Characterization of Nedd4 Function and its Interaction with Angiomotin
by
Madhvi Nath
A thesis submitted in conformity with the requirements for the degree of Master of Science Graduate Department of Biochemistry University of Toronto
© Copyright by Madhvi Nath 2014 Characterization of Nedd4 Function and its Interaction with Angiomotin
Madhvi Nath Master of Science Department of Biochemistry University of Toronto 2014
Abstract
The HECT E3 ubiquitin ligase Nedd4-1 was previously shown to regulate diverse processes such as cell and animal growth, insulin signaling, and lysosomal trafficking. To further elucidate the cellular functions of Nedd4-1, Nedd4-1 knockout mouse embryonic fibroblasts were characterized relative to their wild type counterparts. Immunofluorescence experiments revealed an altered lysosomal distribution in the knockout cells, although their lysosomal proteolytic function appeared normal. Transmission Electron Microscopy revealed striking morphological differences, especially regarding the lysosome and endoplasmic reticulum of the knockout cells. Another aspect of my studies examined the interaction between Nedd4-1 and Angiomotin (p130-AMOT), which involves the same motifs required to sequester transcriptional co-activators YAP and TAZ in the cytoplasm. To test either a competitive or non-competitive mode of binding, co-immunoprecipitation experiments involving p130-AMOT, the Nedd4 proteins, and YAP or TAZ were performed, with results not supporting a competitive mode of interaction. Overall, my results demonstrate new
Nedd4-1 cellular functions.
ii Acknowledgements
Firstly and foremost, I would like to thank my supervisor Dr. Daniela Rotin for her guidance and encouragement throughout the past few years. Your knowledge and enthusiasm for Science know no bounds. I would also like to thank my committee members, Dr. Allen
Volchuk and Dr. Vuk Stambolic, for their suggestions and guidance throughout my studies.
I would also like to thank the past and present members of the Rotin Lab for all of their support and really making the lab a welcoming place to come in everyday. Thanks to
Dr. Philipp Alberts and Dr. Avinash Persaud for introducing me to all of the Cell Biology techniques I used in my studies. To Chong, Ruth, and Wioletta for always pointing me in the right direction. I will continue to covet the friendship and support I have received here.
iii Table of Contents
Abstract ii Acknowledgements iii Table of Contents iv List of Tables vii List of Figures viii Abbreviations x
Chapter 1: Introduction 1
Par t A: Characterization of Nedd4-1 knockout (KO) mouse embryonic fibroblasts 2 (MEFs)
1. Ubiquitin- Proteasome System 2 2. The Nedd4 Family of HECT E3 Ligases 5 3. Functions of Nedd4 Family Members 5 4. Studies on Nedd4-1 Knockout (KO) MEFs 8 A) Observations in the Nedd4-1 KO MEFs 8 B) Grb10, insulin signaling and Nedd4-1 9 C) Grb10 and mTORC1 10 5. Other Functions of Nedd4-1 14 A) Examples of other, known binding partners of Nedd4-1 14 B) Nedd4-1 Interaction with Angiomotin 15
Part B: Nedd4-1 interaction with Angiomotin 15
1. Discovery and Structure of Angiomotin (AMOT) 15 2. Functions of AMOT 18 A) AMOT in Junctional Integrity 18 B) Angiomotin in Development 18 C) Regulation of Ras/MAPK signaling by Angiomotin 19 3. Differences between the p130 and p80 isoforms of Angiotmotin 19 4. The Hippo Signalling Pathway 20 5. Angiomotin in Hippo Signalling 23 A) p130-AMOT Interacts with YAP and TAZ 23 B) YAP and TAZ Function 23 6. p130 AMOT interaction with Nedd4-1 and Nedd4-2 26 7. Nedd4 family of E3 ligases in Hippo Signalling 26
Rationale and Hypotheses 28
iv Chapter 2: Methods and Materials 29
Par t A: Characterization of Nedd4-1 knockout (KO) mouse embryonic 30 fibroblasts (MEFs)
1. Cell Culture 30 2. Immunofluorescence 30 A) Fixation 30 B) Immunostaining 30 C) Imaging 31 3. Immunoblot Analysis 32 4. DQ BSA Proteolysis Assay - Live Immunofluorescence Imagining 33 5. Tranmission Electron Microscopy of MEFs 34
Part B: Nedd4-1 interaction with Angiomotin 34
1. Cell Culture 34 2. Mutagenesis 34 3. Cloning and Plasmids 35 4. Transfection 35 5. Immunoprecipitation 35
Chapter 3: Results 38
Par t A: Characterization of Nedd4-1 knockout (KO) mouse embryonic 39 fibroblasts (MEFs)
1. Grb10 is increased in the Nedd4-1 KO MEFs 39 2. Lysosomes have altered distribution in the Nedd4-1 KO MEFS 41 3. mTORC1 signalling is not overactive in Nedd4-1 KO MEFs (in 43 response to amino acid restimulation) 4. Lysosomes from the Nedd4-1 KO MEFs have normal proteolytic 47 activity 5. Morphological Differences between the Nedd4-1 WT and KO MEFs 50 analyzed by EM 6. Comparing Levels of ER Stress Markers in Nedd4-1 KO MEFs 53 relative to WT MEFs 7. There are Lower Levels of Rac1 protein in the Nedd4-1 KO MEFs 55
Part B: Nedd4-1 interaction with Angiomotin 57
1. AMOT and Nedd4-1 interact in HEK293T cells 57 2. Nedd4-1 knockdown in HEK293T results in an increase of 59 endogenous AMOT levels
v 3. Interaction with Nedd4-1 is abrogated when Angiomotin's three PY 61 motifs are mutated 4. AMOT interacts with Nedd4-1 and Nedd4-1 in HeLa cells 63 5. Increased ubiquitination of Angiomotin in the presence of Nedd4-1 65 and Nedd4-2 in HeLa cells. 6. Nedd4-1 and Nedd4-2 do not disrupt the interactions of Angiomotin 68 with TAZ in HeLa cells 7. The introduction of Nedd4s does not disrupt AMOT and YAP1 69 interaction
Chapter 4: Discussion 75
Part A: Characterization of the Nedd4-1 KO MEFs 76
Part B: Angiomotin (AMOT) and Nedd4-1 interactions 83
Future Directions 87 Conclusions 90 References 91
vi List of Tables
Chapter 1: Introduction
Table 1: Interactors of Nedd4-1 14
Chapter 2: Methods and Materials
Table 2: Mutagenesis Primers 34
vii List of Figures
Chapter 1: Introduction
Figure 1: The Ubiquitination Cascade Involving HECT or RING E3 3 Ligases
Figure 2: Nedd4 family of HECT E3 ligases 7
Figure 3: mTOR signalling pathway 12
Figure 4: mTORC1 Regulation of Grb10 stability 13
Figure 5: Domain Architecture of the Motin family 17
Figure 6: The Mammalian Hippo Signalling Cascade 22
Figure 7: Angiomotin's role in Hippo Signalling 25
Chapter 3: Results
Figure 8: Grb10 levels are elevated in the Nedd4-1 KO MEFs 40
Figure 9: Lysosomal Distribution is Altered in the Nedd4-1 KO MEFs 42
Figure 10: mTORC1 Signaling is Not Overactive in the Nedd4-1 KO 45 MEFs
Figure 11: DQ BSA Assay in the WT and Nedd4-1 KO MEFs 48
Figure 12: Transmission electron micrographs of both the Nedd4-1 WT 51 and KO MEFs
Figure 13: ER Stress Marker Comparison between WT and Nedd4-1 KO 54 MEFs
Figure 14: Decreased levels of Rac1 in the Nedd4-1 KO MEFs, relative 56 to WT
Figure 15: Validation of the Nedd4-1 and Angiomotin interaction 58
Figure 16: Nedd4-1 knock down leads to an increase in endogenous 60 Angiomotin levels
viii Figure 17: Mutation of AMOT's three PY motifs abrogates interaction 62 with Nedd4-1 and Nedd4-2
Figure 18: Nedd4-1 and AMOT interaction is Preserved in HeLa cells 64
Figure 19: In HeLa cells, Wild type Angiomotin ubiquitination increases 66 in the presence of Nedd4-1 and Nedd4-2
Figure 20: The introduction of V5-tagged Nedd4s does not disrupt the 70 interaction between FLAG-TAZ and HA-Angiomotin wild type
Figure 21: The introduction of Nedd4 variants does not disrupt binding 72 between Angiomotin and YAP1
Chapter 4: Discussion
Figure 22: Comparison of Nedd4-1 KO MEFs to Galactosialidosis Patient 80 Fibroblasts
Figure 23: Proposed models for AMOT interaction with Nedd4 and 84 YAP/TAZ
ix List of Abbreviations
4-MU-NANA 2-(4-Methylumbelliferyl)- α-D-N- acetylneuraminic acid
4eBP-1 eIF4E Binding-Protein 1
AIP4 Atrophin Interacting Protein 4 (Itch)
AMOT Angiomotin
AMOTL1 Angiomotin-like 1
AMOTL2 Angiomotin like-2
BPS (domain) Between Pleckstrin Homology and SH3
CF Cystic Fibrosis
CFTR Cystic Fibrosis Transmembrane Receptor
Comm. Commissureless
DAPI 4',6-diamidino-2-phenylindole
DMEM Dulbecco's Modified Essential Medium
DNedd4 Drosophila Nedd4
DQ BSA De-quenched Bovine Serum Albumin
DUBs De-ubiquitinating enzymes
Dvl1 Dishevelled 1 eIF2 α eukaryotic Initiation Factor 2 α eIF4E eukaryotic Initiation Factor 4E eIF4F eukaryotic Intiation Factor 4F
ENaC Epithelial Sodium Channel
ERAD Endoplasmic Reticulum-Associated Degradation
x FBS Fetal Bovine Serum
FGF Fibroblast Growth Factor
FGFR1 FIbroblast Growth Factor Receptor 1
Grb10 Growth Factor Receptor Bound 10
HECT Homologous to E6-AP Carboxy-Terminus
HEK293T cells Human Embryonic Kidney 293T cells
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
IGFR-1 Insulin-like growth factor receptor 1
IRS1 Insulin Receptor Substrate 1
KD Knock down
KO Knock out
LAMP1 Lysosomal-Associated Membrane Protein 1
LAPTM4 Lysosomal Protein Transmembrane 4
LAPTM5 Lysosomal Protein Transmembrane 5
LATS1/2 Large Tumour Suppressor Kinase 1/2
LSD Lysosomal Storage Disorder
MAE cells Mouse Aortic Endothelial Cells
MAPK Mitogen Activated Protein Kinase
MEFs Mouse Embryonic Fibroblasts
Merlin Moesin-Ezrin-Radixin-Like Protein, Neurofibromin 2 mTOR mammalian Target of Rapamycin
xi mTORC1 mammalian Target of Rapamycin Complex 1
NCC Na +/Cl - Co-transporter
Nedd4-1 Neural precursor cell expressed, developmentally down-regulated 4-1 p130-AMOT 130 kDa isoform of Angiomotin p80-AMOT 80 kDa isoform of Angiomotin pAKT phospho-Akt
Pals1 Protein Associted with Lin Seven 1
PBS Phosphate Buffered Saline
PFA Paraformaldehyde
PH (domain) Pleckstrin Homology
PI-3-K Phosphatidylinositide 3-kinase
PMSF phenylmethylsulfonyl fluoride
PPCA Protective Protein/Cathepsin A
PSF Penicillin/Streptomycin/Fungizone
Rac1 Ras-related C3 botulinum toxin substrate 1
RAG A/B/C/D Ras-related GTP binding A/B/C/D
RHEB Ras Homolog Enriched in Brain
RING Really Interesting New Gene
RTK Receptor Tyrosine Kinase rtPCR real time Polymerase Chain Reaction
S6K ribosomal protein S6 kinase
Sav1 Salvador homolog 1
xii SDS Sodium dodecyl sulfate
SH3 (domain) Src Homology Domain 3
Smurf1 SMAD Ubiquitination Regulatory Factor 1
Smurf2 SMAD Ubiquitination Regulatory Factor 1
TAE Tris-acetate-EDTA
TAZ Tafazzin
TEAD1 TEA domain member 1
TJ Tight Junction
TNF Tumour Necrosis Factor
TSC1/2 Tuberous Sclerosis Complex 1/2
Tsp-1 Thrombospondin-1
WT Wild Type
YAP Yes-Associated Protein
xiii Chapter 1: Introduction
1 Part A: Characterization of Nedd4-1 knockout (KO) mouse embryonic fibroblasts
(MEFs)
1. Ubiquitin- Proteasome System
The Ubiqutin-Proteasome System is a system that controls cellular homeostasis by regulating protein turnover through proteasomal degradation, signal termination through transmembrane protein endocytosis, lysosomal degradation, regulation of subcellular trafficking, as well as other cellular functions. Not surprisingly, perturbations in this pathway can have severe pathological implications [1]. As such, this pathway involves a tightly regulated cascade of enzymes, whose sequential activities result in the covalent conjugation of the 76-amino acid Ubiquitin protein onto specific lysine residues in a target protein.
This coordinated cascade involves three enzymes: E1 (ubiquitin activating enzyme),
E2 (ubiquitin conjugating enzyme) and the E3 (ubiquitin ligase). The E1 activates ubiquitin by creating a high energy thioester bond between itself and ubiquitin, consuming an ATP molecule in the process (thus this process is energy dependent). This Ubiquitin is then conjugated to the E2 conjugating enzyme, maintaining this thioester link. Then the ubiquitin is transferred to the E3 ubiquitin ligase, in the case of HECT (Homologous to E6-AP
Carboxy-Terminus) E3 ligases, which then recognizes the protein substrate and proceeds with the ubiquitylation reaction. In the case of RING (Really Interesting New Gene) E3 ligases, the ubiquitin remains conjugated to the E2 and the E3 ligase act as a scaffold for the protein substrate and the ubiquitin-bound E2, bringing them into close proximity for the ubiquitin transfer to occur (See Figure 1) [2].
2 FIGURE 1 : The Ubiquitination Cascade Involving HECT or RING E3 Ligases The ubiquitination cascade involving the a) RING E3 ligases or b) the HECT E3 ligases In the case of HECT E3 ligases, the ubiquitin is directly transferred to a Cysteine residue in the HECT domain of HECT E3s and then transferred to the protein substrate. Not shown is the action of DeUbiquitinating enzymes (DUBs) prior to proteasomal degradation.
( from P, de Bie and A, Ciechanover, 2011, [2])
3 It is the E3 enzymes that are responsible for recognizing and interacting with specific protein substrates, thus they exist in the greatest number, ~600 E3 ligases encoded by the human genome, in contrast to 1-2 E1s and ~100 E2s. There are also E4 elongating enzymes.
They require a substrate protein to already have a ubiquitin moiety attached before they can catalyze the formation of a polyubiquitin chain, the significance of which will be described in the next section [3].
Ubiquitination is most often described in the context of protein degradation by the
26S proteasome, however the outcome of ubiquitination can vary depending on the pattern and position of ubiquitination. Ubiquitin contains 7 lysine residues that can serve as points for further conjugation, allowing for the creation of polyubiquitin chains at different positions: K6, K11, K27, K29, K33, K48 and K63 [4, 5] . The K48 and K63 linkages are most common and well characterized, with K48 linked polyubiquitin chains typically leading to proteasomal degradation and K63 linked chains being involved in endocytosis and trafficking, as well as other cellular functions. Although ubiquitination at all these lysine residues, as well as the amino group in the N-terminal Methionine, has been observed, much less is known about the significance of this modification at positions other than K48 and K63
[6]. There is however some evidence that the K11 linked polyubiquitin chains are involved in the ERAD (endoplasmic reticulum-associated degradation) pathway [3].
In recent years, a new pattern of ubiquitination has emerged, entitled "linear ubiquitination". This ubiquitination pattern results from the "head-to-tail" placement of ubiquitin proteins, where the C-terminal Glycine 76 is linked to the N-terminal Methionine of the next ubiquitin protein [6]. Recent studies have shown that Linear Ubiquitination is
4 necessary to mediate TNF-induced NF- κB and Mitogen Activated Kinase (MAPK) signalling pathway activation, although the exact mechanism is not yet elucidated [7].
In summary, the variations in the pattern and position of ubiquitination form "the
Ubiquitin Code" through differential interactions with downstream effector proteins.
2. The Nedd4 Family of HECT E3 Ligases
Neural precursor cell-expressed developmentally downregulated gene 4-1 (Nedd4-1) belongs to the evolutionarily conserved Nedd4 family of Homologous to E6-AP Carboxy- terminus (HECT) E3 ligases [8]. Nedd4 (also known as Nedd4-1) was first identified as a gene that is highly expressed during development of the Central Nervous System, with expression gradually decreasing as embryonic development progresses [9, 10]. These are conserved among eukaryotes, including Nedd4-1, Nedd4-2, Itch, Smurf1, Smurf2, WWP1,
WWP2, NEDL1, and NEDL2 in humans [8]. All members of the Nedd4 family possess a conserved domain architecture, with a C2 lipid/calcium-binding domain, 2 to 4 WW domains
(depending on species of origin) and the C-terminal HECT domain that contains the key, catalytic cysteine residue responsible for the E3 ligase activity (Figure 2). Protein-protein interactions involving these E3 ligases are typically mediated by the WW domains, which bind PY motifs (either LPxY or PPxY) on target proteins [11,12].
3. Functions of Nedd4 Family Members
Nedd4-1 and Nedd4-2 (also known as Nedd4-like or Nedd4L) are the most closely related members of the Nedd4 family and are encoded by two separate genes. Despite being
5 closely related, they regulate distinct subsets of proteins, as evidenced from phenotypic differences between Nedd4-1 and Nedd4-2 knockout mice. Nedd4-1 knockout mice are embryonic lethal and will be discussed in depth in the following sections, whereas Nedd4-2 knockout survive (dependent on genetic background of mice used). Briefly, Nedd4-2 is mostly regarded as a regulator of ion channels, with the Epithelial Sodium Channel (ENaC) being its most well characterized substrate. Studies in our lab showed that Nedd4-2 recognizes PY motifs on the beta and gamma subunits of ENaC and the loss or mutation of these PY motifs results in decreased endocytosis and lysosomal degradation of the channel
[13]. Of particular significance deletion or mutation of the PY motifs of ENaC, which impair binding to Nedd4-2, causes Liddle syndrome, a hereditary hypertension [14]. ENaC endocytosis also requires catalytically active Nedd4-2, with the CS (catalytic cysteine to serine) mutant showing increased ENaC stability at the plasma membrane
[15], [16]. In accord, Nedd4-2 knockout mice are hypertensive due to increased levels of
ENaC at the apical membranes [17]. Recent studies have also demonstrated increased levels of the Na +/Cl - cotransporter (NCC) in the kidney, which contribute to this hypertensive phenotype [18].
Our lab recently generated mice with conditional knockout of Nedd4-2 in lung epithelium, a tissue where ENaC is also required for fluid absorption [19]. These mice show lung symptoms resembling Cystic Fibrosis (CF), likely due to enhanced ENaC function
[20] (which phenocopies loss of CFTR in CF patients) since CFTR is known to normally suppress ENaC function in the airways [21]. These symptoms include buildup of mucus in the
6 FIGURE 2: Nedd4 family of HECT E3 ligases A) Shown is the conserved domain architecture of the Nedd4 family of HECT E3 ligases. At the N-terminus, there is a Ca2+ dependent/lipid binding domain (the C2 domain), followed by the 2 to 4 WW domains. These domains are usually responsible for recognizing PY motifs with the sequence LPxY or PPxY in protein substrate. At the C-terminus is the HECT domain that contains the catalytic cysteine residue responsible for the ubiquitin ligase reaction. B) Shown is the evolutionary relationship between all the members of the Nedd4 family of E3 ligases. Domains are shown in the same order as the image above it where from N- terminus to C-terminus are: the C2 domains (white rectangles), the WW domains (grey squares) and the HECT domains (black rectangles). Nedd4-1 and Nedd4-2 (both mouse and human) have been highlighted in red rectangles.
(Panel B adapted from Yang and Kumar, 2010 [22].)
7 airways, bacterial infection, and death due to blocked airways [20]. Therefore, it is hypothesized that there are some functions of Nedd4-2 that counteract these symptoms and that both ENaC and Nedd4-2 could be future drug targets in CF patients [20].
4. Studies on Nedd4-1 knockout (KO) MEFs
A) Observations in the Nedd4-1 KO MEFs
To further study the functions of Nedd4-1, our lab generated Nedd4-1 knockout (KO) mice. This deletion resulted in embryonic lethality at E11.5-E13.5. The KO embryos were overall smaller than their WT littermates at the same stage in embryonic development and had strong defects in vasculature and heart development [23]. In addition, other labs have also shown that Nedd4-1 deficient embryos had decreased muscle fibre size, altered arrangement of muscle fibres and defects in synaptogenesis [24]. This work corroborated earlier studies performed in Drosophila melanogaster in our lab, where deficiency in the
Drosophila homologue of Nedd4-1, DNedd4, leads to impaired synaptogenesis as a result of decreased ubiquitination and endocytosis of the transmembrane protein Commisureless
(Comm). This effect was also replicated when the PY motifs in Comm were mutated to abrogate binding to DNedd4 or when catalytically inactive DNedd4 was overexpressed [25].
Mouse Embryonic Fibroblasts (MEFs) harvested from the Nedd4-1 KO mouse embryos show distinct differences from their WT counterparts. These KO cells grow very slowly and do not survive prolonged serum starvation and, in contrast to the differences in size in the entire organism, these cells are bigger than their WT counterparts. Studies using
Mass Spectrometry also revealed elevated levels of Thrombospondin-1 (Tsp-1) in KO MEFs
8 and embryos, an inhibitor of vasculogenesis. Further studies determined that Nedd4-1 does not ubiquitinate or degrade Tsp-1, but rather upregulates transcriptional levels of Tsp-1. The lethality in the Nedd4-1 knockout mice was partially rescued through aspirin administration, which led to a decrease in Tsp-1 levels. However, the defects in cardiovascular system and reduced size of KO mice relative to WT littermates was still maintained, suggesting that other effectors are responsible for these phenotypes. In addition, there was also an increase in
Growth Factor Receptor Bound 10 (Grb10) levels, as seen in Figure 4, a protein belonging to the Growth Factor Receptor Bound 7/10/14 family of adaptor proteins [23]. Similar to Tsp-1,
Grb10 directly interacts with, but is not ubiquitinated by Nedd4-1 [26]. The next section will discuss the functional relevance of the Grb10 and Nedd4-1 interaction.
B) Grb10, insulin signalling and Nedd4-1
Grb10 is part the Grb7/10/14a family of adaptor proteins, which comprises PH-BPS-
SH2 domain architecture. Grb10 is a known effector of the IGFR-1 and Insulin receptors and downstream signalling pathways [27]. There is some controversy as to whether Grb10 is a positive or negative regulator of cellular growth, even with experiments performed in the same cell lines [27, 28]. However, studies performed in mice where Grb10 was knocked out showed increased size relative to wild type mice, supporting the notion that Grb10 is a negative regulator of growth [29, 30].
In addition to the elevated levels of Grb10 in the Nedd4-1 KO MEFs, Nedd4-1 and
Grb10 are also involved in negatively regulating insulin signalling [31, 32]. Insulin and
Insulin-like Growth Factor are ligands for the Insulin Receptor (IR) and Insulin-like Growth
9 Factor Receptor 1 (IGF-R1) transmembrane receptor tyrosine kinases (RTKs). The canonical pathways involves ligand binding at the extracellular domain of the receptor, promoting dimerization of two receptors and their subsequent cross Tyrosine phosphorylation. This allows for the binding and phosphorylation of insulin receptor substrate 1 and 2 (IRS1 and
IRS2), which serve as binding sites for the p85 subunit of phosphoinositide-3-kinase (PI-3-K) and result in Akt kinase activation, promoting cell survival and growth [33]. Grb10 and
Nedd4-1 function to downregulate insulin and IGF signalling by promoting receptor endocytosis [31, 32]. However, in the Nedd4-1 KO MEFs, there is a decrease in insulin and
IGF signaling (contradictory to the above proposed notion that Nedd4-1 is a negative regulator of IGF signaling). Further experiments showed that this decrease is not a result of reduced amounts of insulin and IGF receptor, but rather due to a decrease in their presence at the cell surface. This was partially rescued through Grb10 knockdown [34]. Therefore, there still is some controversy and contradictions with regards to how Nedd4-1 regulates insulin signalling.
C) Grb10 and mTORC1
It has been shown that Grb10 is a direct substrate of the serine/threonine kinase
Mammalian Target of Rapamycin Complex 1 (mTORC1), where Grb10 phosphorylation leads to its stabilization (Figure 5) [35, 36]. mTOR signalling functions to integrate information such as nutrient availability and pro-growth signals from the extracellular environment to determine if conditions are favourable for cellular growth and proliferation
(Figure 4). If so, mTORC1 directly and indirectly leads to the downstream phosphorylation
10 of proteins that play a role in growth, such as those involved in protein synthesis. Two of the best characterized direct substrates and those often used as markers of mTORC1 activity are
4E-BP1 and S6 kinase. In states of nutrient deprivation, 4E-BP1 binds eukaryotic translation initiation factor 4E (eIF4E), the protein that is responsible for recognizing the 5' cap on mRNAs in the cytoplasm and involved with the assembly of the translation pre-intiation complex. When 4E-BP1 binds eIF4E, it inhibits the interaction of eIF4E with the other components of eIF4F, halting the association of the translation pre-initiation complex and resulting in the arrest of cap dependent translation [37].
11 FIGURE 3: mTOR signalling pathway Shown is the integration of the different signalling pathways that regulate mTORC1 and mTORC2 signalling. Note mTORC1 activation in particular, and how it directly phosphorylates 4E-BP1 and S6 kinase in response to both growth factor signalling and amino acid availability.
(from Zoncu, R., et al, 2011, [37])
12 FIGURE 4: mTORC1 Regulation of Grb10 stability This figure shows how mTORC1 signalling, when active, directly phosphorylates Grb10 on S501 and S503. This leads to increased Grb10 stability, which contributes to a negative feedback loop--increased mTORC1 activity leads to decreased growth factor signalling through the inhibitory function of Grb10.
(from Yu, Y. et al, 2011, [35]).
13 5. Other Functions of Nedd4-1
A) Examples of other, known binding partners of Nedd4-1
TABLE 1: Interactors of Nedd4-1
Protein Finding Reference
Lysosome Associated Protein Requires interaction with [38] Transmembrane 5 (LAPTM5) Nedd4-1 to be trafficked to the lysosomal compartment from Golgi
LAPTM4 Requires interaction with [39] Nedd4-1 to be sorted to lysosomal compartment
Rac1 and Disheveled (Dvl1) Rac1 recruits Nedd4-1 to the [40] plasma membrane, where it is brought into proximity with Dvl1. Nedd4-1 then polyubiquitinates Dvl1, a component of canonical Wnt signalling, targetting it for proteasomal degradation.
FGFR1 Nedd4-1 ubiquitinates [41, 42] activated Fibroblast Growth Factor Receptor 1 (FGFR1), leading to its endocytosis and reduced signaling.
pAKT Nedd4-1 ubiquitinates [43] phospho-AKT, allowing for its nuclear translocation.
14 B) Nedd4-1 interaction with Angiomotin
To identify in vivo substrates for Nedd4-1, our lab has carried out mass spectrometry analyses to identify its binding partners. These experiments led to repeated identification of
Angiomotin (AMOT) as a top hit.
The next section will explore the details and known functions of AMOT and current understanding of its interaction with the Nedd4 family members.
Part B: Nedd4-1 interaction with Angiomotin
1. Discovery and Structure of Angiomotin (AMOT)
Angiomotin (AMOT) is a member of the Motin family of proteins, along with
Angiomotin-like 1 (AMOTL1) and Angiomotin-like 2 (AMOTL2) [44]. It was first identified as a possible receptor of Angiostatin, an extracellular protein that is known to inhibit angiogenesis [45] and vascularization of tumours [46, 47].
In order to understand how the ligand angiostatin exerts its anti-angiogenic functions, the Holmgren lab sought to identify its cellular receptors, and by using a yeast two-hybrid screen, identified Angiomotin as its receptor [45]. They also showed that cells expressing
AMOT have a highly motile phenotype, which is reversed with Angiostatin treatment, suggesting that AMOT functions to increase cell motility [45].
This effect could also be achieved by DNA vaccination against Angiomotin, where a plasmid encoding human AMOT is electroporated into cancer-prone mice, which induces the production of anti-Angiomotin antibodies [48]. This was sought out as an alternative to
Angiostatin treatment as Angiostatin has a very short half-life. Results from DNA vaccination
15 against Angiomotin showed decreased tumor growth as a result of decreased angiogenesis and increased chemotherapy efficacy due to more permeable blood vessels
[48]–[50]. This is particularly interesting given that Angiomotin levels have been found to be elevated in human breast cancer and these increased levels have been linked to a more invasive tumor type [51]. Angiomotin's affect on tumor growth and invasion was also demonstrated in Mouse Aortic Endothelial (MAE) cells transfected with wild type
Angiomotin and injected into mice [52].
All members of the Motin family of proteins possess a conserved domain architecture
(see Figure 5) [44], with two different isoforms of Angiomotin resulting from alternative splicing: an 80kDa and a 130kDa isoform [53]. p130 AMOT, AMOTL1 and AMOTL2 possess three N-terminal PY motifs, a central coiled-coil motif (that has been implicated in mediating homo and heterodimerization between members of the Motin family [54] and interacting with the Rac1 GTPase Activating Protein (GAP), Rich1 [55]) and a terminal
PDZ-binding motif (Figure 6). The latter mediates AMOT, AMOTL1 and AMOTL2's localization to Tight Junctions via interaction with Pals1 and Patj in the Crumbs complex and
Par-3 in the Par-3 complex [56]. These assemblies are involved in the maintenance of cell polarity [55]. The integrity of these PDZ-binding motifs have also been shown to be necessary for Angiomotin's migratory phenotype. Cells transfected with Angiomotin constructs where the last three amino acids were mutated were unable to promote tube formation in Matrigel or to promote an invasive tumor phenotype in MAE injected into mice
[57].
16 FIGURE 5: Domain Architecture of the Motin family The Motin family of proteins, made up of the 80kDa and 130kDa splice isoforms of Angiomotin, Angiomotin-like 1 (AMOTL1) and AMOTL2, have a conserved domain architecture. From the N-terminus, there are three PY motifs in all of the proteins except for p80-AMOT. These facilitate protein-protein interactions with WW domain-containing proteins. There is a central coiled-coil domain and then a C-terminal PDZ-binding motif.
17 2. Functions of AMOT
A) AMOT in Junctional Integrity
As mentioned above, Angiomotin interacts with components of the Crumbs and Par-3 junctional complexes via its PDZ domains. The functional relevance of this interaction has been explored in numerous studies examining the effects of overexpressing Angiomotin on epithelial permeability, where increased levels of Angiomotin resulted in the displacement of
Par-3 and Pals1 (junctional complex components) to vesicular structures in the cytosol rather than at Tight Junctions. This resulted in an increase in epithelial permeability, which was quantified through measuring transepithelial resistance (TER) [55].
B) Angiomotin in Development
Studies were carried out in both zebrafish and mice to determine the role of
Angiotmotin in embryogenesis, particularly in the context of vascularization. The results showed that transgenic zebrafish that had Angiomotin knocked down (KD), has vascularization defects in their head and trunk regions. Partial rescue was observed with the addition of AMOTL1, providing evidence for some redundancy in function between these two relatives [58].
Experiments examining the physiological role of Angiomotin during mammalian embryogenesis in a mouse model demonstrated that it is required for normal development, as evidenced by the death of the majority of embryos between E11 and E11.5 upon Angiomotin knockout. In addition, KO embryos were smaller than their wild type (WT) littermates.
Blood vessels in the AMOT KO mice were dilated compared to WT mice [58].
18 C) Regulation of Ras/MAPK signalling by Angiomotin
Angiomotin can affect Ras/MAPK signalling via its interaction with Merlin (Moesin, ezrin, and radixin li ke protein), an inhibitor of the Ras/MAPK signalling pathways. The mechanism was found to involve the interaction of Angiomotin with the Rac1 and Cdc42
GTP Activating Protein (GAP), Rich1, mediated by its coiled-coil motif. Merlin can displace
Rich1, allowing Rich1 to exert its function as a Rac1-GAP and inactivate Rac1 signalling.
This is particularly interesting given that patient-derived, mutant versions of Merlin that were unable to interact with Angiomotin (and, thus, to displace Rich1) were unable to attenuate
Ras-MAPK signalling [59].
3. Differences between the p130 and p80 isoforms of Angiotmotin
Recent studies have described functional differences between the two splice isoforms of Angiomotin (the 80kDa and 130kDa isoforms). Altering the ratio between the 80kDa and the 130kDa isoforms has been linked to a switch in phenotype from motile to non-motile , where increased amounts of p80-Angiomotin promote migration [54, 60, 61].
The 130kDa isoform was first identified when an immunoprecipitation experiment using antibodies directed towards the C-terminus of Angiomotin showed two distinct bands for Angiomotin in HEK293T cells (which have very high endogenous Angiomotin expression). Mass Spectrometry analysis showed that this bigger isoform contained the aforementioned N-terminal extension, but was otherwise identical to the 80kDa isoform.
Subsequent studies aiming to determine specific functions for the 130kDa isoform found that it colocalized with actin fibers and that there was an increase in number of actin fibers in
19 cells expressing p130-Angiomotin. In addition, there was a striking difference in cell size, where Mouse Aortic Endothelial (MAE) cells expressing p130-Angiomotin had a two-fold increase in cell surface area compared to cells transfected with p80-Angiomotin or vector control. The same study examined if cells expressing p130-Angiomotin also induced a highly mobile phenotype, which would then be reversed with Angiostatin treatment. Wound- healing experiments demonstrated that p130-Angiomotin did not bestow a high-motility phenotype upon cells relative to both cells expressing p80-Angiomotin or vector control cells. These experiments collectively suggest that the 80kDa and 130kDa isoforms of
Angiomotin have distinct functions [61].
The ratio of p80-Angiomotin to p130-Angiomotin has also proven to be important for the switch between motile and non-motile cells, with homo- and heterodimerization between the two isoforms mediating the switch. Co-transfection of both isoforms in cells that do not have endogenous Angiomotin expression demonstrated that p80-Angiomotin is able to mediate a change in p130-Angiomotin's localization, from cell-cell contacts to cytoplasmic.
This cytoplasmic redistribution promotes a more migratory cell phenotype [54].
Finally, the 130kDa splice isoform of Angiomotin has been shown to be involved in the Hippo Signalling Pathway [62]–[64] via the 3 PY motifs in its N-terminal extension. This involvement will be elaborated upon in the next sections.
4. The Hippo Signalling Pathway
First described in Drosophila, the Hippo signalling pathway is highly conserved and
20 is regarded as a tumour suppressor pathway as it functions to inhibit the transcriptional co- activation of genes that promote cell growth and proliferation. It consists of a kinase cascade that terminates in the phosphorylation of transcriptional co-activators YAP (Yes-associated protein) and TAZ (transcriptional co-activator with PDZ-binding motif), which prevents the nuclear translocation required for fulfilling their transcriptional co-activator function. In the absence of Hippo signalling, YAP and TAZ are able to interact with transcription factors, most notably the TEAD 1-4 transcription factors that regulate the expression of pro-growth and proliferation and anti-apoptotic genes [65, 66]. In particular, this pathway has been involved in regulating organ size, with experiments in mouse models demonstrating that increased levels of YAP lead to an enlarged liver [67]. Increased levels of YAP and TAZ have also been found in human cancers [68, 69].
The steps of the mammalian Hippo signalling pathway are as follows (Figure 7):
Mst1/2, when bound to Sav1, can interact with and phosphorylate LATS1/2 which in turn interacts with Mob1 to recognize YAP and TAZ and phosphorylate them on Serine 127 and
Serine 89 respectively. This modification allows for phospho-YAP and phospho-TAZ to be bound by the cytoplasmic 14-3-3 protein which inhibits their nuclear localization [66]. Once retained in the cytoplasm, they can be shunted to a variety of outcomes, including proteasomal degradation [70] or interaction with cytoplasmic beta-catenin [71]. Interestingly, many of the protein-protein interactions in the Hippo signalling kinase cascade are mediated via the association of PY motifs (LPxY or PPxY) and WW domains [72].
21 FIGURE 6: The Mammalian Hippo Signalling Cascade This schematic diagram shows the components of the mammalian Hippo Signalling cascade. Also shown are some of the YAP and TAZ target genes that are transcriptionally coactivated in the absence of Hippo signalling.
(from Ramos, A. and Camargo, F.D., 2012, [73])
22 5. Angiomotin in Hippo Signalling
A) p130-AMOT interacts with YAP and YAZ
p130-Angiomotin is the isoform with the N-terminal extension containing 3 PY motifs and has been reported to have a role in the Hippo Signalling pathway [62]–[64]. It has been shown that YAP and TAZ can bind p130 AMOT through its PY motifs. This interaction then inhibits the translocation of YAP and TAZ into the nucleus (Figure 7), where they would otherwise transcriptionally co-activate the expression of pro-growth genes, such as Fibroblast
Growth Factor (FGF) [66]. AMOT's interaction with YAP and TAZ is actually independent of Hippo signalling activity, as AMOT can associate with and inhibit the nuclear localization of YAP and TAZ that has not previously been phosphorylated by LATS1/2. This was shown by using mutants of YAP and TAZ that had their LATS1/2 phosphorylation sites mutated
[64]. Other experiments demonstrated that p130-Angiomotin actually promoted YAP and
TAZ phosphorylation by LATS1/2, with Angiomotin functioning as a protein scaffold [74].
Interestingly, AMOT is not conserved in Drosophila, the system in which the Hippo signalling pathway is most well characterized [75].
B) YAP and TAZ function
YAP and TAZ are two closely related proteins, with TAZ arising as a result of a gene duplication event. They are both downstream effectors of Hippo signalling and while many functions of YAP and TAZ overlap, they are not completely functionally redundant. This is best exemplified by the difference in phenotype between YAP knockout mice and TAZ knockout mice. YAP deficiency leads to embryonic lethality, with death occurring at E8.5
23 with strong defects in yolk sac and placental vasculogenesis. It is important to note that these defects occurred even in the presence of TAZ [76]. On the other hand, TAZ knockout mice survive embryogenesis and have a more subtle phenotype, reminiscent of Polycystic Kidney
Disease [77] and pulmonary emphysema [78] in humans. In summary, while YAP and TAZ are very closely related proteins that both function as downstream effectors of Hippo signalling and often interact with a shared subset of proteins, they are not functionally redundant.
In addition to YAP's transcriptional co-activation of pro-growth genes, it can also co- activate the transcription of pro-apoptotic genes in conditions of cellular stress, such as serum starvation and DNA damage. For example, YAP can interact with p73 (a member of the p53- family of tumour suppressors) via its WW domains. YAP competes with Itch, a Nedd4- family E3 ubiquitin ligase, for interaction with p73, effectively leading to increased levels of p73. Furthermore, YAP and p73 activate the transcription, and thus expression, of more p73, an example of a positive feedback loop [79]. Interestingly, AMOTL1 has been shown to also inhibit this function of YAP [80].
In addition, both YAP and TAZ have been implicated in the Wnt signalling pathway, where they have been shown to directly interact with beta-catenin. This interaction then prevents beta-catenin from transcriptional activation of Wnt pathway target genes. This link was first established when it was shown that there is upregulation of beta-catenin target genes in systems that have the Hippo signalling compromised, ie: in systems where YAP and TAZ were not being sequestered in the cytoplasm [71, 81].
24 FIGURE 7: Angiomotin's role in Hippo Signalling A) Interactions between Angiomotin and Yap Shown in the domain architecture of Angiomotin and YAP. Of particular interest are the PY motifs in the long, 130kDa isoform of Angiomotin and the WW domains in YAP, as they are responsible for mediating interactions between these two proteins. B) Angiomotin's inhibition of YAP and TAZ-mediated transcriptional co-activation The transcriptional co-activators YAP and TAZ can interact with Angiomotin via WW domains and PY motifs respectively.
(Panel A and B are adapted from Zhao, B., et al, 2011, [63])
25 In summary, YAP and TAZ are important for multiple cellular functions with some overlap in terms of TEAD-responsive genes that promote growth and being effectors of Hippo
Signalling.
6. p130 AMOT interaction with Nedd4-1 and Nedd4-2
Recent studies examining the regulation of Angiomotin have uncovered that
Angiomotin levels are controlled by proteasomal degradation and that the Nedd4 family members Nedd4-1, Nedd4-2 and Itch are the E3 ligases that mediate the ubiquitylation of the long isoform of AMOT in HEK293T cells [82]. As indicated above, this 130kDa isoform contains 3 PY motifs that are conserved in the Motin family members AMOTL1 and
AMOTL2, which bind the WW domains in the Nedd4 family members [82]. This study also showed that overexpression these Nedd4 family members resulted in lower levels of
Angiomotin, whereas their knockdown had the opposing effect [82]. However, the physiological role for this interaction remains to be established.
7. Nedd4 family of E3 ligases in Hippo Signalling
There have also been new reports regarding the role of the Nedd4 family of E3 ligases in regulating Hippo signaling. It has been described that Itch, also known as Atrophin 1 binding protein 4 (A1P4), can negatively regulate levels of LATS1/2 kinase through ubiquitination and subsequent proteasomal degradation with more recent studies also describing that Nedd4-1 can similarly ubiquitinate PYmotif-containing LATS1/2. There have also been conflicting reports about the effect of Nedd4 family-mediated ubiquitination on
26 p130-AMOT stability, with new studies reporting that ubiquitination results in a stabilization of p130-AMOT. Some have demonstrated that this helps p130-AMOT to negatively regulate
YAP transcriptional co-activation [83, 84]. However, others have shown that p130-AMOT is actually part of the TEAD-YAP transcriptional complex and that there is a great deal of overlap in the genes regulated by p130-AMOT and YAP [85]. In summation, there are many avenues for exploring the role of the Nedd4 family of HECT E3 ligases in the context of
Hippo signaling regulation.
27 Rationale and Hypotheses
Part A: Characterization of the Nedd4-1 KO MEFs
Given that Grb10 level is highly elevated in the Nedd4-1 KO MEFs and some of the phenotypes can be rescued by interrupting the Grb10 gene or knocking it down, I wanted to determine the mechanism behind this increase. I hypothesize that mTORC1 signalling is overactive in the Nedd4-1 KO MEFs and I will study this by addressing the following issues:
a) Is mTORC1 signalling overactive in the Nedd4-1 KO MEFs, leading to the
increased stability of Grb10?
b) Study other phenotypic differences between the WT and Nedd4-1 KO MEFs in
order to uncover novel processes that involve Nedd4-1.
Part B: The Angiomotin and Nedd4-1 Interaction
My goal was to determine the mode of interaction between the p130-Angiomotin and Nedd4-
1 and Nedd4-2. I hypothesize that the Nedd4-1 and YAP/TAZ are competitive interactors of p130-AMOT and I will investigate this by:
a) Generating PY motif mutants of Angiomotin that cannot bind the WW domains of
Nedd4 proteins, or those of YAP or TAZ.
b) Testing the model of interaction between Nedd4, p130-AMOT, and YAP/TAZ, to
determine if it is competitive or cooperative in nature.
28 Chapter 2: Materials and Methods
29 Part A: Characterization of Nedd4-1 knockout (KO) mouse embryonic fibroblasts
(MEFs)
1. Generation of Nedd4-1 KO MEFs
The wild type and Nedd4-1 KO MEFs were generated in our lab as previously described [86].
2. Cell culture
The wild type (WT) and Nedd4-1 KO MEFs were maintained in Dulbecco's Modified
Essential Medium (DMEM, Wisent) supplemented with 10% Fetal Bovine Serum (FBS,
Wisent)), 1% penicillin/streptomycin (PSF) and 12mM L-Glutamine and incubated at 37ºC in
5% CO 2.
3. Immunofluorescence
A) Fixation
Cells were plated on 15mm round coverslips that had been treated with 1:100 poly-
D-lysine for 1h at 37ºC at a density of 25000 cells/mL in a 24-well plate in 500 µL of cell culture medium (supplemented with 10% FBS, 1% PSF and 12mM L-Glutamine) and allowed to adhere and grow overnight. The next day, the medium was aspirated and replaced with 250 µL of 4% paraformaldehyde (PFA) in pH 7.5 phosphate buffered saline (PBS) for 30 min for fixation. The PFA was aspirated and subsequently replaced by 500 µL of PBS, pH7.5.
30 B) Immunostaining
A permeablizing/blocking buffer consisting of 1% FBS and 0.01% Triton-X 100 in
PBS was used to first permeablize cells for 5 min before incubation with primary antibodies in the same buffer. The primary antibody dilutions were as follows: 1:300 rabbit anti-mTOR
(Cell Signalling), 1:1000 mouse anti-Transferrin Receptor (Zymed), and 1:1000 rat anti-
LAMP1 (BD Biosciences). Cells were incubated with primary antibodies for 90 min at room temperature, antibody solutions were then aspirated and the coverslips washed with PBS 3 times. Cells were then incubated with secondary antibodies conjugated with fluorophores at a dilution of 1:1000 each in permeablizing/blocking buffer for 30 min at room temperature.
For the last 5 min, 100 µL of 1 µg/mL 4',6-diamidino-2-phenylindole (DAPI) was added to each coverslip. Once again, the antibody solutions were aspirated and the coverslips were
washed with PBS 3 times. Coverslips were then rinsed in ddH 2O and then mounted on slides using Dako Mounting Medium (Agilent) and allowed to dry a minimum of 24 h prior to imagining.
C) Imaging
Imaging was carried out using a Quorum Spinning Disk Confocal
Microscope,consisting of a Zeiss Axiovert 200M inverted fluorescence microscope equipped with a Hamamatsu C9100-13 back-thinned EM-CCD camera, Yokogawa CSU 10 spinning disk confocal scan head, and Andor Mosaic FRAP unit. The 40X magnification objective was used for all experiments and Volocity Imaging Software (Perkin Elmer) was used for all acquisitions.
31 D) Data Analysis
Measurements between the centre of the lysosomal compartments and the edge of the nucleus were performed using the Volocity Demo software (Perkin Elmer) and then exported in Microsoft Excel file format. GraphPad Prism software was used for graphing the frequency of measurements.
4. Immunoblot Analysis
Prior to lysis, the medium from the tissue culture dishes was aspirated and cells were washed 2X with ice-cold PBS. Cells were then lysed in Lysis Buffer (150mM NaCl, 50mM
HEPES pH7.4, 1% Triton, 10% glycerol, 1.5mM MgCl2 and 1.0mM EGTA) supplemented with the protease inhibitors 10 µg/mL Leupeptin, 10 µg/mL Aprotinin, 10 µg/mL Pepstatin and 1mM Phenylmethanesulfonyl fluoride (PMSF). Cells were scraped off the bottom of the tissue culture dishes with a rubber policeman and cells in lysis buffer were transferred to eppendorf tubes, where they were placed on ice for 20 min. Samples were then clarified through centrifugation for 30 min at 14 000 rpm and at 4ºC. Protein concentration was determined via Bradford Assays and diluted to 1mg/mL. 5X SDS loading buffer was added and samples were boiled for 5 min. 25-30 µg of each sample was resolved on SDS PAGE.
Samples were than transferred onto a nitrocellulose membrane at a voltage of 110V for 90 min.
Hydrated membranes were blocked with 3% skim milk in wash buffer (PBS, 0.05%
Triton) for 30 min and then incubated with primary antibodies overnight in 3% skim milk in
Wash Buffer with 0.1% NaN 3. The antibody dilutions used were as follows: 1:2000 for rabbit
32 anti-mTOR (Cell Signalling), 1:2000 rabbit anti-phospho-mTOR (Cell Signalling), 1:2000 for rabbit anti-p70/S6 kinase (Cell Signalling), 1:2000 for rabbit anti-pp70/pS6 kinase (Cell
Signalling), 1:5000 for mouse anti-Rac1 (Abcam) and 1:40000 for mouse anti-beta actin as a loading control. Membranes were then washed with Wash Buffer 3 times for 10 min each.
Secondary antibody solutions were prepared in 3% skim milk in Wash Buffer, containing horshradish peroxidase-conjugated secondary antibodies at a dilution of 1:10,000.
Membranes were incubated with secondary antibodies for 30 min at room temperature and then washed (10min x3). Membranes were developed using equal volumes of Western
Lightning Plus -ECL Enhanced Luminol Reagent Plus and Oxidizing Reagent Plus.
5. DQ BSA Proteolysis Assay - Live Immunofluorescence Imagining
Cells were plated on 25mm, round coverslips that had been pre-treated with 10 µg/mL poly-D-lysine hydrobromide (Sigma) for 30min at 37ºC, and allowed to adhere overnight in cell culture medium (DMEM supplemented with 10% FBS, 1% penicillin+streptomycin and
12mM L-Glutamine). The next day, the cell culture medium was replaced with fresh medium containing 100 µg/mL DQ BSA Green and 75 µg/mL Alexa647-conjugated Dextran and incubated at 37ºC for 60min. Coverslips were then washed to remove excess probes and to commence the "chase" period. Cells on coverslips were then imaged at the following chase timepoints: 0, 30, 60 and 90 min.
Imaging was carried out using the same Quorum Spinning Disk Confocal Microscope described in previous sections. The 40X magnification objective was used for all
experiments, which were performed a37ºC, 5% CO 2 in a stage warmer chamber.
33 6. Tranmission Electron Microscopy of MEFs
Electron Microscopy was performed at the Advanced Bioimaging Centre (at Mount
Sinai Hospital) after cells, consisting of 2 clones of WT and Nedd4-1 KO MEFs each, had been fixed in 2% glutaraldehyde in 0.1M sodium cacodylate buffer pH7.3 for 60 min at room temperature.
Part B: Nedd4-1 Interaction with Angiomotin
1. Cell Culture
Human Embryonic Kidney (HEK) 293T cells and HeLa cells were maintained in
DMEM medium (Wisent) supplemented with 10% FBS (Wisent) and 1%
peniciilin/streptomycin (Wisent). Cells were incubated at 37ºC in 5% CO 2.
2. Mutagenesis
Stratagene Quikchange Site-Directed Mutagenesis was used to generate PY mutations in the Angiomotin construct using the following primers:
TABLE 2: Mutagenesis Primers Motif Direction 5'-3' sequence 1st PY motif Forward caaaataatgaagaactcgcgacctatgaagaagccaagg Reverse ccttggcttcttcataggtcgcgagttcttcattattttg 2nd PY motif Forward aacaccgaggccccccagcagaatatcccttcaagggcat Reverse atgcccttgaagggatattctgctggggggcctcggtgtt 3rd PY motif Forward tgaggtatcagcatcccgctgagtatggagcagccaggc Reverse gcctggctgctccatactcagcgggatgctgatacctca
34 These primers served to mutate the PY motifs, which normally have the sequence PPxY or
LPxY, such that the second Proline residue in each PY motif was changed to an Alanine residue.
3. Cloning and Plasmids
AMOT has the accession number 154796 and the 2XHA-AMOT in pcDNA3 plasmid was purchased from Dr. Kunliang Guan 's lab via Addgene (Addgene plasmid 32821).
YAP1, accession number 10413, was also purchases from Addegene as FLAG-YAP1 in pcDNA, from Dr. Yosef Shaul (addgene plasmid 18881). Finally, TAZ (accession number
6901) cDNA was obtained from Sidnet at Sickkids Hospital and, using the Gateway cloning system (Invitrogen), a FLAG-TAZ construct was created.
4. Transfection
HEK293T cells were transfected using the calcium phosphate method [87] while
HeLa cells were transfected using Polyjet (Frogo) according to the manufacturer's instructions.
5. Immunoprecipitation
Cells were lysed 24 hours post-transfection using Lysis Buffer, as above. Samples were placed on ice for 20 min and then clarified by centrifugation for 30 min at 14,000rpm at
4ºC. Protein concentration was measured using a Bradford Assay and all samples were diluted down to 1mg/mL. 1mL of each sample was added to 15 µL of anti-FLAG Affinity Gel
35 (Sigma) or 0.5 µL of mouse anti-V5 antibody (Serotec). Samples that were incubated with the anti-V5 antibody also had 30 µL of Protein G slurry (Bioshop). Sample tubes were incubated at 4°C for 2 hours, pellets washed with low salt IP Wash Solution (20mM HEPES pH7.5,
150mM NaCl, 10% glycerol, and 0.1% Triton X-100) 3 times. The Affinity Gel or Protein G beads were then resuspended in 50 µL 1X SDS Loading Buffer and boiled for 5 min to elute proteins.
For experiments measuring AMOT ubiquitination, HeLa cells were plated and transfected using Polyjet reagent, as described above. Cells were co-transfected with 1µg
HA-tagged AMOT cDNA, with or without 1µg of V5-hNedd4-1 WT, V5-hNedd4-1 CS, V5- hNedd4-2 WT and V5-hNedd4-2 CS (the CS denotes a catalytically inactive hNedd4-1n where the key Cysteine residue has been mutated to a Serine). Cells were lysed in lysis buffer, as described above, plus lysosomal inhibitor chloroquine (10 µM) and the proteasomal inhibitor MG132 (10 µM). Protein concentration was assayed using the Bio-Rad Bradford
Reagent and standardized to 1mg/mL across all samples. 150µL of 20% SDS was added to each 1mL sample and then boiled at 99ºC for 5 min to disrupt any non-covalent interactions.
Lysates were then diluted to 10mL with the addition of 9mL of lysis buffer. 30 µL of Protein G bead slurry and 0.5 µL of anti-HA antibodies (Covance) were added to each sample and incubated overnight at 4ºC. Samples were then briefly centrifuged to pellet the Protein G beads, beads were washed with 1mL of low salt IP Wash Buffer (20mM HEPES pH7.5,
150mM NaCl, 10% glycerol, and 0.1% Triton X-100) 3 times. Finally, the beads were re- suspended in 50 µL of 1X SDS loading buffer and boiled for 5 min. 25-30 µg of each sample was resolved by SDS PAGE, transferred onto a nitrocellulose membrane as above, and
36 immunoblotted for ubiquitin with anti-ubiquitin antibodies (Covance, 1:1000 dilution).
NOTE: A complementary assay using His-Ubiquitin was attempted, but was unsuccessful due to naturally-occurring polyhistidine sequence in Angiomotin.
37 Chapter 3: Results
38 Part A: Characterization of Nedd4-1 knockout (KO) MEFs
1. Grb10 is increased in the Nedd4-1 KO MEFs
Prior to exploring the reason for the elevated levels of Grb10 in Nedd4-1 KO MEFs, I wanted to ensure that the cells I would be using actually possessed the increased levels. The elevated levels of Grb10 in the Nedd4-1 KO MEFs is well documented [23, 34], and in accordance with this, the two Nedd4-1 KO MEF clones I used for all of the following experiments show that they have significantly elevated levels of Grb10 protein relative to the
WT MEFs, as detected by immunoblot analysis (see Figure 8).
39 FIGURE 8: Grb10 levels are elevated in the Nedd4-1 KO MEFs A) Immunoblot of Grb10 in one WT and one Nedd4-1 KO clone Shown is a sample Immunoblot from an experiment where both the WT and Nedd4-1 KO MEFs were treated with Rapamycin to measure the effects on Grb10 levels. This was performed for two clones of each genotype, with the first lane for each set representing steady state levels of Grb10. These were used in the quantification shown in Panel B. B) Quantification of Grb10 in two WT and two Nedd4-1 KO clones Shown are measurements of average Grb10 levels in between 2 clones each of the wild type (WT) and Nedd4-1 KO MEFs, as visualized by Immunoblot. This represents the results of 2 replicate experiments, with error bars showing Standard Error and the Student's t-test confirming a significant difference, with p<0.05.
Legend: clone 2 WT - clone 2 Wild Type MEFs clone 3 KO - clone 3 Knockout MEFs
40 2. Lysosomes have altered distribution in the Nedd4-1 KO MEFS
Given that Grb10 levels are elevated in Nedd4-1 KO MEFs [23, 34] (although insensitive to rapamycin treatment--Figure 8), and that the mTORC1 signalling pathway activity has been reported to increase Grb10 stability through direct phosphorylation [36, 87],
I wanted to examine if there are perturbations in mTORC1 signalling in the KO MEFs. One of the ways in which endogenous Grb10 was examined was through Immunofluorescence experiments where both WT and Nedd4-1 KO MEFs were stained with antibodies raised against Grb10, mTOR, the lysosomal marker LAMP1 and DAPI (a nuclear stain) in order to observe any differences in subcellular localization or morphology between the two cell genotypes. The rationale for staining for the lysosomal compartment was that the active mTORC1 complex has been described to localize to the lysosomal surface, where it can interact with its regulators, such as the RAG and RHEB GTPases [89].
Confocal imaging of these cells revealed a striking phenotypic difference between the WT and Nedd4-1 KO MEFs in the context of lysosomal distribution. In the case of the
WT MEFs, the lysosomal compartments displayed the typical perinuclear distribution in normal growth conditions [90]. However, the Nedd4-1 KO MEFs had more evenly and peripherally distributed lysosomal compartments. This difference was preserved across two
WT MEF clones as well as two Nedd4-1 KO MEF clones, as seen in Figure 9. To ensure that there was a measurable difference in lysosomal distribution, the distance from the edge of the nuclear envelope to the centre of each lysosome was quantified using Volocity Imaging
Software (Perkin Elmer). The quantification of these distances (Figure 9, Panel B)) demonstrates that there is a real difference in the lysosomal distribution between the WT and
41 FIGURE 9 : Lysosomal Distribution is Altered in the Nedd4-1 KO MEFs A) Confocal Immunofluorescence images showing differences in Lysosomal Distribution Confocal Microscopy images of the WT MEFs (clones 2 and 7) and Nedd4-1 KO MEFs (clones 3 and 5) that have been stained for the lysosomal marker LAMP1, where the solid line denotes the edges of the cell. As seen in the images below, there is a striking difference in lysosomal distribution between the WT and Nedd4-1 KO MEFs, where the WT cells have a perinuclear distribution, whereas the Nedd4-1 KO MEFs have a more even and peripheral distribution. B) Quantification of Differences in Lysosomal Distribution between Nedd4-1 WT and KO MEFs Differences in lysosomal distribution between the WT and Nedd4-1 KO MEFs are depicted as percent frequency, with distance between the edge of the nucleus to the centre of the lysosomes in micrometres along the X-axis. This data represents measurements from 40 cells of each the WT and Nedd4-1 KO MEFs, with two clones used for each genotype. Each clone contributed ~4000 individual measurements. As seen above, the lysosomes in the Nedd4-1 KO MEFs are further from the nucleus than in the WT MEFs. This difference in frequency distribution is significant, as calculated using the Student's t-test, with p<0.0001.
42 the Nedd4-1 KO MEFs.
Given that differences in lysosomal distribution has been associated with changes in nutrient availability [90] and mTORC1 activity [91], perhaps the more peripheral distribution of lysosomes in the Nedd4-1 KO MEFs is linked to alterations in mTORC1 activity. Or, given how nutrient deprivation leads to a change in lysosomal distribution, perhaps the
Nedd4-1 KO MEFs are chronically starved, which could explain why they proliferate so slowly relative to WT MEFs [23, 34]. Both of these possibilities were addressed in subsequent experiments.
3. mTORC1 signalling is not overactive in Nedd4-1 KO MEFs (in response to amino acid restimulation)
In order to test if the altered distribution of lysosomes in the KO MEFs could be related to mTORC1 function in response to nutrient supply, starvation and amino acid restimulation experiments were performed in both WT and Nedd4-1 KO MEFs. The increased size of the Nedd4-1 KO MEFs also provided a reason to investigate this pathway, as mammalian cell size is positively regulated by mTORC1 activity [92]. In this series of experiments, cells were first starved of amino acids and growth factors to inactivate mTORC1 signalling, and then essential amino acids were added to reactivate this pathway.
RPMI 1640 Amino Acid-free medium was used as the starvation medium and 50X MEM
Amino Acids Solution in starvation medium was used to restimulate mTORC1 signalling.
The activity of mTORC1 signalling in response to this treatment was measured by
Immunoblot Analysis, in particular the ratio of phospho-p70 (phospho-S6 kinase) to total p70
43 (S6 kinase). Recall that p70 (S6 kinase) is a direct substrate of mTORC1 on Threonine 389 and, when activated through phosphorylation, functions to phosphorylate the S6 ribosomal protein and other substrates that work together to promote global protein synthesis [93].
These experiments were performed in two WT clones and two Nedd4-1 KO clones to ensure that the observations were not simply a result of innate variations between cell lines, but actually attributable to the genotypic differences being tested. The 4 hour time point was chosen as this just precedes the amount of time required for the autophagic process to sufficiently replenish the amino acid pool for the reactivation of mTORC1 signalling [94].
As seen in Figure 10, mTORC1 is not overactive in the Nedd4-1 KO MEFs in response to amino acid starvation and re-stimulation relative to WT cells. While this pathway appears to become more active more quickly in the Nedd4-1 KO MEF clone 5, this was not reproduced in the other KO clone 3 and thus, cannot be attributed to their genotype.
This experiment was formulated to examine mTORC1 signalling reactivation only in response to amino acids. Adding growth factors would have resulted in the confounding factor of mTORC2 signalling leading to the activation of mTORC1, through the downstream inhibition of Tuberous Sclerosis Complex 1/2 (TSC 1/2) by Akt [95].
44 FIGURE 10: mTORC1 Signaling is Not Overactive in the Nedd4-1 KO MEFs A) Amino Acid and Serum Starvation and Amino Acid Restimulation Immunoblot Shown is a sample Western Blot from these experiments that conveys the typical result of a starvation and amino acid re-stimulation experiment. This blot shows the mTORC1 activation of WT MEFs clone 2. Legend: AA - Essential Amino Acids B) Quantification of mTORC1 Re-Stimulation with Essential Amino Acids Shown is the time course restimulation of the mTORC1 signalling pathway in response to essential amino acid treatment. This graph shows averages of 3 experiments, with the Y-axis showing the ratio of phospho-p70 to p70. All protein levels were standardized to an actin loading control and error bars represent Standard Error.
Table of Linear Regressions This table shows the equations for the lines of best fit for the above graph, with the R-values. The p-value for the slopes is 0.566, showing that there is no significant difference between the reactivation of mTORC1 between the WT and Nedd4-1 KO MEFs.
45 Clone and Genotype Equation of the Line R-squared value WT - clone 2 Y = 0.03013*X - 0.04801 0.9253 WT - clone 7 Y = 0.02229*X + 0.03344 0.4711 KO - clone 3 Y = 0.02024*X + 0.007211 0.8301 KO - clone 5 Y = 0.03316*X + 0.08271 0.6652
46 A similar, preliminary experiment (not shown) was performed to examine if there is a difference in mTORC1 re-stimulation in response to growth factor treatment (using Fetal
Bovine Serum (FBS)), showing a similar pattern with regards to mTORC1 activation to that shown in Figure 10.
4. Lysosomes from the Nedd4-1 KO MEFs have normal proteolytic activity
Since lysosomal distribution in the Nedd4-1 KO MEFs was altered relative to the WT
MEFs, I investigated if lysosomal function, assessed by analyzing lysosomal proteolytic activity, is altered in the Nedd4-1 KO MEFs.
Two molecular probes, DQ BSA Green and Alexa-647 conjugated Dextran
(Molecular Weight 10 000), were employed to measure lysosomal proteolysis. DQ BSA
Green is a probe that is initially in a quenched state, not possessing any intrinsic fluorescence, until it reaches an endo/lysosomal compartment containing lysosomal hydrolases. Hydrolytic cleavage results in dequenching and a green fluorescent signal is emitted. In contrast, Alexa-647-conjugated Dextran cannot be degraded, so it served as a loading control, allowing for the subsequent analysis to correct for possible differences in endocytosis when measuring the appearance of the green fluorescent signal from the DQ
BSA. Sample Confocal images from these experiments are depicted in Panel A of Figure 11 on the following pages.
Analysis of the intensity of the DQ BSA Green signal over time, normalized to the
Dextran Alexa-647 signal for each image, demonstrated that the Nedd4-1 KO MEFs did not have defects in lysosomal proteolysis (see Panel B of Figure 11) relative to WT cells. In
47 FIGURE 11: DQ BSA Assay in the WT and Nedd4-1 KO MEFs A)Confocal Images from the DQ BSA Experiment Sample images showing typical cell in the DQ BSA assay. This particular set of images show a Nedd4-1 KO MEF after 30 min of chase following a 60 min incubation with the DQ BSA Green and Dextran Alexa-647 probes. B)Quantification of the DQ BSA Lysosomal Proteolysis Assay Analysis of differences in lysosomal proteolysis between the WT and Nedd4-1 KO MEFs, measured as the ratio between the signal intensity for DQ BSA Green and Dextran A647. As shown below, the Nedd4-1 KO MEFs consistently had a higher ratio at all time points examined, relative to the WT MEFs. In this graph, the data for 2 clones per genotype are pooled, and with a p-value of 0.9715, there is no significant difference in proteolysis between the WT and Nedd4-1 KO MEFs. N=75-80 cells per genotype, with 100-150 intensity measurements per cell at each time point. Error bars represent standard error.
48 49 addition, the Nedd4-1 KO MEFs demonstrated a higher intensity signal for DQ BSA Green at all time points. Since DQ BSA exists in a dequenched state prior to hydrolysis, this may suggest increased proteolytic activity in the Nedd4-1 KO MEFs relative to the WT MEFs and may be affected by the more peripheral lysosomal distribution in the Nedd4-1 KO MEFs, given that DQ BSA reaches the more peripheral lysosomal compartments earlier and has been in the lysosomal compartments longer in the KO MEFs at the time of imaging.
5. Morphological Differences between the Nedd4-1 WT and KO MEFs analyzed by EM
Tranmission Electron Microscopy (TEM) was performed on fixed samples of the WT and the Nedd4-1 KO MEFs to visualize any obvious morphological differences between them, particularly phenotypes that might bear resemblance to a lysosomal storage disorder
(LSD). This was a possibility given that there was already at lease one difference in phenotype involving lysosomes, with the lysosomes in the Nedd4-1 KO MEFs being more peripherally distributed. There is also some evidence of increased exocytosis in LSDs, to allow for the clearance of accumulated materials [94,95], which might appear as a more peripheral lysosomal distribution. In addition, at least one of Nedd4-1's substrates,
LAPTM4, has been known to contribute to a lysosomal storage disorder [98]. Lysosomal storage disorders, as visualized by TEM, often appear as an accumulation of electron dense material as the result of un-degraded materials building up in the lysosomal compartment
[98].
Figure 12 shows several striking differences between the WT and Nedd4-1 KO MEFs.
Firstly, while there was no obvious evidence of lysosomal storage disease markers, there
50 FIGURE 12: Transmission electron micrographs of both the Nedd4-1 WT and KO MEFs A) These images show the morphology of the WT MEFs, with particular emphasis on the Lysosomal compartments and the Rough Endoplasmic Reticulum (RER) B) Images show the morphology of the Nedd4-1 KO MEFs. In contrast with the WT MEFs, the RER is more distended rather than tubular and the lysosomes appear vacuolar.
Figure Legend: Lyso - Lysosome RER - Rough Endoplasmic Reticulum MVB - Multivesicular Bodies
51 52 were "vacuolar" structures which resemble lysosomes. These structures were only seen in the Nedd4-1 KO MEFs and were mostly devoid of electron density, with some electron density sometimes along the edges of these structures. Some of these structures also appeared to contain fragments of membranes. The other very striking difference between the two genotypes was the appearance of the Rough Endoplasmic Reticulum (RER), where in the
Nedd4-1 KO MEFs, the RER was distended rather than tubular, as seen in Figure 12.
6. Comparing Levels of ER Stress Markers in Nedd4-1 KO MEFs relative to WT MEFs
The Transmission Electron Micrographs of the WT and Nedd4-1 KO MEFs also revealed dramatic differences in the context of the Rough Endoplasmic Reticulum (RER).
As seen in Figure 12 pages, the RER is distended to the point of appearing circular in the
Nedd4-1 KO MEFs, whereas they appear to have normal, more tubular morphology in the
WT MEFs. This alteration in normal RER morphology is characteristic of ER stress, which can result from the accumulation of unfolded proteins [99].
In order to determine if known markers of ER stress were elevated in the KO MEFs, cell lysates from the WT and Nedd4-1 KO MEFs were immunoblotted for phospho-IRE1 α,
Grp78(BiP)/Grp 94 and phospho-eIF2 α. IRE1 α is an ER transmembrane protein that under normal, unstressed conditions, interacts with the Hsp70-family chaperone BiP in the ER lumen. Grp94 is an ER-resident chaperone of the Hsp90 family and eIF2 α is a component of the eukaryotic translation initiation complex, where the phosphorylation of the latter in response to ER stress leads to the reduction of global translation. Overall, the ER stress response aims to downregulate global translation and upregulate the expression of
53 FIGURE 13: ER Stress Marker Comparison between WT and Nedd4-1 KO MEFs Levels of the ER stress markers phopsho-IRE1, Grp78/94 and phosph-eIF2 α were determined by immunoblotting of lysates from 2 WT and 2 Nedd4-1 KO MEF clones to determine if they were elevated in the KO MEFs. Levels of all 3 markers did not appear to be elevated in the Nedd4-1 KO MEFs.
54 chaperones to combat the source of the stress [100].
The Nedd4-1 KO and WT MEFs were examined for signs of ER stress by immunoblot analysis, as visualized by levels of the aforementioned ER stress markers. As seen in Figure 13, there did not appear to be an elevation of these markers in the Nedd4-1 KO
MEFs in steady state conditions in this preliminary experiment.
7. Decreased Levels of Rac1 protein in the Nedd4-1 KO MEFs
Tight Junctions (TJs) exist between epithelial and endothelial cells, on their apical side, to prevent the unregulated transfer of materials between cells. TJ components are also involved in regulating cell proliferation, transformation into cancer cells and metastasis
[101]. Nedd4-1 has been shown to have a role in TJ maturation, through its interaction with the Rho family GTPase Rac1 and Disheveled 1(Dvl1), a component of canonical Wnt signaling. Nedd4-1 becomes involved once recruited to the cell membrane by Rac1, where it is then brought into close proximity to Dvl1, allowing for its Nedd4-1 mediated polyubiquitination and subsequent proteasomal degradation [40]. This was demonstrated to be independent of whether Rac1 is GTP bound or GDP bound. In addition, the Nedd4-1 interactor Angiomotin (AMOT) [82] partially regulates Rac1 and Cdc42 (another closely related Rho GTPase) activity by interacting with their GTP Activating Protein (GAP), Rich1
[55].
Rac1 has also been described to positively regulate mTORC1 and mTORC2 signaling, where levels of Rac1 affected mTOR's subcellular localization. Cells in which
Rac1 was knocked down demonstrated a more diffused mTOR localization and reduced
55 Figure 14: Decreased levels of Rac1 in the Nedd4-1 KO MEFs, relative to WT A) Immunoblot of Rac1 levels in Nedd4-1 WT and KO MEFs Shown is an Immunoblot from one of the experiments measuring differences in Rac1 levels between the WT and Nedd4-1 KO MEFs in steady state conditions. B) Quantification of Rac1 levels in Nedd4-1 WT and KO MEFs Pooled data from two experiments, with two clones of each gentoype, is represented. The Student's t-test confirms that this difference is significant, with p<0.05. The error bars represent standard error.
56 signalling. This process is also dependent on Rac1 protein levels, rather than Rac1 activity
[102].
As such, I performed some preliminary experiments in the WT and Nedd4-1 KO
MEFs, aiming to detect differences in Rac1. As seen in Figure 14, Immunoblot Analysis detected a significant decrease in Rac1 levels in the Nedd4-1 KO MEFs. This figure represents data from two experiments using 2 clones each of the Nedd4-1 KO and WT MEFs.
This demonstrates that Nedd4-1 contributes to the increase of Rac1 levels and, as an extension, possibly has an effect on the aforementioned functions of Rac1.
Summary of Part A - Characterization of Nedd4-1 KO MEFs
The above experiments show that there are indeed differences between the WT and
Nedd4-1 KO MEFs, especially at the morphological level concerning rough endoplasmic reticulum and the lysosomes, with the latter demonstrating differences in both localization and overall morphology. In addition, experiments examining mTORC1 signalling in both WT and Nedd4-1 KO MEFs suggested that mTORC1 signalling is not overactive in the Nedd4-1
KO MEFs.
Part B: Examining the AMOT and Nedd4-1 Interaction
1. AMOT and Nedd4-1 interact in HEK293T cells
Our lab had performed Mass Spectrometry experiments on HEK293T cell lysates to identify novel interactors of Nedd4-1, with the goal of uncovering new roles for Nedd4-1. A protein named Angiomotin (AMOT) was identified as a specific interactor of Nedd4-1.
57 Figure 15: Validation of the Nedd4-1 and Angiomotin interaction HEK293T cells, which endogenously express both Nedd4-1 and Angiomotin, were lysed and AMOT was immunoprecipitated. Lysates and immunoprecipitates were then immunoblotted for AMOT and Nedd4-1, confirming the interaction of endogenous AMOT and Nedd4-1 in HEK293T cells.
58 Immunoprecipitation experiments were performed to validate the interaction of Angiomotin and Nedd4-1 in the HEK293T cell system, as this cell line endogenously expresses high levels of both isoforms, p130 and p80, of Angiomotin [44], as well as Nedd4-1. As seen in the Immunoblot in Figure 15, Nedd4-1 co-immunoprecipitates with endogenous AMOT in
HEK293Ts, validating the interaction of these proteins in this cellular system.
2. Nedd4-1 knockdown in HEK293T results in an increase of endogenous AMOT levels
Studies reported that the interaction between Angiomotin and Nedd4-1 mediates to polyubiquitination of p130-Angiomotin, leading to its subsequent proteasomal degradation
[82]. In order to determine if Nedd4-1 knockdown is sufficient to cause an increase in endogenously expressed p130-AMOT, a HEK293T cell line with Nedd4-1 stably knocked down through shRNA treatment was created. As seen in Figure 16, the cell line with Nedd4-1 knocked down had increased levels o f Angiomotin relative to control cells treated with a randomly scrambled, non-specific shRNA. These experiments also examined the effects of the transfection of Nedd4-1 WT, Nedd4-1 CS (a catalytically inactive mutant), Nedd4-2 WT and Nedd4-2 CS with regard to Angiomotin levels. As seen in Figure 16, there is a decrease in Angiomotin levels in all cases, even where the transfected Nedd4-family member was catalytically inactive. These results suggest that the loss of Nedd4-1 is sufficient to cause an increase in AMOT levels. However, because there are similar levels of AMOT expression in the presence of both wild type Nedd4-1 and Nedd4-2 and catalytically inactive Nedd4-1 and
Nedd4-2, as seen in the quantification in Panel B of Figure 16, I cannot attribute the
59 FIGURE 16: Nedd4-1 knock down leads to an increase in endogenous Angiomotin levels A) Immunblot of AMOT levels in Nedd4-1 knockdown HEK293T cells Shown is an immunoblot from one of the experiments examining the effect of Nedd4-1 knockdown on endogenous AMOT levels. B) Quantification of the Effect of Nedd4-1 knockdown on AMOT levels HEK293T cells with Nedd4-1 knocked down by shRNA showed significantly increased levels of endogenous Angiomotin relative to cells treated with a scrambled control shRNA, with p<0.05. Reconstitution by transfection with Nedd4-1 WT (denoted 1WT), the catalytically-inactive Nedd4-1 CS (denoted 1CS), Nedd4-2 WT (denoted 2WT) and Nedd4-2 CS (denoted 2CS) all resulted in a significant decrease in Angiomotin levels, with p<0.05. However, the differences between Nedd4-1 WT and Nedd4-2 with their catalytically inactive counterparts was not significant, with p>0.05. This represents the data of two replicate experiments, with error bars showing standard error.
60 decreases seen in samples with Nedd4-1 WT and Nedd4-2 to increased ubiquitination and proteasomal degradation of AMOT. One possibility is that the overexpression of these
Nedd4 family-members is taxing the translational machinery in the cell, which manifests as a decrease in all protein levels, including AMOT.
3. Interaction with Nedd4-1 is abrogated when Angiomotin's three PY motifs are mutated
WW domains typically mediate protein-protein interactions through binding PY motifs, with the sequence L/PPxY [103]. Two examples of proteins that make use of this mode of interaction include the Nedd4 family members [8] and components of the Hippo
Signalling Pathway [72, 102]. The p130 isoform of AMOT contains an N-terminal extension, containing three such PY motifs at amino acid positions 106-109, 239-242, and 284-287, which does not exist in the p80 isoform. In addition, one study had shown that mutation of these PY motifs was sufficient to abrogate the interaction between Nedd4-1 and p130-AMOT
[82].
To continue my investigation of the Nedd4-1 and p130-AMOT interaction, I wanted to generate my own triple PY mutant (3PYmut) to both act as a negative control for binding experiments and to be used in future experiments to test the effects of p130-AMOT that is not able to interact with Nedd4-1 in a more functional context. As such, I mutated all three
PY motifs in p130-AMOT such that the the second Proline residue in each PY motif was mutated to an Alanine. In order to confirm that these mutations abrogated the Nedd4-1 and p130-AMOT interaction, I transfected HEK293T cells with V5-tagged Nedd4-1 with either
61 FIGURE 17: Mutation of AMOT's three PY motifs abrogates interaction with Nedd4-1 and Nedd4-2 A) Mutation of AMOT's 3 PY motifs disrupts the interaction with Nedd4-1 WT This immublot demonstrates that while WT AMOT co-immunoprecipitates with Nedd4-1, 3PYmut AMOT does not. B) Mutation of AMOT's 3 PY motifs disrupts the interaction with Nedd4-1 and Nedd4- 2 This immunoblot shows that the 3PYmut AMOT protein does not co-immunoprecipitate with Nedd4-1 and Nedd4-2, both WT and catalytically inactive variants.
The 3PYmut AMOT protein consistently appears at a higher molecular weight than its wild type counterpart. One reason may be that mutating the PY motifs results in change in biochemical properties. However, this is not certain.
62 WT 2HA-tagged AMOT or 3PYmut 2HA-tagged AMOT and then immunoprecipitated
Nedd4-1 using an anti-V5 antibody. As seen in Panel A of Figure 17, WT 2HA-tagged
AMOT co-immunoprecipitated with V5-Nedd4-1, but 3PYmut 2HA-AMOT did not. I also wanted to ensure that this was the case for the other Nedd4 variants I would be using in my experiments. As seen in Panel B of Figure 17, this 3PYmut AMOT did not immunoprecipitate with V5-tagged Nedd4-1 WT, Nedd4-1 CS (catalytically inactive),
Nedd4-2 WT or Nedd4-2 CS. These experiments confirmed that I could use this 3PYmut
AMOT construct to act as a negative control in future experiments.
4. AMOT interacts with Nedd4-1 and Nedd4-2 in HeLa cells
Up to this point, many of the experiments involving Angiomotin and Nedd4-1 had been performed in HEK293T cells because they possess high levels of both isoforms of
Angiomotin [44]. However, this posed a problem in experiments designed to study the affects of introducing the 3PYmut variant of Angiomotin--the endogenous, WT Angiomotin was always expressed at a higher level that the exogenous proteins. This prevents the desired dominant-negative affect with overexpression of the ectopic protein, casting doubt on whether any future observations could be ascribed to the 3PYmut variant Angiomotin, especially given that the Angiomotin has been observed to dimerize via its central, coiled-coil domains [54]. This would allow for WT, endogenous Angiomotin to dimerize with the
3PYmut and possibly negate any effect of this mutant by allowing 3PYmut AMOT to indirectly interact with proteins that normally require the PY motifs. To circumvent this, a new system in which Angiomotin is not endogenously expressed was used--HeLa cells
63 FIGURE 18: Nedd4-1 and AMOT interaction is Preserved in HeLa cells Shown is an Immunoblot from a co-immunoprecipitation experiment that verified the interaction between Nedd4-1 and AMOT in HeLa cells, a cell line that does not endogenously express AMOT.
64 However, before proceeding with additional experiments, it was important to determine if previous experiments performed in HEK293T cells were reproducible in this new system.
One of these experiments was to test if Nedd4-1 and Nedd4-2 could interact with
Angiomotin in HeLa cells. To test this, I co-transfected HeLa cells with either WT or
3PYmut AMOT and V5-tagged Nedd4-1 or Nedd4-2. Figure 18 shows that this interaction is preserved in HeLa cells.
5. Increased ubiquitination of Angiomotin in the presence of Nedd4-1 and Nedd4-2 in
HeLa cells.
The same group that published the Nedd4-1 and p130-AMOT interaction also showed that p130-AMOT is a substrate of the Nedd4 family members Nedd4-1, Nedd4-2 and Itch and that polyubiquitination mediated by these Nedd4 family members targets p130-AMOT for proteasomal degradation [82]. That study demonstrated this in the HEK293T cell system. I wanted to examine if increased p130-AMOT polyubiquitination in the presence of
Nedd4-1 and Nedd4-2 could also be detected in HeLa cells. To test this, HeLa cells were co- transfected with 2HA-tagged, WT p130-AMOT either alone or with V5-tagged Nedd4-1 WT,
V5-tagged Nedd4-1 CS, V5-tagged Nedd4-2 WT or V5-tagged Nedd4-2 CS. An untransfected negative control was included as well.
In this experiment, lysates were first boiled in SDS to disrupt any non-covalent interactions, taking advantage of the fact the ubiquitination is a covalent modification. 2HA- tagged Angiomotin was then immunoprecipated using anti-HA antibodies, with the resulting
65 FIGURE 19: In HeLa cells, Wild type Angiomotin ubiquitination increases in the presence of Nedd4-1 and Nedd4-2 A) Immunoblot of AMOT Ubiquitination in the Presence of Nedd4s When HeLa cells are co-transfected with WT 2HA-AMOT and Nedd4-1 wild type, Nedd4-1 CS (the catalytically inactive mutant), Nedd4-2 wild type and Nedd4-2 CS, there is a noticeable increase in the levels of ubiquitin seen in the anti-HA immunoprecipitate. This is observed for samples co-transfected with both catalytically active Nedd4-1 and Nedd4-2, but not their catalytically-inactive mutants. B) Quantification of AMOT Ubiquitination in the Presence of Nedd4s Pooled data from two replicated experiments is represented here, showing that there is a significant increase in AMOT ubiquitination in the presence of WT Nedd4-1 and Nedd4-2. The differences observed between catalytically active (WT) and catalytically inactive (CS) Nedd4-1 and Nedd4-2 are also shown to be significantly different, as determined by the Student's t-test. Error bars show standard error.
Figure Legend: * = p<0.05 ** = p<0.001 *** = p<0.0001
66 67 immunoblots probed with anti-Ubiquitin antibodies. The resulting immunoblot in Panel A of
Figure 19 shows that there is an increase in AMOT polyubiquitination in the presence of WT
Nedd4-1 or WT Nedd4-2, as demonstrated by the appearance of high molecular weight smears, but not in the presence of their catalytically inactive variants. These differences in ubiquitination were also quantified and averaged for two experiments, as seen in Panel B of
Figure 19. This demonstrates that the presence of Nedd4-1 or Nedd4-2 leads to a significant increase in AMOT ubiquitination in HeLa cells. This experiment confirmed that the Nedd4-1 and p130-AMOT interaction leads to p130-AMOT polyubiquitination, as had previously only been shown in HEK293T cells [82].
6. Nedd4-1 and Nedd4-2 do not disrupt the interactions of Angiomotin with TAZ in
HeLa cells
Both the transcriptional co-activators YAP and TAZ and the E3 ligases Nedd4-1 and
Nedd4-2 have been reported to interact with p130-Angiomotin via its PY motifs and their respective WW domains [63, 64, 82]. There has been some recent interest in determining whether these interactions are competitive, and if yes, what effects that might have on Hippo signalling. There are currently conflicting results as to whether AMOT's interaction with
YAP is competitive with its interaction with Nedd4-1 [82, 103]. As such, I wanted to examine the effects of Nedd4 on the TAZ and p130-AMOT interaction. In particular, I wanted to determine if the addition of Nedd4 would cause decreased amounts of p130-AMOT to co- immunoprecipitate with TAZ. In order to test this, I co-transfected Hela cells with with
FLAG-tagged TAZ with either HA-tagged WT or 3PYmut AMOT. Additional samples had
68 V5-tagged Nedd4-1 WT, Nedd4-1 CS, Nedd4-2 WT or Nedd4-2 CS.
Cells were lysed 24 hours post-transfection and anti-FLAG (TAZ) immunoprecipitation was carried out for 2 hours. As can be seen Panel A of Figure 20, there does not appear to be a reduction in the amount of WT AMOT that coimmunoprecipitates with FLAG- tagged TAZ in the presence of Nedd4-1 and Nedd4-2. The data for three replicate experiments were were quantified in Panel B of Figure 20 and statistical analysis determined there is no significant change (defined as p<0.05) between the amount of p130-
AMOT co-immunoprecipitating with TAZ when Nedd4s are added. The results of these experiments support a non-competitive binding model for the interactions between p130-
AMOT and TAZ and p130-AMOT and Nedd4-1 and Nedd4-2.
7. The introduction of Nedd4s does not disrupt AMOT and YAP1 interaction
The same experiments were performed to examine if the AMOT and YAP1 interaction could be disrupted with the introduction of the Nedd4s, in case of any differences between YAP and TAZ which, as mentioned in previous sections, are not completely functionally redundant [76]–[78]. This experiment was performed in the same way where either FLAG-YAP1 alone, or with 2HA-AMOT WT or 2HA-AMOT 3PYmut were co- transfected into HeLa cells. Additional samples were also contransfected with the Nedd4 variants: V5- tagged Nedd4-1 WT, Nedd4-1 CS, Nedd4-2 WT or Nedd4-2 CS. As seen in
Figure 21, my experiments show that the addition of Nedd4-1 and Nedd4-2 does not significantly alter the amount of p130-AMOT co-immunoprecipitating with FLAG-YAP1
(with p>0.05).
69 FIGURE 20: The introduction of V5-tagged Nedd4s does not disrupt the interaction between FLAG-TAZ and HA-Angiomotin wild type A) Immublot for co-immunoprecipitation of p130-AMOT with TAZ in the presence of Nedd4s Shown is a sample immunoblot from one of the replicate experiments where HeLa cells were co-transfected with either FLAG-TAZ alone, with 2HA-AMOT WT or 2HA-AMOT 3PYmut, and with the Nedd4 variants to investigate if they could reduce the interaction between TAZ and AMOT WT. B) Quantification of co-immunoprecipitation of p130-AMOT with TAZ in the presence of Nedd4s This quantification graphically conveys the data from three replicate experiments measuring the co-immunoprecipitation of TAZ and p130-AMOT both in the absence and presence of Nedd4-1 and Nedd4-2, both WT and catalytically inactive variants (denoted CS). Comparisons of the co-immunoprecipitation of TAZ and p130-AMOT in the absence of Nedd4s and then with Nedd4-1 WT, Nedd4-1 CS, Nedd4-2 WT or Nedd4-2 CS did not show a significant difference, with p>0.05 for each one. The error bars show standard error and N=3.
70 71 FIGURE 21: The introduction of Nedd4 proteins does not disrupt binding between Angiomotin and YAP1 A) Immublot for co-immunoprecipitation of p130-AMOT with YAP1 in the presence of Nedd4s Shown is a sample immunoblot from one of the replicate experiments where HeLa cells were co-transfected with either FLAG-YAP1 alone, with 2HA-AMOT WT or 2HA-AMOT 3PYmut, and with the Nedd4 proteins to investigate if they could reduce the interaction between YAP1 and AMOT WT. B) Quantification of co-immunoprecipitation of p130-AMOT with YAP1 in the presence of Nedd4s This quantification graphically conveys the data from two replicate experiments measuring the co-immunoprecipitation of YAP1 and p130-AMOT both in the absence and presence of Nedd4-1 and Nedd4-2, both WT and catalytically inactive variants (denoted CS). Statistical analysis using the Student's t-test did not demonstrate a significant difference between the amounts of p130-AMOT co-immunoprecipitating with YAP1 in any of the conditions tested, with p>0.05. The error bars show standard deviation and N=2.
72 73 These two experiments demonstrate that the introduction of the Nedd4s does not cause a disruption in the p130-AMOT and YAP/TAZ interactions, supporting a non- competitive binding model.
74 Chapter 4: Discussion
75 Part A: Characterization of the Nedd4-1 KO MEFs
My studies performed on the Nedd4-1 KO MEFs and their WT counterparts have potentially revealed new information about the roles of the Nedd4-1 at the cellular level.
Starvation and re-stimulation experiments were performed in WT and Nedd4-1 KO
MEFs to compare mTORC1 activity between these two genotypes, to determine if overactivity in mTORC1 signalling was the reason for elevated levels of Grb10 in the Nedd4-
1 KO cells. My results show that mTORC1 was not overactive in the Nedd4-1 KO MEFs, hence it is not likely to be the cause of elevated Grb10 expression. It is possible that either an increase in Grb10 transcription and/or translation, or a decrease in its degradation (increased stability), may account for increased levels in the KO MEFs. As such, future experiments would include examining Grb10 expression in these contexts using reverse-transcription
PCR and half-life experiments using cycloheximide treatment.
The lysosome is the primary degradative organelle in the cell, an acidic compartment where exogenous materials and membrane-bound proteins can be broken down by its resident hydrolases [106]. In addition, the lysosomal compartment is important for the process of autophagy, where in conditions of nutrient deprivation, the cell sacrifices cellular materials (other organelles and proteins) to replenish the pool of amino acids and ensure cell survival [89, 90, 105, 106]. Active mTORC1 also resides on the lysosomal surface, in close proximity to its regulators: the RAG and RHEB GTPases [89].
Experiments performed in WT and the Nedd4-1 KO MEFs demonstrated that there are differences in the lysosomal compartment between the two genotypes. As part of pursuing information about mTORC1 between these two genotypes, the MEFs were
76 immunostained for both mTOR and the lysosomal marker, LAMP1. Confocal imaging of these cells revealed a striking difference in the lysosomal distribution between these genotypes. In steady state conditions, the WT MEFs showed a perinuclear lysosomal distribution, whereas the Nedd4-1 KO MEFs appeared to have a more diffused lysosomal distribution. Lysosomal redistribution in response to nutrient deprivation is well-documented
[89, 90]. This begged the question if the Nedd4-1 KO MEFs were suffering from some kind of chronic starvation, given they demonstrated an altered lysosomal distribution and they had been shown to grow more slowly relative to WT cells in steady state growth conditions [23,
34].
In addition, confocal images of the WT and Nedd4-1 KO MEFs immunostained for the lysosomal marker LAMP1 showed that the lysosomes in the Nedd4-1 KO MEFs appear somewhat bloated, a possible sign of a lysosomal storage disorder (LSDs). LSDs have been at the forefront since the discovery of the lysosome as the cell's main degradative organelle, with findings revealing that many early onset neurological disorders, such as Tay-Sachs, have such lysosomal defects [109] . There is also some precedent for Nedd4-1 involvement in the lysosomal compartment in the context of the correct trafficking of lysosomal proteins
(LAPTM4 and LAPTM5). Work performed in our lab has demonstrated that LAPTM5 requires association with catalytically active Nedd4-1 to be trafficked from the Golgi to the
Lysosome [38]. LAPTM4 has also been shown to require Nedd4-1 for proper trafficking to the lysosomal compartment [39]. LAPTM4b has also been been linked to Mucolipidosis, an
LSD [98].
As such, experiments comparing the proteolytic capacity of the WT and Nedd4-1 KO
77 MEFs were performed. These experiments, employing the molecular probes DQ BSA Green and Dextran Alexa-647, showed that the Nedd4-1 KO lysosomes were not protealytically defective. Interestingly, a higher ratio of intensities for DQ BSA/Dextran appeared for these
KO MEFs relative to the WT MEFs at all time points. One possible explanation for this could be that the internalized cargo is reaching the more peripherally distributed more quickly than in WT cells. Given that a DQ BSA signal only appears once the probe is hydrolytically cleaved, it stands to reason that if the probe reaches the more peripheral lysosomes of the Nedd4-1 KO MEFs more quickly, that at the same time points, the DQ BSA will have been in the lysosomal compartment for longer in the KO MEFs. This could explain why the ratio is higher for the KO MEFs from the very first time point. However, given that the ratio for DQ BSA/Dextran is higher in the KO MEFs than the WT cells at all time points, perhaps the lysosomal hydrolases in the KO MEFs are also more active. Altogether, these observations demonstrate that lysosomal proteolysis is not impaired in the Nedd4-1 KO
MEFs relative to the WT cells.
My work shows that there were many striking differences between the WT and the
Nedd4-1 KO MEFs in the context of the lysosomal compartment. As visualized by Electron
Microscopy, which has long been used as a diagnostic tool for human LSDs [110], there appears to be vacuolarization of the lysosomal compartment such that the lysosomal compartment appears to be mostly devoid of electron density, except in some vacuoles that have some dense pockets of density along the edges of the lysosomal membrane. This appearance is characteristic of a subset of the LSDs, where the fixation process can deplete electron density for compounds such as glycogen and neutral lipids. In particular, the
78 lysosomes in electron micrographs of the Nedd4-1 KO MEFs very closely resemble electron micrographs of Galactosialidosis patient fibroblasts, as seen in Figure 22 [111].
Galactosialidosis is an LSD that results from the lack of Protective Protein/Cathepsin A, which itself is required for the lysosomal targeting and activity of neuroaminidase 1 (Neu1, neuroaminidases are also known as sialidases) and beta-galactosidase, independent of the mannose-6-phosphate receptor [91, 92]. Neu1 is a lysosomal enzyme that catalyzes the hydrolytic removal of terminal sialic acid residues from glycoproteins and whose mislocalization or absence results in the LSD Sialidosis. There are multiple cellular sialidases: Neu1 (is lysosomal resident), Neu2 (cytosolic), Neu3 (plasma membrane) and
Neu4 (lysosome), where Neu1 is the most ubiquitously expressed and implicated in genetic human disease [114]. Lack of Neu1 activity due to the absence of PPCA and the resulting improper trafficking of Neu1 leads to secondary sialidosis. In the context of galactosialidosis, there is evidence that all three PPCA, Neu1 and beta-galactosidase function in a trimeric complex [113]. It would be interesting to determine if sialidase and beta-galactosidase activity is compromised in the Nedd4-1 KO MEFs and, if yes, to determine the mechanism responsible in the context of Nedd4-1.
79 FIGURE 22: Comparison of Nedd4-1 KO MEFs to Galactosialidosis Patient Fibroblasts A) Electron Micrographs of the Nedd4-1 KO MEFS Particular points of interest have been been labelled to emphasize differences between the WT and Nedd4-1 KO MEFs. B) Electron Micrographs of Galactosialidosis Patient Fibroblasts The same points of interest (lysosomes and rough endoplasmic reticulum) have been labelled as a basis for comparison.
A comparison of these images shows that the he vacuolar structures seen in the Nedd4-1 KO MEFs (by TEM) resemble the lysosomes seen in Galactosialidosis patient fibroblasts.
Figure legend: Lyso - Lysosome MVB - Multivesicular Body RER - Rough Endoplasmic Reticulum
(Electron micrographs of Sialidosis and Galactosialidosis patient fibroblasts (Panel B) is adapted from Seyrantepe, V., et al , 2004, [111])
80 81 As seen in above images, the Nedd4-1 KO MEFs also have distended Rough
Endoplasmic Reticulum (RER), a sign of ER stress [99]. As such, preliminary experiments were carried out to determine if there were increased amounts of the ER stress markers phospho-IRE1 α , BiP (also known as Grp 78, a chaperone of the Hsp70 family), Grp 94 (a chaperone of the Hsp90 family) and phospho-eIF2 α [94, 95]. Immunoblot analysis of lysates from the WT and Nedd4-1 KO MEFs in steady state conditions did not demonstrate increased levels of these ER stress markers in the Nedd4-1 KO MEFs in steady state conditions. Despite this, the electron micrographs provide strong evidence that these cells are stressed [99]. One possible explanation for this discrepancy is that these KO MEFs have achieved an altered state of homeostasis that allows the cells to survive in conditions of chronic stress. One way to test this would be to acutely stress cells using a pharmacological
ER stress inducers, such as Tunicamycin or Brefeldin A, to assess any differences in response between the two genotypes. This response can be measured through using immunoblotting, using rt-PCR to examine chaperone mRNAs and by measuring cell survival after treatment.
Interestingly, the induction of the Unfolded Protein Response (UPR) has been documented in cells with perturbed lysosomal homeostasis. Experiments performed in cells with lysosomal storage disorders demonstrated elevated levels of the previously mentioned
ER stress markers, as well as elevated levels of mRNA encoding ER-resident chaperones such as Calnexin [115]. As such, there is precedent for LSDs contributing to ER stress. This is especially significant given that PPCA is a chaperone [116] and that expression of Neu1 in the absence of PPCA leads to its aggregation in the ER[113].
82 Lastly, preliminary experiments performed in the WT and Nedd4-1 KO MEFs revealed that there is a significant decrease in overall Rac1 levels in the Nedd4-1 KO MEFs relative to WT. It would be interesting to determine the cause of these differing levels by examining differences in protein half-life and Rac1 mRNAs. This is particular interesting given that Nedd4-1's involvement in TJ maturation has been demonstrated to involve Rac1- mediated recruitment, dependent on Rac1 levels and not its GTP-state [40]. It would also be interesting to test if there are any differences in Rac1 activity, as measured through its co- immunoprecipitation with the purified PAK-PBD (protein binding domain)[117].
Part B: Angiomotin (AMOT) and Nedd4-1 interactions
In the past few months, it has been described that p130-AMOT interacts with
Nedd4-1 and that this interaction is an important step towards Nedd4-1-mediated polyubiquitination of p130-AMOT [82] . However, there has been very little information about what the functional relevance of this interaction. Others have performed experiments exploring how the Nedd4 family of E3 ligases can affect p130-AMOT's known functions [82,
98], with p130-AMOT's role as an inhibitor of YAP and TAZ-mediated transciptional co- activation being of particular interest [63,64]. There is some potential overlap given that p130-AMOT employs its PY motifs in its interaction with both the Nedd4-family members and YAP and TAZ.
To examine the effects of Nedd4 on AMOT levels, I used to HEK293T cells with
Nedd4-1 knocked down, where I expected the knockdown of Nedd4-1 to increase levels of
AMOT relative to cells treated with control shRNA. A modest, but significant increase was
83 FIGURE 23: Proposed models for AMOT interaction with Nedd4 and YAP/TAZ A) The competition model where the interaction between Nedd4 and p130-Angiomotin is mutually exclusive with the interaction between YAP/TAZ and p130-Angiomotin B) The binding model where the Nedd4, p130-Angiomotin and YAP/TAZ can form a trimeric complex.
84 observed. Soon after this experiment, a group published observations that Nedd4-1, Nedd4-2 and Itch could all interact with and target AMOT for proteasomal degradation [82]. Other samples that had Nedd4-1 re-introduced and while they showed a decrease in lysate levels of p130-AMOT, samples transfected with Nedd4-1 CS also showed a decrease, although not as much as Nedd4-1 WT. One possible explanation for this could be that overexpressing these exogenous proteins taxed the protein synthesis machinery, resulting in lower levels of all expressed proteins.
In order to explore the functional relevance of the AMOT and Nedd4-1 interaction, particularly in the context of AMOT's previously described roles in the Hippo Signalling pathway [63, 64, 74] I wanted to determine if, in the presence of the Nedd4-1 or Nedd4-2, there is a decrease in YAP/TAZ interaction with AMOT. I used the HeLa cell system, as it does not endogenously express AMOT [44] and allows me to use 3PYmut AMOT as a negative control. My experiments show that the introduction of Nedd4s does not result in decreased amounts of WT AMOT co-immunoprecipitating with FLAG-tagged YAP1 or TAZ.
In reference to the potential binding models, where either a competitive binding model was pictured or a trimeric complex, as seen in Figure 23, I believe the competitive binding model is invalid, since I did not observe disruptions of the AMOT and Nedd4 interaction in the presence of YAP1 or TAZ. However, that does not necessarily mean that they exist as a complex, even if there is some new evidence to suggest a trimeric complex consisting of YAP1, AMOT and the Nedd4-family member, Itch [118]. There is also the possibility that both Nedd4 and YAP/TAZ can interact with WT AMOT at different times, limited by other factors, such as subcellular localization, for example.
85 There has been recent evidence of a trimeric complex comprising of Angiomotin,
YAP and Itch, although in this case Itch-mediated ubiquitination of Angiomotin led to increased stability of Angiomotin [118]. This is of particular interest given that Itch is the E3 ligase responsible for regulating LATS1/2, the kinase that phosphorylates YAP and TAZ as part of Hippo signalling. This study demonstrated that the assembly of this trimeric complex led to a switch in Itch function, from targeting LATS1/2, a negative regulator of YAP and
TAZ, for degradation to targeting YAP, introducing a new means of YAP regulation parallel to
Hippo Signalling [118].
Recent studies have also implicated Nedd4-1 as a regulator of the Hippo signalling pathway independent of its interaction with AMOT. Studies have demonstrated that like Itch,
Nedd4-1 can polyubiquitinate and target LAT1/2 kinase for degradation[119]. This is interesting because, as a negative regulator of Hippo signalling, it is in accordance with
Nedd4's known role of a positive regulator of growth. It would be interesting to test if there are changes in the expression of TEAD-responsive genes as a result of increased Nedd4-1 levels.
86 Future Directions
Part A: Characterization of the Nedd4-1 KO MEFs
These studies have revealed striking differences between the WT and Nedd4-1 KO
MEFs generated in our lab, differences that may help reveal new information about what additional role Nedd4-1 might have in normal lysosomal morphology and, possibly, function.
1) Lysosomal Morphology and Function
As much as the the vacuolar structures visualized in the Nedd4-1 KO MEFs resemble lysosomes in sialidosis and galactosialidosis patient fibroblasts, there needs to be confirmation that these structures are actually the lysosomal compartment. This can be confirmed by Immunoelectron microscopy, where an antibody that marks lysosomes (eg:
LAMP1) conjugated with a gold particle is used to provide the electron density that is detected by the microscope.
Given the strong phenotypic similarities in lysosomal morphology, it would be interesting to test both the WT and Nedd4-1 KO MEFs for sialidase and beta-galactosidase activity. There exists a synthetic, fluorescent substrate that can be used for sialidosis assays, called 2′-(4-methylumbelliferyl)- α-D- N-acetylneuraminic acid (4-MU-NANA) [94].
2) Lysosomal Distribution
In order to study the link between the absence of Nedd4-1 and the change in lysosomal distribution to the more peripheral distribution seen in the Nedd4-1 KO MEFs, it would be interesting to acutely knockdown Nedd4-1 and then verify if this change is
87 observed.
3) Inducing ER stress in the WT and KO MEFs
A very preliminary experiment comparing levels of the known ER stress markers failed to show differences between the WT and Nedd4-1 KO MEFs. One way to measure these differences, as the distended ER suggests there is ER stress, is to induce ER stress in these cells using drugs such as Tunicamycin. Differences in phospho-IRE1alpha and phospho-eIF2alpha between the WT and Nedd4-1 KO MEFs would corroborate the evidence in the electron micrographs. In addition, given that the transcription of chaperones increases in response to ER stress induction, measuring the mRNA levels of chaperones such as BiP through Reverse Transcription PCR can provide an independent measure of the ER stress response.
4) Exploring other reasons for elevation of Grb10 levels
Experiments measuring half-life of Grb10, through cycloheximide pulse-chase experiments and rtPCR to examine mRNA levels can provide more information about why
Grb10 levels are elevated in the Nedd4-1 KO MEFs. Other additional experiments will be required to delineate the biochemical pathways that lead to normal suppression of Grb10 by
Nedd4.
4) Exploring other differences in Rac1 between WT and Nedd4-1 KO MEFs
My experiments have shown that there are decreased levels of Rac1 in the absence of
88 Nedd4-1, as the Nedd4-1 KO MEFs exhibit lower Rac1 levels than the WT MEFs. It would be interesting to test differences in Rac1 activity by co-immunprecipitation experiments with
PAK-PBD (purified binding domain), as well as exploring the signaling pathways involved.
5) Finding novel differences between WT and Nedd4-1 KO MEFs
a) Mass Spectrometry experiments to identify Nedd4-1 interactors, that need to be
validated and then studied.
b) Studying differences in autophagy between the two genotypes, as it is one of the
points of intersection of lysosomes of mTORC1 activity.
c) Examining if the increased cell size observed for the Nedd4-1 KO MEFs, relative
to WT, is Rapamycin sensitive and therefore dependent on mTORC1 activity.
d) Investigate differences in gene expression between the WT and KO MEFs through
Microarray.
Part B: Examination of the AMOT and Nedd4-1 Interaction
1) In-vitro binding experiments
While it has been demonstrated that Nedd4-1 and Nedd4-2 interact with and increase the ubiquitination of WT p130-Angiomotin, this has thus far only been performed using cellular lysates. It is important to investigate if this interaction is a direct through in vitro binding experiments. This can be done using in vitro binding assays using purified proteins.
2) Determining the affect of TAZ and YAP1 on the interaction between AMOT and
89 Nedd4s
Experiments have already been carried out using YAP 1 and TAZ and examining if the introduction of Nedd4-1 and Nedd4-2 alter the amount of AMOT that co- immunoprecipitates with YAP1 or TAZ. The alternative experiments need to be performed where the effect and YAP1 or TAZ on the interaction between AMOT and Nedd4-1 and
Nedd4-2.
3) Exploring the role of the Nedd4s in the Hippo Signalling Pathway
The goal of the experiments involving YAP1, TAZ and AMOT is to determine if the
Nedd4s affect AMOT-mediated regulation of YAP1 and TAZ given that Nedd4 has been shown to:
a) interact with AMOT through its PY motifs, the same motifs used by YAP1 and
TAZ
b) target AMOT for proteasomal degradation through ubiquitination.
As such, it would be interesting to explore the affects of Nedd4 on YAP1 and TAZ co- transcriptional activity. Two ways this can be determined is by examining YAP1 and TAZ subcellular localization by immunofluorescence confocal microscopy and by measuring
YAP1 and TAZ transcriptional co-activation by reverse transcription PCR.
Conclusions
Part A: Characterization of the Nedd4-1 KO MEFs
My studies have determined novel differences between Nedd4-1 WT and KO MEFs, particularly at the lysosomal level, where I have demonstrated there is an altered lysosomal
90 distribution and that the Nedd4-1 KO MEFs resemble fibroblasts from Galactosialidosis patients.
Part B: Examination of the AMOT and Nedd4-1 Interaction
My experiments were designed to examine two different binding models: one where the interaction between the Nedd4s and AMOT competes with the interaction between YAP1 or
TAZ and AMOT, using the same 3 PY motifs found in the regarding the interactions between the Nedd4s and AMOT and the other where a trimeric complex (AMOT/Nedd4/YAP or TAZ) is formed. My results provide evidence against the competitive model of binding seen in
Figure 23.
Overall, my work over the last two years demonstrates novel contributions of Nedd4 to cellular and biochemical function of cells.
References
[1] L. N. Micel, J. J. Tentler, P. G. Smith, and G. S. Eckhardt, “Role of ubiquitin ligases and the proteasome in oncogenesis: novel targets for anticancer therapies.,” J. Clin. Oncol. , vol. 31, no. 9, pp. 1231–8, Mar. 2013. [2] P. de Bie and a Ciechanover, “Ubiquitination of E3 ligases: self-regulation of the ubiquitin system via proteolytic and non-proteolytic mechanisms.,” Cell Death Differ. , vol. 18, no. 9, pp. 1393–402, Sep. 2011. [3] P. Xu, D. M. Duong, N. T. Seyfried, D. Cheng, Y. Xie, J. Robert, J. Rush, M. Hochstrasser, D. Finley, and J. Peng, “Quantitative proteomics reveals the function of unconventional ubiquitin chains in proteasomal degradation.,” Cell , vol. 137, no. 1, pp. 133–45, Apr. 2009. [4] H. Tanno and M. Komada, “The ubiquitin code and its decoding machinery in the endocytic pathway.,” J. Biochem. , vol. 153, no. 6, pp. 497–504, Jun. 2013. [5] D. Komander and M. Rape, “The ubiquitin code.,” Annu. Rev. Biochem. , vol. 81, pp. 203–
91 29, Jan. 2012. [6] T. Kirisako, K. Kamei, S. Murata, M. Kato, H. Fukumoto, M. Kanie, S. Sano, F. Tokunaga, K. Tanaka, and K. Iwai, “A ubiquitin ligase complex assembles linear polyubiquitin chains.,” EMBO J. , vol. 25, no. 20, pp. 4877–87, Oct. 2006. [7] E. Rieser, S. M. Cordier, and H. Walczak, “Linear ubiquitination: a newly discovered regulator of cell signalling.,” Trends Biochem. Sci. , vol. 38, no. 2, pp. 94–102, Feb. 2013. [8] D. Rotin and S. Kumar, “Physiological functions of the HECT family of ubiquitin ligases.,” Nat. Rev. Mol. Cell Biol. , vol. 10, no. 6, pp. 398–409, Jun. 2009. [9] S. Kumar, K. F. Harvey, M. Kinoshita, N. G. Copeland, M. Noda, and N. a Jenkins, “cDNA cloning, expression analysis, and mapping of the mouse Nedd4 gene.,” Genomics , vol. 40, no. 3, pp. 435–43, Mar. 1997. [10] S. Kumar, Y. Tomooka, and M. Noda, “Identification of a set of genes with developmentally down-regulated expression in the mouse brain,” Biochem. Biophys. Res. … , vol. 185, no. 3, pp. 1155–1161, 1992. [11] O. Staub, S. Dho, P. C. Henry, J. Correa, T. Ishikawa, J. Mcglade, and D. Rotin, “WW domains of Nedd4 bind to the proline-rich PY motifs in the epithelial Na + channel deleted in Liddle ’ s syndrome,” vol. 15, no. 10, pp. 2371–2380, 1996. [12] V. Kanelis, D. Rotin, and J. D. Forman-kay, “letters Solution structure of a Nedd4 WW domain – ENaC peptide complex,” pp. 407–412, 2001. [13] C. Lu, S. Pribanic, A. Debonneville, C. Jiang, and D. Rotin, “The PY motif of ENaC, mutated in Liddle syndrome, regulates channel internalization, sorting and mobilization from subapical pool.,” Traffic , vol. 8, no. 9, pp. 1246–64, Sep. 2007. [14] R. P. Lifton, A. G. Gharavi, D. S. Geller, and H. Hughes, “Molecular mechanisms of human hypertension.,” vol. 104, pp. 545–556, 2001. [15] H. Abriel, J. Loffing, J. F. Rebhun, J. H. Pratt, L. Schild, J. D. Horisberger, D. Rotin, and O. Staub, “Defective regulation of the epithelial Na+ channel by Nedd4 in Liddle’s syndrome.,” J. Clin. Invest. , vol. 103, no. 5, pp. 667–73, Mar. 1999. [16] E. Kamynina, C. Debonneville, M. Bens, a Vandewalle, and O. Staub, “A novel mouse Nedd4 protein suppresses the activity of the epithelial Na+ channel.,” FASEB J. , vol. 15, no. 1, pp. 204–214, Jan. 2001. [17] P. P. Shi, X. R. Cao, E. M. Sweezer, T. S. Kinney, N. R. Williams, R. F. Husted, R. Nair, R. M. Weiss, R. A. Williamson, C. D. Sigmund, P. M. Snyder, O. Staub, J. B. Stokes, B. Yang, H. Rf, R. Nair, W. Rm, W. Ra, and S. Cd, “Salt-sensitive hypertension and cardiac hypertrophy in mice deficient in the ubiquitin ligase Nedd4-2,” vol. 52242, pp. 462–470, 2008. [18] C. Ronzaud, D. Loffing-cueni, P. Hausel, A. Debonneville, S. R. Malsure, N. Fowler- jaeger, N. A. Boase, R. Perrier, M. Maillard, B. Yang, J. B. Stokes, R. Koesters, S.
92 Kumar, E. Hummler, J. Loffing, and O. Staub, “Renal tubular NEDD4-2 deficiency causes NCC-mediated salt-dependent hypertension.” [19] E. Hummler, P. Barker, and J. Gatzy, “Early death due to defective neonatal lung liquid clearance in αENaC-deficient mice,” Nat. … , 1996. [20] T. Kimura, H. Kawabe, C. Jiang, W. Zhang, Y. Xiang, C. Lu, and M. W. Salter, “Deletion of the ubiquitin ligase Nedd4L in lung epithelia causes cystic fibrosis-like disease,” pp. 2–7, 2011. [21] S. H. Donaldson and R. C. Boucher, “Sodium channels and cystic fibrosis.,” Chest , vol. 132, no. 5, pp. 1631–6, Nov. 2007. [22] B. Yang and S. Kumar, “Nedd4 and Nedd4-2: closely related ubiquitin-protein ligases with distinct physiological functions,” Cell Death Differ. , vol. 17, no. 1, pp. 1–21, 2009. [23] F. Fouladkou, C. Lu, C. Jiang, L. Zhou, Y. She, J. R. Walls, H. Kawabe, N. Brose, R. M. Henkelman, A. Huang, B. G. Bruneau, and D. Rotin, “The ubiquitin ligase Nedd4-1 is required for heart development and is a suppressor of thrombospondin-1.,” J. Biol. Chem. , vol. 285, no. 9, pp. 6770–6780, Feb. 2010. [24] Y. Liu, R. W. Oppenheim, Y. Sugiura, and W. Lin, “Abnormal development of the neuromuscular junction in Nedd4-deficient mice.,” Dev. Biol. , vol. 330, no. 1, pp. 153–66, Jun. 2009. [25] B. Ing, A. Shteiman-Kotler, M. Castelli, P. Henry, Y. Pak, B. Stewart, G. L. Boulianne, and D. Rotin, “Regulation of Commissureless by the ubiquitin ligase DNedd4 is required for neuromuscular synaptogenesis in Drosophila melanogaster.,” Mol. Cell. Biol. , vol. 27, no. 2, pp. 481–96, Jan. 2007. [26] a Morrione, P. Plant, B. Valentinis, O. Staub, S. Kumar, D. Rotin, and R. Baserga, “mGrb10 interacts with Nedd4.,” J. Biol. Chem. , vol. 274, no. 34, pp. 24094–24099, 1999. [27] A. Morrione, “Grb10 adapter protein as regulator of insulin-like growth factor receptor signaling.,” J. Cell. Physiol. , vol. 197, no. 3, pp. 307–11, Dec. 2003. [28] L. J. Holt and K. Siddle, “Grb10 and Grb14: enigmatic regulators of insulin action--and more?,” Biochem. J. , vol. 388, no. Pt 2, pp. 393–406, Jun. 2005. [29] M. Charalambous, F. M. Smith, W. R. Bennett, T. E. Crew, F. Mackenzie, and A. Ward, “Disruption of the imprinted Grb10 gene leads to disproportionate overgrowth by an Igf2-independent mechanism.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 100, no. 14, pp. 8292–7, Jul. 2003. [30] L. Wang, B. Balas, C. Y. Christ-Roberts, R. Y. Kim, F. J. Ramos, C. K. Kikani, C. Li, C. Deng, S. Reyna, N. Musi, L. Q. Dong, R. a DeFronzo, and F. Liu, “Peripheral disruption of the Grb10 gene enhances insulin signaling and sensitivity in vivo.,” Mol. Cell. Biol. , vol. 27, no. 18, pp. 6497–505, Sep. 2007.
93 [31] A. Vecchione, A. Marchese, P. Henry, D. Rotin, and A. Morrione, “The Grb10 / Nedd4 Complex Regulates Ligand-Induced Ubiquitination and Stability of the Insulin-Like Growth Factor I Receptor,” vol. 23, no. 9, pp. 3363–3372, 2003. [32] G. Monami, V. Emiliozzi, and A. Morrione, “Grb10/Nedd4-mediated multiubiquitination of the insulin-like growth factor receptor regulates receptor internalization.,” J. Cell. Physiol. , vol. 216, no. 2, pp. 426–37, Aug. 2008. [33] K. Siddle, “Signalling by insulin and IGF receptors: supporting acts and new players.,” J. Mol. Endocrinol. , vol. 47, no. 1, pp. R1–10, Aug. 2011. [34] X. Cao, N. Lill, and N. Boase, “Nedd4 controls animal growth by regulating IGF-1 signaling,” … Signal. , vol. 1, no. 38, pp. 1–20, 2008. [35] Y. Yu, S.-O. Yoon, G. Poulogiannis, Q. Yang, X. M. Ma, J. Villén, N. Kubica, G. R. Hoffman, L. C. Cantley, S. P. Gygi, and J. Blenis, “Phosphoproteomic analysis identifies Grb10 as an mTORC1 substrate that negatively regulates insulin signaling.,” Science , vol. 332, no. 6035, pp. 1322–6, Jun. 2011. [36] P. P. Hsu, S. a Kang, J. Rameseder, Y. Zhang, K. a Ottina, D. Lim, T. R. Peterson, Y. Choi, N. S. Gray, M. B. Yaffe, J. a Marto, and D. M. Sabatini, “The mTOR-regulated phosphoproteome reveals a mechanism of mTORC1-mediated inhibition of growth factor signaling.,” Science , vol. 332, no. 6035, pp. 1317–22, Jun. 2011. [37] R. Zoncu, A. Efeyan, and D. M. Sabatini, “mTOR: from growth signal integration to cancer, diabetes and ageing.,” Nat. Rev. Mol. Cell Biol. , vol. 12, no. 1, pp. 21–35, Jan. 2011. [38] Y. Pak, W. K. Glowacka, M. C. Bruce, N. Pham, and D. Rotin, “Transport of LAPTM5 to lysosomes requires association with the ubiquitin ligase Nedd4, but not LAPTM5 ubiquitination.,” J. Cell Biol. , vol. 175, no. 4, pp. 631–45, Nov. 2006. [39] R. Milkereit and D. Rotin, “A role for the ubiquitin ligase Nedd4 in membrane sorting of LAPTM4 proteins.,” PLoS One , vol. 6, no. 11, p. e27478, Jan. 2011. [40] M. Nethe, B.-J. de Kreuk, D. V. F. Tauriello, E. C. Anthony, B. Snoek, T. Stumpel, P. C. Salinas, M. M. Maurice, D. Geerts, A. M. Deelder, P. J. Hensbergen, and P. L. Hordijk, “Rac1 acts in conjunction with Nedd4 and dishevelled-1 to promote maturation of cell-cell contacts.,” J. Cell Sci. , vol. 125, no. Pt 14, pp. 3430–42, Jul. 2012. [41] A. Persaud, P. Alberts, E. M. Amsen, X. Xiong, J. Wasmuth, Z. Saadon, C. Fladd, J. Parkinson, and D. Rotin, “Comparison of substrate specificity of the ubiquitin ligases Nedd4 and Nedd4-2 using proteome arrays.,” Mol. Syst. Biol. , vol. 5, no. 333, p. 333, Jan. 2009. [42] A. Persaud, P. Alberts, M. Hayes, S. Guettler, I. Clarke, F. Sicheri, P. Dirks, B. Ciruna, and D. Rotin, “Nedd4-1 binds and ubiquitylates activated FGFR1 to control its endocytosis and function.,” EMBO J. , vol. 30, no. 16, pp. 3259–3273, Aug. 2011. [43] C.-D. Fan, M. a Lum, C. Xu, J. D. Black, and X. Wang, “Ubiquitin-dependent regulation
94 of phospho-AKT dynamics by the ubiquitin E3 ligase, NEDD4-1, in the insulin-like growth factor-1 response.,” J. Biol. Chem. , vol. 288, no. 3, pp. 1674–84, Jan. 2013. [44] A. Bratt, W. J. Wilson, B. Troyanovsky, K. Aase, R. Kessler, E. G. Van Meir, L. Holmgren, and E. G. Van Meir, “Angiomotin belongs to a novel protein family with conserved coiled-coil and PDZ binding domains.,” Gene , vol. 298, no. 1, pp. 69–77, Sep. 2002. [45] B. Troyanovsky, T. Levchenko, G. Månsson, O. Matvijenko, and L. Holmgren, “Angiomotin: an angiostatin binding protein that regulates endothelial cell migration and tube formation.,” J. Cell Biol. , vol. 152, no. 6, pp. 1247–54, Mar. 2001. [46] M. L. Wahl, D. J. Kenan, M. Gonzalez-Gronow, and S. V Pizzo, “Angiostatin’s molecular mechanism: aspects of specificity and regulation elucidated.,” J. Cell. Biochem. , vol. 96, no. 2, pp. 242–61, Oct. 2005. [47] P. Andreasson and R. Carlsson, “Targeting angiogenesis with antibodies for the treatment of cancer.,” IDrugs Investig. drugs … , 2005. [48] L. Holmgren, E. Ambrosino, O. Birot, C. Tullus, N. Veitonmäki, T. Levchenko, L.-M. Carlson, P. Musiani, M. Iezzi, C. Curcio, G. Forni, F. Cavallo, and R. Kiessling, “A DNA vaccine targeting angiomotin inhibits angiogenesis and suppresses tumor growth.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 103, no. 24, pp. 9208–13, Jun. 2006. [49] T. Levchenko, N. Veitonmäki, A. Lundkvist, H. Gerhardt, Y. Ming, K. Berggren, A. Kvanta, R. Carlsson, and L. Holmgren, “Therapeutic antibodies targeting angiomotin inhibit angiogenesis in vivo.,” FASEB J. , vol. 22, no. 3, pp. 880–9, Mar. 2008. [50] M. Arigoni, G. Barutello, S. Lanzardo, D. Longo, S. Aime, C. Curcio, M. Iezzi, Y. Zheng, I. Barkefors, L. Holmgren, and F. Cavallo, “A vaccine targeting angiomotin induces an antibody response which alters tumor vessel permeability and hampers the growth of established tumors.,” Angiogenesis , vol. 15, no. 2, pp. 305–16, Jun. 2012. [51] W. G. Jiang, G. Watkins, A. Douglas-Jones, L. Holmgren, and R. E. Mansel, “Angiomotin and angiomotin like proteins, their expression and correlation with angiogenesis and clinical outcome in human breast cancer.,” BMC Cancer , vol. 6, p. 16, Jan. 2006. [52] T. Levchenko, A. Bratt, J. L. Arbiser, and L. Holmgren, “Angiomotin expression promotes hemangioendothelioma invasion,” pp. 1469–1473, 2004. [53] J. Moreau, M. Lord, M. Boucher, P. Belleau, and M. J. G. Fernandes, “Protein diversity is generated within the motin family of proteins by alternative pre-mRNA splicing.,” Gene , vol. 350, no. 2, pp. 137–48, May 2005. [54] M. Ernkvist, O. Birot, I. Sinha, N. Veitonmaki, S. Nyström, K. Aase, and L. Holmgren, “Differential roles of p80- and p130-angiomotin in the switch between migration and stabilization of endothelial cells.,” Biochim. Biophys. Acta , vol. 1783, no. 3, pp. 429– 37, Mar. 2008.
95 [55] C. D. Wells, J. P. Fawcett, A. Traweger, Y. Yamanaka, M. Goudreault, K. Elder, S. Kulkarni, G. Gish, C. Virag, C. Lim, K. Colwill, A. Starostine, P. Metalnikov, and T. Pawson, “A Rich1/Amot complex regulates the Cdc42 GTPase and apical-polarity proteins in epithelial cells.,” Cell , vol. 125, no. 3, pp. 535–48, May 2006. [56] Y. Sugihara-Mizuno, M. Adachi, Y. Kobayashi, Y. Hamazaki, M. Nishimura, T. Imai, M. Furuse, and S. Tsukita, “Molecular characterization of angiomotin/JEAP family proteins: interaction with MUPP1/Patj and their endogenous properties.,” Genes Cells , vol. 12, no. 4, pp. 473–86, Apr. 2007. [57] T. Levchenko, K. Aase, B. Troyanovsky, A. Bratt, and L. Holmgren, “Loss of responsiveness to chemotactic factors by deletion of the C-terminal protein interaction site of angiomotin.,” J. Cell Sci. , vol. 116, no. Pt 18, pp. 3803–10, Sep. 2003. [58] K. Aase, M. Ernkvist, L. Ebarasi, L. Jakobsson, A. Majumdar, C. Yi, O. Birot, Y. Ming, A. Kvanta, D. Edholm, P. Aspenström, J. Kissil, L. Claesson-Welsh, A. Shimono, and L. Holmgren, “Angiomotin regulates endothelial cell migration during embryonic angiogenesis.,” Genes Dev. , vol. 21, no. 16, pp. 2055–68, Aug. 2007. [59] C. Yi, S. Troutman, D. Fera, A. Stemmer-Rachamimov, J. L. Avila, N. Christian, N. L. Persson, A. Shimono, D. W. Speicher, R. Marmorstein, L. Holmgren, and J. L. Kissil, “A tight junction-associated Merlin-angiomotin complex mediates Merlin’s regulation of mitogenic signaling and tumor suppressive functions.,” Cancer Cell , vol. 19, no. 4, pp. 527–40, Apr. 2011. [60] E. Roudier, N. Chapados, S. Decary, C. Gineste, C. Le Bel, J.-M. Lavoie, R. Bergeron, and O. Birot, “Angiomotin p80/p130 ratio: a new indicator of exercise-induced angiogenic activity in skeletal muscles from obese and non-obese rats?,” J. Physiol. , vol. 587, no. Pt 16, pp. 4105–19, Aug. 2009. [61] M. Ernkvist, K. Aase, C. Ukomadu, J. Wohlschlegel, R. Blackman, N. Veitonmäki, A. Bratt, A. Dutta, and L. Holmgren, “P130-Angiomotin Associates To Actin and Controls Endothelial Cell Shape.,” FEBS J. , vol. 273, no. 9, pp. 2000–11, May 2006. [62] W. Wang, J. Huang, and J. Chen, “Angiomotin-like proteins associate with and negatively regulate YAP1.,” J. Biol. Chem. , vol. 286, no. 6, pp. 4364–70, Feb. 2011. [63] B. Zhao, L. Li, Q. Lu, L. H. Wang, C.-Y. Liu, Q. Lei, and K.-L. Guan, “Angiomotin is a novel Hippo pathway component that inhibits YAP oncoprotein.,” Genes Dev. , vol. 25, no. 1, pp. 51–63, Jan. 2011. [64] S. W. Chan, C. J. Lim, Y. F. Chong, A. V Pobbati, C. Huang, and W. Hong, “Hippo pathway-independent restriction of TAZ and YAP by angiomotin.,” J. Biol. Chem. , vol. 286, no. 9, pp. 7018–26, Mar. 2011. [65] B. Zhao, K. Tumaneng, and K.-L. Guan, “The Hippo pathway in organ size control, tissue regeneration and stem cell self-renewal.,” Nat. Cell Biol. , vol. 13, no. 8, pp. 877–83, Aug. 2011. [66] J. C. Hau, D. Erdmann, Y. Mesrouze, P. Furet, P. Fontana, C. Zimmermann, T.
96 Schmelzle, F. Hofmann, and P. Chène, “The TEAD4-YAP/TAZ protein-protein interaction: expected similarities and unexpected differences.,” Chembiochem , vol. 14, no. 10, pp. 1218–25, Jul. 2013. [67] F. D. Camargo, S. Gokhale, J. B. Johnnidis, D. Fu, G. W. Bell, R. Jaenisch, and T. R. Brummelkamp, “YAP1 increases organ size and expands undifferentiated progenitor cells.,” Curr. Biol. , vol. 17, no. 23, pp. 2054–60, Dec. 2007. [68] L. Zender, M. S. Spector, W. Xue, P. Flemming, C. Cordon-Cardo, J. Silke, S.-T. Fan, J. M. Luk, M. Wigler, G. J. Hannon, D. Mu, R. Lucito, S. Powers, and S. W. Lowe, “Identification and validation of oncogenes in liver cancer using an integrative oncogenomic approach.,” Cell , vol. 125, no. 7, pp. 1253–67, Jun. 2006. [69] A. a Steinhardt, M. F. Gayyed, A. P. Klein, J. Dong, A. Maitra, D. Pan, E. a Montgomery, and R. a Anders, “Expression of Yes-associated protein in common solid tumors.,” Hum. Pathol. , vol. 39, no. 11, pp. 1582–9, Nov. 2008. [70] B. Zhao, L. Li, K. Tumaneng, C.-Y. Wang, and K.-L. Guan, “A coordinated phosphorylation by Lats and CK1 regulates YAP stability through SCF(beta-TRCP).,” Genes Dev. , vol. 24, no. 1, pp. 72–85, Jan. 2010. [71] X. Varelas, B. W. Miller, R. Sopko, S. Song, A. Gregorieff, F. a Fellouse, R. Sakuma, T. Pawson, W. Hunziker, H. McNeill, J. L. Wrana, and L. Attisano, “The Hippo pathway regulates Wnt/beta-catenin signaling.,” Dev. Cell , vol. 18, no. 4, pp. 579–91, Apr. 2010. [72] A. Hergovich, “Mammalian Hippo signalling: a kinase network regulated by protein- protein interactions.,” Biochem. Soc. Trans. , vol. 40, no. 1, pp. 124–8, Feb. 2012. [73] A. Ramos and F. D. Camargo, “The Hippo signaling pathway and stem cell biology.,” Trends Cell Biol. , vol. 22, no. 7, pp. 339–46, Jul. 2012. [74] M. Paramasivam, A. Sarkeshik, J. R. Yates, M. J. G. Fernandes, and D. McCollum, “Angiomotin family proteins are novel activators of the LATS2 kinase tumor suppressor.,” Mol. Biol. Cell , vol. 22, no. 19, pp. 3725–33, Oct. 2011. [75] W. Bossuyt, C.-L. Chen, Q. Chen, M. Sudol, H. McNeill, D. Pan, a Kopp, and G. Halder, “An evolutionary shift in the regulation of the Hippo pathway between mice and flies.,” Oncogene , no. January, pp. 1–11, Apr. 2013. [76] E. M. Morin-kensicki, B. N. Boone, M. Howell, J. R. Stonebraker, J. Teed, J. G. Alb, T. R. Magnuson, W. O. Neal, S. L. Milgram, N. Carolina, and C. Hill, “Defects in Yolk Sac Vasculogenesis , Chorioallantoic Fusion , and Embryonic Axis Elongation in Mice with Targeted Disruption of Yap65,” vol. 26, no. 1, pp. 77–87, 2006. [77] Z. Hossain, S. M. Ali, H. L. Ko, J. Xu, C. P. Ng, K. Guo, Z. Qi, S. Ponniah, W. Hong, and W. Hunziker, “Glomerulocystic kidney disease in mice with a targeted inactivation of Wwtr1.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 104, no. 5, pp. 1631–6, Jan. 2007. [78] R. Makita and Y. Uchijima, “Multiple renal cysts, urinary concentration defects, and
97 pulmonary emphysematous changes in mice lacking TAZ,” … Physiol. … , pp. 542– 553, 2008. [79] D. Levy, Y. Adamovich, N. Reuven, and Y. Shaul, “The Yes-associated protein 1 stabilizes p73 by preventing Itch-mediated ubiquitination of p73.,” Cell Death Differ. , vol. 14, no. 4, pp. 743–51, Apr. 2007. [80] T. Oka, a P. Schmitt, and M. Sudol, “Opposing roles of angiomotin-like-1 and zona occludens-2 on pro-apoptotic function of YAP.,” Oncogene , vol. 31, no. 1, pp. 128–34, Jan. 2012. [81] A. Hergovich and B. a Hemmings, “TAZ-mediated crosstalk between Wnt and Hippo signaling.,” Dev. Cell , vol. 18, no. 4, pp. 508–9, Apr. 2010. [82] C. Wang, J. An, P. Zhang, C. Xu, K. Gao, D. Wu, D. Wang, H. Yu, J. O. Liu, and L. Yu, “The Nedd4-like ubiquitin E3 ligases target angiomotin/p130 to ubiquitin-dependent degradation.,” Biochem. J. , vol. 444, no. 2, pp. 279–89, Jun. 2012. [83] J. J. Adler, D. E. Johnson, B. L. Heller, L. R. Bringman, W. P. Ranahan, M. D. Conwell, Y. Sun, A. Hudmon, and C. D. Wells, “Serum deprivation inhibits the transcriptional co-activator YAP and cell growth via phosphorylation of the 130-kDa isoform of Angiomotin by the LATS1/2 protein kinases.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 110, no. 43, Oct. 2013. [84] X. Dai, P. She, F. Chi, Y. Feng, H. Liu, D. Jin, Y. Zhao, X. Guo, D. Jiang, K.-L. Guan, T. P. Zhong, and B. Zhao, “Phosphorylation of angiomotin by Lats1/2 kinases inhibits F- actin binding, cell migration and angiogenesis.,” J. Biol. Chem. , Oct. 2013. [85] C. Yi, Z. Shen, A. Stemmer-Rachamimov, N. Dawany, S. Troutman, L. C. Showe, Q. Liu, A. Shimono, M. Sudol, L. Holmgren, B. Z. Stanger, and J. L. Kissil, “The p130 isoform of angiomotin is required for Yap-mediated hepatic epithelial cell proliferation and tumorigenesis.,” Sci. Signal. , vol. 6, no. 291, p. ra77, Sep. 2013. [86] F. Fouladkou, T. Landry, H. Kawabe, A. Neeb, C. Lu, N. Brose, V. Stambolic, and D. Rotin, “The ubiquitin ligase Nedd4-1 is dispensable for the regulation of PTEN stability and localization.,” Proc. Natl. Acad. Sci. U. S. A. , vol. 105, no. 25, pp. 8585– 90, Jun. 2008. [87] J. O’MAHONEY and T. ADAMS, “Optimization of experimental variables influencing reporter gene expression in hepatoma cells following calcium phosphate transfection,” DNA Cell Biol. , 1994. [88] Y. Yu, S.-O. Yoon, G. Poulogiannis, Q. Yang, X. M. Ma, J. Villén, N. Kubica, G. R. Hoffman, L. C. Cantley, S. P. Gygi, and J. Blenis, “Phosphoproteomic analysis identifies Grb10 as an mTORC1 substrate that negatively regulates insulin signaling.,” Science , vol. 332, no. 6035, pp. 1322–6, Jun. 2011. [89] L. Bar-peled, L. D. Schweitzer, R. Zoncu, and D. M. Sabatini, “Ragulator Is a GEF for the Rag GTPases that Signal Amino Acid Levels to mTORC1,” Cell , vol. 150, no. 6, pp. 1196–1208, 2012.
98 [90] V. I. Korolchuk, S. Saiki, M. Lichtenberg, F. H. Siddiqi, E. a Roberts, S. Imarisio, L. Jahreiss, S. Sarkar, M. Futter, F. M. Menzies, C. J. O’Kane, V. Deretic, and D. C. Rubinsztein, “Lysosomal positioning coordinates cellular nutrient responses.,” Nat. Cell Biol. , vol. 13, no. 4, pp. 453–60, Apr. 2011. [91] L. Yu, C. K. McPhee, L. Zheng, G. a Mardones, Y. Rong, J. Peng, N. Mi, Y. Zhao, Z. Liu, F. Wan, D. W. Hailey, V. Oorschot, J. Klumperman, E. H. Baehrecke, and M. J. Lenardo, “Termination of autophagy and reformation of lysosomes regulated by mTOR.,” Nature , vol. 465, no. 7300, pp. 942–6, Jun. 2010. [92] D. Fingar, S. Salama, and C. Tsou, “Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E,” Genes … , pp. 1472–1487, 2002. [93] B. Magnuson, B. Ekim, and D. C. Fingar, “Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks.,” Biochem. J. , vol. 441, no. 1, pp. 1–21, Jan. 2012. [94] L. Yu, C. K. Mcphee, L. Zheng, G. A. Mardones, Y. Rong, J. Peng, N. Mi, Y. Zhao, Z. Liu, F. Wan, D. W. Hailey, V. Oorschot, J. Klumperman, E. H. Baehrecke, and M. J. Lenardo, “Termination of autophagy and reformation of lysosomes regulated by mTOR,” Nature , vol. 465, no. June, pp. 942–947, 2010. [95] A. Y. Choo, S. G. Kim, M. G. Vander Heiden, S. J. Mahoney, H. Vu, S.-O. Yoon, L. C. Cantley, and J. Blenis, “Glucose addiction of TSC null cells is caused by failed mTORC1-dependent balancing of metabolic demand with supply.,” Mol. Cell , vol. 38, no. 4, pp. 487–99, May 2010. [96] C. Spampanato, E. Feeney, L. Li, M. Cardone, J.-A. Lim, F. Annunziata, H. Zare, R. Polishchuk, R. Puertollano, G. Parenti, A. Ballabio, and N. Raben, “Transcription factor EB (TFEB) is a new therapeutic target for Pompe disease.,” EMBO Mol. Med. , vol. 5, no. 5, pp. 691–706, May 2013. [97] X. Wu, K. a Steigelman, E. Bonten, H. Hu, W. He, T. Ren, J. Zuo, and A. d’Azzo, “Vacuolization and alterations of lysosomal membrane proteins in cochlear marginal cells contribute to hearing loss in neuraminidase 1-deficient mice.,” Biochim. Biophys. Acta , vol. 1802, no. 2, pp. 259–68, Feb. 2010. [98] S. Vergarajauregui, J. a Martina, and R. Puertollano, “LAPTMs regulate lysosomal function and interact with mucolipin 1: new clues for understanding mucolipidosis type IV.,” J. Cell Sci. , vol. 124, no. Pt 3, pp. 459–68, Feb. 2011. [99] C. M. Oslowski and F. Urano, Measuring ER stress and the unfolded protein response using mammalian tissue culture system. , 1st ed., vol. 490. Elsevier Inc., 2011, pp. 71– 92. [100] V. M. Parmar and M. Schröder, “CHAPTER 10 SENSING ENDOPLASMIC RETICULUM STRESS,” pp. 153–168, 2012. [101] E. A. Runkle and D. Mu, “Tight junction proteins: from barrier to tumorigenesis.,” Cancer Lett. , vol. 337, no. 1, pp. 41–8, Aug. 2013.
99 [102] A. Saci, L. C. Cantley, and C. L. Carpenter, “Rac1 regulates the activity of mTORC1 and mTORC2 and controls cellular size.,” Mol. Cell , vol. 42, no. 1, pp. 50–61, Apr. 2011. [103] M. Macias, S. Wiesner, and M. Sudol, “WW and SH3 domains, two different scaffolds to recognize proline-rich ligands,” FEBS Lett. , vol. 513, pp. 30–37, 2002. [104] M. Sudol, “Newcomers to the WW Domain-Mediated Network of the Hippo Tumor Suppressor Pathway.,” Genes Cancer , vol. 1, no. 11, pp. 1115–8, Nov. 2010. [105] K. Skouloudaki and G. Walz, “YAP1 recruits c-Abl to protect angiomotin-like 1 from Nedd4-mediated degradation.,” PLoS One , vol. 7, no. 4, p. e35735, Jan. 2012. [106] C. Settembre, A. Fraldi, D. L. Medina, and A. Ballabio, “Signals from the lysosome: a control centre for cellular clearance and energy metabolism.,” Nat. Rev. Mol. Cell Biol. , vol. 14, no. 5, pp. 283–96, May 2013. [107] E. J. Feeney, C. Spampanato, R. Puertollano, A. Ballabio, G. Parenti, and N. Raben, “What else is in store for autophagy? Exocytosis of autolysosomes as a mechanism of TFEB-mediated cellular clearance in Pompe disease.,” Autophagy , vol. 9, pp. 1117– 1118, 2013. [108] S. Müller, J. Dennemärker, and T. Reinheckel, “Specific functions of lysosomal proteases in endocytic and autophagic pathways.,” Biochim. Biophys. Acta , vol. 1824, no. 1, pp. 34–43, Jan. 2012. [109] R.-M. N. Boustany, “Lysosomal storage diseases-the horizon expands.,” Nat. Rev. Neurol. , vol. 9, no. 10, pp. 583–98, Oct. 2013. [110] C. Vogler, H. S. Rosenberg, J. C. Williams, and I. Butler, “Electron microscopy in the diagnosis of lysosomal storage diseases.,” Am. J. Med. Genet. Suppl. , vol. 3, no. March 1984, pp. 243–55, Jan. 1987. [111] V. Seyrantepe, K. Landry, S. Trudel, J. a Hassan, C. R. Morales, and A. V Pshezhetsky, “Neu4, a novel human lysosomal lumen sialidase, confers normal phenotype to sialidosis and galactosialidosis cells.,” J. Biol. Chem. , vol. 279, no. 35, pp. 37021–9, Aug. 2004. [112] a van der Spoel, E. Bonten, and a d’Azzo, “Transport of human lysosomal neuraminidase to mature lysosomes requires protective protein/cathepsin A.,” EMBO J. , vol. 17, no. 6, pp. 1588–97, Mar. 1998. [113] E. J. Bonten, Y. Campos, V. Zaitsev, A. Nourse, B. Waddell, W. Lewis, G. Taylor, and A. d’Azzo, “Heterodimerization of the sialidase NEU1 with the chaperone protective protein/cathepsin A prevents its premature oligomerization.,” J. Biol. Chem. , vol. 284, no. 41, pp. 28430–41, Oct. 2009. [114] E. Monti, E. Bonten, A. D’Azzo, R. Bresciani, B. Venerando, G. Borsani, R. Schauer, and G. Tettamanti, Sialidases in vertebrates: a family of enzymes tailored for several cell functions. , vol. 64, no. 10. 2010, pp. 403–79.
100 [115] H. Wei, S.-J. Kim, Z. Zhang, P.-C. Tsai, K. E. Wisniewski, and A. B. Mukherjee, “ER and oxidative stresses are common mediators of apoptosis in both neurodegenerative and non-neurodegenerative lysosomal storage disorders and are alleviated by chemical chaperones.,” Hum. Mol. Genet. , vol. 17, no. 4, pp. 469–77, Feb. 2008. [116] E. J. Bonten, G. Yogalingam, H. Hu, E. Gomero, D. van de Vlekkert, and A. d’Azzo, “Chaperone-mediated gene therapy with recombinant AAV-PPCA in a new mouse model of type I sialidosis.,” Biochim. Biophys. Acta , vol. 1832, no. 10, pp. 1784–92, Oct. 2013. [117] P. Pujuguet, L. Del Maestro, A. Gautreau, D. Louvard, and M. Arpin, “Ezrin Regulates E-Cadherin-dependent Adherens Junction Assembly through Rac1 Activation,” vol. 14, no. May, pp. 2181–2191, 2003. [118] J. J. Adler, B. L. Heller, L. R. Bringman, W. P. Ranahan, R. R. Cocklin, M. G. Goebl, M. Oh, H.-S. Lim, R. J. Ingham, and C. D. Wells, “Amot130 adapts atrophin-1 interacting protein 4 to inhibit yes-associated protein signaling and cell growth.,” J. Biol. Chem. , vol. 288, no. 21, pp. 15181–93, May 2013. [119] Z. Salah, S. Cohen, E. Itzhaki, and R. I. Aqeilan, “NEDD4 E3 ligase inhibits the activity of the Hippo pathway by targeting LATS1 for degradation.,” Cell Cycle , vol. 12, pp. 85–91, 2013.
101