Local Translation in Nuclear Condensate Amyloid Bodies

Home , EEF1E1, EIF1, EIF2A, EIF3D, EIF3F, EIF4A2

Local translation in nuclear condensate amyloid bodies

Phaedra R. Theodoridisa,b,1, Michael Bokrosa,b,1, Dane Marijanc, Nathan C. Balukoffa,b, Dazhi Wanga,b, Chloe C. Kirka,b, Taylor D. Budinea,b, Harris D. Goldsmitha,b, Miling Wanga,b, Timothy E. Audasc, and Stephen Leea,b,2

aDepartment of Biochemistry and Molecular Biology, Miller School of Medicine, University of Miami, Miami, FL 33136; bSylvester Comprehensive Cancer Center, Miller School of Medicine, University of Miami, Miami, FL 33136; and cDepartment of Molecular Biology and Biochemistry, Simon Fraser University, Burnaby, BC, Canada V5A 1S6

Edited by Peter Cresswell, Yale University, New Haven, CT, and approved January 11, 2021 (received for review July 9, 2020) Biomolecular condensates concentrate molecules to facilitate basic similar to Balbiani bodies in Xenopus oocytes (31). In contrast to biochemical processes, including transcription and DNA replica- liquid-like condensates that concentrate molecules to facilitate tion. While liquid-like condensates have been ascribed various biochemical reactions, amyloid bodies and Balbiani bodies are functions, solid-like condensates are generally thought of as amor- believed to store proteins and induce cellular dormancy (19, 27, phous sites of protein storage. Here, we show that solid-like am- 31). Since amyloid bodies also comprise an array of mobile yloid bodies coordinate local nuclear protein synthesis (LNPS) proteins (e.g., ribosomal proteins) (23), it remains unknown if during stress. On stimulus, translationally active ribosomes accu- these nuclear condensates have other cellular functions in ad- mulate along fiber-like assemblies that characterize amyloid bod- dition to protein retention and metabolic depression. ies. Mass spectrometry analysis identified regulatory ribosomal Here, we report that nuclear amyloid bodies are sites of stress- proteins and translation factors that relocalize from the cytoplasm resistant local nuclear protein synthesis (LNPS). Mass spec- to amyloid bodies to sustain LNPS. These amyloidogenic compart- trometry with stable isotope labeling by amino acids in cell culture ments are enriched in newly transcribed messenger RNA by Heat (MS-SILAC) cytoplasmic ribosomal proteins and translation fac- Shock Factor 1 (HSF1). Depletion of stress-induced ribosomal inter- tors that relocalize to amyloid bodies in cells responding to an- genic spacer noncoding RNA (rIGSRNA) that constructs amyloid aerobic fermentation or heat shock. In vitro puromycylation and bodies prevents recruitment of the nuclear protein synthesis ma- proximity ligase assays uncovered ribosomal acceptor sites orga- chinery, abolishes LNPS, and impairs the nuclear HSF1 response. nized along fiber-like assemblies that characterize these solid-like We propose that amyloid bodies support local nuclear translation condensates. Amyloid bodies anchor HSF1 target mRNAs that

during stress and that solid-like condensates can facilitate complex CELL BIOLOGY biochemical reactions as their liquid counterparts can. recruit the LNPS machinery to sustain nuclear protein synthesis. We discuss how amyloid-body protein synthesis can be compared long noncoding RNA | hypoxia | acidosis | HSR | Hsp70 to local translation machineries that synthesize proteins at specific cellular coordinates (32–40) during periods of inhibition of nuclear/cytoplasmic trafficking. These results identify amyloid bodies ells are remarkable in their ability to sustain viability under as nuclear, solid-like condensates that sustain stress-induced local Cadverse environmental conditions (1). Hypoxia-induced extracellular acidosis is a common stimulus observed in an array of translation. physiological and pathological settings including development, Results cancer, and ischemic episodes (2, 3). Cells acclimatize to the acidotic state by suppressing global protein synthesis among Physiological Stressors Induce LNPS in Amyloid Bodies. Cells were other pathways (4–6) while activating the heat shock response incubated in low-oxygen tension to induce the natural acidifi- (HSR) involved in protein homeostasis (7–9). The master regulator cation of their extracellular milieu as a consequence of lactic of the HSR is heat shock factor 1 (HSF1) that transcribes genes encoding a wide array of chaperones, including the canonical heat Significance shock protein 70 (Hsp70) (10). Activation of the HSR through HSF1 is believed to sustain cellular viability during periods of intense stress, The central dogma of eukaryotic biology is clear: DNA replica- such as extracellular acidosis and heat shock (9). tion and RNA transcription occur in the nucleus while protein In addition to activating the HSR, extracellular acidosis and synthesis takes place in the cytoplasm. While this fundamental heat shock induce the formation of several membraneless bodies tenet of biology is entrenched in textbooks, it has undergone (e.g., stress granules) that have been implicated in a wide range recurring challenges over the decades, most notably the exis- of cellular functions, such as storage of cytoplasmic messenger tence of nuclear translation. We report that solid-like conden- RNAs (mRNAs) and nuclear splicing factors. These organelles sate amyloid bodies are hubs of stress-resistant local nuclear have been described as liquid-like biomolecular condensates and translation in cells engaging in hypoxic fermentation or are formed by a phenomenon called “phase separation” (11–14). responding to high temperature. Conceptually, this paper Liquid-like biomolecular condensates are typically dynamic as provides a physiological context for nuclear protein synthesis their constituent proteins are highly mobile and can exchange while highlighting a role for solid-like condensates in coordi- between the phase-separated bodies and the extracellular milieu nating complex biochemical reactions. (15–18). Fermentation-induced acidosis and heat shock also stimulate the formation of amyloid bodies: nuclear organelles Author contributions: P.R.T., M.B., T.E.A., and S.L. designed research; P.R.T., M.B., D.M., that can be readily distinguished from other compartments by N.C.B., D.W., C.C.K., T.D.B., H.D.G., and M.W. performed research; P.R.T., M.B., N.C.B., their large electron-dense fibers that stain with various amyloi- T.E.A., and S.L. analyzed data; and P.R.T., T.E.A., and S.L. wrote the paper. dophylic dyes (19). Amyloid bodies are constructed by a class of The authors declare no competing interest. inducible long noncoding RNA (lncRNA) derived from stimuli- This article is a PNAS Direct Submission. specific loci of the ribosomal intergenic spacer (rIGSRNA) (20–22). Published under the PNAS license. Mass spectrometry and photobleaching analyses revealed that 1P.R.T. and M.B. contributed equally to this work. amyloid bodies are enriched in a heterogeneous population of 2To whom correspondence may be addressed. Email: [email protected]. full-length proteins, many of which are immobile (23–26). As This article contains supporting information online at https://www.pnas.org/lookup/suppl/ such, amyloid bodies have been described as nondynamic, or doi:10.1073/pnas.2014457118/-/DCSupplemental. solid-like, condensates with amyloidogenic properties (27–30) Published February 10, 2021.

PNAS 2021 Vol. 118 No. 7 e2014457118 https://doi.org/10.1073/pnas.2014457118 | 1of9 Downloaded by guest on September 24, 2021 fermentation, recapitulating various in vivo conditions including ribosomes (51, 53, 54). Consistent with previous reports (47), a ischemia (41) and microenvironments of aggressive tumors (42). slightly over background nuclear 6′FAM-puromycin signal was Under such anaerobic acidosis conditions (37 °C, 1% O2, pH observed in permeabilized cells that were maintained at basal 6.0), cells remain viable while displaying a marked decrease in conditions (Fig. 1C: first panel and fourth panel for low magni- global translation compared to their basal (37 °C, 21% O2, pH fication). In sharp contrast, intense nuclear 6′FAM-puromycin 7.4) or anaerobic neutral (37°, 1% O2, pH 7.4) counterparts (SI signal was detected in acidotic or thermal-stressed cells (Fig. 1C: Appendix, Fig. S1 A and B). To corroborate these results, we second and third panels and fifth panel for low magnification; performed immunofluorescence analysis on cells incubated with Fig. 1D). Anisomycin competes with puromycin for ribosomal puromycin (SI Appendix, Fig. S1C). Cells were treated with A-site binding although these molecules are structurally different emetine to prevent the synthesis of new proteins and fixed with and thus unlikely to bind to the same nonspecific sites (47, 55, the denaturant methanol to enable the detection of free and 56). Addition of anisomycin abolished in vitro 6′FAM- residual translating, ribosome-associated, puromycylated pep- puromycin incorporation (Fig. 1 C and D and SI Appendix, Fig. tides (43, 44). Under these experimental conditions, we observed S1 F and G), demonstrating that the puromycylation reactions abundant puromycin signal in the cytoplasm of cells maintained occur at bona fide ribosomal A-sites in the nucleus. Likewise, at basal (37 °C, 21% O2, pH 7.4) or hypoxic neutral (37°, 1% O2, addition of anisomycin abolished puromycin signal in intact cells pH 7.4) conditions (Fig. 1A). Surprisingly, puromycin signal was (Fig. 1A). The presence of nuclear ribosomes actively synthe- detected in nuclear foci, in addition to the cytoplasm, in cells sizing proteins was further demonstrated by the detection of engaging in anaerobic fermentation (Fig. 1A) or exposed to heat elongating puromycylated peptides of different lengths following shock (43 °C, 21% O2, pH 7.4; Fig. 1A and SI Appendix, Fig. Western analysis of the in vitro assay (Fig. 1 B and E). The S1 D–F), another potent inhibitor of global protein synthesis (SI presence of different puromycylated species confirmed that the Appendix, Fig. S1 A–E). Previous studies revealed that a small nuclear signal is not due to contaminating cytosol, aborted small fraction of puromycylated peptides remain bound to translating peptides, or puromycylated transfer RNAs (tRNAs). We esti- ribosomes (45, 46); this fraction may be detectable by immuno- mate that LNPS represents roughly 5% of total protein synthesis fluorescence especially if concentrated in clearly defined foci. To intensity in stressed cells as assessed by Western blot analysis and test the possibility that elongating ribosomes form in the nucleus cellular puromycin signal (SI Appendix, Fig. S1H). We performed of cells responding to stressors, we designed an in vitro pur- a complementation assay to eliminate the unlikely possibility that omycylation assay adapted from well-established protocols in vitro nuclear puromycylation signals arise from any other (47–51). Cells grown on coverslips were subjected to cytoplasmic contaminating cytosolic components during permeabilization. membrane solubilization followed by extensive washing to Soluble and insoluble fractions of cells maintained at 37 °C or remove cytosolic components as monitored by the loss of calre- 43 °C incubated with 6′FAM-puromycin were directly added to ticulin staining (Fig. 1B). Permeabilized cells were incubated permeabilized cells in the presence of anisomycin (SI Appendix, with 6′carboxyfluorescein (6′FAM)-labeled puromycin (52) to Fig. S1I). We did not observe nuclear 6′FAM-puromycin fol- directly monitor the puromycylation reaction without the need lowing these complementation assays, demonstrating that nu- for immunofluorescence. The assay was done at 4 °C, which does clear 6′FAM-puromycin did not originate from residual, not prevent the puromycylation reaction but considerably de- contaminating cytosolic 6′FAM-puromycylated peptides or creases the release of puromycylated peptides from translating translating ribosomes that could have entered the nucleus during

A E Basal Hypoxia Acidosis Heat shock Basal Acidosis kD Basal kD Heat shock 100:1 Aniso 100:1 Aniso 75 75 Puromycin Puromycin B In vitro puromycylation D Puromycin No Aniso 4ºC 4ºC 4ºC 6 1:100 Aniso 25 25

stimulus cytoplasmic cytosolic removal puromycylation * * Cal Cal membrane solubilized 0 * basal/ heat shock/ polysome buffer 6’FAM-puromycin 6’FAM-puromycin Basal Heat cyto nuc cyto nuc acidosis 0.1% NP-40 or puromycin for PLA Pixel intensity/Nucleus Acidosis shock C 6’FAM-puromycin F 6’FAM-puromycin Basal Acidosis Heat Shock Basal Heat shock Heat shock Ctl Complementation 100:1 Aniso Soluble

Cal Hoechst Cal HoechstCal Hoechst

Fig. 1. Physiological stressors activate local nuclear protein synthesis. (A) Puromycin immunofluorescence in intact acidotic or thermal-stressed cells; 100:1 anisomycin competition abolishes signal. (B) In vitro puromycylation schematic. Cells are permeabilized on coverslips with 0.1% Nonidet P-40 and washed to complete cytosolic removal before incubation with 6′FAM-puromycin or puromycin at 4 °C. (C) FAM-puromycin signal in permeabilized thermal-stressed cells lacking cytosol; 100:1 anisomycin competition abolishes signal. Signal is observed in entire cellular population of thermal-stressed cells. (D) Competition for A-site–binding assays with anisomycin eliminate FAM-puromycin signal in thermal-stressed and acidotic cells. (E) Western blot analysis of in vitro puromycylation in cytosolic (1:5 diluted) and nuclear fractions. Bio-Rad precision plus protein ladder included. (F) Complementation assay shows no accumulation of soluble puromycylated proteins in heat-shocked cells. (Scale bars: 5 μm.) Pixel intensity values depicted are ×104. Error bars represent SEM. *P < 0.05.

2of9 | PNAS Theodoridis et al. https://doi.org/10.1073/pnas.2014457118 Local translation in nuclear condensate amyloid bodies Downloaded by guest on September 24, 2021 permeabilization (Fig. 1F and SI Appendix, Fig. S1J). Nuclear in this subcellular domain. These models suggest that pre- puromycin signal was rapidly observed under stress (SI Appendix, ribosomes are initially produced in nucleoli and require export to Fig. S1D) and was completely lost within a few hours following undergo the final steps of maturation (57–60) by assembling with stimuli termination (SI Appendix, Fig. S1K). key cytoplasmic Rps such as Rpl24 and Rpl7 (61). Interestingly, Fermentation-induced extracellular acidosis and thermal SILAC-MS analysis (19, 24) revealed that amyloid bodies not stress trigger the formation of various membrane-less liquid- and only retain, but also are broadly enriched in ribosomal proteins, solid-like compartments. High-resolution microscopy of nuclear including the aforementioned regulatory Rps (Fig. 3A and SI 6′FAM-puromycin fluorescence and nuclear puromycin signal Appendix, Fig. S3A). Immunofluorescence (Fig. 3B and SI Ap- detected by immunofluorescence revealed translating ribosomes pendix, Fig. S3 B and C) and Western blot analysis (Fig. 3C and organized along fiber-like assemblies that characterize solid-like SI Appendix, Fig. S3D) confirmed that full-length regulatory Rps condensate amyloid bodies (Fig. 2A). The nuclear 6′FAM- accumulate in amyloid bodies along their characteristic fiber-like puromycin and immunofluorescence signals colocalized with assemblies (Fig. 3B) in proximity to puromycylated peptides amyloidophylic dyes, confirming that amyloid bodies are sites of (Fig. 3D and SI Appendix,Fig.S3E and F). Silencing of rIGSRNA stress-induced LNPS (Fig. 2B and SI Appendix, Fig. S2A). prevented the recruitment of regulatory Rps to amyloid bodies Amyloid-body biogenesis is mediated by a class of inducible (Fig. 3E and SI Appendix,Fig.S3G) as well as nuclear Rps26/ lncRNA molecules derived from stimuli-specific loci of the puromycylated peptides proximity ligation assay (PLA) signal in rDNA intergenic spacer (rIGSRNA) (SI Appendix, Fig. S2B) cells (Fig. 3D). Based on data shown in Fig. 3 A–E that amyloid- (19–22). Induction of these chromatin-associated lncRNA mol- body ribosomes harbor similar Rps to cytoplasmic ribosomes, we ecules remodels nucleoli into fibrous amyloid bodies (SI Ap- reasoned that LNPS should be sensitive to the same antibiotics pendix, Fig. S2B). Depletion of rIGS16RNA and rIGS22RNA, that inhibit cytoplasmic translation. Consistent with this notion, which seed amyloid bodies during heat shock, reduced nuclear 6′ treatment of thermal-stressed or acidotic cells with the translation FAM-puromycin incorporation (Fig. 2 C and D and SI Appendix, initiation inhibitors harringtonine (Harr) (62) or aurintricarboxylic Fig. S2C) and cellular puromycin immunofluorescence signal (SI acid (ATA) (63) efficiently abolished 6′FAM-puromycin incor- Appendix, Fig. S2D) to levels similar to those observed in basal poration in the in vitro assays and nuclear puromycylation in conditions with little effect on cytoplasmic immunofluorescence intact cells (Fig. 3 F and G and SI Appendix, Fig. S3 H and I). (SI Appendix, Fig. S2D). Likewise, rIGS28RNA silencing, which Thus, amyloid bodies retain preribosomal subunits while prevents anaerobic acidosis-induced amyloid-body biogenesis, recruiting regulatory Rps typically found in the cytoplasm to impaired LNPS under acidosis (Fig. 2 C and D and SI Appendix, form translationally competent ribosomes. Fig. S2C). These experiments eliminate any possibility that 6′ MS-SILAC also identified the enrichment in amyloid bodies CELL BIOLOGY FAM-puromycin nuclear signal may be caused by contaminat- of the eukaryotic translation initiation factor 4H (eIF4H) (64). ing cytosolic ribosomes entering the nucleus during the per- Immunofluorescence analysis confirmed that eIF4H is exclu- meabilization step as this contamination would need to be sively cytoplasmic at 37 °C but relocalizes to amyloid bodies in dependent on chromatin-associated lncRNA. Likewise, the loss thermal-stressed (Fig. 4A) or acidotic cells (SI Appendix, Fig. of nuclear puromycylation signal in rIGSRNA-depleted intact S4A), colocalizing with puromycin (SI Appendix, Fig. S4B) and cells further suggests that the aforementioned nuclear signal is amyloidophilic dyes (SI Appendix, Fig. S4A). As with Rps26, not simply the consequence of diffusion of puromycylated pep- eIF4H was observed in proximity to nuclear puromycylated tides from the cytoplasm. Termination of LNPS correlated with peptides in intact cells (Fig. 4 B and C) and in the in vitro assay the disassembly of amyloid bodies during stress recovery (Fig. 2F (SI Appendix, Fig. S4C) which, again, excludes the possibility that and SI Appendix,Fig.S1K). These results suggest that physiological nuclear PLA signal originates from diffusion of puromycylated stressors stimulate LNPS in solid-like condensate amyloid bodies. peptides from cytoplasmic ribosomes. Depletion of rIGSRNA impaired the relocalization of eIF4H to amyloid bodies and The LNPS Machinery. Current paradigms imply that protein syn- proximity between eIF4H and nuclear puromycylated peptides, thesis is strictly localized in the cytoplasm since regulatory ri- further suggesting that these solid-like condensates coordinate bosomal proteins (Rps) and translation factors reside exclusively the assembly of the LNPS machinery (Fig. 4 D–F). Silencing of

A B E siCtl 6’FAM-puromycin 6’FAM-puromycin Puromycin Basal Heat shock Acidosis sirIGSRNA 1

.5 * Amylo-glo Overlay Amylo-glo Overlay Amylo-glo Overlay Heat shock pixel intensity 0 Relative puromycin 6’FAM-puromycin Cytoplasm Nucleus

C D F Puromycin siCtl sirIGS RNA shCtl shrIGS RNA Amylo-glo 16/22 28 120 6 Amyloid-bodies * % Cells with 4 * * * 60 2 Acidosis Puromycin Heat shock pixel intensity 0 0 0h 2h 2h 4h 6h 43ºC Heat shock 37ºC Recovery

Fig. 2. LNPS in solid condensate amyloid bodies. (A) Superresolution microscopy of puromycin. (B) FAM-puromycin LNPS signal colocalizes with Amylo-glo, a fluorescent amyloid-specific histochemical tracer. (C) rIGSRNA depletion abolishes FAM-puromycin LNPS signal. (D) Effect of rIGSRNA depletion on FAM- puromycin LNPS signal. (E) Effect of rIGSRNA depletion on cytoplasmic and LNPS puromycin signal in thermal-stressed cells. (F) LNPS puromycin signal cor- relates with percentage of cells containing amyloid bodies. Measurements were taken for up to 2 h of heat shock followed by a total of 6 h in recovery. (Scale bars: 5 μm.) Pixel intensity values depicted are ×104. Error bars represent SEM. *P < 0.05.

Theodoridis et al. PNAS | 3of9 Local translation in nuclear condensate amyloid bodies https://doi.org/10.1073/pnas.2014457118 Downloaded by guest on September 24, 2021 A Heat shock B C Nucleolus or E SILAC-MS Acidosis Amyloid-body kDa siCtl sirIGS RNA 3 Basal Heat shock Heat shock 16/22 Rps3 30

1.5 Rpl24 18 Rpl24

Rps26 Rps26 14

Fold increase 0 Rps9 Rpl7 CDC73 70 Amyloid-bodies/Nucleoli Rps26 Rpl24

Basal Acidosis D PLA-Rps26/Puromycin PLA-Rps26/Puro F Heat shock G 8 siCtl siCtl sirIGS RNA 20 DMSO ATA Harr -puromycin antibody 16/22 10 E 4

Puncta/Nucleus 0 * 0 * Ctl Ctl 16/22 6’FAM-puromycin Pixel intensity/Nucleus 6’FAM-Puromycin ATA

-puro ab. Harr

siRNA DMSO

Fig. 3. Stress-induced relocalization of key regulatory ribosomal proteins to amyloid bodies. (A) Selected Rps identified by MS-SILAC analysis of nucleoli versus amyloid bodies. Raw ratios are depicted. One-fold enrichment signifies no change between basal and stress treatment. (B) Superresolution microscopy of Rps26. (C) Western blot analysis of Rp localization. CDC73: amyloid-body marker. (D) PLA of Rps26 to puromycin reveals a quantifiable loss of proximity between Rps26 and puromycin antibodies in nuclei of thermal-stressed cells. (E) rIGSRNA depletion impairs accumulation of Rpl24 in amyloid bodies. (F) Pretreatment with 2 μg/mL Harringtonine (Harr) or 100 μM aurintricarboxylic acid (ATA) abolishes FAM-puromycin LNPS signal in thermal-stressed cells, (G) quantified by ImageJ. (Scale bars: 5 μm.) Pixel intensity values depicted are ×104. Error bars represent SEM. *P < 0.05.

eIF4H had no discernible effect on protein synthesis intensity at at 37 °C. While many translation factors remained cytoplasmic 37 °C (SI Appendix, Fig. S4D) but prevented LNPS in amyloid even during stress (SI Appendix,Fig.S4G, gray), several were bodies as measured by in vitro incorporation of 6′FAM- abundantly observed in amyloid bodies under heat shock condi- puromycin and puromycin immunofluorescence (Fig. 4 G and tions (SI Appendix,Fig.S4G, purple, black). RNA interference H and SI Appendix, Fig. S4D) without affecting the construction analysis revealed that translation factors that remained in the of these solid-like condensates (SI Appendix, Fig. S4 E and F). cytoplasm during stress did not participate in LNPS or have ac- We suspected that additional translation factors relocalize to cessory functions (SI Appendix, Fig. S4G,blue;SI Appendix,Fig. amyloid bodies but may have escaped detection by MS-SILAC. S4 D–H). For example, efficient silencing of eIF4A1 or eIF5A1, To test this, we performed an immunofluorescence screen of translation initiation factors that localize to the cytoplasm at 43 °C several known endogenous translation factors to examine their (Fig. 4 G and H and SI Appendix,Fig.S4F–H), had no effect on potential role in LNPS (SI Appendix,Fig.S4G and H). As amyloid-body 6′FAM-puromycin incorporation and puromycin expected, translation factors were cytoplasmic in cells maintained immunofluorescence during heat shock (Fig. 4 G and H and SI

A eIF4H eIF4A1 B PLA-eIF4H/Puromycin PLA-eIF4A1/Puromycin Basal Heat shock Basal Heat shock Basal Heat Shock Heat shock Heat shock -puromycin antibody

PLA-eIF4H/Puromycin C eIF4H eIF4A1 DEeIF4H F PLA-eIF4H/Puro siCtl sirIGS RNA siCtl sirIGS RNA 20 20 * 16/22 16/22

10 /Nucleus Heat shock Heat shock * Puncta 0 Puncta/Nucleus 0 Ctl 16/22 37°C 43°C 43°C 43°C -puro ab. siRNA

G H I Met tRNA-synthetase siCtl sieIF4H sieIF4A1 sieIF5A1 3 Basal Heat shock

/Nucleus 1.5

* 0 6’FAM-puromycin Ctl4H 4A1 5A1 Pixel intensity 6’FAM-Puromycin siRNA

Fig. 4. The amyloid-body protein synthesis machinery. (A) Immunofluorescence (IF) of eIF4H and eIF4A1. (B) PLA of eIF4H to puromycin reveals a quantifiable (C) loss of proximity between eIF4H and puromycin antibodies in nuclei of heat-shocked cells. (D) rIGSRNA depletion in heat shock impairs accumulation of eIF4H in amyloid bodies. (E) rIGSRNA depletion impairs PLA signal of eIF4H and puromycin in thermal-stressed cells in a (F) quantifiable manner. (G) In vitro FAM-puromycin signal in thermal-stressed eIF4H-depleted versus eIF4A1- or eIF5A1-depleted cells, (H) quantified by ImageJ. (I) IF of Met-tRNA-synthetase. (Scale bars: 5 μm.) Pixel intensity values depicted are ×104. Error bars represent SEM. *P < 0.05.

4of9 | PNAS Theodoridis et al. https://doi.org/10.1073/pnas.2014457118 Local translation in nuclear condensate amyloid bodies Downloaded by guest on September 24, 2021 Appendix,Fig.S4D). In contrast, silencing of eIF4B that accu- Fig. S5 F and G). RNA–fluorescent in situ hybridization (FISH) mulates in amyloid bodies, along with eIF4H, impaired nuclear revealed the presence of Hsp70 mRNA in amyloid bodies, but protein synthesis (SI Appendix,Fig.S4G: red, SI Appendix,Fig. not in nucleoli, a finding that was dependent on de novo tran- S4 D and H). It has been suggested that several aminoacyl-tRNA scription by HSF1 and rIGSRNA. (Fig. 5 F and G). It is inter- synthetases localize to translating ribosomes, thereby marking esting that depletion of chromatin-associated rIGSRNA mainly sites of active local translation (65). Immunofluorescence analysis reduces heat shock-induced accumulation of Hsp70 protein in revealed that Met-, Lys-, and Arg-tRNA synthetases were found the nucleus rather than cytoplasmic steady-state pools (Fig. 5 H in amyloid bodies in a rIGSRNA-dependent manner (Fig. 4I and and I). This trend was also observed for other HSF1 targets (SI SI Appendix,Fig.S4I and J), suggesting that LNPS encompasses Appendix, Fig. S5 H and I). However, these experiments do not all the major biochemical classes (i.e., ribosomes, translation preclude the possibility that rIGSRNA depletion affects cyto- factors, aminoacyl tRNA synthetases) involved in cytoplasmic plasmic translation of proteins that are eventually imported into protein synthesis. Put together, these results demonstrate that the nucleus (66). Finally, DRB or small interfering RNA regulatory Rps and translation factors relocalize from the cyto- (siRNA) against HSF1 prevented the recruitment of the LNPS plasm to amyloid bodies to participate in stress-induced local machinery to amyloid bodies (Fig. 5 J and K and SI Appendix, translation. Figs. S3F and S5 J–M). Pretreatment with cycloheximide, which does not affect amyloid-body biogenesis under our experimental HSF1 Activation Drives LNPS. Heat shock activates a potent tran- settings, did not prevent such recruitment, indicating that the scription response to coordinate the HSR. Treatment with the preexisting translation factors and Rps enter the nucleus to RNA polymerase II inhibitor 5,6-Dichloro-1-β-d-ribofur- sustain LNPS (SI Appendix, Fig. S5N). These results suggest that anosylbenzimidazole (DRB) completely abolished 6′FAM- newly transcribed HSF1 transcripts are required for LNPS and puromycin fluorescence and puromycin signal in amyloid that these mRNAs recruit the LNPS machinery to drive stress- bodies without affecting the construction of these solid-like con- resistant nuclear translation by amyloid bodies. densates (Fig. 5A and SI Appendix, Fig. S5 A and B). This suggested that stress-induced de novo-transcribed mRNAs are Discussion captured by amyloid bodies for LNPS. HSF1 is a master regu- In this report, we provide evidence that nuclear solid-like con- lator of the stress response that activates the transcription of densate amyloid bodies are hubs of stress-resistant protein syn- heat shock genes. Silencing of HSF1 (Fig. 5 B and C) or treat- thesis. Local nuclear translation relies on the expression of SI Appendix C–E

ment with an HSF1 inhibitor ( , Fig. S5 ) im- inducible ribosomal intergenic spacer lncRNAs that construct CELL BIOLOGY paired nuclear 6′FAM-puromycin incorporation and puromycin amyloid bodies and on activation of the HSF1 transcriptional signal in amyloid bodies without affecting their biogenesis. In program. Our study suggests that amyloid bodies concentrate contrast, incubation of cells with a c-myc transcription factor cytoplasmic translation factors and regulatory Rps to sustain inhibitor had no effect on amyloid-body translational capacity nuclear protein synthesis. Stimuli-induced LNPS joins local under similar conditions (SI Appendix, Fig. S5C). RNA se- translation in neuronal axons (33–36, 67–69) and the rough en- quencing and qPCR analysis of purified amyloid bodies con- doplasmic reticulum (70, 71), highlighting the ability of cells to firmed that HSF1-transcribed mRNAs accumulate in these solid- localize protein synthesis at distinct subcellular domains. These like condensates during stress (Fig. 5 D and E and SI Appendix, data also indicate that solid-like condensates coordinate complex

A 6’FAM-Puromycin B 6’FAM-Puromycin C D Amyloid-body RNome - Gene Ontology enrichment analysis 10 DMSO DRB siCtl siHSF1 Cellular responses to stress p=3.47e-06

Cellular response to heat stress p=1.22e-08 5 Regulation of HSF1-mediated heat shock response p=8.91e-08 HSF1 activation p=2.77e-09

* HSF1-dependent transactivation p=1.25e-08

Attenuation phase p=1.30e-09 Heat shock Heat shock 0

6’FAM-puromycin Ctl HSF1 MAPK6/MAPK4 signaling p=3.40e-04 Pixel intensity/Nucleus siRNA # of common genes Toll Like Receptor 4 Cascade p=2.68e-02 E F RNA-FISH Hsp70 mRNA G 43°C RNA-FISH Hsp70 mRNA Basal Heat shock Heat shock Heat shock siCtl sirIGS RNA KRIBB11 RNase 16/22 BAG3 AKAP13 JUN DUSP1 CCDC13 FOS PGF HSPA6 HBA1 HSPE1 HMGB1 HSPA4L HSPA1A EGR1 HSPD1 PTGES3 IER5 Validated amyloid-body mature mRNA

H I siCtl J K PLA Rps26/Puromycin

siCtl sirIGS RNA sirIGS16/22RNA siCtl siHSF1 siCtl siHSF1 16/22 1

.5 * eIF4H Hsp70 Heat shock 0 Relative Hsp70 signal NucleusCytoplasm

Fig. 5. HSF1 activation drives LNPS. (A) LNPS in cells pretreated with 100 μM DRB for 15 min. (B) LNPS signal in siRNA-mediated HSF1-depleted thermal- stressed cells, (C) quantified by ImageJ. (D) Gene ontology (GO) enrichment analysis of RNA sequencing performed on purified amyloid bodies. P values are included for each GO term. (E) List of qPCR-validated mature mRNAs enriched in amyloid bodies from thermal-stressed cells. (F) RNA-FISH of Hsp70 mRNA signal, sensitive to KRIBB11 and RNase treatment. (G) RNA-FISH of Hsp70 mRNA following rIGSRNA depletion. (H) IF of endogenous Hsp70 in rIGSRNA- depleted thermal-stressed cells, (I) quantified by ImageJ. (J) IF of eIF4H in HSF1-depleted thermal-stressed. (K) HSF1 depletion impairs PLA signal of Rps26 and puromycin in thermal-stressed cells. (Scale bars: 5 μm.) Pixel intensity values depicted are ×104. Error bars represent SEM. *P < 0.05.

Theodoridis et al. PNAS | 5of9 Local translation in nuclear condensate amyloid bodies https://doi.org/10.1073/pnas.2014457118 Downloaded by guest on September 24, 2021 biochemical reactions similar to their liquid-like counterparts and pathological settings such as development, cancer, and ischemic (11, 22, 27, 29). episodes that activate the HSR, among other adaptive pathways. The central dogma of eukaryotic biology is clear: DNA rep- Understanding the exact function of LNPS participants (e.g., eIF4H, lication and transcription are nuclear events while protein syn- eIF4B, etc.) and how mRNAs are targeted to amyloid bodies to drive thesis occurs in the cytoplasm (72). While this view is deeply translation will provide an exciting opportunity to further charac- entrenched in textbooks, it has undergone frequent challenges terize the nuclear protein synthesis machinery and the role of solid- over the past few decades by several groups reporting the exis- like condensates in coordinating biochemical reactions. tence of protein synthesis in the nucleus (47, 73–81). The rather provocative presence of several participants of the translational Materials and Methods apparatus in nucleoli has led investigators to propose the exis- Cell Culture and Reagents. Human cell lines purchased from the American tence of nuclear protein synthesis under certain conditions (81). Type Culture Collection were used in this study; i.e., MCF7, U87MG, and WI-38 Despite these studies, the “concept of nuclear translation has were propagated in Dulbecco’s Modified Eagle Media (DMEM) (HyClone) – engaged many but convinced few” as elegantly stated by Reid with 10% fetal bovine serum (Omega Scientific) and 1% penicillin and Nicchitta (ref. 82, p. 7). There are unanswered questions that streptomycin (HyClone). Cells were maintained at 37 °C in a 5% CO2 humidified incubator (normoxia neutral, NN). Cells were subjected to hypoxia have precluded the general acceptance of nuclear protein syn- (hypoxia neutral, HN) (1% O , 24 h, unless otherwise stated) at 37 °C in a 5% thesis (77, 83, 84); many of these questions have been resolved 2 CO2,N2-balanced, humidified H35 HypOxystation (HypOxygen). Cells were for local translation in axons (34, 85, 86). This study addresses subjected to hypoxia acidosis by culturing them in acidotic permissive media several of these concerns by identifying the following: 1) physi- in the hypoxic chamber. Cells were introduced to DMEM without bicar- ological contexts that enhance nuclear translation (e.g., anaero- bonate at pH 7.4. They were allowed to naturally acidify to a pH of ∼6.0 (∼30 bic fermentation); 2) key cytoplasmic ribosomal proteins and min). Cells were subjected to heat shock by translocation to a 5% CO2 hu- translation factors that relocalize to amyloid bodies to partici- midified incubator maintained at 43 °C and incubated there for a minimum pate in LNPS; 3) nuclear translating ribosomes with an in vitro of 2 h and maximum of 6 h. Thermal stress of 4 to 6 h was used for puro- assay that excludes the possibility of cytoplasmic contaminants mycin experiments in intact cells and localization of factors by immunoflu- (e.g., cytoplasmic puromycylated peptides); 4) the transcriptional orescence while 2 h heat shock was sufficient for all other experiments. For staining experiments, cells were grown on poly-L-lysine–coated coverslips response that drives nuclear protein synthesis (HSF1); and 5) (Neuvitro). Puromycin (ThermoFisher Scientific) was used at a final concen- inducible long noncoding RNA (rIGSRNA) that coordinate tration of 2 μM for the last 10 min of stimulus. 6′FAM-puromycin (Jena LNPS. We also note that similar results were obtained with Bioscience, Lot BM015-073) was used at a final concentration of 20 μMfor

cellular (emetine-treated) and in vitro puromycylation as well as 10 min at 4 °C, diluted in Polysome Buffer (50 mM Tris·HCl, 5 mM MgCl2, proximity ligation assays across many experimental conditions 25 mM KCl, ethylenediaminetetraacetic acid (EDTA)-free protease inhibitors, (e.g., depletion of rIGSRNA, eIF4H, HSF1, etc.). Since the half- 10 U/mL RNase out). Anisomycin (Sigma) and ampicillin (Sigma) were used at life of released puromycylated peptides is very short, the residual indicated competing molarities. Emetine (Sigma) was used at a final con- ribosome-bound puromycylated peptides may be easier to visu- centration of 200 μM and added 5 min prior to incubation with puromycin or alize, especially if concentrated in well-defined foci (e.g., amyloid 5 min prior to solubilization for in vitro FAM-puromycylation. Cyclo- hexamide (Sigma) was used at a final concentration of 0.2 mg/mL and added bodies) and as long as cells are treated with a denaturing fixative – 5 min prior to incubation with puromycin. Harringtonine (MedChemExpress) (e.g., methanol) for access to the puromycin epitope (45, 87 90). was used at a final concentration of 2 μg/mL while aurintricarboxylic acid A caveat of using a denaturing fixative is the possibility of gen- (Sigma) was used at a final concentration of 100 uM, both of which were erating false proximity between molecules. Nonetheless, silenc- added 20 min prior to incubation with puromycin. DRB (Sigma) was ad- ing of chromatin-associated rIGSRNA that blunts nuclear ministered 15 min prior to stimulus at a final concentration of 100 μM. RNase translation and proximity between LNPS participants/pur- (ThermoFisher Scientific) treatments of 100 μg/mL were used. KRIBB11 (EMD omycylated peptides with little effect on cytoplasmic protein Millipore) was used at a final concentration of 50 μM and added onto cells synthesis further highlights the nuclear origin of LNPS. Likewise, 30 min prior to heat shock. CCT251236 (Axon Medchem) was used at a final concentration of 200 nM, HSF1A (Axon Medchem) was used at a final con- treatment with DRB or depletion of HSF1 prevents the reloc- μ alization of LNPS participants to amyloid bodies and nuclear centration of 100 M, and 10058-F4 (Axon Medchem) was used at a final concentration of 100 μM, all three of which were added to cells 30 min prior puromycylation reactions. However, our experiments do not to heat shock. preclude that depletion of translation factors (e.g., eIF4H), HSF1, or rIGSRNA has an indirect effect on nuclear translation Immunocytochemistry. Cells were washed once with cold phosphate-buffered by altering the synthesis of LNPS participants in the cytoplasm. saline (PBS), then fixed on coverslips for 10 min in methanol, washed with Interestingly, electron microscopy has revealed that translation- PBS, and then permeabilized for 10 min using 0.5% Triton-X (in PBS). After competent nucleoli isolated from liver display the distinct fiber- wash, cells were blocked with 5% horse serum (in phosphate buffered saline like morphology (91) that characterizes amyloid bodies, consis- with tween [PBST]) for 30 min. Cells were incubated for 1 h at 37 °C or at 4 °C tent with the observation that these solid-like condensates are overnight in primary antibody (1:100) and washed and incubated with cor- present in many intact tissues (19). As prolonged exposure to responding secondary antibody (1:500) for 1 h at 37 °C. Cells were washed physiological stimuli is believed to inhibit major nuclear/cyto- three times for 10 min, and nuclei were stained using Hoescht 33258 plasmic trafficking pathways (92–97), it is conceivable that large (1:1,000, ThermoFisher Scientific) during the second wash. Cells were mounted on slides using Fluoromount and visualized and analyzed by preassembled ribosomes cannot be efficiently exported to the fluorescent microscopy with the BZ-X800 High-Resolution Imaging and cytoplasm. Likewise, nuclear import of proteins synthesized in Analysis System (Keyence). Excitation wavelengths were 334 nm/438 to the cytoplasm is impaired during stress. In these settings, it may 533 nm for Amylo-glo, 488 nm/509 to 529 nm for AlexaFluor 488 and be advantageous for stressed cells to simply import a few small anti–DIG-488, and 555 nm/569 to 589 nm for AlexaFluor 555 and Congo red. regulatory Rps/translation factors to complete the assembly of Images were uniformly adjusted to increase brightness/contrast with Pho- functional ribosomes and produce proteins specific for the nu- toshop CC (Adobe). To determine nuclear/cytoplasmic ratio, the corrected clear environment while guarding the genome against mis-folded total cell fluorescence was determined for both the nucleus and cytoplasm = – × cytoplasmic proteins. As such, our data agree with the local trans- using ImageJ (CTCF Integrated Density [area of selected cell mean = nucleus cytoplasm lation field and the necessity to synthesize and concentrate proteins fluorescence of background readings]) and compared CTCF /CTCF . The following primary antibodies were used (all 1:100): puromycin at specific subcellular coordinates under various conditions. (4G11) (Millipore, MABE342), calreticulin (Invitrogen, PA3-900), Rpl24 (Pro- The data shown here provide physiological and mechanistical teintech, 17082–1-AP), Rps26 (Proteintech, 14909–1-AP), Rpl7 (Proteintech, contexts that will serve as a seed for future work to better un- 14583–1-AP), Rpl27 (Proteintech, 14980–1-AP), RplP0 (Proteintech, 11290–2- derstand stress-induced LNPS. We envision that stress-resistant AP), Rps9 (Proteintech, 18215–1-AP), Rps3 (Proteintech, 66046–1-Ig), Rps6 local nuclear translation will play pivotal roles in several physiological (Cell Signaling, #2217), eIF4H (Cell Signaling, #3469), eIF4A1 (Abcam,

6of9 | PNAS Theodoridis et al. https://doi.org/10.1073/pnas.2014457118 Local translation in nuclear condensate amyloid bodies Downloaded by guest on September 24, 2021 ab31217), methionyl tRNA synthetase (MARS) (Abcam, ab50793), arginyl 66046–1-Ig), Rpl24 (Proteintech, 17082–1-AP), Rps26 (Proteintech, 14909–1- tRNA synthetase (Novus, NBP1-46148), lysyl tRNA synthetase (Abcam, AP), Cdc73 (ThermoFisher Scientific, PA5-26189), fibrillarin (Santa Cruz, sc- ab31532), eEF1E1 (Novus, H00009521-B01P), eIF1 (Proteintech, 14654–1- 25397), GAPDH (Santa Cruz, sc-47724), eIF4H (Cell Signaling, #3469), eIF4A1 AP), eIF2A (Proteintech, 11233–1-AP), eIF2α (Cell Signaling, #5324), eIF2D (Abcam, ab31217), Hsp40 (DNAJB1) (Proteintech, 13174–1-AP), Hsp70 n-term (Proteintech, 12840–1-AP), eIF2S1 (Abcam, ab32157), eIF3D (Abcam, (Aviva, ARP74952_P050), eIF2A (Proteintech, 11233–1-AP), eIF4A2 (Proteintech, ab155419), eIF3E (Abcam, ab36766), eIF3F (Abcam, ab64177), eIF3K (Santa 11280–1-AP), eIF4B (Novus, NB100-93308), eIF5A1 (Abcam, ab32443), eIF5A2 Cruz, sc-81262), eIF4A2 (Proteintech, 11280–1-AP), eIF4A3 (Proteintech, (ThermoFisher Scientific, PA5-30770), HSF1 (Santa Cruz, sc-17757), METTL3 17504–1-AP), eIF4B (Novus, NB100-93308), eIF4E1 (Abcam, ab1126), (Proteintech, 15073–1-AP), and YTHDF2 (Proteintech, 24744–1-AP). Amyloid- eIF4E2 (Genetex, GTX103977), eIF4E3 (Proteintech, 17282–1-AP), eIF4G1 body purification for immunoblotting was performed as previously reported (Novus, NB100-268), eIF4G2 (Cell Signaling, #5169), eIF4G3 (Genetex, by Audas et al. (19). GTX118109), eIF5 (Santa Cruz, sc-135894), eIF5A1 (Abcam, ab32443), eIF5A2 (ThermoFisher Scientific, PA5-30770), eIF5B (Santa Cruz, sc- Amylo-Glo Staining. Cells were washed with cold PBS and fixed with 4% 393564), eIF6 (Santa Cruz, sc-390432), B23 (Santa Cruz, sc-32256), Cdc73 formaldehyde for 10 min. Cells were washed with PBS and permeabilized (ThermoFisher Scientific, PA5-26189), Hsp70 (Santa Cruz, sc-66048), and with 0.5% Triton-X (in PBS) for 5 min. After 2 min of still incubation with Hsp70 n-term (Aviva, ARP74952_P050). nuclease-free water, cells were incubated with Amylo-glo (1:100, Biosensis) in 0.9% saline for 10 min. Following 15 s of rinsing with nuclease-free water, Immunocytochemistry: Puromycin Assay in Intact Cells. Cells grown on cov- coverslips were mounted with 5% glycerol and sealed with varnish. erslips were treated with emetine at a final concentration of 200 μM5min prior to the dropwise addition of puromycin per each condition. After Congo Red Staining. Cells were fixed with 4% formaldehyde for 10 min and 10 min of puromycin treatment, cells were washed once with cold PBS. then permeabilized with 0.5% Triton for 10 min. Cells were washed with PBS Fixation was achieved with a 10-min incubation of cold methanol which acts and then stained with Hoescht 33258 (1:1,000) for 10 min. Cells were washed by dehydrogenation and protein precipitation and can reveal the pur- with ddH20 and then incubated with Congo Red solution (3.5 mM Congo Red, omycylated peptides that would otherwise be sterically hidden in translating 0.5 M NaCl, 80% EtOH) for 15 min, washed three times with ddH20, and ribosomes. Cells were washed with PBS and then permeabilized for 10 min mounted with 5% glycerol for visualization. using 0.5% Triton-X (in PBS). After wash, cells were blocked with 5% horse serum (in PBST) for 30 min, and antibody staining was performed as Proximity Ligation Assay. Cells were grown at basal conditions or heat described above. shocked for 4 h. For siRNA experiments, cells were heat shocked for 2 h. Emetine was added 15 min prior to the end of treatment. At 10 min prior to In Vitro 6′FAM-Puromycin Assay. Cells grown on coverslips were removed from the end of treatment, puromycin was added. At the end of treatment, cells each condition and washed with cold polysome buffer (50 mM Tris·HCl, 5 mM were washed in PBS, fixed in cold methanol for 10 min, and permeabilized MgCl , 25 mM KCl, EDTA-free protease inhibitors, 10 U/mL RNase out). From 2 with 0.5% Triton X in PBS. Cells were probed with antibodies for eIF4h, eIFA1, this point onward, the assay was performed at 4 °C, a temperature at which CELL BIOLOGY Rps3, and Rps26, and puromycin. For negative control experiments, samples few nascent chains are released (51, 53, 54). Cells were incubated for 15 min were incubated without puromycin antibody. For in vitro PLA, cells were with permeabilization buffer (50 mM Tris·HCl, 5 mM MgCl , 25 mM KCl, 2 prepared as outlined in Fig. 1B. Primary antibody incubation was 16 h at 4 °C, EDTA-free protease inhibitors, 10 U/mL RNase out, 0.1% Nonidet P-40) and and PLA was performed according to Duolink In Situ PLA protocol. The then washed gently with polysome buffer twice. Cells were incubated for following reagents used were: DUO92005-30RXN Duolink In Situ PLA Probe 10 min with 20 uM 6′FAM-puromycin (Jena Bioscience, Lot BM015-073) di- Anti-Rabbit MINUS, DUO92001-30RXN Duolink In Situ PLA Probe Anti- luted in polysome buffer in a light-protected manner. Cells were washed 3× Mouse PLUS, DUO92008-30RXN Duolink In Situ Detection Reagents Red, with polysome buffer and fixed with 1% formaldehyde for 10 min. Cells DUO82049-4L Duolink In Situ Wash Buffers, fluorescence, and DUO82040- were washed with polysome buffer again, stained with Hoescht 33258, and 5ML Duolink In Situ Mounting Medium with DAPI. mounted for visualization as described above.

RNA Interference and Transfections. Target-specific pools of four independent Propidium Iodide and Fluorescein Diacetate Staining. Live cells were incubated siRNA species (siGENOME SMARTpool, Dharmacon) were purchased for most with final concentration of 1 μg/mL each of propidium iodide, fluorescein targets. siRNAs against rIGSRNA were constructed by ThermoFisher Scien- diacetate, and Hoescht 33342 (ThermoFisher Scientific) for 30 min at 37 °C tific. siRNAs (100 pmol) were reverse-transfected using RNAiMAX (Thermo and washed twice with media before imaging by fluorescence microscopy. Fisher Scientific) and treated/harvested 48 h post transfection. Cell counting was done manually or via ImageJ for viability measurements.

MS-SILAC. For each condition shown, MCF‐7 cells were grown in stable iso- Nuclear/Cytoplasmic Extraction. Cells were washed with cold PBS and har- ‐ vested in PBS and then kept on ice for the remaining procedure. Micro- tope labeling with amino acids in cell culture (SILAC) labeling media, amy- ‐ – centrifuge tubes containing harvested cells were centrifuged briefly for 5 to loid body containing fractions were purified, and samples were analyzed by 10 s at 10,000 × g to pellet cells. Supernatant was removed, and cells were mass spectrometry (MS) following previously described protocols. MS data- resuspended in cold PBS containing 0.1% Nonidet P-40 and then triturated sets have been published in Audas et al. (19) and Marijan et al. (24). Raw five times on ice with a P1000 pipette tip. A fraction of this solution was set ratios were used for the proteomic output analysis of ribosomal proteins in aside as whole-cell lysate. Remaining cell suspension was centrifuged briefly nucleoli versus amyloid bodies from heat-shocked or acidotic cells, one-fold for 5 to 10 s at 10,000 × g. A portion of the supernatant was set aside as enrichment signifying no change between basal and stress treatment. cytoplasmic fraction. The remaining supernatant was discarded, removing drops with an extended-length P100 pipette tip. Pellet was resuspended in RNA Sequencing. Cells were either grown at basal conditions or heat shocked PBS containing 0.1% Nonidet P-40 and then centrifuged briefly for 5 to 10 s for 1 h. Plates were then washed with PBS, and cells were harvested in cold × at 10,000 × g. Supernatant was discarded, removing drops with an solution 1 (0.5 M sucrose, 3 mM MgCl2) and sonicated for 6 10 s using a extended-length P100 pipette tip. Nuclear pellet was washed three times microtip probe. Samples were then underlaid with cold solution 2 (1 M su- × with cold PBS and then resuspended in Ripa buffer (ThermoFisher Scientific). crose, 3 mM MgCl2) and centrifuged at 2,800 g for 10 min at 4 °C. Pellets Nuclear fractions were sheared with 25-g needles (BD) and centrifuged at were resuspended in PBS, and a fraction of each sample was used to de- maximum speed for 10 min to remove DNA. termine proper isolation of nucleoli and amyloid bodies by microscopic evaluation. Remaining resuspended samples were then used for RNA Immunoblot. Sodium dodecyl sulfate/polyacrylamide gel electrophoresis was isolation with TRIzol reagent (Invitrogen) and submitted for total RNA performed on Bolt 4 to 12% Bis-Tris Plus premade gels (ThermoFisher Sci- sequencing. entific) using the Mini Gel Tank system (ThermoFisher Scientific) and trans- ferred to 0.2- μm Immuno-Blot PVDF membranes (Bio-Rad) using the Bolt qRT-PCR. First-strand complementary DNA (cDNA) synthesis was performed Mini Blot Module (ThermoFisher Scientific), all according to the manufac- with the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Sci- turer’s protocols. Chemiluminescent signals were detected using SuperSignal entific), according to the manufacturer’s protocols. qRT-PCR was performed West Pico PLUS chemiluminescent substrate (ThermoFisher Scientific) on an using the PowerUp SYBR Green Master Mix (Thermo Fisher Scientific) and a Amersham Imager 600 (G9E Healthcare Life Sciences). Primary antibodies StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). Relative used (all 1:1,000) were the following: puromycin (Kerafast, EQ0001), calre- changes in expression were calculated using the comparative Ct (ΔΔCt) ticulin (Invitrogen, PA3-900), β-actin (Santa Cruz, sc-47778), Rps3 (Proteintech, method. Primer sequences are available upon request.

Theodoridis et al. PNAS | 7of9 Local translation in nuclear condensate amyloid bodies https://doi.org/10.1073/pnas.2014457118 Downloaded by guest on September 24, 2021 Fluorescent In Situ Hybridization. FISH was performed with 5′ and 3′ digox- (SEM) between repeats. Appropriate statistical analyses were performed igenin (DIG)-labeled oligonucleotides. Following 30 min fixation, 0.1 M (e.g., Student’s t test), while significance was defined as P < 0.05. Tris·HCl, pH 7.0 was added to cells for 10 min before ± Proteinase K treatment (NEB, 800 U/mL stock, 100,000× dilution) at 37 °C for 30 min. Cells were Data Availability. RNA-sequencing data have been deposited in the Gene × – equilibrated in 2 saline sodium citrate buffer (SSC) before overnight hybrid- Expression Omnibus database (accession no. GSE164846) (98). ization at 37 °C. Probes (10 pmol) were denatured at 85 °C for 10 min. Hybrid- ization buffer was 15% formamide, 10% dextran sulfate, 2 mM vanadyl ACKNOWLEDGMENTS. We thank Dr. Mekhail (University of Toronto) for × – ribonucleoside, and 2 SSC. Probes were detected with an anti DIG-flourescin critically reviewing this paper; Dr. Xianzun Tao for technical help; and Dr. μ × antibody (Sigma, 11207750910) at 20 g/L in 4 SSC. Slides were mounted in 90% Siôn L. Williams and the Sylvester Comprehensive Cancer Center (SCCC) glycerol. The following RNA-FISH probes were used: Hsp70 (TGCTGAAACACG- Oncogenomics Core Facility for RNA-sequencing services. S.L. is funded by CCCACGCACGAGTAGGTGGTGCCCAGGTCGATGCCCAC) and HspA1A (GACAAC- grants from the NIH (National Institute of General Medical Sciences Grant GGGAGTCACTCT CGAAAAAGGTAGTGGACTGTCGCAGCAGCTCC). 1R01GM115342 and National Cancer Institute Grant 1R01CA200676) and the SCCC. T.E.A. is funded by the Canadian Institute of Health Research (PJT‐ Statistical Analysis. All experiments were performed at least two independent 162364) and Natural Sciences and Engineering Research Council (RGPIN/ times, unless otherwise stated. Quantitation of microscopy-based data was 04998‐2017). T.E.A. acknowledges the kind support of the Canada Research performed using ImageJ on at least three representative images. Graphs Chairs program for a Tier II Canada Research Chair in Functional RNA and Cellular represent mean values, and error bars depicted represent SD of the mean Stress. N.C.B. is the recipient of NIH F30 Fellowship Grant CA243268-01.

1. L. Galluzzi, T. Yamazaki, G. Kroemer, Linking cellular stress responses to systemic 30. H. A. Lashuel, R. V. Pappu, Amyloids go genomic: Insights regarding the sequence homeostasis. Nat. Rev. Mol. Cell Biol. 19, 731–745 (2018). determinants of prion formation from genome-wide studies. ChemBioChem 10, 2. G. L. Semenza, Oxygen sensing, homeostasis, and disease. N. Engl. J. Med. 365, 1951–1954 (2009). 537–547 (2011). 31. E. Boke et al., Amyloid-like self-assembly of a cellular compartment. Cell 166, 637–650 3. C. Corbet, O. Feron, Tumour acidosis: From the passenger to the driver’s seat. Nat. (2016). Rev. Cancer 17, 577–593 (2017). 32. P. K. Sahoo, D. S. Smith, N. Perrone-Bizzozero, J. L. Twiss, Axonal mRNA transport and 4. C. Corbet et al., Acidosis drives the reprogramming of fatty acid metabolism in cancer translation at a glance. J. Cell Sci. 131, jcs196808 (2018). cells through changes in mitochondrial and histone acetylation. Cell Metab. 24, 33. H. Jung, B. C. Yoon, C. E. Holt, Axonal mRNA localization and local protein synthesis in 311–323 (2016). nervous system assembly, maintenance and repair. Nat. Rev. Neurosci. 13, 308–324 5. M. Khacho et al., Acidosis overrides oxygen deprivation to maintain mitochondrial (2012). function and cell survival. Nat. Commun. 5, 3550 (2014). 34. C. E. Holt, K. C. Martin, E. M. Schuman, Local translation in neurons: Visualization and 6. K. A. Spriggs, M. Bushell, A. E. Willis, Translational regulation of gene expression function. Nat. Struct. Mol. Biol. 26, 557–566 (2019). during conditions of cell stress. Mol. Cell 40, 228–237 (2010). 35. L. Davis, P. Dou, M. DeWit, S. B. Kater, Protein synthesis within neuronal growth 7. V. Cherkasov et al., Coordination of translational control and protein homeostasis cones. J. Neurosci. 12, 4867–4877 (1992). during severe heat stress. Curr. Biol. 23, 2452–2462 (2013). 36. P. B. Crino, J. Eberwine, Molecular characterization of the dendritic growth cone: – 8. S. Lindquist, The heat-shock response. Annu. Rev. Biochem. 55, 1151–1191 (1986). Regulated mRNA transport and local protein synthesis. Neuron 17, 1173 1187 (1996). 9. K. Richter, M. Haslbeck, J. Buchner, The heat shock response: Life on the verge of 37. C. E. Holt, E. M. Schuman, The central dogma decentralized: New perspectives on RNA – death. Mol. Cell 40, 253–266 (2010). function and local translation in neurons. Neuron 80, 648 657 (2013). 10. R. Gomez-Pastor, E. T. Burchfiel, D. J. Thiele, Regulation of heat shock transcription 38. J. Dodd, S. B. Morton, D. Karagogeos, M. Yamamoto, T. M. Jessell, Spatial regulation factors and their roles in physiology and disease. Nat. Rev. Mol. Cell Biol. 19,4–19 of axonal glycoprotein expression on subsets of embryonic spinal neurons. Neuron 1, – (2018). 105 116 (1988). 11. S. F. Banani, H. O. Lee, A. A. Hyman, M. K. Rosen, Biomolecular condensates: Orga- 39. M. R. Khan et al., Amyloidogenic oligomerization transforms Drosophila Orb2 from a translation repressor to an activator. Cell 163, 1468–1483 (2015). nizers of cellular biochemistry. Nat. Rev. Mol. Cell Biol. 18, 285–298 (2017). 40. Z. Liang et al., The pseudokinase CaMKv is required for the activity-dependent 12. J. M. Choi, A. S. Holehouse, R. V. Pappu, Physical principles underlying the complex maintenance of dendritic spines. Nat. Commun. 7, 13282 (2016). biology of intracellular phase transitions. Annu. Rev. Biophys. 49, 107–133 (2020). 41. M. I. Bak, J. S. Ingwall, Acidosis during ischemia promotes adenosine triphosphate 13. Y. Shin, C. P. Brangwynne, Liquid phase condensation in cell physiology and disease. resynthesis in postischemic rat heart. In vivo regulation of 5′-nucleotidase. J. Clin. Science 357, eaaf4382 (2017). Invest. 93,40–49 (1994). 14. S. C. Weber, C. P. Brangwynne, Getting RNA and protein in phase. Cell 149, 1188–1191 42. M. Anderson, A. Moshnikova, D. M. Engelman, Y. K. Reshetnyak, O. A. Andreev, (2012). Probe for the measurement of cell surface pH in vivo and ex vivo. Proc. Natl. Acad. Sci. 15. J. Lippincott-Schwartz, N. Altan-Bonnet, G. H. Patterson, Photobleaching and pho- U.S.A. 113, 8177–8181 (2016). toactivation: Following protein dynamics in living cells. Nat. Cell Biol. (suppl.):S7–S14 43. B. D. Hobson, L. Kong, E. W. Hartwick, R. L. Gonzalez, P. A. Sims, Elongation inhibitors (2003). do not prevent the release of puromycylated nascent polypeptide chains from ribo- 16. A. Németh, I. Grummt, Dynamic regulation of nucleolar architecture. Curr. Opin. Cell somes. eLife 9, e60048 (2020). Biol. 52, 105–111 (2018). 44. S. U. Enam et al., Puromycin reactivity does not accurately localize translation at the 17. R. D. Phair, T. Misteli, High mobility of proteins in the mammalian cell nucleus. Nature subcellular level. eLife 9, e60303 (2020). 404, 604–609 (2000). 45. R. Aviner, The science of puromycin: From studies of ribosome function to applica- 18. S. C. Weber, Sequence-encoded material properties dictate the structure and function tions in biotechnology. Comput. Struct. Biotechnol. J. 18, 1074–1083 (2020). – of nuclear bodies. Curr. Opin. Cell Biol. 46,62 71 (2017). 46. J. J. Langille, K. Ginzberg, W. S. Sossin, Polysomes identified by live imaging of nascent 19. T. E. Audas et al., Adaptation to stressors by systemic protein amyloidogenesis. Dev. peptides are stalled in hippocampal and cortical neurites. Learn. Mem. 26, 351–362 – Cell 39, 155 168 (2016). (2019). 20. T. E. Audas, M. D. Jacob, S. Lee, Immobilization of proteins in the nucleolus by ri- 47. A. David et al., Nuclear translation visualized by ribosome-bound nascent chain – bosomal intergenic spacer noncoding RNA. Mol. Cell 45, 147 157 (2012). puromycylation. J. Cell Biol. 197,45–57 (2012). 21. M. Wang et al., Stress-induced low complexity RNA activates physiological amyloi- 48. M. B. Yarmolinsky, G. L. Haba, Inhibition by puromycin of amino acid incorporation – dogenesis. Cell Rep. 24, 1713 1721.e1714 (2018). into protein. Proc. Natl. Acad. Sci. U.S.A. 45, 1721–1729 (1959). 22. M. Wang, M. Bokros, P. R. Theodoridis, S. Lee, Nucleolar sequestration: Remodeling 49. A. Nabbi, K. Riabowol, Rapid isolation of nuclei from cells in vitro. Cold Spring Harb. nucleoli into amyloid bodies. Front. Genet. 10, 1179 (2019). Protoc. 2015, 769–772 (2015). 23. M. D. Jacob, T. E. Audas, J. Uniacke, L. Trinkle-Mulcahy, S. Lee, Environmental cues 50. M. W. Nirenberg, J. H. Matthaei, The dependence of cell-free protein synthesis in induce a long noncoding RNA-dependent remodeling of the nucleolus. Mol. Biol. Cell E. coli upon naturally occurring or synthetic polyribonucleotides. Proc. Natl. Acad. Sci. 24, 2943–2953 (2013). U.S.A. 47, 1588–1602 (1961). 24. D. Marijan et al., Stress-specific aggregation of proteins in the amyloid bodies. FEBS 51. A. David, J. R. Bennink, J. W. Yewdell, Emetine optimally facilitates nascent chain Lett. 593, 3162–3172 (2019). puromycylation and potentiates the ribopuromycylation method (RPM) applied to 25. K. Mekhail et al., Regulation of ubiquitin ligase dynamics by the nucleolus. J. Cell Biol. inert cells. Histochem. Cell Biol. 139, 501–504 (2013). 170, 733–744 (2005). 52. S. R. Starck, H. M. Green, J. Alberola-Ila, R. W. Roberts, A general approach to detect 26. K. Mekhail et al., Identification of a common subnuclear localization signal. Mol. Biol. protein expression in vivo using fluorescent puromycin conjugates. Chem. Biol. 11, Cell 18, 3966–3977 (2007). 999–1008 (2004). 27. J. B. Woodruff, A. A. Hyman, E. Boke, Organization and function of non-dynamic 53. S. Pestka, Inhibitors of ribosome functions. Annu. Rev. Microbiol. 25, 487–562 (1971). biomolecular condensates. Trends Biochem. Sci. 43,81–94 (2018). 54. G. Blobel, D. Sabatini, Dissociation of mammalian polyribosomes into subunits by 28. A. S. Holehouse, R. V. Pappu, Functional implications of intracellular phase transitions. puromycin. Proc. Natl. Acad. Sci. U.S.A. 68, 390–394 (1971). Biochemistry 57, 2415–2423 (2018). 55. J. L. Hansen, P. B. Moore, T. A. Steitz, Structures of five antibiotics bound at the 29. S. M. Lyons, P. Anderson, RNA-seeded functional amyloids balance growth and sur- peptidyl transferase center of the large ribosomal subunit. J. Mol. Biol. 330, vival. Dev. Cell 39, 131–132 (2016). 1061–1075 (2003).

8of9 | PNAS Theodoridis et al. https://doi.org/10.1073/pnas.2014457118 Local translation in nuclear condensate amyloid bodies Downloaded by guest on September 24, 2021 56. M. Sugita, T. Morita, T. Yonesaki, Puromycin induces apoptosis of developing chick 77. J. Dahlberg, E. Lund, Nuclear translation or nuclear peptidyl transferase? Nucleus 3, sympathetic neurons in a similar manner to NGF-deprivation. Zool. Sci. 12, 419–425 320–321 (2012). (1995). 78. F. J. Iborra, D. A. Jackson, P. R. Cook, Coupled transcription and translation within 57. E. Thomson, S. Ferreira-Cerca, E. Hurt, Eukaryotic ribosome biogenesis at a glance. nuclei of mammalian cells. Science 293, 1139–1142 (2001). J. Cell Sci. 126, 4815–4821 (2013). 79. M. L. Birnstiel, W. G. Flamm, Intranuclear site of histone synthesis. Science 145, 58. S. K. Natchiar, A. G. Myasnikov, H. Kratzat, I. Hazemann, B. P. Klaholz, Visualization of 1435–1437 (1964). chemical modifications in the human 80S ribosome structure. Nature 551, 472–477 80. M. L. Birnstiel, B. B. Hyde, Protein synthesis by isolated pea nucleoli. J. Cell Biol. 18, (2017). 41–50 (1963). 59. S. Klinge, J. L. Woolford Jr, Ribosome assembly coming into focus. Nat. Rev. Mol. Cell 81. T. Pederson, J. C. Politz, The nucleolus and the four ribonucleoproteins of translation. – Biol. 20, 116–131 (2019). J. Cell Biol. 148, 1091 1095 (2000). 60. S. Penman, I. Smith, E. Holtzman, Ribosomal RNA synthesis and processing in a par- 82. D. W. Reid, C. V. Nicchitta, The enduring enigma of nuclear translation. J. Cell Biol. – ticulate site in the HeLa cell nucleus. Science 154, 786–789 (1966). 197,7 9 (2012). 61. K. Karbstein, Quality control mechanisms during ribosome maturation. Trends Cell 83. L. Nathanson, T. Xia, M. P. Deutscher, Nuclear protein synthesis: A re-evaluation. RNA – Biol. 23, 242–250 (2013). 9,9 13 (2003). 62. M. Fresno, A. Jiménez, D. Vázquez, Inhibition of translation in eukaryotic systems by 84. J. W. Yewdell, A. David, Nuclear translation for immunosurveillance. Proc. Natl. Acad. – harringtonine. Eur. J. Biochem. 72, 323–330 (1977). Sci. U.S.A. 110, 17612 17613 (2013). 63. D. Vazquez, Inhibitors of protein synthesis. FEBS Lett. 40(suppl.), S63–S84 (1974). 85. D. H. Ebert, M. E. Greenberg, Activity-dependent neuronal signalling and autism – 64. N. J. Richter-Cook, T. E. Dever, J. O. Hensold, W. C. Merrick, Purification and charac- spectrum disorder. Nature 493, 327 337 (2013). 86. J. E. Grotzke, P. Cresswell, Are ERAD components involved in cross-presentation? Mol. terization of a new eukaryotic protein translation factor. Eukaryotic initiation factor Immunol. 68, 112–115 (2015). 4H. J. Biol. Chem. 273, 7579–7587 (1998). 87. S. tom Dieck et al., Direct visualization of newly synthesized target proteins in situ. 65. A. David et al., RNA binding targets aminoacyl-tRNA synthetases to translating ri- Nat. Methods 12, 411–414 (2015). bosomes. J. Biol. Chem. 286, 20688–20700 (2011). 88. U. Schubert et al., Rapid degradation of a large fraction of newly synthesized proteins 66. S. Kose, M. Furuta, N. Imamoto, Hikeshi, a nuclear import carrier for Hsp70s, protects by proteasomes. Nature 404, 770–774 (2000). cells from heat shock-induced nuclear damage. Cell 149, 578–589 (2012). 89. S. W. Ha, D. Ju, W. Hao, Y. Xie, Rapidly translated polypeptides are preferred sub- 67. E. Koenig, P. Adams, Local protein synthesizing activity in axonal fields regenerating strates for cotranslational protein degradation. J. Biol. Chem. 291, 9827–9834 (2016). in vitro. J. Neurochem. 39, 386–400 (1982). 90. A. L. Goldberg, Degradation of abnormal proteins in Escherichia coli (protein 68. R. D. Frankel, E. Koenig, Identification of major indigenous protein components in breakdown-protein structure-mistranslation-amino acid analogs-puromycin). Proc. mammalian axons and locally synthesized axonal protein in hypoglossal nerve. Exp. Natl. Acad. Sci. U.S.A. 69, 422–426 (1972). Neurol. 57, 282–295 (1977). 91. R. Maggio, P. Siekevitz, G. E. Palade, Studies on isolated nuclei. II. Isolation and 69. A. Biever, P. G. Donlin-Asp, E. M. Schuman, Local translation in neuronal processes. chemical characterization of nucleolar and nucleoplasmic subfractions. J. Cell Biol. 18, – Curr. Opin. Neurobiol. 57, 141 148 (2019). 293–312 (1963). 70. S. Jagannathan, D. W. Reid, A. H. Cox, C. V. Nicchitta, De novo translation initiation on 92. S. H. Yoshimura, S. Otsuka, M. Kumeta, M. Taga, K. Takeyasu, Intermolecular disulfide membrane-bound ribosomes as a mechanism for localization of cytosolic protein bonds between nucleoporins regulate karyopherin-dependent nuclear transport. – mRNAs to the endoplasmic reticulum. RNA 20, 1489 1498 (2014). J. Cell Sci. 126, 3141–3150 (2013).

71. O. Hermesh, R. P. Jansen, Take the (RN)A-train: Localization of mRNA to the endo- 93. Y. Miyamoto et al., Cellular stresses induce the nuclear accumulation of importin CELL BIOLOGY – plasmic reticulum. Biochim. Biophys. Acta 1833, 2519 2525 (2013). alpha and cause a conventional nuclear import block. J. Cell Biol. 165, 617–623 (2004). – 72. F. Crick, Central dogma of molecular biology. Nature 227, 561 563 (1970). 94. M. Kodiha, P. Banski, D. Ho-Wo-Cheong, U. Stochaj, Dissection of the molecular 73. K. Al-Jubran et al., Visualization of the joining of ribosomal subunits reveals the mechanisms that control the nuclear accumulation of transport factors importin- presence of 80S ribosomes in the nucleus. RNA 19, 1669–1683 (2013). alpha and CAS in stressed cells. Cell. Mol. Life Sci. 65, 1756–1767 (2008). 74. V. G. Allfrey, Amino acid incorporation by isolated thymus nuclei. I. The role of des- 95. J. B. Kelley, B. M. Paschal, Hyperosmotic stress signaling to the nucleus disrupts the oxyribonucleic acid in protein synthesis. Proc. Natl. Acad. Sci. U.S.A. 40, 881–885 Ran gradient and the production of RanGTP. Mol. Biol. Cell 18, 4365–4376 (2007). (1954). 96. M. Furuta et al., Heat-shock induced nuclear retention and recycling inhibition of 75. V. G. Allfrey, A. E. Mirsky, Protein synthesis in isolated cell nuclei. Nature 176, importin alpha. Genes Cells 9, 429–441 (2004). 1042–1049 (1955). 97. S. Datta, C. J. Snow, B. M. Paschal, A pathway linking oxidative stress and the Ran 76. S. Apcher et al., Translation of pre-spliced RNAs in the nuclear compartment gener- GTPase system in progeria. Mol. Biol. Cell 25, 1202–1215 (2014). ates peptides for the MHC class I pathway. Proc. Natl. Acad. Sci. U.S.A. 110, 98. X. Tao, M. Wang, S. Lee, RNA-sequencing. Gene Expression Omnibus. https://www. 17951–17956 (2013). ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE164846. Deposited 14 January 2021.

Theodoridis et al. PNAS | 9of9 Local translation in nuclear condensate amyloid bodies https://doi.org/10.1073/pnas.2014457118 Downloaded by guest on September 24, 2021