DOCSLIB.ORG

The Role of the Grb14 Adaptor Protein in Receptor Tyrosine Kinase Signalling

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of the Grb14 Adaptor Protein in Receptor Tyrosine Kinase Signalling The role of the Grb14 adaptor protein in receptor tyrosine kinase signalling Rania Kairouz A thesis submitted for the degree of Doctor of Philosophy Faculty of Medicine University of New South Wales 2002 a:Jedication irhis undeservin8 thesis is dedicated to the Creator of a(( discoveries, for mercifu((y hefpin8 us to make them 11 !Jl.cinowfedgments 'The simpler one writes the better it will be' St. Bernadette Soubirous Whether this thesis lives up to St. Bernadette's wisdom remains to be seen, but I can state with certainty that this work would not have been possible without dedicated individuals with whom I had the pleasure to work and learn. First and foremost, my dear and kind supervisors. Roger Daly, in particular, for his invaluable guidance at every step, during the highs, lows and the flatlines... His unwavering positivism and insight regarding experiments are quite appreciated, in addition to his eagerness in viewing Western blots (or any blot!) and his magnanimous endurance in hearing and editing some of my 'favourite' words, including 'basically' and the most recent 'plethora', so BASICALLY thanks Rog. I also sincerely thank Rob Sutherland for providing continuous support and morale-boosting advice on scientific and career issues, and for giving me the opportunity and the privilege to work in such a stimulating, friendly and intricately well-managed environment. Many thanks also to Liz Musgrove, for all her help and guidance when I joined forces with the Cell Cyders. For advice and help with this thesis, I also thank Big Bad Boris, Dr Dan, and Gary Leong. I appreciate the assistance from Sue, Carsten and Tuan for statistical analysis. My heartfelt thanks to all those who contributed to this work (see Chapter 2), including Georgina Sanderson and Roger for the 184 library screening. In particular, I BASICALLY thank Ruth for technical advice and help, and the lovely Jayamala with whom I worked during the latter part of my PhD. Thankyou to all my precious Cancerites and Garvanites for your support throughout my PhD, you are all like a second family to me (my sympathy to those unfortunate individuals whom I pestered with questions). I am grateful to Fireman Charlie who 'always saves the day', for sending me references (and jokes) during my 'hermitress' writing phase. It is no secret that working in lab 1 is never monotonous, and here I have the opportunity to reveal all. However, I shall leave that for my upcoming bestseller and contend with thanking Colonel Michelle (whose favourite pasttime was to answer my questions), Suzann for being lll a 'pseudo' big sister, Mel for being a 'pseudo' little sister, Amanda! Amanda! Amanda! for making sure I was 'stirred not shaken', Psycho Sam for bravely enduring repetitions of 'catch a falling star' and Prof. Clancy, my partner-in-crime (that's in my bestseller), for allowing me to metastasise to her bench. Frequently. Thanks also to Steph and Perla Preciosa Marcia for all the fun outings. I am grateful to Damien for the med/bird stories, Superflower Laura for baby Angelica (who fought her way into this world during my writing) and D.J. for the jokes and discussions (Damien and D. J., I think we agree to disagree!). My cherished family and friends .... Well, thankyou for so much incredible support. You guys have astounded me! I am greatly indebted to Mirna and Carmen for help with proofreading and for effortlessly transforming the rania Frown into a huge smile©. Thanks for the encouragement of those who have been patiently waiting for me to finish, in order to 'party', organise a wedding, travel, and catch up ... This includes the enchanting bride-to­ be Zara, Laura, Aline (i.e. Amex IT expert), Ruby, Sr. Margaret (the gifted branch!), and the State Bodybuilding Champion Charbel (Bro, are we related?). Mum and Dad, my guardian angels, where would I be without you?. A special thanks to my grandparents for their love and prayers: Najla and Joseph Antoun, and Teta Atour. During my PhD, I had to say goodbye to two very dear persons to whom I am greatly indebted. First, the Poet Naeim Khoury, for his amazing talent, kind support and bravery. I have never witnessed anyone fight lung cancer like this man. He remains an unending inspiration to me, to his oncologists and cancer researchers alike ... Second, and most recently, to my dear late grandfather, the legendary Mayor Ibrahim Kairouz, for his constant loving support, and for teaching me what I will never forget... May this work be a tribute to these inspiring souls. Ah! My beautiful Patroness, 'Star of the sea', how can one ever thank another for saving their life? Your Maternal guidance is always my shield ... Finally, and most importantly, to the Knight in Shining Armour I have been waiting for my entire life, who, cleverly hidden but always so close, finally succeeded in rescuing me. Every single heartbeat I make belongs to you, my Merciful Knight, and I look forward to galloping away with you up that steep mountain into eternal bliss ... IV !Jl.bstract The Grb7 family of SH2 domain-containing signalling proteins, which comprises Grb7, -10 and -14, perform both adaptor and regulatory roles in receptor tyrosine kinase (RTK) signalling. Overexpression of Grb7 family proteins has been detected in several types of human cancer or cancer cell lines, and Grb7 has been linked with enhanced tumour invasion. In addition, splice variants with alterations in key functional domains that display distinct RTK recruitment profiles have been identified for Grb7 and -10. However, the function of Grb14, the most recent member of this family, remains undefined and its interacting partners unidentified. Therefore, this study sought to characterise the role of Grb 14 in cellular signalling. Using RT-PCR, a novel human Grb14 isoform was identified and designated Grb14 ~- This isoform contains a 94 bp deletion in SH2 domain-encoding sequences and a premature termination codon that truncates the SH2 module and abrogates its function. 3/12 cDNA clones isolated from a human breast epithelial cDNA library also contained this deletion. Further, PCR from genomic DNA demonstrated that the deleted region in the Grb14 gene is flanked by exon-intron junctions, suggesting that Grb14 ~ transcripts originate by alternative mRNA splicing. Interestingly, differential expression of Grb14 isoforms was detected amongst breast cancer cell lines. In order to functionally characterise the two variants, association with particular RTKs was investigated by co­ immunoprecipitation analysis and GST fusion protein pulldowns. FGFR-1 was identified as a novel Grb14 a binding partner. Further analysis revealed that both Grb14 a and~ bind the insulin receptor in an interaction mediated by the 'between PH and SH2' (BPS) domain and that the SH2 domain is dispensable for this signalling role. However Grb14 a, but not ~' bound FGFR-1 since this interaction requires a functional SH2 domain. Therefore, alternative mRNA splicing regulates association of Grb14 with particular RTKs, where the distinct functional modules mediate interactions with different receptors. V While this work was in progress, a study demonstrated inhibition of FGF-induced DNA synthesis by overexpression of Grb14. It also reported enhancement of this FGF-induced response by overexpression of a Grb14 protein that cannot bind the FGFR-1 due to a generated point-mutation (R466K) in the SH2 domain. Since this may have functional implications for the novel Grb14 splice variant which also fails to mediate receptor binding, the functional effect of Grb 14 ~ in FGF-stimulated proliferation of fibroblasts was examined using thymidine incorporation analysis and flow cytometry. This revealed that Grb14 ~ did not affect FGF-stimulated DNA synthesis or cell cycle progression. A significant effect of Grb14 a overexpression on these endpoints was not observed, indicating that Grb14 is not a major physiological regulator of FGF-induced mitogenesis. Grb14 is implicated in regulation of insulin signalling and it is differentially expressed in breast cancer cell lines, although little is known about its regulation. Thus, the regulation of this protein by insulin/IGF-I and estrogen was investigated, since these hormones synergise in the regulation of breast cancer cell proliferation. In MCF-7 cells maintained in charcoal-stripped serum, Grb14 expression was downregulated by estradiol and increased by the pure antiestrogen ICI 182780. Under serum-free conditions, insulin enhanced Grb14 expression but this effect was repressed by estradiol when both hormones were used in combination. Using a system in which c-Myc induction drives cell cycle progression independently of estradiol, Grb14 regulation was specific to estradiol treatment. Finally, a novel functional role was revealed for Grb14 whereby its overexpression inhibited not only insulin- but also estrogen-induced cell cycle progression. These data represent the first demonstration of regulation of Grb14 expression levels in response to hormonal stimuli, and are consistent with its role as a repressor of insulin/IGF signalling. Furthermore, they implicate a modulatory role for Grb14 in hormonal cooperativity in regulating the proliferation of breast cancer cells. vi TABLE OF CONTENTS Dedication -------------------------------ii Ac know Ie d gmen t s _________________________ iii Abstract ____________________________ v Figures ______________________________ x Abbreviations xii Chapter 1 - Literature Review ____________________ 1 1. 1 Signalling by receptor tyrosine kinases (RTKs)
Load more

Recommended publications
  • Mitochondrial Membrane Binding and Protein Complexing of the Anti-Apoptotic Adaptor Protein Grblo
    Mitochondrial membrane binding and protein complexing of the anti-apoptotic adaptor protein GrblO. by Jennifer Hassard Department of Biology McGill University, Montreal A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Master's of Science August 2001 Supervisor: Dr. David Thomas, Department of Biochemistry © Jennifer Hassard, 2001 .....--. National Library Bibliothèque nationale 1+1 of Canada du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395. rue Wellington OttawaON K1A0N4 Ottawa ON K1 A ON4 canada canada Your liIe VoIJ8 rrlfénJnce Our liIe Notre rtifénlncs The author has granted a non­ L'auteur a accordé une licence non exclusive licence al10wing the exclusive permettant à la National Library ofCanada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies ofthis thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/film, de reproduction sur papier ou sur format électronique. The author retains ownership ofthe L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts from it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the autbor's ou autrement reproduits sans son penmsslon. autorisation. 0-612-78889-X Canada ABSTRACT GrblO is a member of the Grb7 family of adaptor proteins that also includes Grb7 and Grb14. These three members contain multiple protein binding domains and lack enzymatic activity.
    [Show full text]
  • Chromosomal Aberrations in Head and Neck Squamous Cell Carcinomas in Norwegian and Sudanese Populations by Array Comparative Genomic Hybridization
    825-843 12/9/08 15:31 Page 825 ONCOLOGY REPORTS 20: 825-843, 2008 825 Chromosomal aberrations in head and neck squamous cell carcinomas in Norwegian and Sudanese populations by array comparative genomic hybridization ERIC ROMAN1,2, LEONARDO A. MEZA-ZEPEDA3, STINE H. KRESSE3, OLA MYKLEBOST3,4, ENDRE N. VASSTRAND2 and SALAH O. IBRAHIM1,2 1Department of Biomedicine, Faculty of Medicine and Dentistry, University of Bergen, Jonas Lies vei 91; 2Department of Oral Sciences - Periodontology, Faculty of Medicine and Dentistry, University of Bergen, Årstadveien 17, 5009 Bergen; 3Department of Tumor Biology, Institute for Cancer Research, Rikshospitalet-Radiumhospitalet Medical Center, Montebello, 0310 Oslo; 4Department of Molecular Biosciences, University of Oslo, Blindernveien 31, 0371 Oslo, Norway Received January 30, 2008; Accepted April 29, 2008 DOI: 10.3892/or_00000080 Abstract. We used microarray-based comparative genomic logical parameters showed little correlation, suggesting an hybridization to explore genome-wide profiles of chromosomal occurrence of gains/losses regardless of ethnic differences and aberrations in 26 samples of head and neck cancers compared clinicopathological status between the patients from the two to their pair-wise normal controls. The samples were obtained countries. Our findings indicate the existence of common from Sudanese (n=11) and Norwegian (n=15) patients. The gene-specific amplifications/deletions in these tumors, findings were correlated with clinicopathological variables. regardless of the source of the samples or attributed We identified the amplification of 41 common chromosomal carcinogenic risk factors. regions (harboring 149 candidate genes) and the deletion of 22 (28 candidate genes). Predominant chromosomal alterations Introduction that were observed included high-level amplification at 1q21 (harboring the S100A gene family) and 11q22 (including Head and neck squamous cell carcinoma (HNSCC), including several MMP family members).
    [Show full text]
  • Whole Proteome Analysis of Human Tankyrase Knockout Cells Reveals Targets of Tankyrase- Mediated Degradation
    ARTICLE DOI: 10.1038/s41467-017-02363-w OPEN Whole proteome analysis of human tankyrase knockout cells reveals targets of tankyrase- mediated degradation Amit Bhardwaj1, Yanling Yang2, Beatrix Ueberheide2 & Susan Smith1 Tankyrase 1 and 2 are poly(ADP-ribose) polymerases that function in pathways critical to cancer cell growth. Tankyrase-mediated PARylation marks protein targets for proteasomal 1234567890 degradation. Here, we generate human knockout cell lines to examine cell function and interrogate the proteome. We show that either tankyrase 1 or 2 is sufficient to maintain telomere length, but both are required to resolve telomere cohesion and maintain mitotic spindle integrity. Quantitative analysis of the proteome of tankyrase double knockout cells using isobaric tandem mass tags reveals targets of degradation, including antagonists of the Wnt/β-catenin signaling pathway (NKD1, NKD2, and HectD1) and three (Notch 1, 2, and 3) of the four Notch receptors. We show that tankyrases are required for Notch2 to exit the plasma membrane and enter the nucleus to activate transcription. Considering that Notch signaling is commonly activated in cancer, tankyrase inhibitors may have therapeutic potential in targeting this pathway. 1 Kimmel Center for Biology and Medicine at the Skirball Institute, Department of Pathology, New York University School of Medicine, New York, NY 10016, USA. 2 Proteomics Laboratory, Department of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016, USA. Correspondence and requests for materials should be addressed to S.S. (email: [email protected]) NATURE COMMUNICATIONS | 8: 2214 | DOI: 10.1038/s41467-017-02363-w | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/s41467-017-02363-w ankyrases function in cellular pathways that are critical to function in human cells will provide insights into the clinical cancer cell growth including telomere cohesion and length utility of tankyrase inhibitors.
    [Show full text]
  • Common Differentially Expressed Genes and Pathways Correlating Both Coronary Artery Disease and Atrial Fibrillation
    EXCLI Journal 2021;20:126-141– ISSN 1611-2156 Received: December 08, 2020, accepted: January 11, 2021, published: January 18, 2021 Supplementary material to: Original article: COMMON DIFFERENTIALLY EXPRESSED GENES AND PATHWAYS CORRELATING BOTH CORONARY ARTERY DISEASE AND ATRIAL FIBRILLATION Youjing Zheng, Jia-Qiang He* Department of Biomedical Sciences and Pathobiology, College of Veterinary Medicine, Virginia Tech, Blacksburg, VA 24061, USA * Corresponding author: Jia-Qiang He, Department of Biomedical Sciences and Pathobiology, Virginia Tech, Phase II, Room 252B, Blacksburg, VA 24061, USA. Tel: 1-540-231-2032. E-mail: [email protected] https://orcid.org/0000-0002-4825-7046 Youjing Zheng https://orcid.org/0000-0002-0640-5960 Jia-Qiang He http://dx.doi.org/10.17179/excli2020-3262 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/). Supplemental Table 1: Abbreviations used in the paper Abbreviation Full name ABCA5 ATP binding cassette subfamily A member 5 ABCB6 ATP binding cassette subfamily B member 6 (Langereis blood group) ABCB9 ATP binding cassette subfamily B member 9 ABCC10 ATP binding cassette subfamily C member 10 ABCC13 ATP binding cassette subfamily C member 13 (pseudogene) ABCC5 ATP binding cassette subfamily C member 5 ABCD3 ATP binding cassette subfamily D member 3 ABCE1 ATP binding cassette subfamily E member 1 ABCG1 ATP binding cassette subfamily G member 1 ABCG4 ATP binding cassette subfamily G member 4 ABHD18 Abhydrolase domain
    [Show full text]
  • Characterization of the Full-Length Human Grb7 Protein, and A
    Characterization of the full-length human Grb7 protein and a phosphorylation representative mutant Item Type Article Authors Bradford, Andrew M; Koirala, Rajan; Park, Chad K; Lyons, Barbara A Citation Bradford, AM, Koirala, R, Park, CK, Lyons, BA. Characterization of the fulllength human Grb7 protein and a phosphorylation representative mutant. J Mol Recognit. 2019;e2803. https:// doi.org/10.1002/jmr.2803 DOI 10.1002/jmr.2803 Publisher WILEY Journal JOURNAL OF MOLECULAR RECOGNITION Rights © 2019 John Wiley & Sons, Ltd. Download date 27/09/2021 08:45:31 Item License http://rightsstatements.org/vocab/InC/1.0/ Version Final accepted manuscript Link to Item http://hdl.handle.net/10150/634134 Characterization of the full-length human Grb7 protein, and a phosphorylation representative mutant Andrew M. Bradforda, Rajan Koiralac, Chad K. Parkb, and Barbara A. Lyonsc* aAgena Bioscience, 4755 Eastgate Mall, San Diego, CA 92121; bAnalytical Biophysics Core, Department of Chemistry and Biochemistry, University of Arizona, Tucson, AZ 85721; cDepartment of Chemistry and Biochemistry, New Mexico State University, Las Cruces, NM 88003 Correspondence should be addressed to: Dr. Barbara A. Lyons Department of Chemistry and Biochemistry MSC 3C, P.O. Box 30001 Las Cruces, New Mexico 88003-8001 575-636-4072 [email protected] Abstract It is well known the dimerization state of receptor tyrosine kinases (RTKs), in conjunction with binding partners such as the Grb7 protein, plays an important role in cell signaling regulation. Previously we proposed, downstream of RTKs, that the phosphorylation state of Grb7SH2 domain tyrosine residues could control Grb7 dimerization, and dimerization may be an important regulatory step in Grb7 binding to RTKs.
    [Show full text]
  • Spatial and Temporal Aspects and the Interplay of Grb14 and Protein
    Rajala et al. Cell Communication and Signaling 2013, 11:96 http://www.biosignaling.com/content/11/1/96 RESEARCH Open Access Spatial and temporal aspects and the interplay of Grb14 and protein tyrosine phosphatase-1B on the insulin receptor phosphorylation Raju VS Rajala1,2,3,4*, Devaraj K Basavarajappa1,4,5, Radhika Dighe1,4 and Ammaji Rajala1,4 Abstract Background: Growth factor receptor-bound protein 14 (Grb14) is an adapter protein implicated in receptor tyrosine kinase signaling. Grb14 knockout studies highlight both the positive and negative roles of Grb14 in receptor tyrosine kinase signaling, in a tissue specific manner. Retinal cells are post-mitotic tissue, and insulin receptor (IR) activation is essential for retinal neuron survival. Retinal cells express protein tyrosine phosphatase-1B (PTP1B), which dephosphorylates IR and Grb14, a pseudosubstrate inhibitor of IR. This project asks the following major question: in retinal neurons, how does the IR overcome inactivation by PTP1B and Grb14? Results: Our previous studies suggest that ablation of Grb14 results in decreased IR activation, due to increased PTP1B activity. Our research propounds that phosphorylation in the BPS region of Grb14 inhibits PTP1B activity, thereby promoting IR activation. We propose a model in which phosphorylation of the BPS region of Grb14 is the key element in promoting IR activation, and failure to undergo phosphorylation on Grb14 leads to both PTP1B and Grb14 exerting their negative roles in IR. Consistent with this hypothesis, we found decreased phosphorylation of Grb14 in diabetic type 1 Ins2Akita mouse retinas. Decreased retinal IR activation has previously been reported in this mouse line.
    [Show full text]
  • Unveiling Genomic Regions That Underlie Differences Between Afec-Assaf Sheep and Its Parental Awassi Breed
    Seroussi et al. Genet Sel Evol (2017) 49:19 DOI 10.1186/s12711-017-0296-3 Genetics Selection Evolution RESEARCH Open Access Unveiling genomic regions that underlie differences between Afec‑Assaf sheep and its parental Awassi breed Eyal Seroussi, Alexander Rosov, Andrey Shirak, Alon Lam and Elisha Gootwine* Abstract Background: Sheep production in Israel has improved by crossing the fat-tailed local Awassi breed with the East Friesian and later, with the Booroola Merino breed, which led to the formation of the highly prolific Afec-Assaf strain. This strain differs from its parental Awassi breed in morphological traits such as tail and horn size, coat pigmentation and wool characteristics, as well as in production, reproductive and health traits. To identify major genes associated with the formation of the Afec-Assaf strain, we genotyped 41 Awassi and 141 Afec-Assaf sheep using the Illumina Ovine SNP50 BeadChip array, and analyzed the results with PLINK and EMMAX software. The detected variable genomic regions that differed between Awassi and Afec-Assaf sheep (variable genomic regions; VGR) were compared to selection signatures that were reported in 48 published genome-wide association studies in sheep. Because the Afec-Assaf strain, but not the Awassi breed, carries the Booroola mutation, association analysis of BMPR1B used as the test gene was performed to evaluate the ability of this study to identify a VGR that includes such a major gene. Results: Of the 20 detected VGR, 12 were novel to this study. A ~7-Mb VGR was identified on Ovies aries chromo- some OAR6 where the Booroola mutation is located.
    [Show full text]
  • Figure S1. Reverse Transcription‑Quantitative PCR Analysis of ETV5 Mrna Expression Levels in Parental and ETV5 Stable Transfectants
    Figure S1. Reverse transcription‑quantitative PCR analysis of ETV5 mRNA expression levels in parental and ETV5 stable transfectants. (A) Hec1a and Hec1a‑ETV5 EC cell lines; (B) Ishikawa and Ishikawa‑ETV5 EC cell lines. **P<0.005, unpaired Student's t‑test. EC, endometrial cancer; ETV5, ETS variant transcription factor 5. Figure S2. Survival analysis of sample clusters 1‑4. Kaplan Meier graphs for (A) recurrence‑free and (B) overall survival. Survival curves were constructed using the Kaplan‑Meier method, and differences between sample cluster curves were analyzed by log‑rank test. Figure S3. ROC analysis of hub genes. For each gene, ROC curve (left) and mRNA expression levels (right) in control (n=35) and tumor (n=545) samples from The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer cohort are shown. mRNA levels are expressed as Log2(x+1), where ‘x’ is the RSEM normalized expression value. ROC, receiver operating characteristic. Table SI. Clinicopathological characteristics of the GSE17025 dataset. Characteristic n % Atrophic endometrium 12 (postmenopausal) (Control group) Tumor stage I 91 100 Histology Endometrioid adenocarcinoma 79 86.81 Papillary serous 12 13.19 Histological grade Grade 1 30 32.97 Grade 2 36 39.56 Grade 3 25 27.47 Myometrial invasiona Superficial (<50%) 67 74.44 Deep (>50%) 23 25.56 aMyometrial invasion information was available for 90 of 91 tumor samples. Table SII. Clinicopathological characteristics of The Cancer Genome Atlas Uterine Corpus Endometrioid Cancer dataset. Characteristic n % Solid tissue normal 16 Tumor samples Stagea I 226 68.278 II 19 5.740 III 70 21.148 IV 16 4.834 Histology Endometrioid 271 81.381 Mixed 10 3.003 Serous 52 15.616 Histological grade Grade 1 78 23.423 Grade 2 91 27.327 Grade 3 164 49.249 Molecular subtypeb POLE 17 7.328 MSI 65 28.017 CN Low 90 38.793 CN High 60 25.862 CN, copy number; MSI, microsatellite instability; POLE, DNA polymerase ε.
    [Show full text]
  • Tissue-Specific Regulation and Function of Grb10 During Growth And
    PAPER Tissue-specific regulation and function of Grb10 during COLLOQUIUM growth and neuronal commitment Robert N. Plasschaert and Marisa S. Bartolomei1 Department of Cell & Developmental Biology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, PA 19104 Edited by Eric B. Keverne, University of Cambridge, Cambridge, United Kingdom, and accepted by the Editorial Board September 23, 2014 (received for review July 29, 2014) Growth-factor receptor bound protein 10 (Grb10) is a signal factor, which is recruited in a DNA methylation-sensitive manner adapter protein encoded by an imprinted gene that has roles in and has been implicated in the regulation of imprinted expression growth control, cellular proliferation, and insulin signaling. Addi- at other loci (Fig. 1A). tionally, Grb10 is critical for the normal behavior of the adult Thus, Grb10 is an imprinted gene with multiple functions and mouse. These functions are paralleled by Grb10’s unique tissue- a complex tissue-specific imprinted expression pattern. Here, we specific imprinted expression; the paternal copy of Grb10 is review work that has illuminated the functional roles of Grb10 in expressed in a subset of neurons whereas the maternal copy is embryonic development, cellular growth, and behavior. We also expressed in most other adult tissues in the mouse. The mecha- review the various regulatory mechanisms that have been implicated nism that underlies this switch between maternal and paternal in the control of Grb10 tissue-specific expression and imprinting. expression is still unclear, as is the role for paternally expressed Additionally, we present data addressing the regulation of Grb10 Grb10 in neurons. Here, we review recent work and present com- expression during neuronal development in vitro.
    [Show full text]
  • Grb7, a Critical Mediator of EGFR/Erbb Signaling, in Cancer Development and As a Potential Therapeutic Target
    cells Review Grb7, a Critical Mediator of EGFR/ErbB Signaling, in Cancer Development and as a Potential Therapeutic Target 1, 1,2, 1,3, Pei-Yu Chu y , Yu-Ling Tai y and Tang-Long Shen * 1 Department of Plant Pathology and Microbiology, National Taiwan University, Taipei 10617, Taiwan; [email protected] (P.-Y.C.); [email protected] (Y.-L.T.) 2 Department of Urology, University of Texas Southwestern Medical Center, Dallas, TX 75390, USA 3 Center for Biotechnology, National Taiwan University, Taipei 10617, Taiwan * Correspondence: [email protected]; Tel.: +886-2-3366-4998 These authors contributed equally to this work. y Received: 30 March 2019; Accepted: 9 May 2019; Published: 10 May 2019 Abstract: The partner of activated epidermal growth factor receptor (EGFR), growth factor receptor bound protein-7 (Grb7), a functionally multidomain adaptor protein, has been demonstrated to be a pivotal regulator for varied physiological and pathological processes by interacting with phospho-tyrosine-related signaling molecules to affect the transmission through a number of signaling pathways. In particular, critical roles of Grb7 in erythroblastic leukemia viral oncogene homolog (ERBB) family-mediated cancer development and malignancy have been intensively evaluated. The overexpression of Grb7 or the coamplification/cooverexpression of Grb7 and members of the ERBB family play essential roles in advanced human cancers and are associated with decreased survival and recurrence of cancers, emphasizing Grb70s value as a prognostic marker and a therapeutic target. Peptide inhibitors of Grb7 are being tested in preclinical trials for their possible therapeutic effects. Here, we review the molecular, functional, and clinical aspects of Grb7 in ERBB family-mediated cancer development and malignancy with the aim to reveal alternative and effective therapeutic strategies.
    [Show full text]
  • The Genes Pme-1 and Pme-2 Encode Two Poly(ADP-Ribose) Polymerases in Caenorhabditis Elegans Steve N
    Biochem. J. (2002) 368, 263–271 (Printed in Great Britain) 263 The genes pme-1 and pme-2 encode two poly(ADP-ribose) polymerases in Caenorhabditis elegans Steve N. GAGNON*, Michael O. HENGARTNER† and Serge DESNOYERS*1 *Department of Pediatrics, Laval University Medical Research Centre and Faculty of Medicine, Laval University, Quebec, Canada, and †Institute of Molecular Biology, University of Zu$ rich, Winterthurerstrasse 190, 8057 Zu$ rich, Switzerland Poly(ADP-ribose) polymerases (PARPs) are an expanding, well- domain of PARPs in general and shares 24% identity with conserved family of enzymes found in many metazoan species, huPARP-2. Recombinant PME-1 and PME-2 display PARP including plants. The enzyme catalyses poly(ADP-ribosyl)ation, activity, which may partially account for the similar activity a post-translational modification that is important in DNA found in the worm. A partial duplication of the pme-1 gene with repair and programmed cell death. In the present study, we pseudogene-like features was found in the nematode genome. report the finding of an endogenous source of poly(ADP- Messenger RNA for pme-1 are 5h-tagged with splice leader 1, ribosyl)ation in total extracts of the nematode Caenorhabditis whereas those for pme-2 are tagged with splice leader 2, suggesting elegans. Two cDNAs encoding highly similar proteins to human an operon-like expression for pme-2. The expression pattern of PARP-1 (huPARP-1) and huPARP-2 are described, and we pme-1 and pme-2 is also developmentally regulated. Together, propose to name the corresponding enzymes poly(ADP-ribose) these results show that PARP-1 and -2 are conserved in evolution metabolism enzyme 1 (PME-1) and PME-2 respectively.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]