific arginine uptake was determined from the difference between uptake at 4 8C (non-specific) and uptake at 37 8C (total uptake). At least 6 wells from 3 different culture groups 2. Methods were assayed and uptake values were normalized to Ag pro- tein/min. Data are presented as the average uptake in nmol/ 2.1. Materials mg protein/min (FS.E.) and significance was determined using an unpaired Students’ t test or ANOVAwith GraphPad Vinyl-l-NIO (N5-(1-imino-3-butenyl)-l-ornithine) (v-l- Prism 3.02 (GraphPad Software Inc., San Diego, CA). NIO) was purchased from Alexis Biochemicals (San Diego, To determine the Na+ dependence of the transport CA). N-Nitro-l-arginine methyl ester (l-NAME), N-l- mechanisms and to differentiate between transport systems, monomethyl arginine (NMMA) and ferrous sulfate were the uptake buffer was modified. For certain experiments, purchased from Sigma Chemical Co. (St. Louis, MO). choline chloride (137 mM) replaced NaCl (Na+-free buffer) Ionomycin was purchased from Calbiochem-Novabiochem or 5 mM leucine or 5 mM alanine was added to either Na+- + Corp. (San Diego, CA). Angeli’s salt (Na2N2O3; sodium containing or Na -free uptake buffer. trioxodinitrate) was a generous gift of Dr. Jon Fukuto, UCLA, Los Angeles, CA. Stock solutions were dissolved in 9 M 2.4. RT-PCR NaOH and diluted into media at the appropriate concentration immediately prior to the pretreatment period. Rotenone Total RNA from differentiated CAD cells was extracted (Calbiochem Corp., San Diego CA) was dissolved into using the RNeasy Mini kit (Qiagen, Valencia, CA). For this 100% DMSO for storage at 4 8C and was diluted into normal process, 1 Ag of total RNA was treated with RQ1 DNase media immediately prior to the pretreatment of cells. (Promega Biosciences Inc., San Luis Obispo, CA) to remove DNA contamination and then reverse-transcribed using 2.2. CAD cell culture AMV transcriptase (Promega Biosciences Inc., San Luis Obispo, CA) and random primers. The reverse transcription CAD cells were generously provided by Dr. D. Chikar- reactions were incubated at room temperature for 10 min, and aishi, Department of Neurobiology, Duke University Med- then at 42 8C for 40 min. The transcriptase was subsequently ical Center, Durham NC. CAD cells were cultured in a inactivated by heating at 99 8C for 5 min and cooling to 4 8C humidified 5% CO2/95% air atmosphere at 37 8C in DMEM/ for 5 min. Samples lacking reverse-transcriptase were also F12 medium supplemented with 8% fetal bovine serum used to ensure that genomic DNA was not amplified in the (FBS) (Hyclone, Logan, UT) and 100 U/ml penicillin and PCR reaction. The resulting cDNA templates were then 100 Ag/ml streptomycin as described previously [21]. For the mixed with primer/probe sets (Table 1) for the murine experiments, cells were plated onto poly-d-lysine (mol. wt. cationic amino acid transporter 1gene (CAT1, also known as N300,000)-coated 24-well tissue culture plates at a density of SLC7A1), for a common sequence of both isoforms of the 5Â104 cells/well and cultured in the presence of serum until cationic amino acid transporter 2 gene (CAT2A and B, also confluent (usually 48 h). Once confluent, the cells were known as SLC7A2), the cationic amino acid transporter 3 placed into serum-free media for 15–24 h to differentiate. gene (CAT3, also known as SLC7A3), the arginase I gene (AGI), the arginase II gene (AGII), the nitric oxide synthase 1 2.3. Arginine uptake gene (NOS1), the argininosuccinate synthase (AS)and argininosuccinate lyase genes (AL), for the y+L-type amino Arginine uptake was measured essentially as described by acid transporter gene ( y+LAT1, also known as SLC7A7), for Nicholson et al. [23]. Immediately prior to the experiment, the y+ L-type amino acid transporter gene ( y+LAT2, also cells were pre-equilibrated for 30 min in an arginine-free known as SLC7A6) and for the brelated to b0,+ amino acid uptake buffer (137 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, transportQ gene (rBAT, also known as SLC7A9) [22,23].
Load more

Recommended publications
  • Birthdating of Myenteric Neuron Subtypes in the Small Intestine of the Mouse
    RESEARCH ARTICLE Birthdating of Myenteric Neuron Subtypes in the Small Intestine of the Mouse Annette J. Bergner,1 Lincon A. Stamp,1 David G. Gonsalvez,1 Margaret B. Allison,2,3 David P. Olson,4 Martin G. Myers Jr,2,3,5 Colin R. Anderson,1 and Heather M. Young1* 1Department of Anatomy & Neuroscience, University of Melbourne, Victoria, Australia 2Department of Internal Medicine, University of Michigan, Ann Arbor, Michigan, USA 3Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, Michigan, USA 4Division of Endocrinology, Department of Pediatrics, University of Michigan, Ann Arbor, Michigan, USA 5Department of Neuroscience Graduate Program, University of Michigan, Ann Arbor, Michigan, USA ABSTRACT vast majority of myenteric neurons had exited the cell There are many different types of enteric neurons. Pre- cycle by P10. We did not observe any EdU1/NOS11 vious studies have identified the time at which some myenteric neurons in the small intestine of adult mice enteric neuron subtypes are born (exit the cell cycle) in following EdU injection at E10.5 or E11.5, which was the mouse, but the birthdates of some major enteric unexpected, as previous studies have shown that NOS1 neuron subtypes are still incompletely characterized or neurons are present in E11.5 mice. Studies using the unknown. We combined 5-ethynynl-20-deoxyuridine proliferation marker Ki67 revealed that very few NOS1 (EdU) labeling with antibody markers that identify myen- neurons in the E11.5 and E12.5 gut were proliferating. teric neuron subtypes to determine when neuron sub- However, Cre-lox-based genetic fate-mapping revealed types are born in the mouse small intestine.
    [Show full text]
  • The Baseline Structure of the Enteric Nervous System and Its Role in Parkinson’S Disease
    life Review The Baseline Structure of the Enteric Nervous System and Its Role in Parkinson’s Disease Gianfranco Natale 1,2,* , Larisa Ryskalin 1 , Gabriele Morucci 1 , Gloria Lazzeri 1, Alessandro Frati 3,4 and Francesco Fornai 1,4 1 Department of Translational Research and New Technologies in Medicine and Surgery, University of Pisa, 56126 Pisa, Italy; [email protected] (L.R.); [email protected] (G.M.); [email protected] (G.L.); [email protected] (F.F.) 2 Museum of Human Anatomy “Filippo Civinini”, University of Pisa, 56126 Pisa, Italy 3 Neurosurgery Division, Human Neurosciences Department, Sapienza University of Rome, 00135 Rome, Italy; [email protected] 4 Istituto di Ricovero e Cura a Carattere Scientifico (I.R.C.C.S.) Neuromed, 86077 Pozzilli, Italy * Correspondence: [email protected] Abstract: The gastrointestinal (GI) tract is provided with a peculiar nervous network, known as the enteric nervous system (ENS), which is dedicated to the fine control of digestive functions. This forms a complex network, which includes several types of neurons, as well as glial cells. Despite extensive studies, a comprehensive classification of these neurons is still lacking. The complexity of ENS is magnified by a multiple control of the central nervous system, and bidirectional communication between various central nervous areas and the gut occurs. This lends substance to the complexity of the microbiota–gut–brain axis, which represents the network governing homeostasis through nervous, endocrine, immune, and metabolic pathways. The present manuscript is dedicated to Citation: Natale, G.; Ryskalin, L.; identifying various neuronal cytotypes belonging to ENS in baseline conditions.
    [Show full text]
  • Nitric Oxide Enhances the Sensitivity of Alpaca Melanocytes to Respond to A-Melanocyte-Stimulating Hormone by Up-Regulating Melanocortin-1 Receptor
    Biochemical and Biophysical Research Communications 396 (2010) 849–853 Contents lists available at ScienceDirect Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc Nitric oxide enhances the sensitivity of alpaca melanocytes to respond to a-melanocyte-stimulating hormone by up-regulating melanocortin-1 receptor Yanjun Dong, Jing Cao, Haidong Wang, Jie Zhang, Zhiwei Zhu, Rui Bai, HuanQing Hao, Xiaoyan He, Ruiwen Fan, Changsheng Dong * College of Animal Science and Technology, Shanxi Agricultural University, 030801 Taigu, Shanxi, China article info abstract Article history: Nitric oxide (NO) and a-melanocyte-stimulating hormone (a-MSH) have been correlated with the syn- Received 25 April 2010 thesis of melanin. The NO-dependent signaling of cellular response to activate the hypothalamopituitary Available online 6 May 2010 proopiomelanocortin system, thereby enhances the hypophysial secretion of a-MSH to stimulate a-MSH- receptor responsive cells. In this study we investigated whether an NO-induced pathway can enhance the Keywords: ability of the melanocyte to respond to a-MSH on melanogenesis in alpaca skin melanocytes in vitro.Itis Nitric oxide (NO) important for us to know how to enhance the coat color of alpaca. We set up three groups for experiments a-Melanocyte-stimulating hormone using the third passage number of alpaca melanocytes: the control cultures were allowed a total of 5 days (a-MSH) growth; the UV group cultures like the control group but the melanocytes were then irradiated everyday Melanocortin-1 receptor (MC1R) 2 Alpaca (once) with 312 mJ/cm of UVB; the UV + L-NAME group is the same as group UV but has the addition of Melanocyte 300 lM L-NAME (every 6 h).
    [Show full text]
  • Influence of Functional Variant of Neuronal Nitric Oxide Synthase on Impulsive Behaviors in Humans
    ORIGINAL ARTICLE Influence of Functional Variant of Neuronal Nitric Oxide Synthase on Impulsive Behaviors in Humans Andreas Reif, MD; Christian P. Jacob, MD; Dan Rujescu, MD; Sabine Herterich, PhD; Sebastian Lang, MD; Lise Gutknecht, PhD; Christina G. Baehne, Dipl-Psych; Alexander Strobel, PhD; Christine M. Freitag, MD; Ina Giegling, MD; Marcel Romanos, MD; Annette Hartmann, MD; Michael Rösler, MD; Tobias J. Renner, MD; Andreas J. Fallgatter, MD; Wolfgang Retz, MD; Ann-Christine Ehlis, PhD; Klaus-Peter Lesch, MD Context: Human personality is characterized by sub- Main Outcome Measures: For the association stud- stantial heritability but few functional gene variants have ies, the major outcome criteria were phenotypes rel- been identified. Although rodent data suggest that the evant to impulsivity, namely, the dimensional pheno- neuronal isoform of nitric oxide synthase (NOS-I) modi- type conscientiousness and the categorical phenotypes fies diverse behaviors including aggression, this has not adult ADHD, aggression, and cluster B personality been translated to human studies. disorder. Objectives: To investigate the functionality of an NOS1 Results: A novel functional promoter polymorphism in promoter repeat length variation (NOS1 Ex1f variable NOS1 was associated with traits related to impulsivity, number tandem repeat [VNTR]) and to test whether it including hyperactive and aggressive behaviors. Specifi- is associated with phenotypes relevant to impulsivity. cally, the short repeat variant was more frequent in adult ADHD, cluster B personality disorder, and autoaggres- Design: Molecular biological studies assessed the cel- sive and heteroaggressive behavior. This short variant lular consequences of NOS1 Ex1f VNTR; association came along with decreased transcriptional activity of the studies were conducted to investigate the impact of this genetic variant on impulsivity; imaging genetics was ap- NOS1 exon 1f promoter and alterations in the neuronal plied to determine whether the polymorphism is func- transcriptome including RGS4 and GRIN1.
    [Show full text]
  • The Genetics of Bipolar Disorder
    Molecular Psychiatry (2008) 13, 742–771 & 2008 Nature Publishing Group All rights reserved 1359-4184/08 $30.00 www.nature.com/mp FEATURE REVIEW The genetics of bipolar disorder: genome ‘hot regions,’ genes, new potential candidates and future directions A Serretti and L Mandelli Institute of Psychiatry, University of Bologna, Bologna, Italy Bipolar disorder (BP) is a complex disorder caused by a number of liability genes interacting with the environment. In recent years, a large number of linkage and association studies have been conducted producing an extremely large number of findings often not replicated or partially replicated. Further, results from linkage and association studies are not always easily comparable. Unfortunately, at present a comprehensive coverage of available evidence is still lacking. In the present paper, we summarized results obtained from both linkage and association studies in BP. Further, we indicated new potential interesting genes, located in genome ‘hot regions’ for BP and being expressed in the brain. We reviewed published studies on the subject till December 2007. We precisely localized regions where positive linkage has been found, by the NCBI Map viewer (http://www.ncbi.nlm.nih.gov/mapview/); further, we identified genes located in interesting areas and expressed in the brain, by the Entrez gene, Unigene databases (http://www.ncbi.nlm.nih.gov/entrez/) and Human Protein Reference Database (http://www.hprd.org); these genes could be of interest in future investigations. The review of association studies gave interesting results, as a number of genes seem to be definitively involved in BP, such as SLC6A4, TPH2, DRD4, SLC6A3, DAOA, DTNBP1, NRG1, DISC1 and BDNF.
    [Show full text]
  • Competitive Metabolism of L-Arginine: Arginase As a Therapeutic Target In
    JBR Journal of Biomedical Research，2011，25(5):299-308 http://elsevier.com/wps/ Review find/journaldescription.cws_ home/723905/description#description Competitive metabolism of L-arginine: arginase as a therapeutic ☆ target in asthma * Jennifer M. Bratt, Amir A. Zeki, Jerold A. Last, Nicholas J. Kenyon Department of Internal Medicine, Division of Pulmonary and Critical Care and Sleep Medicine, University of California, Davis, CA 95616, USA Received 25 April 2011, Revised 24 June 2011, Accepted 21 July 2011 Abstract Exhaled breath nitric oxide (NO) is an accepted asthma biomarker. Lung concentrations of NO and its amino acid precursor, L-arginine, are regulated by the relative expressions of the NO synthase (NOS) and arginase iso- forms. Increased expression of arginase I and NOS2 occurs in murine models of allergic asthma and in biopsies of asthmatic airways. Although clinical trials involving the inhibition of NO-producing enzymes have shown mixed results, small molecule arginase inhibitors have shown potential as a therapeutic intervention in animal and cell culture models. Their transition to clinical trials is hampered by concerns regarding their safety and potential tox- icity. In this review, we discuss the paradigm of arginase and NOS competition for their substrate L-arginine in the asthmatic airway. We address the functional role of L-arginine in inflammation and the potential role of arginase inhibitors as therapeutics. Keywords: nitric oxide, L-arginine, arginase, nor-NOHA, nitrosation, nitric oxide synthase INTRODUCTION from accumulation of collagens in the submucosal and [3] Asthma is a common disease characterized by a reticular basement membrane . The airway remod- syndrome of persistent airway inflammation and re- eling and resultant reduction in overall lung function versible airway obstruction.
    [Show full text]
  • Three Classes of Tetrahydrobiopterin-Dependent Enzymes
    DOI 10.1515/pterid-2013-0003 Pteridines 2013; 24(1): 7–11 Review Ernst R. Werner* Three classes of tetrahydrobiopterin-dependent enzymes Abstract: Current knowledge distinguishes three classes in Antalya, Turkey. For a more detailed review on bio- of tetrahydrobiopterin-dependent enzymes as based on chemistry and pathophysiology of tetrahydrobio pterin, protein sequence similarity. These three protein sequence the reader is referred to Ref. [ 1 ]. Here, a short historical clusters hydroxylate three types of substrate atoms and overview of the discovery of tetrahydrobiopterin-depend- use three different forms of iron for catalysis. The first ent enzymes is presented, followed by a summary of the class to be discovered was the aromatic amino acid biochemical properties of these enzymes. The reactions hydroxylases, which, in mammals, include phenylalanine catalyzed by the three classes of tetrahydrobiopterin- hydroxylase, tyrosine hydroxylase, and two isoforms of dependent enzymes are detailed in Figure 1 . tryptophan hydroxylases. The protein sequences of these tetrahydrobiopterin-dependent aromatic amino acid hydroxylases are significantly similar, and all mammalian Discovery of tetrahydrobiopterin- aromatic amino acid hydroxylases require a non-heme- dependent enzymes bound iron atom in the active site of the enzyme for cataly- sis. The second classes of tetrahydrobiopterin-dependent enzymes to be characterized were the nitric oxide syn- Aromatic amino acid hydroxylases thases, which in mammals occur as three isoforms. Nitric oxide synthase protein sequences form a separate cluster Phenylalanine hydroxylase was the first enzyme charac- of homologous sequences with no similarity to aromatic terized to be dependent on a tetrahydropterin [ 2 ]. It then amino acid hydroxylase protein sequences. In contrast to took five more years to identify the nature of the endo- aromatic amino acid hydroxylases, nitric oxide synthases genous cofactor as tetrahydrobiopterin [ 3 ].
    [Show full text]
  • Cellular Distribution and Function of Soluble Guanylyl Cyclase in Rat Kidney and Liver
    ARTICLES J Am Soc Nephrol 12: 2209–2220, 2001 Cellular Distribution and Function of Soluble Guanylyl Cyclase in Rat Kidney and Liver FRANZISKA THEILIG,* MAGDALENA BOSTANJOGLO,* HERMANN PAVENSTADT,¨ † CLEMENS GRUPP,‡ GUDRUN HOLLAND,* ILKA SLOSAREK,* AXEL M. GRESSNER,§ MICHAEL RUSSWURM,࿣ DORIS KOESLING,࿣ and SEBASTIAN BACHMANN* *Department of Anatomy, Charite´, Humboldt University, Berlin, Germany; †Department of Nephrology, University of Freiburg, Freiburg, Germany; ‡Department of Nephrology, University of Go¨ttingen, Go¨ttingen, Germany; §Department of Clinical Chemistry, Rheinisch-Westfa¨lische Technische Hochschule Aachen, Aachen, Germany; and ࿣Department of Pharmacology, Ruhr University, Bochum, Germany. Abstract. Soluble guanylyl cyclase (sGC) catalyzes the biosyn- pendent accumulation of cGMP in cytosolic extracts of tissues thesis of cGMP in response to binding of L-arginine-derived and cells was measured in vitro. Renal glomerular arterioles, nitric oxide (NO). Functionally, the NO-sGC-cGMP signaling including the renin-producing granular cells, mesangium, and pathway in kidney and liver has been associated with regional descending vasa recta, as well as cortical and medullary inter- hemodynamics and the regulation of glomerular parameters. stitial fibroblasts, expressed sGC. Stimulation of isolated mes- The distribution of the ubiquitous sGC isoform ␣1␤1 sGC was angial cells, renal fibroblasts, and hepatic Ito cells with a NO studied with a novel, highly specific antibody against the ␤1 donor resulted in markedly increased cytosolic cGMP levels. subunit. In parallel, the presence of mRNA encoding both This assessment of sGC expression and activity in vascular and subunits was investigated by using in situ hybridization and interstitial cells of kidney and liver may have implications for reverse transcription-PCR assays.
    [Show full text]
  • Genetics and Epigenetics of Nicotine Dependence
    Department of Biosciences Faculty of Biological and Environmental Sciences University of Helsinki, Finland Health and Work Ability Finnish Institute of Occupational Health Helsinki, Finland GENETICS AND EPIGENETICS OF NICOTINE DEPENDENCE Polymorphisms and methylation of CYP2D6, MAOA, MAOB, and SLC6A3 genes as modifiers of smoking phenotypes Emmi Tiili DOCTORAL DISSERTATION To be presented for public discussion with the permission of the Faculty of Biological and Environmental Sciences of the University of Helsinki, in Auditorium 1041, Biocenter 2, on the 25th of September, 2020 at 12 o’clock. Helsinki 2020 Doctoral Program Integrative Life Science Supervised by Docent Ari Hirvonen, PhD Health and Work Ability Finnish Institute of Occupational Health Helsinki, Finland Reviewed by Professor Hannu Raunio, MD, PhD Faculty of Health Science University of Eastern Finland Kuopio, Finland Docent Merja Auvinen, PhD CEO and Founder at DiagFactor Oy Helsinki, Finland Opponent Professor Janne Hukkanen, Research Unit of Internal Medicine Biocenter Oulu and Medical Research Center University of Oulu and Oulu University Hospital Oulu, Finland The Faculty of Biological and Environmental Sciences uses the Urkund system (plagiarism recognition) to examine all doctoral dissertations. ISBN 978-951-51-6434-6 (nid.) ISBN 978-951-51-6435-3 (PDF) Unigrafia Helsinki 2020 2 ABSTRACT Nicotine dependence is a major cause of tobacco-related illnesses. Although tobacco smoking continues to be the leading cause of preventable death, and although the harmful health effects resulting from it are well known, about 20% of the global population continues to smoke. The addiction-causing substance in tobacco, nicotine, acts through dopamine pathways in the brain to produce several pleasurable experiences as a result of cigarette smoking.
    [Show full text]
  • Nos1-Adaptor Protein Dysfunction in the Nucleus Tractus Solitarii Contributes to the Neurogenic Heart Damage and Qt Interval Prolongation
    NOS1-ADAPTOR PROTEIN DYSFUNCTION IN THE NUCLEUS TRACTUS SOLITARII CONTRIBUTES TO THE NEUROGENIC HEART DAMAGE AND QT INTERVAL PROLONGATION A Dissertation Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science By Neha Singh In Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY Major Department: Cellular and Molecular Biology November 2014 Fargo, North Dakota North Dakota State University Graduate School Title NOS1-ADAPTOR PROTEIN DYSFUNCTION IN THE NUCLEUS TRACTUS SOLITARII CONTRIBUTES TO THE NEUROGENIC HEART DAMAGE AND QT INTERVAL PROLONGATION By Neha Singh The Supervisory Committee certifies that this disquisition complies with North Dakota State University’s regulations and meets the accepted standards for the degree of DOCTOR OF PHILOSOPHY SUPERVISORY COMMITTEE: Chengwen Sun, M.D., Ph.D. Chair Stephen T. O’Rourke, Ph.D. Jagdish Singh, Ph.D. Mark Sheridan, Ph.D. Approved: 4/20/15 Jane Schuh, Ph.D. Date Department Chair ABSTRACT Variants of the Nitric Oxide Synthase 1 Adaptor Protein (NOS1AP) locus are strongly related to QT interval prolongation and sudden cardiac death (SCD) in human. Neurogenic cardiac damage due to subarachnoid hemorrhage, stroke, epilepsy and myocardial infarction is known to contribute to sudden death in most cases. Our aim was to study the role of NOS1AP in the neurogenic cardiac damage by silencing NOS1AP expression in the Nucleus Tractus Solitarii (NTS) area of the brainstem using lentiviral vector-mediated NOS1AP shRNA (Lv-NOS1AP- shRNA). Real time PCR data showed NOS1AP mRNA levels were expressed in the NTS 3-fold higher than other organs such as kidney and heart in Sprague Dawley (SD) rats.
    [Show full text]
  • Supplementary Table I. Morpholino Oligonucleotides and Primer Sequences Used in This Study
    Supplementary Table I. Morpholino oligonucleotides and primer sequences used in this study Oligonucleotide Name Accession Sequence Morpholinos tlr5a AY389449 5'-AAAGTGTATGTAGCTGCCATTCTGG tlr5b AY389450 5'-TGAATGTATATCCCATTCTGTGAGC myd88 AY388401 5'-TAGCAAAACCTCTGTTATCCAGCGA myd88 5bp mismatch AY388401 5'-TAcCAtAACCTgTGTTATCgAGgGA standard control morpholino 5'-CCTCTTACCTCAGTTACAATTTATA qRT-PCR ppial-qP1-Fw AY391451 5’- ACACTGAAACACGGAGGCAAAG ppial-qP2-Rev 5’- CATCCACAACCTTCCCGAACAC irak3-qP1-Fw CK026195 5’- TGAGGTCTACTGTGGACGATGG irak3-qP2-Rev 5’- ATGTTAGGATGCTGGTTGAGTTGG tlr5a-qP1-Fw AY389449 5’-ATTCTGGTGGTGCTTGTTGTAG tlr5a-qP2-Rev 5’-ACGAGGTAACTTCTGTTCTCAATG tlr5b-qP3-Fw AY389450 5’-GCGTTGTTGAAGAGGCTGGAC tlr5b-qP4-Rev 5’-TTCTGGATGGCCACTTCTCATATTGG mmp9-qP3-Fw NM_213123 5’-CATTAAAGATGCCCTGATGTATCCC mmp9-qP4-Rev 5’-AGTGGTGGTCCGTGGTTGAG il1b-qP1-Fw NM_212844 5’-GAACAGAATGAAGCACATCAAACC il1b-qP2-Rev 5’-ACGGCACTGAATCCACCAC il8-qP1-Fw XM_001342570 5’-TGTGTTATTGTTTTCCTGGCATTTC il8-qP2-Rev 5’-GCGACAGCGTGGATCTACAG ifn1-qP3-Fw NM_207640 5’- TTAATACACGCAAAGATGAGAACTC ifn1-qP4-Rev 5’- GCCAAGCCATTCGCAAGTAG tnfa-qP5-Fw NM_212829 5’- AGACCTTAGACTGGAGAGATGAC tnfa-qP6-Rev 5’- CAAAGACACCTGGCTGTAGAC cxcl-C1c-qP1-Fw NM_001115060 5’- GGCATTCACACCCAAAGCG cxcl-C1c-qP2_Rev 5’- GCGAGCACGATTCACGAGAG * In situ ccl-C5a-Fw NM_001082906 5’- CATCACTAGGAAAGGATTGAAC ccl-C5a-Rev-T7 5’- TAATACGACTCACTATAGGGGATGTCAAAGACTTTATTCAC cxcl-C1c-Fw NM_001115060 5’- GTTAAACATAAATAACACCGACTC cxcl-C1c-Rev-T7 5’- TAATACGACTCACTATAGGGACACCCTATAAAACTGAGTA irak3-Fw CK026195 5’- CAGTGAGAGAGGCATGAAACATC
    [Show full text]
  • Arginase: Marker, Effector, Or Candidate Gene for Asthma?
    Arginase: marker, effector, or candidate gene for asthma? Donata Vercelli J Clin Invest. 2003;111(12):1815-1817. https://doi.org/10.1172/JCI18908. Commentary Microarray analysis of the expression profiles of lung tissue in two murine models of asthma revealed high levels of arginase I and arginase II activity, in association with IL-4 and IL-13 overexpression, suggesting that arginine pathways are critical in the pathogenesis of asthma. Find the latest version: https://jci.me/18908/pdf molecular bases of the TNF signaling. initiation in the absence of caspase-8. J. Biol. Chem. is a direct inhibitor of apoptosis signal- regulat- 276:46639–46646. ing kinase (ASK) 1. EMBO J. 17:2596–2606. Given its important contribution to 5. Wajant, H., and Scheurich, P. 2001. Tumor necro- 13. Zhang, L., Chen, J., and Fu, H. 1999. Suppression TNF-induced JNK activation, AIP1 sis factor receptor-associated factor (TRAF) 2 and of apoptosis signal-regulating kinase 1-induced may represent a suitable target for pos- its role in TNF signaling. Int. J. Biochem. Cell. Biol. cell death by 14-3-3 proteins. Proc. Natl. Acad. Sci. 33:19–32. U. S. A. 96:8511–8515. sible therapeutic applications in 6. Ip, Y.T., and Davis, R.J. 1998. Signal transduction 14. Zhang, R., et al. 2003. AIP1 mediates TNF-α– human diseases characterized by by the c-jun N-terminal kinase (JNK): from induced ASK1 activation by facilitating disso- inflammation to development. Curr. Opin. Cell ciation of ASK1 from its inhibitor 14-3-3. increased TNF-α–mediated apoptosis.
    [Show full text]