UNIVERSITY OF CINCINNATI
Date:______
I, ______, hereby submit this work as part of the requirements for the degree of: in:
It is entitled:
This work and its defense approved by:
Chair: ______
Characterization of Non-protein Coding Ribonucleic Acids by their Signature Digestion Products and Mass Spectrometry
A dissertation submitted to the
Graduate School
of the University of Cincinnati
in partial fulfillment of the
requirements for the degree of
DOCTOR OF PHILOSOPHY (PhD)
in the Department of Chemistry
of the McMicken College of Arts and Sciences
By
MAHMUD HOSSAIN
M.S., Chemistry, Murray State University, KY, 2004
M.S., Biochemistry, University of Dhaka, Bangladesh, 1996
Committee Chair: Patrick A. Limbach, PhD
ABSTRACT
Transfer RNA (tRNA) and ribosomal RNA (rRNA) are two major non-protein coding ribonucleic acids (ncRNAs) in cell. In addition to their housekeeping roles during protein synthesis, they also participate in other cellular activities. The main objective of this dissertation is to characterize these two classic ncRNAs by their signature digestion products and MALDI mass spectrometry.
The separation of biologically active, pure, specific tRNAs is difficult due to the overall similarity in secondary and tertiary structures of different tRNAs. Because prior methods do not facilitate high-resolution separations of the extremely complex mixture represented by a cellular tRNA population, global studies of tRNA characterization are rare. I have found that the enzymatic digestion of an individual tRNA by a ribonuclease will generate digestion products yields a set of unique or signature digestion products that ultimately enable the detection of individual tRNA from a total tRNA pool. The detection is facilitated by MALDI-MS. This facile method enables the individual identification of tRNA isoacceptors without requiring any purification steps. I also developed a new approach including multiple ribonucleases to increase tRNA detection where an RNA mixture is digested separately with three ribonucleases, RNase
T1, RNase A, and RNase TA, which generate their own sets of signature digestion products. The digestion conditions of these three ribonucleases with E. coli and B. subtilis were optimized.
This signature digestion product-based detection technique has been extended to 16O- and
18O-isotope labeling for RNA quantification. I introduced two equations to overcome the
interfering peak-related difficulty and was able to calculate the ion abundance ratios of those 1
Da overlapping peaks. My studies on a mixture of standard tRNAs and total tRNAs of E. coli
iii grown in MOPS minimal and EZ rich defined medium found that this approach provided quantitative results from those complex samples at light-to-heavy ratio between 2.5:1 and 1:2.5 with MALDI-MS. Selection of an appropriate product ion in the MALDI spectra is crucial for accurate results. Preliminary work has also been done related to the quantification of large rRNAs of E. coli and to the detection of cytoplasmic and mitochondrial tRNAs in yeast S. cerevisiae.
iv
v ACKNOWLEDGEMENTS
I would like to provide a great deal of thanks for patience, understanding, consideration
and encouragement that my mentor Professor Patrick A. Limbach has shown me over the past
four and half years. I am really grateful to him. I would also like to thank him for the guidance
and endless support throughout this project, and for letting me work and think almost
independently.
Committee members, Professor Joe Caruso and Professor Albert Bobst, are highly
recognized for their constructive suggestions, guidance, and continuous support for my graduate research and dissertation. Very special thanks to Professor William Heineman, Professor Brian
Halsall, Professor Apryll Stalcup and Professor Tom Ridgway for all they have done for me. I would also like to thank Department of Chemistry at University of Cincinnati for the financial support and for the valuable teaching experience. Special thanks to Dr. Stephen Macha of Mass
Spectrometry Facility and all of the Limbach research group members, from both present and past, for their support, encouragement and help. This is a wonderful research group to work in.
Finally, I would like to thank my lovely wife Khodeja Tull Fatema and my Halloween daughter Fariha Fardin for all of their love, endurance and cooperation. All my love also goes to my parents, Md. Amir Hossain and Ms. Fatema Hossain, without them, I could never have accomplished so much, and I am forever grateful for their affection, sacrifice, support and
contribution in their only child’s life.
vi
TABLE OF CONTENTS
ABSTRACT…………………………………………………………………………………… iii
ACKNOWLEDGEMENTS…………………………………………………………………... vi
LIST OF FIGURES……………………………………………………………………………. 4
LIST OF TABLES……………………………………………………………………………… 6
LIST OF ABREVIATIONS…………………………………………………………………… 8
PROLOGUE………………………………………………………………………………….. 10
CHAPTER 1. INTRODUCTION…………………………………………………………… 12
1.1 Central dogma of molecular biology…………………………………………….... 12
1.2 Ribonucleic acids………………………………………………………………….. 12
1.3 Non-protein coding RNAs………………………………………………………… 14
1.4 Major ncRNAs in cells…………………………………………………………….. 15
1.5 Significant cellular roles of major ncRNAs……………………………………….. 19
1.6 Classical methods for isolating the major ncRNAs……………………………….. 23
1.7 Contemporary methods for the characterization of major ncRNAs………………. 26
1.8 MALDI mass spectrometry for biomolecules…………………………………….. 27
1.9 Research goal……………………………………………………………………… 40
CHAPTER 2. SIGNATURE DIGESTION PRODUCT…………………………………… 41
2.1 Introduction………………………………………………………………………... 41
2.2 Experimental………………………………………………………………………. 41
1
2.3 Results……………………………………………………………………………. 44
2.4 Discussion………………………………………………………………………… 57
2.5 Conclusion………………………………………………………………………… 60
CHAPTER 3. MULTIPLE RIBONUCLEASES………………………………………….. 62
3.1 Introduction……………………………………………………………………….. 62
3.2 Experimental………………………………………………………………………. 62
3.3 Results…………………………………………………………………………….. 64
3.4 Discussion………………………………………………………………………… 83
3.5 Conclusion………………………………………………………………………… 90
CHAPTER 4. RELATIVE QUANTIFICATION OF SMALL RNA…………………….. 91
4.1 Introduction……………………………………………………………………….. 91
4.2 Experimental………………………………………………………………………. 92
4.3 Results…………………………………………………………………………….. 94
4.4 Discussion………………………………………………………………………... 111
4.5 Conclusion………………………………………………………………………... 112
CHAPTER 5. EXTENDED APPLICATIONS OF SIGNATURE DIGESTION
PRODUCTS…………………………………………………………………………………. 113
5.1 General introduction……………………………………………………………... 113
Part A. Relative quantification of large ribosomal rRNAs of E. coli by their
signature digestion products………………………………………………………... 114
2
5.2 Introduction……………………………………………………………………… 114
5.3 Experimental……………………………………………………………………... 114
5.4 Results……………………………………………………………………………. 117
5.5 Discussion………………………………………………………………………... 118
5.6 Conclusion……………………………………………………………………….. 119
Part B. Detection of mitochondrial transfer RNAs import of Saccharomyces
cerevisiae by their signature digestion products…………………………………... 119
5.7 Introduction………………………………………………………………………. 119
5.8 Experimental……………………………………………………………………... 119
5.9 Results…………………………………………………………………………… 123
5.10 Discussion……………………………………………………………………… 129
5.11 Conclusion……………………………………………………………………… 131
CHAPTER 6. SCOPE……………………………………………………………………… 132
BIBLIOGRAPHY………………………………………..………………………………… 135
3
LIST OF FIGURES
Figure 1.1 Structure of four common ribonucleotides………………………………………… 13
Figure 1.2 Schematic of a typical E. coli transfer RNA……………………………………….. 17
Figure 2.1 Overview of small RNA isolation procedure……………………………………… 43
Figure 2.2 Determination of signature digestion products. Digestion products in bold are unique or signature digestion products, the rest are common…………………………………….…… 46
Figure 2.3 Some selected common and signature digestion products of tRNATyr I found experimentally when digested with ribonuclease T1. (peaks marked with * are common peaks, whereas marked with # are signature peaks)…………………………………………………... 47
Figure 2.4 Ribonuclease T1 cleavage mechanism………………………………………….…. 48
Figure 2.5 MALDI mass spectra obtained from the RNase T1 digestion of mixtures of E. coli tRNAs. (a) tRNAs of Tyr I, Val III, and Glu II. (b) tRNAs of Phe, Val III, and Glu II. (c) tRNAs of Tyr I, Phe, and Glu II. (d) tRNAs of Tyr I, Phe, and Val III……………………………….. 50
Figure 2.6 Heat map representation of the results from Figure 2.5, along with m/z and sequences of signature digestion products. In all analysis, reproducible detection of the signature digestion products of the expected tRNAs is demonstrated……………….……………………………... 51
Figure 2.7 MALDI mass spectra obtained from the RNase T1 digestion of total tRNA mixtures of E. coli from Sigma. (a) m/z 850-1750; (b) m/z 1850-2600………………………………..… 52
Figure 2.8 MALDI mass spectra obtained from the RNase T1 digestion of E. coli tRNAs. (a) m/z 900-2700; (b) 2700-6000…………………………………………………………….… 54
Figure 2.9 Reproducibility study of RNase T1 digest of E. coli total tRNA mixture………… 56
Figure 3.1 tRNA isoacceptors……………………………………………………………….… 67
Figure 3.2 Digestion of four tRNA mixtures with ribonuclease A. (a) tRNAs of Tyr II, Val III, and Glu II. (b) tRNAs of Phe, Val III, and Glu II. (c) tRNAs of Tyr II, Phe, and Glu II. (d) tRNAs of Tyr II, Phe, and Val III ……………………………………………..…………….… 78
Figure 3.3 RNase TA digestion of tRNATyr I and tRNAGlu II with their expected digestion products………………………………………………………………………………………… 80
Figure 3.4 RNase TA digestion of four standard tRNAs – tRNATyr I, tRNAVal III, tRNAPhe, and tRNAGlu II. Unique digestion products are marked…………………………………………….. 81
Figure 3.5 RNase A digestion of E. coli total tRNA mixture…………………………………. 86
4
Figure 3.6 RNase TA digestion of E. coli total tRNA mixture……………………………...… 86
Figure 3.7 RNase T1 digestion of B. subtilis total tRNA mixture…………………………..… 87
Figure 3.8 RNase A digestion of B. subtilis total tRNA mixture……………………………... 87
Figure 3.9 RNase TA digestion of B. Subtilis total tRNA mixture…………………………… 88
Figure 4.1 Overall relative quantification scheme………………………………………….…. 95
Figure 4.2 18O- and 16O-labeling approach for relative quantification……………………...… 96
Figure 4.3 Ion abundance ratio for simple peak…………………………………………….… 97
Figure 4.4 Ion abundance ratio of overlapping peak…………………………………………... 98
Figure 4.5 Dynamic range for isotope labeling generated from the data presented in Table 4.3 of the RNase T1 digestion products of four standard tRNAs.. ……………………………….… 104
Figure 4.6 Representative MALDI mass spectra of RNase T1 digestion products obtained from the standard tRNA mixture prepared at a heavy-to-light ratio of 1:1. Inset: expanded view of RNase T1 digestion product of tRNATyr I and tRNAGlu II used for quantification………….… 105
Figure 4.7 Representative MALDI mass spectra of RNase T1 digestion products obtained from a E. coli tRNA mixture prepared from equal amount. Inset: expanded view of RNase T1 digestion product of tRNAGln, tRNATyr, and tRNAGlu used for quantification…………………..….…. 109
Figure 5.1 Overall research scheme for large rRNAs………………………………………... 117
Figure 5.2 Percent of coverage of detected signature digestion products with MALDI-MS compared to theoretical products; (a) cytosolic tRNAs (b) mitochondrial tRNAs…………… 131
5
LIST OF TABLES
Table 2.1 Experimentally detected individual tRNA through signature peaks from E. coli tRNA pool by RNase T1-mediated cleavage and MALDI-MS………………………………... 55
Table 2.2 List of all theoretical signature digestion products peaks of E. coli tRNAs………... 58
Table 2.3 E. coli tRNA abundances and detection by MALDI-MS using signature digestion peaks…………………………………………………………………………………………… 60
Table 3.1 RNase A digestion of total tRNA of E. coli………………………………………... 65
Table 3.2 RNase TA digestion of E. coli whole tRNA…………………………………..…… 66
Table 3.3 List of theoretical signature digestion products of E. coli with RNase T1, RNase A, and RNase TA. Bold ones are experimentally detected by MALDI-MS……………………… 68
Table 3.4 RNase T1 digestion of whole tRNA mixture of B. subtilis……………………...…. 69
Table 3.5 RNase A digestion of whole tRNA mixture of B. subtilis…………………….…… 70
Table 3.6 RNase TA digestion of whole tRNA mixture of B. subtilis………………………... 71
Table 3.7 List of theoretical signature digestion products of B. subtilis with RNase T1, RNase A, and RNase TA. Bold ones are experimentally detected by MALDI-MS………………………….
Table 3.8 (A) Summary of the number of theoretical signature digestion products for E. coli tRNAs (of Ala to Leu). Total numbers of signature products are in parentheses after each tRNA families…………………………………………………………………………………………. 73
Table 3.8 (B) Summary of the number of theoretical signature digestion products for E. coli tRNAs (of Lys to Val). Total numbers of signature products are in parentheses after each tRNA families…………………………………………………………………………………………. 74
Table 3.9 Summary of the number of theoretical signature digestion products for B. subtilis tRNAs. Total numbers of signature products are in parentheses after each tRNA families…… 75
Table 3.10 List of signature digestion products of four tRNA mixtures……………………… 79
Table 3.11 List of combined signature digestion products of E. coli with all three ribonucleases. Bold ones are experimentally detected by MALDI-MS……………………..… 84
Table 3.12 List of combined theoretical signature digestion products of B. subtilis with all three ribonucleases. Bold ones are experimentally detected by MALDI-MS………………..……… 85
6
Table 3.13 E. coli tRNA abundances and detection by MALDI-MS using signature digestion peaks. Major tRNAs are in shaded area……………………………………………………...… 89
Table 4.1 The numbers of gene copies for each unmodified anticodon species are shown in a universal codon table. The values in parentheses indicate the relative codon usage (0.1%) in E. coli…………………………………………………………………………………………………………. 91
Table 4.2 List of digestion products with RNase T1 digestion of a tRNA mixture. The digestion products in shaded area are non-quantifiable signature digestion peaks…………………...… 101
Table 4.3 Ion abundance ratio of standard tRNAs mixture……………………………..…… 103
Table 4.4 Experimentally detected individual tRNA through signature peaks from E. coli tRNA pool by RNase T1-mediated cleavage and MALDI-MS. Shaded area consist of non- quantifiable signature digestion products………………………………………………….… 107
Table 4.5 Average ion abundance ratio for denoted heavy/light mixtures of the selected tRNA digestion products of E. coli………………………………………………………………..… 108
Table 5.1 Signature digestion products arise from RNase T1 digestion of total large rRNAs of E. coli. Bold m/z values are detected by MALDI-MS…………………………………………… 118
Table 5.2 Signature digestion products arise from RNase A digestion of total large rRNAs of E. coli. Bold m/z values are detected by MALDI-MS…………………………………………... 118
Table 5.3 Signature digestion products arise from RNase T1 digestion of total cytosolic tRNAs of S. cerevisiae……………………………………………………………………………………….…. 124
Table 5.4 Signature digestion products arise from RNase A digestion of total cytosolic tRNAs of S. cerevisiae…………………………………………………………………………………………..…. 125
Table 5.5 Signature digestion products arise from RNase T1 digestion of total mitochondrial tRNAs of S. cerevisiae……………………………………………………………………….………… 126
Table 5.6 Signature digestion products arise from RNase A digestion of total mitochondrial tRNAs of S. cerevisiae……………………………………………………………………………….… 127
Table 5.7 List of experimentally detected signature digestion products of commercially available total tRNAs mixture of S. cerevisiae from Ambion with RNase T1……………………….… 128
Table 5.8 List of theoretical signature digestion products of S. cerevisiae total tRNAs with RNase T1. Bold ones are experimentally detected by MALDI-MS………………………..… 128
Table 5.9 List of theoretical signature digestion products of S. cerevisiae total tRNAs with RNase A. Bold ones are experimentally detected by MALDI-MS……………………...…… 129
7
LIST OF ABREVIATIONS
A Adenine
A260 Absorbance at 260 nm
B. subtilis Bacillus subtilis
C Cytosine kDa Kilo-Dalton
DAHC Diammonium hydrogen citrate
E. coli Escherichia coli
EDTA Ethylenediaminetetraacetic acid
G Guanine m/z Mass-to-charge ratio
MALDI-MS Matrix-assisted laser desorption/ionization mass spectrometry mM Millimolar
MS Mass spectrometry ncRNA Non-protein coding RNA ng Nanogram
OD600 Optical density at 600 nm
RNA Ribonucleic acid
RNase Ribonuclease rRNA Ribosomal RNA
S. cerevisiae Saccharomyces cerevisiae
SDS Sodium dedocyl sulphate
8
THAP 2,4,6-trihydroxyacetophenone tRNA Transfer RNA tRNAGlu II Transfer RNA, glutamic acid II specific tRNAPhe Transfer RNA, phenylalanine specific
U Uracil
YEPD Culture media containing yeast extract, peptone, and dextrose
µg Microgram
µL Microliter
9
Prologue
The main objective of this dissertation is to characterize the non-protein coding ribonucleic acids (ncRNAs) by their signature digestion products using Matrix-Assisted Laser
Desorption/Ionization mass spectrometry (MALDI-MS). All of the RNAs except messenger
RNA (mRNA) present in the cell are ncRNAs as they do not encode for cellular proteins.
Transfer RNAs (tRNAs) and ribosomal RNAs (rRNAs) are the major ncRNAs. Non-protein coding RNAs are mostly single stranded nucleotide polymers with a stem and loop structure - sometimes with specific structural motifs. Whatever the structural or functional characteristics they possess, all are composed of four nucleotides - adenine (A), guanine (G), cytosine (C), and uracil (U). Although ncRNAs have been known for more than half a century, global characterization techniques are not common. Separation of individual non-protein coding RNAs
is complicated due to their intimately related physiochemical properties. I have developed a
signature digestion product approach that helps to characterize major ncRNAs in a complex
cellular ensemble. When ncRNA mixtures are digested with a ribonuclease, several digestion
products arise, including those unique (i.e., specific mass) to individual ncRNAs, which are the
signature digestion product(s) for that particular RNA. Mass spectrometry has several advantages
for the characterization of nucleic acids due to its ability for providing mass and sequence information. This method enables the individual identification of tRNA isoacceptors or particular rRNAs without requiring any purification techniques. By using this approach, characterization of a specific RNA in a complex mixture is possible in a manner similar to peptide mass fingerprinting used in proteomics allowing RNomic studies of RNA at the post-transcriptional level.
10
This dissertation is divided into six chapters. Chapter one is the introduction. The ncRNAs of prokaryotes, especially of eubacteria, are described here. The role and necessity of ncRNAs in the cell are mentioned as well as the classical and contemporary methods for their characterization with their limitations and scopes. The goal of overall research is also presented.
Chapter two describes the signature digestion product approach. It is the major theme of this research project. The identification and experimental determination of E. coli tRNA signature digestion products by MALDI-MS are described here. Chapter three describes the multiple ribonucleases approach. Maximizing the experimental detection of tRNAs of E. coli and
Bacillus subtilis has been done by using multiple ribonucleases to generate a larger number of signature products. Chapter four describes the relative quantification of small RNAs. Here relative quantification by using 16O- or 18O-labeled water during enzymatic digestion is described. Chapter five describes the extended applications of signature digestion products.
Preliminary studies on the relative quantification of E. coli rRNAs and the identification of ncRNAs of cellular organelle, especially tRNAs of cytosolic and mitochondrial origin, are described to pave the way to detect tRNA import of mitochondria in Saccharomyces cerevisiae and in other higher organisms. Chapter six describes the scope of this method. Future possibilities of the signature digestion product approach are discussed in this last chapter.
11
CHAPTER 1: INTRODUCTION
1.1 Central dogma of molecular biology.
The functional unit of information in living systems is the gene. A gene is defined
biochemically as a segment of deoxyribonucleic acid (DNA) (or, in a few cases, ribonucleic acid,
RNA) that encodes the information required to produce a functional biological product – a
protein. Genetic theory contributed the concept of coding by genes. Physics permitted the determination of molecular structure by x-ray diffraction analysis. Chemistry revealed the composition of nucleic acids and proteins [1]. These and other major advances gave rise to the central dogma of molecular biology comprising the three major processes in the cellular utilization of genetic information.
The first is replication, the copying of parental DNA to form daughter DNA molecules with identical nucleotide sequences. The second is transcription, the process by which parts of the genetic message encoded in DNA are copied precisely into RNA. The third is translation, whereby the genetic message encoded in messenger RNA is translated on the ribosome into a polypeptide with a particular sequence of amino acids.
1.2 Ribonucleic acids.
The expression of the information in a gene normally involves production of an RNA molecule transcribed from a DNA template. Strands of RNA and DNA may seem quite similar at first glance, differing only in the hydroxyl group at the 2´ position of the pentose and the substitution of uracil (U) for thymine (T) (Figure 1.1). However, unlike DNA, most RNAs exist
12
as single strands. These strands fold back on themselves with the potential for much greater structural diversity than DNA. RNA is thus suited to a variety of cellular functions.
NH2 O N N N NH O O - N N N O PO - N NH2 O O PO - - O O O
OH OH OH OH
Adenosine 5' monophosphate Guanosine 5' monophosphate
O NH2
N NH O O - N O - N O O PO O PO O - O - O O
OH OH OH OH
Cytidine 5' monophosphate Uridine 5' monophosphate
Figure 1.1 Structure of four common ribonucleotides.
RNA is the only macromolecule known to function both in the storage and transmission of information and in catalysis, leading to much speculation about its possible role as an essential chemical intermediate in the development of life on this planet. The discovery of catalytic RNAs, or ribozymes, has changed the very definition of an enzyme, extending it beyond the domain of proteins [2].
13
1.3 Non-protein coding RNAs.
A non-protein coding RNA (ncRNA) is any RNA molecule that is not translated into a
protein [3]. Non-protein coding RNAs include transfer RNAs (tRNAs), ribosomal RNAs
(rRNAs), small interfering RNA (siRNAs), small nucleolar RNAs (snoRNAs), micro RNAs
(miRNAs), guide RNAs (gRNAs), piwi-interacting RNAs (piRNAs), and tmRNAs. Transfer
RNA carries the correct amino acid to a growing polypeptide chain at the ribosomal site of
protein biosynthesis during translation, in addition to other recently found cellular roles.
Ribosomal RNAs are synthesized in the nucleolus by RNA polymerase I, and are the central
component of the ribosome, the protein manufacturing machinery of all living cells. The function
of rRNA is to provide a mechanism for decoding mRNA into polypeptides and to interact with
tRNAs during translation by providing peptidyl transferase activity. Small interfering RNA is a
class of small RNA molecules (20-25 nucleotides in length) formed through cleavage of long
double-stranded RNA molecules. siRNAs are particularly important for taming the activity of
transposons and combating viral infection, but they can also regulate protein-coding genes.
Synthetic siRNA can also be artificially expressed for experimental purposes [4]. Small
nucleolar RNAs are a class of small RNA molecules that guide chemical modifications
(methylation or pseudouridylation) of rRNAs and other RNA genes [5]. Small Cajal Body specific RNAs are a class of small RNA molecules similar to snoRNAs which specifically localize in the Cajal body, a nuclear organelle involved in the biogenesis of small nuclear RNA.
U85 is the first reported scaRNA. Unlike typical snoRNA, U85 can guide both pseudouridylation and 2´-O-methylation [6]. MicroRNAs are small RNAs that are the reverse complement of portions of an mRNA transcript and alter the expression of one or several genes through RNA interference. They are around 20-25 nucleotides long in the mature form, single-stranded, and are
14
integrated into the RNA-induced silencing complex (RISC) [4]. Guide RNAs are RNAs that
function in RNA editing. gRNA mediated RNA editing has been found in the mitochondria of
kinetoplastids, in which mRNAs are edited by inserting or deleting stretches of uridylates. The
gRNA forms part of the editosome and contains sequences that hybridize to matching sequences
in the mRNA, to guide the mRNA modifications. Other types of RNA editing are found in many eukaryotes, including humans [7]. Piwi-interacting RNAs are small RNAs (25-30 nucleotides
length) that are generated from long single-stranded precursors. They function as association
with the piwi subfamily of Argonaute proteins, and are essential for the development of germ
cells [8,9]. The bacterial tmRNA is so-named for its dual tRNA-like and mRNA-like nature (also
known as 10Sa RNA or SsrA). tmRNA recognizes ribosomes that have trouble translating or
reading an mRNA and stall, leaving an unfinished protein that may be detrimental to the cell.
tmRNA acts like a tRNA first, and then an mRNA that encodes a peptide tag. The ribosome
translates this mRNA region of tmRNA and attaches the encoded peptide tag to the C-terminus
of the unfinished protein. This attached tag targets the proteins for destruction or proteolysis.
tmRNA gene sequences have been identified in all completely sequenced bacterial genomes (in
17 of 20 phyla) and in certain phage, mitochondrial and plastid genomes, but not yet in archaeal
or eukaryotic nuclear genomes [10]. The signal recognition particle is an RNA-protein complex
present in the cytoplasm of cells that binds to the mRNA of proteins that are destined for
secretion from the cell. The RNA component of the SRP in eukaryotes is called 4.5S RNA [11].
1.4 Major ncRNAs in the cell.
Among all of the above-mentioned non-protein coding RNAs, transfer RNAs and
ribosomal RNAs are mostly comprehended in terms of their known structures and functions.
15
This research project is confined to two of the major or classic ncRNAs, tRNAs and rRNAs,
which have housekeeping roles during mRNA translation [4]. From now on most of the
discussions in this dissertation are limited to these major noncoding RNAs.
1.4.1 Transfer RNAs (tRNAs)
Even before deciphering the genetic code during the 1960s, Francis Crick had postulated, in 1956, that protein synthesis is mediated by “adaptor” RNA molecules [12]. Two years later,
Hoagland et al. discovered a nucleic acid fraction of low molecular weight that served as a carrier for amino acids, transporting them to the place where polypeptides are synthesized. This fraction was termed soluble RNA (sRNA) and was described as mixture of components, each with adaptor ability for a particular amino acid [13]. Nowadays, we know that the sRNA or adaptor molecules are the transfer RNA (tRNA) and they are linking factors between the RNA world and the protein world. The specificity of deciphering results from the fact that tRNAs contain at one tip of their L-shaped tertiary structure an anticodon complementary to a specific codon and at the other tip the corresponding aminoacyl residue linked by an energy-rich ester bond (∆G° ´ = ~-6 kcal mol-1). Charging of tRNAs is performed by synthetases (aaRS), and all
tRNAs that can carry the same amino acid (isoacceptor tRNAs) are usually recognized by the
same enzyme [14].
tRNA constitutes only 10-15% of the total RNA in Escherichia coli. Each tRNA has a
molecular weight of about 25 kDa and a relative sedimentation coefficient of 4S giving rise to
16
Figure 1.2 Schematic of a typical E. coli transfer RNA.
the original name “4S RNA”. The size of tRNA is variable, but on average they have a length of
76 nucleotides (nt). The longest tRNA identified so far is tRNASer from E. coli having 91 nt whereas in nematode mitochondria very short cripple tRNAs (about 56 nt) are found lacking either the D or the TΨC stem loops [15]. Sequence comparison of various tRNAs reveals that all tRNAs adopt a cloverleaf secondary structure which is characterized by three stems (acceptor stem, D stem, and anticodon stem) and four loops or hairpins (D loop, anticodon loop, variable loop, and T loop) (Figure 1.2). The variable loop exists between the T-loop and the anticodon loop, which can be anywhere between 4 and 24 nts. According to the length of this variable loop, the tRNAs have been classified as class I (4-5 nts in variable loops, the vast majority) and class
II (10-24 nts in variable loops, tRNALeu, tRNASer, and tRNATyr in eubacteria and some
organelles) [16].
17
The crystal structure at 3 Å resolutions of yeast tRNAPhe and later tRNAAsp confirmed
that the tRNA molecules adopt an L shape. It is the product of a double co-axial stacking
between the acceptor stem with its CCA end and the T stem loop forming the short arm of the L
arm, and the anticodon stem loop and the D stem loop forming the long arm. In this way, the
cloverleaf structure of the tRNA is transformed into two main domains: the acceptors and
anticodon arms, respectively, enclosing an angle of about 90°.The extremities of both domains
represent the functional “hot spots” of tRNAs [17, 18].
tRNAs are the most modified RNA molecules; almost 25% of the nucleotides of a tRNA
are modified. Eighty nucleotide modifications out of more than 100 reported modifications in all
RNA molecules have been observed in tRNAs [19]. Usually the modification reaction is an
alteration of, or addition to, existing bases in the tRNA, an exception being the base queuosine
(Q). This base is found 5´ to the anticodon at position 34 of tRNAs that read NAU or NAC
codons (where N is any nucleotide), and the modification requires an enzyme that exchanges free
queuosine with guanosine. Many examples of tRNA modifications include ribose/base
methylations (2´-O-methylguanosine, Gm; 2´-O-methylcytidine, Cm; 5-methylcytidine, m5C), base isomerization (U to pseudouridine, Ψ), base reduction (U to D; dihydrouridine), base thiolation (2-thiocytidine, s2C; 2-thiouridine, s2U; 4-thiouridine, s4U) and base deamination
(inosine, I). Some modifications are conserved features of all tRNA molecules (D residues that
give rise to the name of the D-arm, Ψ found in the T ΨC sequence) [14].
There is a distinct synthetase that recognizes every tRNA that participates in the decoding
of the same amino acid, and this group of tRNAs are termed isoaccepting tRNAs. For such a
situation to exist, the isoaccepting tRNAs carry some identical signals or elements for the
recognition of their synthetase [20, 21].
18
1.4.2 Ribosomal RNAs (rRNAs)
The ribosomal RNAs lie at the core of the protein synthesis machinery. In all organisms the ribosome consists of two subunits. These are designated the 40S and 60S subunits in
eukaryotes and the 30S and 50S subunits in Bacteria, Archaea and the cytoplasmic organelles of eukaryotes, mitochondria and chloroplasts. In almost all organisms the small ribosomal subunits contain a single RNA species (the 18S rRNA in eukaryotes and the 16S rRNA elsewhere). In
Bacteria and Archaea, the large ribosomal subunit contains two rRNA species (the 5S and the
23S rRNAs); in most eukaryotes the large subunit contains three RNA species (the 5S, 5.8S and
25S/28S rRNAs). Sequence analysis shows that the 5.8S rRNA corresponds to the 5´ end of the bacterial and archaeal 23S rRNAs, and was presumably generated early in eukaryotic evolution by insertion of a spacer sequence. Chloroplast large ribosomal subunits also contain three RNAs; in this case the 4.5S rRNA is derived from the 3´ terminus of the bacterial 23S rRNA. Finally, in mitochondria the large subunit rRNA is smaller in size and is designated the 21S rRNA [22].
1.5 Significant cellular roles of major ncRNAs.
In addition to the main role in protein synthesis, tRNAs are also involved in a series of other activities in the cell. [14] Those are as follows:
i) tRNALys III is used as a primer for DNA synthesis by HIV reverse transcriptase [23].
ii) Some tRNAs induce the formation of anti-termination structures of the non-translated
region upstream (UTR) of the structural genes of some amino acid operons (ilv-leu,
his, trp) and of some tRNA synthetase genes (thrS, tyrS, lueS, pheS) [24].
19
iii) A deacylated tRNA binds to the ribosome-bound enzyme, RelA, for synthesizing
signaling molecule (p)ppGpp in bacterial stringent response [25]. Under nutrient
deprivation conditions, bacterial cells down-regulate the transcription of genes that
belong to the regulation circuit known as “stringent response” which is mediated by
the synthesis of (p)ppGpp. iv) Glu-tRNAGlu is an activated intermediate in the biosynthetic pathway of δ-
aminolevulinate [26], a tetrapyrrole precursor of porphyrins in plants and bacteria.
The ALA biosynthesis starts with the aminoacylation of tRNAGlu by GluRS, and then
a DADPH-dependent reduction reaction catalyzed by glutamyl-tRNA reductase
occurs on Glu-tRNAGlu to yield glutamyl 1-semialdehyde. Finally, the amino group
of glutamate 1-semialdehyde is transferred to its terminal carbon by an intramolecular
reaction catalyzed by a specific aminotransferase forming ALA. v) Amino acid residues from aminoacyl-tRNAs are used in a cross-linking reaction in
peptidoglycan synthesis of bacterial cell wall [27, 28]. By this reaction, the
pentapeptide moieties attached to the N-acetyl muramic acid residue of both the
disaccharides, N-acetyl muramic acid-N-acetyl glucosamine units, become covalently
bound. vi) RNA polymerase III activity in silkworm depends on several transcription factors,
including tRNAIle containing transcription factor TFIIIR, a fraction in which
transcription activity is provided by RNA [29]. vii) Amino-acyl tRNAs are involved in a proteolytic “N-end rule” pathway [30]. The N-
end pathway governs the half-life of a protein in a cell with respect to the identity of
its N-terminal amino acid residue.
20
viii) In mammals, many diseases are known that are caused by tRNA defects in the
mitochondria, including several human neurodegenerative disorders [31, 32].
Ribosomal RNAs were long regarded as mere scaffolds for the ribosomal proteins (r- proteins) but recent work has shown that the rRNAs in fact carry out the key reactions in translation. A major function of r-proteins is ensuring the correct structure of rRNA, allowing its tight packing around the active centre of the ribosome. The cellular contribution of rRNA [33] includes:
i) Inspection of the structure of rRNAs in distant organisms from the three domains of
life reveals that despite substantial differences among primary sequence, both the
small subunit rRNA (SSU-rRNA) and large subunit rRNA (LSU-rRNA) display
remarkable conservation of their secondary, and probably tertiary, structures. Core
structures can be drawn for the SSU- and LSU-rRNAs which can accommodate the
secondary structures of all rRNAs. The most conserved elements are presumed to be
of functional significance. Notably, almost all the rRNA posttranscriptional
modifications (base and ribose methylation as well as conversion of uridine to Ψ) fall
within these conserved core regions of the rRNAs. In the primary sequences of the
rRNAs, the conserved sequences are separated by variable regions, in which the
primary and secondary structures diverge more rapidly in evolution. The overall
length of these regions is also poorly conserved and is generally longer in eukaryotes;
they are therefore often referred to as expansion segments. The core structures of the
SSU- and LSU-rRNAs contain 10 and 18 such variable regions, respectively. In
general, the variable regions are not necessary for ribosome function.
21
ii) The combination of biochemical approaches, mostly cross-linking experiments and
chemical foot-printing of rRNAs bound to tRNAs or to various antibiotics, with the
genetic analysis of E. coli strains bearing mutations in their rRNAs led to the
definition of several functional domains in the rRNAs. Domains were ascribed to the
most basic functions of the ribosome (i.e., decoding or codon-anticodon recognition
and peptidyl-transferase activity) as well as to antibiotic binding and interactions with
ribosomal proteins and translational factors. The general picture which emerged from
these studies is that the decoding center of the ribosome lies within its small subunit
and the peptidyltransferase activity is carried out with large subunit. The accuracy of
translation is determined by components of both subunits, probably reflecting
interactions of the tRNAs with both ribosomal subunits. iii) The identification of the ribosomal components involved in peptide-bond formation
has been a longstanding challenge in ribosome research. This area was mostly
explored in E. coli, making use of systems for in vitro reconstitution of the subunits.
The current view is that the catalytic activity of the ribosome lies in its RNA
components while the ribosomal proteins act as chaperons in ribosome assembly and
as cofactors to increase the efficiency of the RNA-mediated peptidyltransferase (PT)
reaction and the accuracy of translation. iv) In bacteria, the 3´ end of the 16S rRNA base pairs with mRNA. This is termed the
Shine-Dalgarno interaction and is crucial for translation initiation. In E. coli, an
rRNA-mRNA interaction is proposed to play a role in the recognition of the
termination triplet.
22
v) Antibiotics have been of great use in ribosome research, particularly where their
site(s) of interaction with the ribosome could be correlated with specific translational
defects, providing putative functions for particular sections of rRNAs. Most
characterized antibiotics appear to bind primarily to rRNA. In some cases, the
methylation status of specific rRNA residues correlates with antibiotic resistance or
sensitivity.
vi) Highly conserved in structure and presumed function across all of evolution, the
rRNAs, particularly the small subunit rRNA, have become the most commonly used
markers for establishing phylogenic relationships between organisms. Molecular
phylogeny based on the rRNA sequence led to the conclusion that there are three
domains of life: bacteria (or eubacteria), archaea (or archaebacteria), and eukaryotes
(or eukarya).
1.6 Classical methods for isolating the major ncRNAs
Research on the characterization of tRNA can be traced back to the 1950’s [34]. The
closely related physio-chemical properties of tRNAs have made their isolation as pure species
difficult. Numerous procedures for the fractionation of tRNAs have been reported.
Countercurrent distribution was one of the first techniques used to purify tRNA (then known as
soluble RNA, sRNA) from the soluble fraction of a rat liver homogenate. The solvent system
described by Warner and Vaimberg [35] was used with slight modification, and the distribution
was carried out in the 100-tube countercurrent apparatus described by Raymond [36].
Countercurrent distribution of RNA gives a broad distribution pattern, measured by absorption at
260 nm. Redistribution of materials from different parts of the first distribution pattern
23
establishes that there has been actual fractionation of the RNA. [34] While this technique was
most useful for early studies of tRNAs, it was somewhat unwieldy and separation of tRNAs,
while effective, was quite time consuming [37].
Countercurrent distribution was followed by separation techniques based on the use of
benzoylated DEAE-cellulose (BD-cellulose) by Tener and co-workers [38], DEAE-Sephadex by
Nishimura and coworkers [39], reversed phase chromatography by Kelmers and co-workers [40],
and Sepharose 4B by Holmes et al. [41]. The BD-cellulose column separates tRNAs based on the
interaction of exposed hydrophobic bases to the matrix and provides essentially a one-step
purification of yeast tRNAPhe starting from total yeast tRNA. This tRNA uniquely contains the
hydrophobic base yW (wybutosine) that is exposed and is located next to the anticodon
sequence. Because of this, the yeast tRNAPhe binds tightly to the column even in 1M NaCl and
can be eluted off the column only in the presence of 10% ethanol. DEAE-Sephadex and
Sepharose 4B columns also proved quite useful for large scale purification of many tRNAs.
Reversed phase chromatography (RPC) columns, which could be run at different pHs and temperatures and at high pressure, were quite versatile. Because the columns are run at high pressure, chromatography is quite rapid allowing for fractionation of not just tRNAs but aminoacyl-tRNAs.
Other procedures include chemical modification of uncharged or charged tRNA by the use of monoclonal anti-AMP antibody affinity columns, and by polyacrylamide gel electrophoresis. A combination of hydrophobic chromatography on phenyl-Sepharose and reversed phase HPLC was used to purify individual tRNAs with high specific activity. The efficiency of chromatographic separation was enhanced by biochemical manipulations of the tRNA molecule, such as aminoacylation, formylation of the aminoacyl moiety and enzymatic
24
deacylation [42]. A murine monoclonal anti-AMP antibody affinity matrix was used for isolation
of individual species of tRNAs. The antibodies were prepared using 5´-AMP covalently attached
to bovine serum albumin as the antigen and exhibited high affinity for 5´-AMP but greatly
reduced affinity for 3´-AMP. Native uncharged tRNAs that terminate in a 5´-AMP group on the
amino acid acceptor arm of the molecule bind tightly to the anti-AMP affinity matrix, whereas
aminoacylated tRNAs are not retained. This allows separation of a particular tRNA species as its
aminoacyl derivative from a complex mixture of uncharged tRNAs under very mild conditions
[43]. Elogation factor Tu from Thermus thermophilus containing six histidine residues on its C-
terminus, EF-Tu(CHis6), was used for purification of aminoacyl-tRNA isoacceptors, from
aminoacylated bulk tRNA, by affinity chromatography [44]. Another method employed the
Elongation factor Tu from E. coli, immobilized on activated CH Sepharose 4B, to purify
aminoacylated tRNA isoacceptors from bulk tRNAs [45]. tRNAs from the posterior silk gland
and carcass tissues of the silk warm Bombyx mori were fractionated by high resolution
polyacrylamide gel electrophoresis. Non-labeled tRNA of the posterior silk gland, purified by
benzoylated diethylaminoethyl-cellulose column chromatography and by counter current
distribution, was used to aid in identification of tRNAAla, tRNAGly, and tRNASer isoacceptor
species. The high resolution of tRNA separation on polyacrylamide gels thus provided a
quantitative estimate of the posterior silk gland isoacceptor tRNA distribution which is adapted
to produce large amounts of proteins, silk fibroin, during the fifth larval inster [46].
These methods have been and are of great value for both analytical and preparative experiments. However, they have not been permitted the complete separation of the extremely complex mixture represented by the set of cellular tRNAs. More than one chromatographic procedure must be used to resolve and purify only a few tRNAs, which is time-consuming and
25
usually results in low recovery values. Analogously, chemical modification of tRNA molecules
allows for only the separation of charged from uncharged tRNAs [47]. Thus, these
aforementioned methods are less than ideal for routine analytical research involving individual
tRNAs in complex biological mixtures.
1.7 Contemporary methods for the characterization of major ncRNAs
Over the last couple of decades, several methods based on chromatography,
electrophoresis, and mass spectrometry, have been developed to characterize the tRNAs. Filter
and solution hybridization assays were used for the characterization of yeast cytosolic tRNAPhe, and bovine mitochondrial tRNASer [48, 49, 50]. The hybridization efficiencies varied
considerably among probes, which are complementary to different regions of the tRNAs,
although there was little efficiency variation in the probes toward DNA substrates including the same nucleotide sequence. This efficiency variation was shown to be due to tRNA-specific higher order structures as well as a hypermodified nucleotide in the anticodon loop [50]. Dong et al. used two-dimensional polyacrylamide gel electrophoresis to fractionate tRNA from E. coli and later isolated components were identified by hybridization to tRNA-specific oligonucleotide probes [51]. Systematic measurement of the abundance of different isoaccepting tRNAs were measured by using [5,6-3H]uridine and 32P-containing growth media.
There are still several shortcomings hampering the more widespread use of hybridization:
i) slow kinetics of hybridization to a solid phase, and thus the necessity for a large amount of
immobilized DNA to achieve efficient hybridization; ii) conversely, the requirement to limit the
DNA amount for active immobilization to a support; iii) non-specific interaction of tRNAs with support materials; iv) deterioration of the tRNA recovery rate when the columns are used
26
repeatedly; and v) the need to use different immobilized columns for each tRNA species. The major limitation associated with hybridization efficiency of oligonucleotide probes is the tRNA’s
unpredictability due to secondary/tertiary structures. [50, 52] Mir et al. also supported this idea
by studying the effects of structure on nucleic acid heteroduplex formation in analyzing
hybridization of tRNAPhe to a complete set of complementary oligonucleotides, ranging from
single nucleotides to dodecanucleotides. [53]. Buvoli et al. improved the sensitivity of northern
blotting by alleviating the hindrance to tRNA hybridization [54]. They showed that a
combination of oligodeoxynucleotides employed in the pre/hybridization reaction can reshape
the tRNA structure and increase the sensitivity of specific detection of a suppressor tRNA
derived from the human serine tRNA up to 222-fold. This approach is complex, time consuming,
and overall, not suitable for global analysis of tRNA abundances. Recently, Miyauchi et al. have reported an automated parallel isolation of multiple species of non-coding RNAs including tRNAs from E. coli by the reciprocal circulating chromatography (RCC) method [55]. This approach requires multiple separation techniques – chromatography, gel electrophoresis, and mass spectrometry. A comprehensive, rapid, and sensitive detection of sequence variants of human mitochondrial tRNA genes has been developed on the basis of a modification of denaturing gradient gel electrophoresis (DGGE) [56]. It has shown to be a reliable and efficient mutation screening technique but not suitable for studying the characterization of tRNA sequence with its myriad post-transcriptional modifications.
1.8 MALDI mass spectrometry for biomolecules
1.8.1 Introduction
27
Laser desorption (LD) became an effective method for producing gas-phase ions from
nonvolatile low-mass thermally labile organic salts during the 1970s [57-59] and from
biomolecules during the 1980s [60-61]. However, in LD, molecules with masses over ca. 1000
Da almost always produce only fragment ions. The introduction of an excess of a light-
absorbing compound, the matrix, combined with the analyte of interest facilitated the
development of matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS).
Specifically, the addition of ultrafine metal powder to analyte solutions in glycerol [62] and the co-crystallization of the analyte with an organic small molecule matrix [63], coupled with a time-
of-flight mass analyzer were developed to ionize large biomolecules, these new approaches
revolutionized the area of mass spectrometry by producing mass spectra of proteins of ca.
100,000 Da.
1.8.2 Suspension Matrices
Tanaka et al. changed the perception that LD cannot be used for high mass biomolecules
without fragmentation [62]. An ultra fine metal powder (UFMP, cobalt powder of about 300 Å
diameter) and glycerol were dissolved with organic solvents, e.g., ethanol and acetone, with this
solution along with analyte being dripped onto the sample holder. The sample holder, with
vacuum dried sample, was then introduced into the mass spectrometer for analysis [62] and were
able to detect several high-mass molecular ions e.g., lysozyme (mol. Wt 14.3 kDa), chymotrypsinogen (mol wt. 25.7 kDa), poly(propylene glycol) (PPG) (avg. mol. wt 4kDa),
carboxypeptidase A (mol. wt 34.4 kDa), bovine insulin (mol. wt 5.7 kDa), cytochrome C (mol.
wt 12.3 kDa),and PEG20K (avg. mol. wt ca 20 kDa) [62, 64]. This particle suspension matrix
28
approach was further pursued by only a few groups [65-68] and was shown to be useful for the analysis of some compounds that are less compatible with the normal MALDI chemical matrices
[69], because of limitations in the mass range, analytical sensitivity, and/or spectra quality [68].
1.8.3 Chemical Matrices
The method of sample preparation chosen by Karas and Hillenkamp was fundamentally different. In 1985, Hillenkamp and co-workers began to publish papers containing the hypothesis that large molecular ions could be produced by mixing the analyte with a matrix material that was chosen for its ability to absorb light [70, 71]. This matrix material would absorb light, resulting in its ablation and, hopefully, to a coupled desorption of analyte molecule ions. The profound role of the matrix in driving the desorption process led to the designation of this approach as matrix-assisted laser desorption/ionization (MALDI). They reported the ability of
MALDI-MS to generate a large number of intact molecular ions as well as dimers and doubly charged molecular ions of proteins in the mass range above 10000 Da, stable at least up to time lengths of about a millisecond. In all cases, singly charged molecular ions were the base peaks and no fragmentation was observed above 1000 Da [63]. Today, analysts commonly make their choice from a relatively small number of established “chemical matrices”, e.g., from benzoic or cinnamic acid derivatives. The actual choice depends on the type of the sample being analyzed with only a few matrix compounds (e.g., 2,5-dihydroxybenzoic acid (2,5-DHB)) proving useful for a number of different compound classes [72].
1.8.4 MALDI matrix properties and preparations
1.8.4.1 Matrix Properties
29
The MALDI technique involves the process of desorption, dissociation and ionization of
the analyte and the matrix under high laser energy. The essence of MALDI-MS is the matrix.
Generally analyte compounds are embedded in a surplus of matrix (ca. 1000-fold molar excess) and are co-desorbed upon laser excitation. Despite the importance of the matrix, very little is
known about what makes for a good matrix. Reviewing the matrices that have been discovered,
some common qualities can be identified [73-76]. These features are:
1. solubility, this condition can be expanded to include any solvent system in which the analyte
of interest will co-dissolve with the matrix.
2. absorptivity, which allows the energy to be deposited in the matrix, not the analyte. In UV-
MALDI, the matrix is typically an organic compound that has a relatively high molar
absorptivity (ελ) at the wavelength of the laser, and whose structure is based on an aromatic
core (a chromophore) suitably functionalized to achieve the desired properties. In the case of
IR-MALDI, fewer restrictions apply because wavelengths around 3 µm are effectively
absorbed by O-H and N-H stretch vibrations, while wavelengths around 10 µm cause
excitation of C-O stretch and O-H bending vibrations. Therefore, non-aromatic compounds
can perform well as matrices in IR-MALDI.
3. reactivity, the matrix itself is chemically inert towards the analyte. Matrices that covalently
modify analytes cannot be used. A matrix can serve as protonating or deprotonating agent or
as electron-donating or –accepting agent.
4. volatility, the matrix should have a sufficiently low vapor pressure to minimize volatilization
in the ion source vacuum, yet should sublime relatively easily.
5. desorption, the matrix should facilitate co-desorption of the analyte upon laser irradiation
30
1.8.4.2 Matrix Preparations
Sample preparation/handling is often considered the most important step in MALDI-MS.
The quality of the preparation has a direct impact on the quality of the analytical results.
Different types of sample preparations are available for various types of analytes and purposes
[77, 78]. Sample preparation methods can be divided into three major categories: solid matrix,
liquid matrix, and special preparations. The solid matrix preparation techniques include dried
droplet, crushed-crystal, fast evaporation, overlayer and sandwich methods, spin-coating,
electrospray, matrix-precoated layers, etc. Chemical liquid and chemical-doped liquid are two
techniques for liquid matrices. Special preparations are also available for insoluble samples.
Solid matrices
Dried droplet: This is the oldest and original sample preparation method introduced in 1988 by
Hillenkamp and Karas, which has remained, with minor modifications, in place for nearly two decades [62]. A freshly prepared saturated solution of matrix compound is mixed with analyte solution and dried at ambient temperature. This method tolerates the presence of certain salts and buffers. However, aggregation of higher amounts of analyte/matrix crystals in a ring around
the edge of the drop yield inhomogeneous and irregularly distributed crystals on the MALDI
target; this requires the search for “hot” spots to generate good quality spectra [79-81].
Crushed-crystal: This is an extension of the dried-droplet method developed to allow for the growth of analyte-doped matrix crystals in the presence of high concentrations of non-volatile solvents – glycerol, 6M urea, DMSO, etc. without any purification steps [82]. The films produced are more uniform, with respect to ion production and spot-to-spot reproducibility, than dried-droplet deposits. The disadvantage of the crushed-crystal method is the increase in sample preparation time.
31
Fast-evaporation: Mann et al. introduced fast evaporation with the main goal to improve the
resolution and mass accuracy of MALDI measurements [83]. Matrix and sample handling are
completely decoupled in this simple procedure. The procedure is simple, allows matrix surfaces
to be prepared in advance, and, most importantly, results in a homogenous distribution of matrix
and analyte that enables easier and faster data acquisition .
Overlayer and Sandwich Methods: The overlayer (or two-layer) method was developed on the
basis of two existing methods – crushed crystals and fast evaporation [80]. This method
provides high detection sensitivity and excellent spot-to-spot reproducibility, which is mainly
due to the increase of the matrix-to-analyte ratio and improved isolation between analyte
molecules as a result of analyte/matrix deposition on top of matrix microcrystals [81, 84]. The
sandwich method was introduced as a blend of the overlayer and the fast-evaporation methods
[77, 85].
Other matrices
In chemical liquid method, samples are prepared by first dripping 0.5 µL of liquid matrix
(a molar ratio of chemical liquids) onto a 1-mm2 area of fibrous paper (Kimwipe TM) followed by 0.5 µL of the sample solution [86]. After solvent evaporation, the remaining paste on the sample holder is introduced into the ion source [65, 68, 87]. Chemical-doped liquid method is
based on the dissolution of the solid matrix in a liquid support of low volatility such as glycerol.
This technique has wider scope and can convert most of the solid matrices to the corresponding
solution forms to suit different classes of analytes [88].
Solid supports-based method includes various solid supports that function as a matrix.
Best known is the use of porous Si as a sample support, without the need for any other matrix
(desorption/ionization on silicon or DIOS) [89]. It has been found that by pressing a mixture of
32
finely ground sample and analyte, it is possible to obtain MALDI data from insoluble samples,
for example, insoluble or high molecular weight synthetic polymers [90].
1.8.5 Matrix Classes
1.8.5.1 Proteins/Peptides
MALDI-MS owes much of its popularity to its usefulness as an analytical tool for the
characterization of peptides and proteins. While an extremely large number of matrix candidates
have been investigated for the applicability in peptide and protein analysis, a relatively small
group has proven reliable over the past 15+ years. The members of this small group include 2,5-
dihydroxybenzoic acid (2,5-DHB), α-cyanohydroxycinnamic acid (CHCA or HCCA) and sinapinic acid (SA).
The performance of 2,5-DHB as a matrix for MALDI of proteins (chicken egg albumin, horse heart cytochrome c) at 337 nm wavelength laser radiation was described by Strupat et al
[91]. The detection limit was found to 1 fmol, and good shot-to-shot reproducibility was
obtained. 2,5-DHB was found to be insensitive to contaminations by inorganic salts, buffers and
detergents, even up to 10% sodium dodecylsulphate (SDS).
The most effective of cinanamic acid derivatives are 3-methoxy-4-hydroxycinnamic acid
(ferulic acid), 3,4-dihydroxycinnamic acid (caffeic acid) and 3,5-dimethoxy-4-hydroxycinnamic
acid (sinapinic acid, SA) [92]. The initial report of SA noted improved resolution, mass accuracy, and reproducibility [93]. SA can selectively ionize proteins in the presence of high concentrations of contaminating materials, such as lipids, carbohydrates, and salts
The other successful protein and peptide matrix is CHCA, which was reported by Beavis
et al. [94]. CHCA was found to be a highly effective and efficient matrix for peptides and
33
glycopeptides in the molecular mass range 500-5000. The MALDI mass spectra of proteins obtained from CHCA showed an increased tendency for multiple protonation compared with other widely-used matrices.
9-Aminoacridine (9-AA), a moderately strong base, has been introduced as a matrix for negative mode MALDI [95]. 9-AA was first examined as a matrix for low molecular weight compounds having acidic protons, such as phenols, carboxylic acids, sulfonates, amines and alcohols and has been extended to larger compounds including oligonucleotides, oligoamides and proteins.
1.8.5.2 Nucleic acids
As with other bimolecular compound classes, a large number of candidate matrices have been investigated for the MALDI-MS analysis of nucleic acids. Over the years, only a handful have become standards within the field: 2,4,6-trihydroxyacetophenone (THAP), 3- hydroxypicolinic acid (3-HPA), picolinic acid (PA), 6-aza-2-thiothymine (ATT) and 2,5-DHB.
A variety of synthetic oligodeoxyribonucleotides ranging from 6 to 30 nucleotides were analyzed in MALDI with 2,5-DHB [96]. Molecular ions were observed almost exclusively, with little or no fragmentation and generally minor contributions from multiply charged species. Mixtures of poly d(T)12-30 with low picomole amounts of each component gave well resolved peaks. It was
found that poly-G and poly-A were much more difficult to detect by MALDI. The failure to
detect larger DNA segments may be due to the weak glycosidic bond of A and G [97].
MALDI-TOF MS was used to produce quasi-molecular ion signals from underivatized
mixed-base single-stranded DNA oligomers ranging from 10 to 67 nucleotides in length [98].
These results were obtained with 3-HPA, which showed significant improvement over many
34
previously reported matrices studied in terms of mass range available, signal-to-noise ratio, and
the ability to analyze mixed-base oligomers. The desorption/ionization was studied at 266, 308,
and 355 nm. Spectra taken at 266 nm provided the smallest amounts of doubly charged and dimer ions – characteristics desirable for DNA sequencing by this technology. Negative-ion spectra were uniformly superior to positive-ion spectra.
Picolinic acid (PA) was found to be suitable for oligonucleotides and tRNA [99]. The efficiency of MALDI of oligonucleotides using PA was superior to that found using 3-HPA.
MALDI-MS of tRNAPhe, a 76-base ribonucleic acid, was detected with a signal-to-noise ratio of
>10. The more significant development was using a combination of 3-HPA and PA to analyze
DNA fragments as large as 500 nucleotides [99]. ATT, co-crystallized with ammonium citrate,
has been shown to be a suitable matrix for the analysis of oligonucleotides and short DNA
fragments [100]. The major advantages of ATT over other conventional matrices, e.g., THAP
and 3-HPA, were improved resolution and mass accuracy, easy sample preparation, and
applicability to crude or partially purified samples.
The de facto standard for small oligonucleotides is THAP together with di- and tri-
ammonium salts of organic or inorganic acids [101]. A mixture of THAP in acetonitrile and
aqueous triammonium citrate in a 1:1 molar proportion was found to be a good matrix for the
detection of synthetic oligodeoxynucleotide samples [102]. The matrix was found effective for both low mass modified single nucleotides as well as for longer oligodeoxynucleotides (up to 18- mers).
A MALDI-MS study of DNA analysis using 2,4,6-THAP and 2,3,4- trihydroxyacetophenone (2,3,4-THAP), separately and in combination was performed [103].
The results showed that a mixture of 2,3,4-THAP, 2,4,6-THAP, and ammonium citrate with
35
molar ratios of 2:1:1 serves as a good matrix for the detection of DNA, especially for samples containing a small quantity of DNA such as PCR products. The resolution and shot-to-shot reproducibility using this matrix combination were better than, and the MALDI sensitivity comparable to, that obtained when using 3-HPA, PA and ammonium citrate matrix (9:1:1).
A unique aspect of MALDI-MS analysis of nucleic acid components is the necessity of a co-matrix to minimize cation adduction and improve oligonucleotide signals. The effect of ammonium salt in the detection of oligonucleotides was systematically investigated using several matrices with ammonium salt additives [104]. The results showed that the presence of ammonium salt in the matrix had a beneficial effect on protonation and deprotonation of oligonucleotides in addition to suppressing alkali-ion adducts. Experimental results showed that ammonium citrate and ammonium tartrate were good ionization components.
1.8.5.3 Carbohydrates
MALDI-MS is a particularly valuable analysis tool for carbohydrates because it enables underivatized, as well as derivatized, compounds to be examined. MALDI has been applied to the analysis of carbohydrates since the earliest reports of this technique. Hillenkamp et al. analyzed stachyose, a 666 Da tetrasaccharide, with and without tryptophan and nicotinic acid as matrices [71]. A linear and a cyclic α-glucan, maltoheptaose and cycloheptaose were analyzed separately and as a mixture. Glucan species were generally detected as monosodium and monopotassium carbohydrate adduct ions without any noticeable fragmentation, and protonated molecules were totally absent.
2,5-DHB remains one of the most successful matrices for carbohydrate analysis.
Additives may affect crystallization, embedding the analyte more homogeneously [105]. Using
36
2-hydroxy-5-methoxybenzoic acid as a co-matrix in the 10% range with 2,5-DHB, producing a
mixture known as ‘super-DHB”, resulted in improved ion yields and a 2-3 fold increase of
signal-to-noise ratio for the analysis of a dextran standard (Dextran 1000) presumably through a
disordering in the 2,5-DHB crystal lattice allowing for ‘softer’ desorption [106]. A mixture of
2,5-DHB and 1-hydroxy isoquinoline (HIQ) in a weight ratio of 3:1 was best suited for the
analysis of β-cyclodextrin, maltoheptaose, sucrose octaacetate, chitotetraose and raffinose-5-
hydrate, providing enhanced molecular ion abundances, mass resolution and suppression of
unwanted matrix peaks [105].
6-aza-2-thiothymine (ATT) and 2,4,6-trihydroxyacetophenone (THAP) were found to be
particularly useful for acidic oligosaccharides, with THAP preferred because it gave less
fragmentation [107]. In addition, THAP offered improved sensitivity for detection of acidic
glycopeptides over CHCA. Among different substituted acetophenones, 2,5-
dihydroxyacetophenone (2,5-DHAP) produced relatively strong signals from neutral
carbohydrates in positive ion mode which was comparable to 2,5-DHB [108]. Esculetin (6,7- dihydroxycoumarin) efficiently ionized neutral glycans with better resolution than 2,5-DHB in
both MALDI and AP-MALDI [108]. 5-Chloro-2-mercaptobenzothiazole (CMBT), an analog of
MBT (2-mercapto-benzothiazole), has been found to be not only effective for the analyses of
glycolipids, but also superior to conventional matrices for the analysis of some oligosaccharides
[109].
Commercially available β-carbolines (harmane, nor-harmane, harmine, harmol,
harmaline, and harmalol) with their acidic NH-indolic group and basic N-pyridinic group have been shown to be useful matrices at 337 nm, for cyclic and acyclic oligosaccharides, in both positive and negative mode.
37
1.8.5.4 Lipids
Because lipids are low molecular weight compounds, MALDI analysis can be limited due
to matrix background products. Thus, although a significant number of studies have been
conducted, by far 2,5-DHB has been found to be the most effective matrix for various types of
lipids and phospholipids [110-119].
1.8.5.5 Synthetic Polymers
MALDI MS has been demonstrated to be a powerful technique for the analysis of
polymeric materials. It provides absolute, fast and accurate molecular masses for polymers
characterized by narrow polydispersity. It gives masses for the entire polymer distribution, hence
providing molecular mass information which can be used to obtain the mass of the end-groups,
mass of the repeat unit chemical modifications on the polymer if oligomer resolution is attained
[120]. One of the most useful studies was the division of synthetic polymers into four categories
based upon solubility – water-soluble polymers, polar organic soluble polymers, non-polar
organic soluble polymers and polymers soluble only in ‘difficult’ solvents such as
dimethylsulfoxide, hot 1,2-dichlorobenzene or sulfuric acid [121]. Solvent-free sample
preparation was later extended to PS and PMMA in a mass range from 2 to 100 kDa with similar
or better results compared to solvent-based methods, especially in terms of reproducibility and
mass accuracy. Several problems during sample preparation such as immiscibility, segregation
and suppression effects, solubility and incompatibility restrictions, etc., can also be minimized with dithranol, 7,7,8,8-tetracyanoquinodimethane (TCNQ), and CHCA as matrices [122].
38
1.8.6 Non-traditional matrices
Just as the matrix serves to trap analyte molecules and absorb UV radiation, nanoporous
materials such as porous silicon were found by Siuzdak and co-workers to be an effective
medium for desorbing compounds as well as generating intact ions in the gas phase. This
approach, desorption/ionization on porous silicon (DIOS) has demonstrated characteristics similar to MALDI in that intact molecules are observed at the femtomole to attomole levels with little or no fragmentation [89, 123].
Room-temperature ionic liquids (RTILs) are salts with melting points close to or below room temperature. It has been demonstrated that ionic liquids and solids make useful MALDI matrices [124-130]. 38 different ionic matrices having excellent solubilizing properties and vacuum stability were synthesized and tested with peptides, proteins, and poly(ethylene glycol)
(PEG-2000) analytes [124]. Out of 38 ionic matrices tested, 20 ionic matrices produced homogeneous solutions of greater vacuum stability, higher ion peak intensity, and equivalent or lower detection limits than conventional solid matrices.
Carbon nanotubes, prepared from coal by an arc discharge method, were investigated as the matrix for analyses of small molecules by MALDI-MS [131]. A functionalized carbon nanotube (CNT), CNT 2,5-dihydroxybenzyl hydrazine derivative, was synthesized and used as both a pH adjustable enriching reagent and as a matrix in MALDI-MS analysis of trace peptides
[132].
A functional cleavable detergent designed specifically for use in MALDI mass spectrometry was first reported by Norris et al. [133]. These combined detergents/MALDI matrices have two distinct functions – solubilize hydrophobic biomolecules and enhance MALDI mass analysis.
39
1.9 Research goal
RNA is more than a messenger between DNA and proteins. Ribosomal RNA has long
been recognized as fulfilling a structural role and transfer RNA as maintaining an adaptor role in
the conversion of the message to a protein. The growing interest in non-protein coding RNAs has
been fueled not only by the new discoveries of small RNAs and their enthralling functions but
also by fascinating new functions discovered recently of classic RNAs like tRNAs and rRNAs.
Even the prokaryotic cell consists of different RNAs that are not only diverse in function but also
in abundance. Global characterization of individual RNAs in a complex cellular matrix is
challenging. My overall research goal is to develop a novel but facile methodology to characterize certain ncRNAs globally in a cellular mixture by mass spectrometry, which is now an effective tool for characterizing certain nucleic acids. The overall goal may be divided into three specific aims:
i) Develop a methodology for the global detection of tRNAs of prokaryotes by mass
spectrometry.
ii) Extend the approach to the quantification of E. coli tRNA mixtures.
iii) Extend this technique from prokaryotes to eukaryotes.
40
CHAPTER 2: SIGNATURE DIGESTION PRODUCT
2.1 Introduction
Here I develop an RNA identification strategy based upon the generation of unique or
signature RNase digestion products. This approach is demonstrated on the whole tRNA pool
from Escherichia coli with ribonuclease T1 coupled with MALDI-MS. With this approach,
identification of isoaccepting tRNAs is now feasible without requiring specific affinity
purification or extensive chromatographic and/or electrophoretic purification.
2.2 Experimental
2.2.1 Materials. Escherichia coli strain MRE 600 was purchased from American Type
Culture Collection (ATCC, Manassas, VA). E. coli tRNAVal III (Cat.# R2645-10UN), tRNATyr I
(Cat.# R0258-10UN), tRNAGlu II (Cat.# R6519-10UN), tRNAPhe (Cat.# R4018-1MG), whole
tRNA mixture (E. coli, type XX, strain W, lyophilized powder, Cat.# R1753-100UN) ,
diammonium hydrogen citrate (DAHC, Cat.# 09833) and 2,4,6-trihydroxyacetophenone (THAP,
Cat.# 91928) were purchased from Sigma-Aldrich (St. Louis, MO) and used as received. RNase
T1 (Cat.# 10109193001) was obtained from Roche Molecular Biochemicals (Indianapolis, IN).
Sep-Pak C18 cartridges (Cat.# WAT051910) were obtained from Waters (Milford, MA). MOPS minimal media (Cat.# M2106) was purchased from Teknova (Half Moon Bay, CA). Synthetic oligonucleotides (dT3, dT5, dT15, and dT20) were obtained from the University of Cincinnati
DNA Core Facility. Nanopure water (18 MΩ), from a Barnstead (Dubuque, IA) nanaopure
system, was autoclaved before use.
41
2.2.2 Bacterial Cultures. E. coli strain MRE 600 was grown in MOPS minimal media (10X
MOPS mixture (10%), 0.132 M K2HPO4 (1%), sterile water (88%), 20% glucose (1%), % are by
volume), which is a modification of Neidhardt supplemented MOPS minimal media. E. coli
cells were grown aerobically at 37 °C with vigorous shaking (300 rpm) in an incubator shaker
(Innova 4000, New Brunswick Scientific, Edison, NJ). Cells were harvested at a cell density corresponding to an A540 of 0.50.
2.2.3 Isolation of small RNAs. Total tRNA from E. coli was isolated using the mirVana
miRNA isolation kit (Cat.# AM1560) from Ambion (Austin, TX). Briefly, E. coli cells with
culture media were centrifuged at 10,000 rpm for 10 min in a Sorvell RC 5C centrifuge. After
centrifugation, the media solution was discarded and pellets were collected. After washing with
phosphate-buffered saline at pH 7.2 several times, lysis/binding buffer solution was added to the
disrupted cells.
For immediate analysis, one-tenth volume of the mirVana homogenate solution was
added to the lysis/binding buffer-added disrupted microbial cells and the mixture was incubated
for 10 min on ice. A volume of acid-phenol:chloroform equal to the initial lysate volume was
added. The aqueous phase was carefully recovered and was transferred to a fresh tube. One-
third volume of 100% ethanol was added and mixed thoroughly. The lysate/ethanol mixture was
passed through a filter cartridge and the filtrate was collected. A two-thirds volume of 100%
ethanol was added to the filtrate. The filtrate/ethanol was passed through a second filter spun for
20-30 s at 10,000 rpm to recover the small RNA. The eluent, which contained the RNA, was
collected and stored at -20 ºC prior to further analysis (Figure 2.1). The purity and concentration
of the isolated RNA were determined from the A260/A280 absorbance ratio [134]. If the RNA
42
isolation process were done later, then the disrupted cells were submerged in a RNAlater solution and stored at -20 °C.
Figure 2.1 Overview of small RNA isolation procedure.
2.2.4 Enzyme purification and digestion. Ribonuclease T1 (E.C. 3.1.27.3) was precipitated from its original suspension by the use of acetone. The precipitate was re-suspended and eluted in 1 mL of 75% aqueous acetonitrile from a Sep-pak C18 cartridge. The solution was taken to dryness and resuspended in sterile water. Approximately 10 µg of RNA was added to 500 units of RNase T1 and 5 µL of 220 mM ammonium acetate buffer. The reaction mixtures were incubated for an hour at 37 ºC. The minimum enzyme-to-substrate ratio was estimated to be ~50 units per µg of RNA.
43
2.2.5 Mass spectrometry. All mass spectrometry experiments were performed on a Bruker
Reflex IV MALDI-TOF from Bruker Daltonics (Billerica, MA) having a 3-m effective flight
path, a two-stage gridless ion reflector, pulsed ion extraction, and a nitrogen laser (λ=337 nm).
All MALDI spectra were acquired in negative polarity and in reflectron mode.
A two-layer sample spotting approach was used. The matrix components were 250 mM
THAP in acetonitrile and 300 mM DAHC in water, with each being prepared fresh before use.
Approximately, 0.5 µL of the THAP matrix was first spotted onto the MALDI sample target
plate and allowed to dry. Equal volumes of THAP and DAHC were combined and then mixed
with an equal volume of the sample solution. Approximately 1 µL of this sample/matrix solution
was spotted on top of the previously dried THAP.
Flex control and X-mass software were used for data acquisition and processing,
respectively. Typically, 200 laser shots were co-added per spectrum. Each spectrum was
smoothed using a five-point Savitsky-Golay algorithm and background subtracted. The
instrument was calibrated externally with synthetic oligonucleotides that bracketed the m/z range of interest.
2.2.6 Signature Digestion Products. tRNA sequences were obtained from the tRNA sequence database [135]. The database is organized according to the kingdom and the organism of different species. Published sequences were digested in silico using the Mongo Oligo Mass
Calculator v2.06 [136]. Digestion parameters were set to monoisotopic mass, negative mode and
for RNA molecules with 5´ phosphate and 3´ hydroxyl group.
2.3 Results
44
2.3.1 Signature digestion products. The enzymatic digestion of an individual tRNA by a
ribonuclease (e.g., RNase T1) will generate a number of specific digestion products. A
comparison of an organism’s complete complement of tRNA ribonuclease digestion products
yields a set of unique or “signature” digestion product(s) that ultimately enable the detection of
individual tRNAs from a total tRNA pool [137].
For example, the ribonucleic acid sequence of E. coli tRNATrp and tRNAPhe and their
ribonuclease T1 digestion are listed in Figure 2.2. After digestion with RNase T1 followed by
Trp arranging according to relative molar mass (Mr), eight mass values of tRNA are identical or
shared by the RNase T1 digestion products of other E. coli tRNAs, whereas five mass values are
unique to E. coli tRNATrp. Similarly, thirteen mass values of tRNAPhe digestion are common to
other tRNA digestion products; whereas three mass values are unique to tRNAPhe. These unique
mass values are the ribonuclease signature digestion products of tRNATrp and tRNAPhe, respectively. The mass spectrometric detection of any one or more of these signature products from a complex mixture will then confirm the presence of the corresponding tRNA.
2.3.2 Optimization of digestion conditions. Commercially available individual tRNA and total tRNA mixtures were used to optimize the RNase T1 digestion condition to ensure that it was fully compatible with MALDI-MS analysis. Complete digestion of tRNAs is obligatory in determining the specific digestion product from their cognate m/z values.
45
______
Sequence of tRNAs:
tRNATrp:AGGGGCGs4UAGUUCAADDGGDAGAGCACCGGUCmUCCAms2i6AAACCGGG UGm7GUUGGGAGTΨCGAGUCUCUCCGCCCCUGCCA
tRNAPhe:GCCCGGAs4UAGCUCAGDCGGDAGAGCAGGGGAΨUGAAms2i6AAΨCCCCGU m7Gacp3UCCUUGGTΨCGAUUCCGAGUCCGGGCACCA
After RNase T1 digestion: tRNATrp: AG G G G CG s4UAG UUCAADDG G DAG AG CACCG G UCmUCCAms2i6AAACCG G G Um7GUUG G G AG TPCG AG UCUCUCCG CCCCUG CCA
Gp(363.1), CGp(668.1), AGp(692.1), pAGp(772.1), CCA(877.2), DAGp(1000.2), m4GAGp(1014.1), TΨCGp(1294.2), Um7GUUGp(1640.2), CCCCUGp(1889.2), UCUCUCCGp(2501.3), UUCAADDGp(2554.3), UCmUCCAms2i6AAACCGp(3944.6) tRNAPhe: G CCCG G As4UAG CUCAG DCG G DAG AG CAG G G G AΨUG AAms2i6AAΨCCCCG Um7Gacp3UCCUUG G TΨCG AUUCCG AG UCCG G G CACCA
Gp(363.1), pGp(443.0), AGp(692.1), DCGp(976.1), CAGp(997.2), DAGp(1000.2), CCCGp (1278.2), UCCGp(1279.2), TΨCGp(1294.2), AΨUGp(1304.2), Am4GAGp(1343.2), CACCA(1511.3), CUCAGp(1608.2), AUUCCGp(1914.2), Um7Gacp3UCCUUGp(2657.3), AAms2i6AAΨCCCCGp(3319.5)
______
Figure 2.2 Determination of signature digestion products. Digestion products in bold are unique or signature digestion products, the rest are common.
46
7000 1021.3 * 1021.3
6000
5000
4000 1960.4 # 1960.4 a.i.
3000 * 1027.3 1294.3 * 1294.3 1914.3 *
2000
1000 1906.4 #
0 1000 1200 1400 1600 1800 2000 m/z
Figure 2.3 Some selected common and signature digestion products of tRNATyr I found experimentally when digested with ribonuclease T1. (peaks marked with * are common peaks, whereas marked with # are signature peaks)
The digestion mechanism of RNase T1 is shown in Figure 2.4. The enzyme cleaves ribonucleic acids between 3´-guanylic residues and the 5´-hydroxy residues of adjacent nucleotides with the
formation of the corresponding intermediate 2´,3´-cyclic phosphates. The RNase A and RNase
TA digestion mechanisms are similar.
RNase digestion occurs via a 2´,3´-cyclic phosphate intermediate, and the presence of this
intermediate can be avoided by using an increased enzyme/substrate ratio or by lengthening the
digestion time [138]. The cyclic intermediates are readily noted by the appearance of ions at m/z
values 18 Da lower than expected 3´-phosphate digestion products.
47
HO O B
OH OH O OH H O* H O B 2 O B O POH RNase O O O O OH P O B - - O PO* O O - Cyclic intermediate O OH OH
Figure 2.4 Ribonuclease T1 cleavage mechanism.
Although formation of alkali salts can be a concern in MALDI-MS of nucleic acids
[139], the presence of ammonium acetate in the RNase digestion solution reduced the formation of alkali-adduct digestion products and no further purification prior to MS analysis was required after digestion. The absence of cyclic phosphate intermediates and alkali-adducts simplifies spectral interpretation and digestion product identification.
2.3.4 Analysis of Simple Mixtures. To initially confirm that MALDI-MS analysis of RNase digests of tRNAs will yield sufficient data for the identification of tRNAs through their signature digestion products, four samples, each containing three isoaccepting E. coli tRNAs, were generated. Mixture A1 contained tRNATyr I, tRNAVal III and tRNAGlu II. Mixture A2 contained
tRNAPhe, tRNAVal III and tRNAGlu II. Mixture A3 contained tRNATyr I, tRNAPhe and tRNAGlu II ,
and mixture A4 contained tRNATyr I, tRNAVal III and tRNAPhe. Each solution was digested with
RNase T1 and analyzed by MALDI-MS (Figure 2.5). For this endonuclease, the presence of specific signature digestion products peak(s) in the MALDI spectrum confirmed the presence of the constituent tRNAs in each mixture.
48
(a) 1021.3
6000 1936.3 1961.3 a.i. 1960.3
3000 1649.2 1333.3 2806.3 3182.4 4098.6 3208.4 4001.6 0 1000 2000 3000 4000 m/z
(b) 1021.3
1000 1961.3 1936.3 a.i.
500 2806.3 3182.4 3208.4 4101.6
0 1000 2000 3000 4000 m/z
49
(c)
4000 1960.3, 1961.3 a.i.
2000 1936.3 3182.4 3208.4 4098.6 0 1000 2000 3000 4000 m/z (d)
6000
4000 1343.2 1649.2 a.i. 1960.3
2000 4001.6 4098.6 0 1000 2000 3000 4000 m/z Figure 2.5 MALDI mass spectra obtained from the RNase T1 digestion of mixtures of E. coli tRNAs. (a) tRNAs of Tyr I, Val III, and Glu II. (b) tRNAs of Phe, Val III, and Glu II. (c) tRNAs of Tyr I, Phe, and Glu II. (d) tRNAs of Tyr I, Phe, and Val III.
As seen in Figure 2.6, for these smaller mixtures nearly all of the theoretical signature products were detected reproducibly. Further examination of the data did not reveal any m/z
50
values indicative of signature products from other (absent) tRNA isoacceptors; thus, no false
positives were noted in these analyses.
Figure 2.6 Heat map representation of the results from Figure 2.5, along with m/z and sequences of signature digestion products. In all analysis, reproducible detection of the signature digestion products of the expected tRNAs is demonstrated.
2.3.5 Analysis of total tRNA mixtures from Sigma. After verifying the applicability of this
method for simple mixtures of tRNAs, we next expanded into the analysis of commercially available whole tRNA mixtures from Sigma. There are signature products with RNase T1 digestion for the detection of tRNAs for 16 tRNA families (Figure 2.7). Specific isoaccepting tRNAs include Arg III, Arg V, Gln I, Gln II, Gly II, Leu I, Pro II, Pro III, Ser II, Thr II, Tyr II, and Val III. tRNA families detected by RNase T1 comprise Met, Cys, Glu I/II/III, His, and Pro.
51
(a)
2000
Met
1500
Pro
a.i. 1000 Ala
Arg Cys 5S RNA, 500 G ly Pro Thr
Leu
0 1000120014001600 m/z
(b)
300
250 Leu
200
Gln Tyr His
a.i. Glu 150 Leu, Ser
Gly Gln Met Arg 100 Ile Arg His
50
0 2000 2200 2400 2600 m/z
Figure 2.7 MALDI mass spectra obtained from the RNase T1 digestion of total tRNA mixtures of E. coli from Sigma. (a) m/z 850-1750; (b) m/z 1850-2600.
52
More than one tRNA isoacceptor with one common mass value detected by RNase T1 included
Ala II/III, Arg I/II, Ile I/II, Leu I/III, Leu II/III, Pro II/III. A signature digestion peak of E. coli 5S
RNA (m/z 1655.3) was also detected.
2.3.6 Analysis of whole tRNA mixtures from E. coli . Transfer RNAs were purified from E. coli cell lysates. After purification and digestion as described in the Materials and Methods section, the mixture was analyzed by MALDI-MS. There are tRNAs from 19 tRNA families that are unambiguously identified from E. coli by RNase T1 (Figure 2.8). Individual tRNAs isoacceptors identified by RNase T1 include Arg III, Gln I, Gln II, Gly III, Leu I, Leu II, Leu III,
Tyr II, and Val III. tRNA families detectable by RNase T1 include Asp, Cys, Glu I/II/III, Gly
I/II/III, Ini I/II, His, Lys, Met, Phe, Trp, and Tyr I/II. Two or more isoaccepting tRNAs with a common mass value can also be identified by RNase T1 digestion. Those are Ala I/III, Glu II/III,
Ile I/II, Leu II/III, Ser I/IV, Ser III/IV/V, and Val II/III.
A number of 5S RNA signature digestion peaks (m/z 3135.4, 2829.4, 1655.3 for RNase
T1) were also detected (Table 2.1), which is to be expected given the small RNA isolation protocol used in this work. Importantly, the presence of this 5S RNA does not complicate or interfere with the detection of tRNA signature digestion products, and a single MALDI analysis is sufficient to identify these tRNAs. The ribonuclease-digested transfer RNAs were also labeled with 18O and analyzed separately by MALDI-MS to confirm the expected peaks. All of the major peaks in the mass spectra are easily assignable to expected digestion products, and all expected products generate distinct signals. No prior fractionation is needed for this analysis.
53
(a)
1000
5S R N A
800
Glu
600 Gln Gln Arg Tyr, Glu a.i.
400 Pro Leu Met His, Ala Leu Lys Leu Ser Ser 200 Gly Asp Ile Cys
0 1000 1500 2000 2500 m/z
(b)
Glu
160 a.i. Phe ValTyr In i His Val 80 Asn Leu
GlyTrp
Tyr
0 3600 4500 5400 m/z
Figure 2.8 MALDI mass spectra obtained from the RNase T1 digestion of E. coli tRNAs. (a) m/z 900-2700; (b) 2700-6000.
54
Table 2.1 Experimentally detected individual tRNA through signature peaks from E. coli tRNA pool by RNase T1-mediated cleavage and MALDI-MS.
(isoaccepting) tRNAs Signature peaks Sequence of the digestion product m/z Type tRNAAla I & III 2427.4 III CUC CAC CA tRNAArg III 1327.2 I AUA Gp tRNAAsp 2572.4 II AAU ACC UGp tRNAAsn 3214.4 II UAU m7GUC ACU Gp tRNACys 2941.4 II Us4UA ACA AAGp tRNAGln II 1951.3 I m2AΨA CCGp tRNAGlu II & III 3182.5 III AAU CCC CUA Gp tRNAGlu I, II, & III 1936.3 II ACA CCGp tRNAGly I, II, & III 1487.2 II CUC CA tRNAHis 3512.5 II AAU CCC AUU AGp tRNAIle I & II 2121.4 III CCU ACC A tRNAIni I & II 3197.4 II TΨC AAA UCC Gp tRNALeu I 2289.4 I ACA CAA Gp tRNALeu II 3721.6 I UCC CCC CCC UCGp tRNALeu III 2571.4 I CCC AAU AGp tRNALeu II & III 1996.3 III AAD DGmGp tRNALys 2450.5 II ACC CAC CA tRNAMet 2242.4 II AAU CCC Gp tRNAPhe 3319.6 II AAms2i6A AΨC CCC Gp tRNASer I & IV 2403.5 III Ams2i6AA ACC Gp tRNASer III, IV, &V 1350.1 III AAA Gp tRNATrp 3944.0 II UCmU CCA ms2i6AAA CCGp tRNATyr I & II 1960.3 II CCA AAGp tRNATyr II 1937.3 I UCA CAGp tRNAVal III 4821.4 I CAC CUC CCU cmo5UACm6AAGp tRNAVal II & III 4002.6 III UCA UCA CCC ACC A 5S RNA 1655.2 ~ AAA CGp 5S RNA 2829.4 ~ UCC CAC CUGp 5S RNA 3135.4 ~ UCU CCC CAU Gp
2.3.7 Limit of detection and reproducibility study. The amount of sample required for this approach was also determined. At the lower end, ~50 ng of RNA sample on the MALDI target plate is sufficient to detect tRNA signature digestion products of RNase T1. At the higher end,
~5-10 µg of sample can be spotted on the MALDI target with no evidence of detector saturation.
55
Of course, concentrated samples can always be diluted to the suitable range as required prior to
MALDI analysis in this process as the endonuclease digestion reaction is almost irreversible.
To determine the reproducibility of the method, three separate RNase T1 digestions of an
E. coli cell lysate were analyzed by MALDI-MS three times each. As noted in Figure 2.9,
reproducible information and identifications can be obtained from RNase signature digestion
products. Although most of the tRNAs have multiple signature digestion products, all are not
typically detected in the MALDI mass spectra. The most likely reason is the peak suppression effect, which is common in MALDI-MS [140].
Figure 2.9 Reproducibility study of RNase T1 digest of E. coli total tRNA mixture.
56
2.4 Discussion
2.4.1 Signature digestion products. A list of all the theoretical signature digestion products
of E. coli tRNAs with RNase T1 are presented in Table 2.2. Reviewing these data, out of 48
tRNA possible isoacceptors, 34 E. coli isoaccepting tRNAs yield RNase T1 signature digestion
products. Those isoaccepting tRNAs that do not have any specific signature products are Ala III,
Arg I, Arg II, Glu I, Glu II, Glu III, Ile I, Ile II, Ini I, Ini II, Ser III, Ser IV, Tyr I, and Val I.
Individually 71% of the isoaccepting tRNAs can be identified solely by using RNase T1.
However, RNase T1 digestion generates signature products representing two or more tRNA
isoacceptors having identical mass values, e.g., Ala I/II, Ala II/III, Arg I/II, Gln I/II, Glu I/II/III,
Glu II/III, Gly I/II/III, Ile I/II, Ini I/II, Leu II/III, Leu I/III, Pro I/II, Pro I/III, Pro I/II/III, Ser I/IV,
Ser III/V, Ser III/IV/V, Thr I/II, Tyr I/II, and Val II/III. With RNase T1, there is at least one
possible signature digestion product for a isoaccepting tRNA, representing each of the 22 tRNA
families of E. coli.
The analysis from Table 2.2 reveals the presence of three different types of signature
digestion products: Type I – a signature product unique to one tRNA isoacceptor; Type II – a
signature product specific to one tRNA family (consist of one tRNA or of more than one tRNA isoacceptors) ; Type III – a signature product selective for two or more isoaccepting tRNA, but not all, of the member isoacceptors of one tRNA family. For example, E. coli tRNAs Ini I and II yield no Type I RNase T1 signature digestion products and four Type II RNase T1 signature digestion products (m/z 748, 1888, 3501, and 3197) that identify the presence of an initiator tRNA within a mixture but cannot differentiate between the two isoacceptors. Ala I and Ala II both have two Type II signature products. In E. coli, the only tRNAs that can have Type III
57
Table 2.2 List of all theoretical signature digestion products peaks of E. coli tRNAs. tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala I 1827.233, 1662.238 Leu I 4566.633, 2289.348, 1993.306 Ala II 2732.419, 1648.205 Leu II 3720.476 Ala Ala III none Leu Leu III 2571.362 Ala I/III 2427.378 Leu II/III 1996.305 Ala II/III 1660.173, 1639.211 Leu I/III 1512.255 Arg I none Arg II none 3668.498, 2831.332, 2598.373, Arg III 4964.632, 2450.405 2220.266, 1327.186 Arg Lys Lys Arg IV 3387.469 Arg V 2273.304, 2210.264, 1051.172 Arg I/II 1645.259 5273.724, 2397.379, 2242.309, Asn 4105.589, 3214.406, 2276.221 Met Asn Met 1338.201 Asp Asp 3009.454, 2572.346 Phe Phe 3319.505, 2657.349, 1343.164 Pro I 3826.529, 1323.179 Pro II 4789.675, 2247.313, 1332.19 4475.622, 1637.231 2941.386, 2685.412, 1793.285, Pro III Cys Cys 1614.215 Pro Pro I/II 1308.179 Pro I/III 1293.179 Pro I/II/III 1206.23, 1012.15, 988.138, 683.097 Gln I 1929.241, 1928.257 4214.62 Gln Gln II 2830.348, 2266.321, 1951.284, Sec6 Sec6 1796.178 Gln I/II 749.048 Glu I none Ser I 6250.789, 3487.469 Glu II none Ser II 2290.332, 1777.265 Glu III none Ser III none Glu I/II/III 3208.424, 2806.337, 1961.28, Ser IV none Glu Ser 1936.284 Ser V 2549.318, 1674.189 Ser I/IV 2403.398 Glu II/III 3182.428 Ser III/V 5012.674 Ser III/IV/V 1350.214 Gly I 3136.373, 2854.359 Thr I 1962.264 Gly II 2196.255, 1656.239 Thr II 2272.32, 1633.211 Gly Thr Gly III 3794.478, 2742.356 Thr I/II 1586.239 Gly I/II/III 1488.244 Trp 3944.587, 2554.334, 2501.296, His His 3512.464, 2426.394, 2257.309, Trp 1889.246, 1640.195 2081.299, 1954.23, 1945.236 Ile I none Tyr I none Ile II none Tyr II 1937.268 Ile Tyr Ile III 3352.46, 2540.3 Tyr I/II 5856.831, 4098.614, 1960.296, Ile I/II 2122.337, 1801.276 1906.207 Ini I none Val I none Ini II none Val II 2260.255 Ini Val Val III 4820.644, 3501.484, 3197.427, 1888.262, 1649.189 Ini I/II 748.064 Val II/III 4001.59
58
signature products are Ala, Arg, Glu, Ile, Leu, Ser, and Val, with all but Gly having a Type II
RNase T1 signature product (m/z 1488)
2.4.2 E. coli cell lysate. Applying this approach for tRNA identification to a complex mixture of tRNAs, such as those obtained from an E. coli cell lysate, reveals the potential of this method.
While there are 48 possible E. coli tRNAs that could be present in this mixture, the codon bias of
E. coli leads to the possibility of widely varying tRNA abundances within the sample. Table 2.3 lists the frequency of each possible isoaccepting tRNA in a typical E. coli cell and the results found in the MALDI-MS approach with ribonuclease T1 developed here. The abundance of tRNA isoacceptors listed are from E. coli strain W1485, a derivative of E. coli K12 [141], and is an appropriate representation of the MRE 600 strain used here as it has been previously reported that the tRNA contents of the two enterobacteriaceae (E. coli and S. typhimurium) are quite similar, indicating that the populations of tRNA molecules have been conserved during evolution
[142-144]. It should be pointed out that bacterial tRNA populations differ greatly from that of yeast, for instance, Saccharomyces cerevisiae [143].
The isoaccepting tRNAs present in a typical E. coli cell can be grouped into two main categories: major (those present in >2% of total tRNAs) and minor (<2% of total tRNAs) [137].
With the exception of Arg I and II, all major tRNAs were detected by the signature digestion peak approach. Arg I and II share a common RNase T1 signature peak.
59
Table 2.3 E. coli tRNA abundances and detection by MALDI-MS using signature digestion peaks.
tRNA % out Detected by RNase tRNA % out of Detected by isoacceptors of total T1 isoacceptors total RNase T1 tRNA# tRNA# tRNAAla I 0.95 tRNAAla I/III tRNAleu III 2.49 yes tRNAAla II/III 5.04 tRNAAla I/III tRNALys 2.97 yes tRNAArg I/II 7.37 no signature peak tRNAMet 1.09 yes tRNAArg III 1.34 yes tRNAPhe 1.60 yes tRNAArg IV 0.65 no tRNAPro I 0.90 tRNAPro I/II/III tRNAArg V 0.99 no tRNAPro II 1.38 tRNAPro I/II/III tRNAAsn 1.85 yes tRNAPro III 1.11 tRNAPro I/II/III tRNAAsp 3.72 yes tRNASec6 0.34 no tRNACys 2.46 yes tRNASer I 0.53 tRNASer I/IV tRNAGln I 1.36 no tRNASer II 2.18 no tRNAGln II 1.18 yes tRNASer III/IV 1.18 tRNASer III/IV/V tRNAGlu I/II/III 7.32 tRNAGlu II/III tRNASer V 2.01 tRNASer III/IV/V tRNAGly I & III 3.31 tRNAGly I/II/III tRNAThr I 1.70 no tRNAGly II 6.76 tRNAGly I/II/III tRNAThr II 0.16 no tRNAHis 0.99 yes tRNATrp 1.46 yes tRNAIle I/II/III 5.39 tRNAIle I/II tRNATyr I 1.19 tRNATyr I/II tRNAIni I 1.88 tRNAIni I/II tRNATyr II 1.95 yes tRNAIni II 1.11 tRNAIni I/II tRNAVal I 0.98 no signature peak tRNALeu I 4.57 yes tRNAVal II 0.97 tRNAVal II/III tRNALeu II 6.94 yes tRNAVal III 5.96 yes
# Table 2 of Ref. 141 and other references therein.
2.5 Conclusions
The present approach has several similarities to the peptide mass fingerprinting approach popular in proteomics. A unique difference, however, is that here positive identification of a tRNA isoacceptor is made on the basis of detection of any one of its signature products as opposed to a comparison of all RNase fragment ions with database predictions. In this way, this approach is most analogous to the accurate mass tag method described for protein identification
60
[145], although those stringent levels of mass accuracy are not necessary for the success of the
present approach.
Not all tRNAs will theoretically yield a signature digestion product. For E. coli, tRNAVal I does not have any signature products using RNase T1. Some isoacceptors cannot be differentiated by this approach. For example, E. coli Ini I and II yield signature digestion products (m/z 748, 1888, 3501, 3197) that identify the presence of an initiator tRNA within a mixture but cannot differentiate between the two isoacceptors. Such limitations can usually be overcome by the selection of a different endonuclease that is discussed in the next chapter. In this case, RNase TA (or U2) yields a set of signature digestion products common to both Ini I and II (i.e., m/z 4529, 4128, 3774, 2606) as well as signature digestion products that distinguish between the two isoacceptors (Ini I, m/z 3535; Ini II, m/z 4239).
This approach can be extended to other organisms as well. It has also a possible application to the quantification of ribonucleic acids with stable 16O/18O-isotope labeling. The
approach as developed can not be used for the de novo identification of RNAs. Moreover, some
signature digestion products arise from the presence of posttranscriptional modifications. For
example, among the detected E. coli RNase T1 signature digestion products (Table 2.1), the
tRNAs for Asn, Cys, Gln II, Leu II/III, Phe, Ser I/IV, and Val III contain posttranscriptionally
modified nucleosides. Further application of this approach will be enabled by more
comprehensive RNA sequence databases, which incorporate the modification status of the
RNAs.
61
CHAPTER 3: MULTIPLE RIBONUCLEASES
3.1 Introduction
With the signature digestion product approach, introduced in Chapter 2, it is possible to detect a maximum of about 71% of all the tRNA isoacceptors present in E. coli, but experimentally I can detect at best ~56% of all the tRNAs by using MALDI mass spectrometry with ribonuclease T1 alone. To overcome this limitation as well as to maximize the detection of tRNAs, both theoretically and experimentally, I describe a multiple ribonuclease approach which enables us to obtain the optimum coverage of tRNA signature digestion products from two eubacteria – Escherichia coli and Bacillus subtilis.
3.2 Experimental
3.2.1 Materials
Whole tRNA was isolated from Escherichia coli MRE 600 grown in MOPS minimal media. Purified whole tRNAs from Bacillus subtilis strain 168 was collected from Brown
University (a gift from Prof Steven T. Gregory of Molecular Biology, Cell Biology &
Biochemistry department). E. coli tRNAVal III (Cat.# R2645-10UN), tRNATyr I (Cat.# R0258-
10UN), tRNATyr II, tRNAGlu II (Cat.# R6519-10UN), tRNAPhe(Cat.# R4018-1MG), diammonium hydrogen citrate (DAHC, Cat.# 09833), and 2,4,6-trihydroxyacetophenone (THAP, Cat.# 91928) were purchased from Sigma-Aldrich Inc. and were used as received. RNase T1 (Cat.#
10109193001) and RNase A (Cat.# 10109142001) were obtained from Roche Molecular
Biochemicals. RNase T1 was used after purification. RNase TA (Cat.# A6608) was acquired from AppliChem GmbH, Germany and was used without purification. Sep-Pak C18 (Cat.#
62
WAT051910) cartridges were obtained from Waters. HPLC-purified synthetic oligonucleotides
dT3, dT5, dT15 and dT20 were obtained from the University of Cincinnati DNA core facility.
Nanopure water (18 MΩ) from a Barnstead (Dubuque, IA) nanopure system, was autoclaved
before use.
3.2.2 Small RNA isolation
Total tRNA from E. coli was isolated using the mirVana miRNA isolation kit from
Ambion (Austin, TX). The culture of E. coli in MOPS minimal media and the isolation of total tRNA mixtures from cell lysate have already been described in Chapter 2.
3.2.3 Enzyme purification
Ribonuclease T1 was precipitated from its original suspension by the use of cold acetone.
The precipitate was re-suspended and eluted in 1 mL of 75% aqueous acetonitrile from a Sep-
Pak C18 Cartridge. The cartridge was initially equilibrated and washed with acetonitrile and
water, respectively, before being used.
3.2.4 Digestion
Ribonuclease T1: Approximately 10 µg of RNA was added to 500 units of RNase T1 and
5 µL of 220 mM ammonium acetate buffer. The reaction mixture was incubated for an hour at 37
°C. The minimum enzyme-to-substrate ratio was estimated to be ~50 units per µg of RNA.
Ribonuclease A: Powdered RNase A (E.C. 3.1.27.5) was re-suspended in sterile water
before use. One unit of RNase A was added to ~10 µg of RNA and 5 µL of 220 mM ammonium
acetate buffer and was incubated for 2 h at 37 °C.
63
Ribonuclease TA: About 2 to 5 units of RNase TA (E.C. 3.1.27.4) were used with 10 µg
of RNA and 5 µL of ammonium acetate buffer. The digestion was done at 37 °C for 15-30 min.
Ribonucleic acids from B. subtilis were heated for 15-30 min at 90 °C before being digested.
3.2.5 Mass spectrometry
All mass spectrometry experiments were performed on a Bruker Reflex IV MALDI-TOF
from Bruker Daltonics having a 3-m effective flight path, a two-stage gridless ion reflector,
pulsed ion extraction, and a nitrogen laser (λ =337 nm). All MALDI spectra were acquired in negative polarity and in reflectron mode. The sample and matrix preparation as well as data analysis are described in Chapter 2.
3.3 Results
3.3.1 Signature digestion products.
The basic methodology for identifying signature digestion products of E. coli
isoaccepting tRNAs with RNase T1 has already been described in Chapter 2. We classified the
signature digestion products into three different types: Type I (a signature product unique to one tRNA isoacceptor), Type II (a signature product specific to one tRNA family) and Type III (a signature product selective for two or more, but not all, of the members of one tRNA family).
Escherichia coli. All of the possible theoretical signature digestion products (with their m/z values) of E. coli with ribonuclease T1 (Table 2.2 in Chapter 2), ribonuclease A (Table 3.1) and ribonuclease TA (Table 3.2) are listed.
64
Table 3.1 RNase A digestion of total tRNA of E. coli. tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala I 2360.349, 1521.208 Leu Leu I 2652.358, 2059.335, 1979.29 Ala II 2128.253 Leu II none Ala III none Leu III 2339.301 Ala II/III 2376.344, 1048.123 Leu II/III 4302.633 Arg Arg I 2978.409, 1335.147 Arg II 3307.462 Arg III 2161.334, 1980.274 Lys Lys none Arg IV 1777.265 Arg V 3306.478, 2046.307 Arg III/IV 672.118 4281.622, 2124.328, 2107.301, 2690.396 Met Met Asn Asn 1000.138 Asp Asp 2962.414, 2392.338, 2010.231 Phe Phe 2669.385, 2668.353, 2404.382 1767.21 Pro Pro I none Pro II none 1959.263, 1649.206, 1303.157 1325.207 Cys Cys Pro III Pro I/II 1341.202, 1012.15 Pro II/III 667.103 Gln Gln I 1663.222 2685.38, 2426.299, 1703.239, Gln II 1646.243, 644.075, 519.04 Sec6 Sec6 1379.254, 1089.186 Gln I/II 2683.4 Glu Glu I 2377.339 Ser Ser I 2771.346, 2098.357, 1634.243 Glu II none Ser II 2836.418, 2699.341, 2324.337, 1984.307 Glu III none Ser III 2998.437 Ser IV 4010.588 Ser V 3336.488, 2691.38, 2478.383, Glu I/II/III 2322.322 2097.247, 1686.249, 680.194 Ser III/IV 2997.405 Gly Gly I 2016.297 Thr Thr I none Gly II 1672.234 Thr II none Gly III 518.056 Thr I/II 2276.334 His His none Trp Trp 3943.571, 2112.258, 1753.31 Ile Ile I 4304.613 Tyr Tyr I none Ile II 2977.425 Tyr II none Ile III 2991.441 Tyr I/II 3019.449, 2026.226 Ile I/II 2162.318, 2108.333 Ini Ini I none Val Val I 2469.375 Ini II none Val II none 3389.435, 1678.233, 403.017 Val III 3754.553, 1032.128 Ini I/II Val II/III 4267.606
65
Table 3.2 RNase TA digestion of E. coli whole tRNA. tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala I 2945.388, 2891.366, 2812.338, Leu I 9292.149, 4802.609, 2337.268, 1644.228, 524.057 1954.284 Ala II Leu II 3010.401, 2853.328, 1937.221 4721.612, 2439.295 1404.153 Ala Leu Ala III Leu III 4763.587, 3011.385, 2600.341, none 2281.284 Ala I/III 2400.273 Leu II/III 1957.284 Ala II/III 4566.589, 4532.556 Arg I 3885.489 Arg II 3869.512 Arg III 3650.488, 2893.288, 1975.259 3012.323, 3007.414, 2391.302, Arg IV 2695.359 Arg Lys Lys 2201.272 Arg V 5390.741, 4831.618, 2970.348, 2255.294 Arg I/II 3156.401, 3085.458, 1912.208, 1059.156 Asn Asn 2909.265, 2906.366, 2497.373, Met Met 2741.395, 2610.372, 1301.142, 1605.206 1287.169 Asp Asp 5616.754, 4886.691, 2593.356 Phe Phe 6460.829, 2930.389 Pro Pro I 4434.596, 3344.457, 2629.356, 2054.241, 994.14 Pro II 3904.526, 3024.417, 2204.297, 3556.454, 3093.461, 3027.316 2069.241, 954.134 Cys Cys Pro III 6359.863, 4474.602, 1964.269, 1909.263, 1299.181 Pro I/II 2309.316 Pro II/III 2614.357 Gln Gln I 4471.566 4230.565, 3055.423, 2852.344, Gln II 4128.498, 4056.49 Sec6 Sec6 674.099 Gln I/II 1911.224 Glu I Ser I 5191.694, 3595.477, 3196.407, 3886.502 2641.379, 2280.3, 2014.282 Glu II Ser II 5252.67, 3901.502, 3421.436, none 2986.372 Glu III none Ser III 2642.363 Glu Glu I/II/III Ser Ser IV 2947.303, 2645.363 6120.803, 4459.483, 1527.266 Ser V 5272.69, 3292.397, 3285.407, 2644.379, 1589.222 Glu I/II 2985.394, 2401.257 Ser II/IV 2586.325 Glu II/III Ser III/IV 3381.43, 2282.268 2161.266 Ser II/III/IV 1832.307, 1750.184 Gly I 5537.725, 3066.348, 2640.347, Thr I 2639.363 1633.212 Gly II 5578.715, 4630.618, 2399.289, Thr II 2892.35, 2254.31, 2241.278 Gly Thr 2094.248 Gly III 3596.461, 2395.294, 1936.237 Thr I/II 3440.45 Gly I/II 2506.313 His His 5218.646, 3628.489, 2706.298, Trp Trp 4286.555, 3170.417, 2681.331, 1487.26 1943.268 Ile I 2633.363 Tyr I none Ile II Tyr II Ile 2631.347 Tyr none Ile III 6195.794, 2947.35, 2300.315 Tyr I/II 4673.523, 3382.414, 2293.332, Ile I/II 4362.596, 2587.309 1717.258 Ini I 3517.432 Val I 7044.929 Ini II Val II 6942.898 4221.542 Ini Val 2321.244 Ini I/II 4511.583, 4110.546, 3756.432, Val III 2095.232, 977.161, 957.079 2588.341 Val I/II 2596.356
66
There are about 22 tRNAs families in E. coli, each of which are specific for a particular
amino acid in protein synthesis. These 22 families contain 48 isoaccepting tRNAs. Isoaccepting tRNAs or tRNA isoacceptors are different tRNA species, within a tRNA family, that bind to alternate codons for the same amino acid residues (Figure 3.1). They differ by a few nucleotides only.
______
Isoaccepting tRNAs or tRNA isoacceptors: All members of the set of tRNAs specific for a particular amino acid; e.g., E. coli tRNATyr has two isoacceptors differ by only two nucleotides.
tRNATyr I : GGU GGG Gs4UU CCC GAG CGmG CCA AAG GGA GCA GAC UQU Ams2i6AA ΨCU GCC GUC AUC GAC UUC GAA GGT ΨCG AAU CCU UCC CCC ACC ACC A
tRNATyr II : GGU GGG Gs4UU CCC GAG CGmG CCA AAG GGA GCA GAC UQU Ams2i6AA ΨCU GCC GUC ACA GAC UUC GAA GGT ΨCG AAU CCU UCC CCC ACC ACC A ______
Figure 3.1 tRNA isoacceptors.
By reviewing Table 3.1, 3.2, and 3.3, it is found that, about 71% of individual
isoaccepting tRNAs of E. coli can be identified unambiguously with RNase T1 digestion alone.
Considering Type II and Type III signature products, this increases to 98%. There are no
individual signature products for isoaccepting tRNAs of Ala III, Arg I, Arg II, Glu I, Glu II, Glu
III, Ile I, Ile II, Ini I, Ini II, Ser III, Ser IV, and Tyr I; however, there are signature products for
Ala I/III, Arg I/II, Glu, Ile I/II, Ini, Ser III/IV/V, and Tyr. Although there are no signature
products for the above individual tRNA isoacceptors, there are signature products common to
two or more isoacceptors or all the isoacceptors of a tRNA family. There are no Type II or Type
III signature products identified for Val I with RNase T1 digestion. About 69% of the
isoaccepting tRNAs can be identified with RNase A. Considering Type II and Type III signature
67
products, the detection is 96%. Although there are no separate signature products for isoaccepting tRNAs of Ala III, Glu II, Glu III, Ini I, Ini II, Leu II, Thr I, Thr II, Tyr I, Tyr II, Val
II, Pro I, and Pro II, signature products are available for Ala I/II, Glu, Ini, Leu I/II, Thr, Tyr, Val
I/II, and Pro I/II. About 90% of the isoaccepting tRNAs generate Type I signature digestion products with RNase TA. Including Type II and Type III signature products, all tRNAs yield signature digestion products. In spite of not having a signature product of individual tRNA isoacceptors of Ala III, Glu II, Glu III, Tyr I, and Tyr II; signature products of Ala I/III, Glu
II/III, and Tyr are available.
Table 3.3 List of theoretical signature digestion products of E. coli with RNase T1, RNase A, and RNase TA. Bold ones are experimentally detected by MALDI-MS.
Type of Ribonuclease List of tRNA isoacceptors detected by signature digestion products signature products Type I RNase T1 Ala I, Ala II, Arg III, Arg IV, Arg V, Asn, Asp, Cys, Gln I, Gln II, Gly I, Gly II, Gly III, His, Ile III, Leu I, Leu II, Leu III, Lys, Met, Phe, Pro I, Pro II, Pro III, Sec6, Ser I, Ser II, Ser V, Thr I, Thr II, Trp, Tyr II, Val II, Val III, RNase A Ala I, Ala II, Arg I, Arg II, Arg III, Arg IV, Arg V, Asn, Asp, Cys, Gln I, Gln II, Glu I, Gly I, Gly II, Gly III, Ile I, Ile II, Ile III, Leu I, Leu III, Met, Phe, Pro III, Sec6, Ser I, Ser II, Ser III, Ser IV, Ser V, Trp, Val I, Val III, RNase TA Ala I, Ala II, Arg I, Arg II, Arg III, Arg IV, Arg V, Asn, Asp, Cys, Gln I, Gln II, Glu I, Gly I, Gly II, Gly III, His, Ile I, Ile II, Ile III, Ini I, Ini II, Leu I, Leu II, Leu III, Lys, Met, Phe, Pro I, Pro II, Pro III, Sec6, Ser I, Ser II, Ser III, Ser IV, Ser V, Thr I, Thr II, Trp, Val I, Val II, Val III, Type II RNase T1 Asn, Asp, Cys, Gln, Glu, Gly, His, Ini, Lys, Met, Phe, Pro, Sec6, Thr, Trp, Tyr, RNase A Asn, Asp, Cys, Gln, Glu, Ini, Met, Phe, Sec6, Thr, Trp, Tyr, RNase TA Asn, Asp, Cys, Gln, Glu, His, Ini, Lys, Met, Phe, Sec6, Thr, Trp, Tyr, Type III RNase T1 Ala I/III, Ala II/III, Arg I/II, Glu II/III, Ile I/II, Leu II/III, Leu I/III, Ser I/IV, Ser III/V, Ser II/IV/V, Pro I/II, Pro I/II, Val II/III RNase A Ala II/III, Arg III/IV, Ile I/II, Leu II/III, Pro I/II, Pro II/III, Ser III/IV, Val I/II, RNase TA Ala I/III, Ala II/III, Arg I/II, Glu I/II, Glu II/III, Gly I/II, Ile I/II, Leu II/III, Ser II/IV, Ser III/IV, Ser II/III/IV, Val I/II,
By reviewing Table 3.3, it is found that out of the 48 tRNA isoacceptors in E. coli, 34 isoacceptors have distinguishable digestion products from RNase T1 digestion. Similar numbers of individual isoacceptors are detected from RNase A digestion, whereas 43 isoacceptors have
68
unique digestion products from RNase TA digestion. Considering tRNA families, signature products are generated for 16 tRNA families with ribonuclease T1. Twelve families have distinguishable digestion products from RNase A digestion whereas RNase TA generate signature products that can identify 14 tRNA families. Some of the digestion products (Type III) neither unique for individual tRNA isoacceptors nor for any particular tRNA family, but only for part of a family i.e., two or three tRNA isoacceptors of a specific family. From RNase T1 digestion, 13 such digestion products were found. Similarly, eight Type II digestion products are identified from RNase A, eleven such unique digestion products are found from RNase TA digestion.
Table 3.4 RNase T1 digestion of whole tRNA mixture of B. subtilis. tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 2427.378, 1662.238, 1316.207 Leu Leu 3745.471, 2527.275, 2297.315, 1966.284, 1635.227 Arg Arg 2978.447, 1663.222, 1329.202, Lys Lys I none 1281.132 Lys II none Lys I/II 2831.332
Asn Asn I 2322.275 Met Met 3173.416, 1817.296, 1335.201, Asn II 3488.453 1305.191 Asn I/II none Asp Asp 1222.225 Phe Phe 4008.604, 1816.312 Cys Cys 5367.705, 1793.285 Pro Pro 2501.296, 2296.331, 1311.142, 1206.23 Gln Gln 1915.225, 1527.266, 749.048 Ser Ser I 4991.614, 3245.443, 2357.411, 1326.202 Ser II 6251.773, 2572.246, 1777.265 Ser III 2854.359, 2195.271, 990.1 Ser I/III 1961.28 Ser II/III 2853.375 Glu Glu I none Thr Thr 2551.334, 2502.28, 2412.342, Glu II 1607.232 1952.268, 1334.17 Glu I/II 3135.389, 2242.309, 878.162 Gly Gly 4404.56, 3537.507, 2940.407, Trp Trp 4800.691, 3160.384, 2244.277, 1610.184, 1488.244 1655.255, 772.075 His His I none Tyr Tyr I 4051.642 His II none Tyr II 4097.63 His I/II 4428.571, 1585.189, 1487.26 Tyr I/II 3952.583, 2829.364, 2280.336, 1014.111 Ile Ile 2891.402, 2877.387, 1308.19 Val Val 3978.562 2921.413 Ini Ini 3503.452, 3487.469, 1888.262, 1840.323
69
Bacillus subtilis. The signature digestion products of B. subtilis are listed in Table 3.4, Table
3.5, and Table 3.6 from RNase T1, RNase A, and with RNase TA, respectively.
Table 3.5 RNase A digestion of whole tRNA mixture of B. subtilis.
tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 1767.21, 1004.133 Leu Leu 2632.378, 1991.29, 1341.202 Arg Arg 2998.437, 2344.354 Lys Lys I 733.096 Lys II 1478.205 Lys I/II none Asn Asn I none Met Met 1478.205, 1979.29 Asn II 1302.237 Asn I/II none Asp Asp 1656.239, 1094.095, 283.091 Phe Phe 2418.398, 683.097 Cys Cys 1639.26 Pro Pro 2669.385, 2037.296, 1718.239, 1320.154 Gln Gln 612.143 Ser Ser I 3421.417, 3013.437, 2388.405 Ser II 3012.453, 2771.346, 2162.318 Ser III 2704.412, 2441.31, 2306.327, 1321.186, 991.084 Ser I/III none Ser II/III none Glu Glu I none Thr Thr 1432.218, 1005.117 Glu II 1310.207 Glu I/II none Gly Gly 2637.395, 716.108 Trp Trp 2653.39, 2322.322, 2112.258 1707.322, 1373.192 His His I none Tyr Tyr I 1684.295 His II none Tyr II 1730.283 His I/II none Tyr I/II 3798.454, 1324.223, 1012.15 Ile Ile 3285.466, 995.171 Val Val 2442.294, 1340.218 Ini Ini 1995.285, 1704.223
From Tables 3.4, 3.5, 3.6, and 3.7, it is found that about 82% of isoaccepting tRNAs of B.
subtilis generate unique digestion products from RNase T1 digestion. Considering tRNA
families, all of those generate signature digestion products. There are no unique digestion
products for individual tRNA isoacceptors of Glu I, His I, His II, Lys I, and Lys II from this
ribonuclease. About 86% of individual isoaccepting tRNAs generate signature digestion products
from RNase A digestion alone. There are no unique digestion products representing tRNA
70
families of Asn, Glu, and His with this enzyme. About 79% of isoacceptor tRNAs generate at least one signature products from RNase TA digestion. Considering tRNA families, all of those can be detected. There are no signature products for individual tRNA isoacceptors of His I, His
II, Lys I, Lys II, Tyr I, and Tyr II, however, signature products are available for His, Lys, and
Tyr tRNA families.
Table 3.6 RNase TA digestion of whole tRNA mixture of B. subtilis.
tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 5786.753, 2945.388, 1644.228 Leu Leu 4736.575, 3155.406, 2893.334, 1941.253, 1894.263, 1246.143, 1033.162 Arg Arg 5654.792, 2985.394, 2970.348, Lys Lys I none 2279.305, 1645.212, 637.093 Lys II none Lys I/II 2507.297, 2334.322, 1961.202, 754.065 Asn Asn I 4153.505, 2891.366, 1222.225 Met Met 4682.59, 4647.633, 2889.387 Asn II 2892.35, 2585.341, 1551.184 Asn I/II 3198.375 Asp Asp 4577.58, 4113.498, 3846.496, Phe Phe 6478.816, 3462.426, 1749.2, 2588.293, 893.173 1299.181 Cys Cys 5351.719, 3807.473, 2586.325, Pro Pro 4379.517, 3322.414, 3290.435, 2399.289 1749.2
Gln Gln 2361.25, 1897.215 Ser Ser I 5240.7, 3239.413, 3228.386, 2626.332, 1707.261, 1244.175, 651.054 Ser II 4625.626, 2969.411, 2907.344, 2321.291, 1017.167 Ser III 5232.684, 3117.379, 2640.347, 2242.262, 1631.196, 1362.214 Ser I/III 5192.678 Ser II/III 2628.347 Glu Glu I 4272.493, 1936.237 Thr Thr 2401.315 Glu II 3967.452 Glu I/II 2201.272, 2218.272 Gly Gly 2748.414, 2593.345, 1978.259, Trp Trp 5813.728, 3704.527, 2546.319, 1550.2 2014.282, 1632.228, 409.018 His His I none Tyr Tyr I none His II none Tyr II none His I/II 4697.552, 4499.536, 2443.373, Tyr I/II 4337.543, 3727.461, 3312.479, 1856.225 3276.42, 2031.243, 1717.258 Ile Ile 4166.536, 2594.341, 1935.253, Val Val 4950.659, 2843.333, 2545.335, 978.145 2161.266, 977.161 Ini Ini 4497.568, 4071.524, 3740.456, 2280.3
71
Table 3.7 List of theoretical signature digestion products of B. subtilis with RNase T1, RNase A, and RNase TA. Bold ones are experimentally detected by MALDI-MS.
Type of Ribonuclease List of tRNA isoacceptors detected by signature digestion products signature products Type I RNase T1 Ala, Arg, Asn I, Asn II, Asp, Cys, Gln, Glu II, Gly, Ile, Ini, Leu, Met, Phe, Pro, Ser I, Ser II, Ser III, Thr, Trp, Tyr I, Tyr II, Val, RNase A Ala, Arg, Asn II, Asp, Cys, Gln, Glu II, Gly, Ile, Ini, Leu, Lys I, Lys II, Met, Phe, Pro, Ser I, Ser II, Ser III, Thr, Trp, Tyr I, Tyr II, Val, RNase TA Ala, Arg, Asn I, asn II, Asp, Cys, Gln, Glu I/II, Gly, Ile, Ini, Leu, Met, Phe, Pro, Ser I, Ser II, Ser III, Thr, Trp, Val, Type II RNase T1 Ala, Arg, Asn I, Asn II, Asp, Cys, Gln, Glu I/II, Gly, His I/II, Ile, Ini, Leu, Lys I/II, Met, Phe, Pro, Thr, Trp, Tyr I/II, Val, RNase A Ala, Arg, Asp, Cys, Gln, Gly, Ile, Ini, Leu, Met, Phe, Pro, Thr, Trp, Tyr I/II, Val, RNase TA Ala, Arg, Asn I/II, Asp, Cys, Gln, Glu I/II, Gly, His I/II, Ile, Ini, Leu, Lys I/II, Met, Phe, Pro, Thr, Trp, Tyr I/II, Val, Type III RNase T1 Ser I/III, Ser II/III, RNase A none RNase TA Ser I/III, Ser II/III,
There are about 21 tRNA families in B. subtilis containing a total of 28 isoaccepting
tRNAs. By reviewing Table 3.7, it is found that 23 isoacceptors have distinguishable digestion
products from RNase T1 digestion. Similar numbers of individual isoacceptors are identified
from RNase A digestion, whereas 22 isoacceptors have unique digestion products from RNase
TA digestion. Considering tRNA families, signature products are generated for 19 tRNA families
with ribonuclease T1. Sixteen families have distinguishable digestion products from RNase A
digestion whereas RNase TA generate signature products that can identify 20 tRNA families.
Some of the digestion products (Type III) neither unique for individual tRNA isoacceptors nor
for any particular tRNA family, but only for part of a family i.e., two or three tRNA isoacceptors
of a specific family. From RNase T1 and RNase TA digestions, two of each Type III digestion
products are found.
72
Table 3.8 (A) Summary of the number of theoretical signature digestion products for E. coli tRNAs (of Ala to Leu). Total numbers of signature products are in parentheses after each tRNA families.
tRNAs Isoaccepting RNase T1 RNase A RNase TA Total tRNAs / tRNAs
Ala I 2 2 5 9 Ala II 2 1 2 5 Ala (total 22) Ala III 0 0 0 0 Ala I/III 1 0 1 2 Ala II/III 2 2 2 6 Arg I 0 2 1 3 Arg II 0 1 1 2 Arg III 5 2 3 10 Arg (total 33) Arg IV 1 1 1 3 Arg V 3 2 4 9 Arg I/II 1 0 4 5 Arg III/IV 0 1 0 1 Asn (total 8) Asn 3 1 4 8 Asp (total 9) Asp 2 4 3 9 Cys (total 10) Cys 4 3 3 10 Gln I 2 1 1 4 Gln (total 14) Gln II 4 2 1 7 Gln I/II 1 1 1 3 Glu I 0 1 1 2 Glu II 0 0 0 0 Glu III 0 0 0 0 Glu (total 14) Glu I/II/III 4 1 3 8 Glu I/II 0 0 2 2 Glu II/III 1 0 1 2 Gly I 2 1 4 7 Gly II 2 1 4 7 Gly (total 22) Gly III 2 1 3 6 Gly I/II/III 1 0 0 1 Gly I/II 0 0 1 1 His (total 10) His 6 0 4 10 Ile I 0 1 1 2 Ile II 0 1 1 2 Ile (total 14) Ile III 2 1 3 6 Ile I/II 2 2 2 6 Ini I 0 0 1 1 Ini (total 12) Ini II 0 0 1 1 Ini I/II 4 3 4 11 Leu I 3 3 4 10 Leu II 1 0 4 5 Leu (total 25) Leu III 1 1 4 6 Leu I/III 1 0 0 1 Leu II/III 1 1 1 3
73
Table 3.8 (B) Summary of the number of theoretical signature digestion products for E. coli tRNAs (of Lys to Val). Total numbers of signature products are in parentheses after each tRNA families.
tRNAs Isoaccepting RNase T1 RNase A RNase TA Total tRNAs / tRNAs
Lys (total 6) Lys 2 0 4 6 Met (total 12) Met 4 4 4 12 Phe (total 8) Phe 3 3 2 8 Pro I 2 0 5 7 Pro II 3 0 5 8 Pro III 2 1 5 8 Pro (total 34) Pro I/II 1 2 1 4 Pro I/III 1 1 0 2 Pro I/II/III 4 0 0 4 Pro II/III 0 0 1 1 Sec6 (total 10) Sec6 1 5 4 10 Ser I 2 3 6 11 Ser II 2 4 4 10 Ser III 0 1 1 2 Ser IV 0 1 2 3 Ser V 2 6 5 13 Ser (total 48) Ser I/IV 1 0 0 1 Ser II/IV 0 0 1 1 Ser II/III/IV 0 0 2 2 Ser III/IV 1 1 2 4 Ser III/IV/V 1 0 0 1 Thr I 1 0 1 2 Thr (total 10) Thr II 2 0 3 5 Thr I/II 1 1 1 3 Trp (total 12) Trp 5 3 4 12 Tyr I 0 0 0 0 Tyr (total 11) Tyr II 1 0 0 1 Tyr I/II 4 2 4 10 Val I 0 1 1 2 Val II 1 0 2 3 Val (total 15) Val III 2 2 3 7 Val II/III 1 1 1 3
After reviewing Table 3.8, it is found that all tRNA families of E. coli have multiple signature products with all three ribonucleases, ranging from a low of six for tRNALys to a high of 48 for tRNASer. All tRNA isoacceptors have at least one signature product with the exception of tRNAAla III, tRNAGlu II, tRNAGlu III, and tRNA Tyr I.
74
Table 3.9 Summary of the number of theoretical signature digestion products for B. subtilis tRNAs. Total numbers of signature products are in parentheses after each tRNA families. tRNAs Isoaccepting RNase T1 RNase A RNase TA Total tRNAs / tRNAs
Ala (total 8) Ala 3 2 3 8 Arg (total 12) Arg 4 2 6 12 Asn I 1 0 3 4 Asn (total 10) Asn II 1 1 3 5 Asn I/II 0 0 1 1 Asp (total 9) Asp 1 3 5 9 Cys (total 6) Cys 2 1 3 6 Gln (total 6) Gln 3 1 2 6 Glu I 0 0 2 2 Glu (total 10) Glu II 1 1 1 3 Glu I/II 3 0 2 5 Gly (total 11) Gly 5 2 4 11 His I 0 0 0 0 His (total 7) His II 0 0 0 0 His I/II 3 0 4 7 Ile (total 9) Ile 3 2 4 9 Ini (total 10) Ini 4 2 4 10 Leu (total 15) Leu 5 3 7 15 Lys I 0 1 0 1 Lys (total 7) Lys II 0 1 0 1 Lys I/II 1 0 4 5 Met (total 9) Met 4 2 3 9 Phe (total 8) Phe 2 2 4 8 Pro (total 12) Pro 4 4 4 12 Ser I 4 3 7 14 Ser II 3 3 5 11 Ser (total 43) Ser III 3 5 6 14 Ser I/III 1 0 1 2 Ser II/III 1 0 1 2 Thr (total 8) Thr 5 2 1 8 Trp (total 16) Trp 5 5 6 16 Tyr I 1 1 0 2 Tyr (total 17) Tyr II 1 1 0 2 Tyr I/II 4 3 6 13 Val (total 9) Val 2 2 5 9
Similarly, all tRNA families of B. subtilis also have multiple signature products, ranging from six for tRNACys and tRNAGln , to 43 for tRNASer (Table 3.9). Except for tRNAHis I and tRNAHis II, all isoaccepting tRNAs have one or more signature products, though there are signature products for tRNAHis I/II. Thus the detection of all of the tRNA families with most of
75
their member isoacceptors of E. coli as well as B. subtilis are theoretically possible with this multiple ribonucleases approach by their signature ribonuclease digestion product.
3.3.2 Optimization of ribonuclease digestion.
Optimization of digestion conditions of E. coli whole tRNAs with RNase T1 has already been discussed in Chapter 2. Here the optimization of digestion conditions of RNase A and
RNase TA is discussed.
3.3.2.1 RNase A. The enzymatic digestion conditions of ribonucleic acids were optimized with RNase A in a similar fashion to RNase T1. RNase A is specific for phosphodiester linkages with a pyrimidine base at the 3´-position. After optimizing the digestion of single standard tRNAs, an experimental design was set up which includes four standard tRNAs mixtures, tRNATyr II, tRNAVal III, tRNAGlu II, and tRNAPhe. Four solutions were made up by using three standard tRNAs at a time. A different tRNA was absent in each solution. For example, solution A contained tRNATyr II, tRNAVal III and tRNAGlu II . Similarly, solutions B, C, and D contained three different standard tRNAs mixture excluding tRNATyr II, tRNAVal III, and tRNAGlu II, respectively. Each solution was digested with RNase A and analyzed by MALDI-MS.
The presence of specific signature digestion product peak(s) in the MALDI spectrum confirmed the presence of those tRNAs. The lack of any signature digestion peaks from tRNAs not present in the sample confirms that false positives are not a problem with this approach (Figure 3.2 and
Table 3.10).
76
(a)
2000
1500 2031.3 a.i. 1000 1671.3 2361.3 2047.3 1342.2 500 1027.2 3019.4 1439.1 3754.6
0 1000 1500 2000 2500 3000 3500 4000 m/z
(b)
2000
1500 1671.3 a.i.
1000 1343.2 2361.3
500 2047.3 1358.2 1439.1 3754.6
0 1000 1500 2000 2500 3000 3500 4000 m/z
77
(c)
3500 1326.2 3000
2500
2000 a.i.
1500
1000 2361.3 1342.2
500 2031.3 1027.2 1439.1 3019.4
0 1000 1500 2000 2500 3000 m/z
(d)
2000 1326.2 1800
1600
1400
1200
a.i. 1000
800 1342.2
600
400 1358.2 2031.3 1027.2 3754.6 3019.4 200 1439.1
0 1000 1500 2000 2500 3000 3500 4000 m/z
Figure 3.2 Digestion of four tRNA mixtures with ribonuclease A. (a) tRNAs of Tyr II, Val III, and Glu II. (b) tRNAs of Phe, Val III, and Glu II. (c) tRNAs of Tyr II, Phe, and Glu II. (d) tRNAs of Tyr II, Phe, and Val III.
78
Table 3.10 List of signature digestion products of four tRNA mixtures.
Figure 3.2 (a) Figure 3.2 (c) m/z Base composition tRNA m/z Base composition tRNA isoacceptor isoacceptor 1027.2 GmGCp tRNATyr II 1027.2 GmGCp tRNATyr II 1326.2 AGA Cp tRNATyr II 1326.2 AGA Cp tRNATyr II 1342.2 GAG Cp tRNATyr II 1342.2 GAG Cp tRNATyr II 2031.3 GAA GGTp tRNATyr II 2031.3 GAA GGTp tRNATyr II 3019.4 AAA GGG AGCp tRNATyr II 3019.4 AAA GGG AGCp tRNATyr II 1439.1 pGGG Up tRNAVal III 1343.2 GAG Up tRNAPhe 3754.6 m6AAG GAG GGG m7GUp tRNAVal III 1358.2 GGG Cp tRNAPhe 1671.3 AGG ACp tRNAGlu II 2361.3 AGG GGA Cp tRNAGlu II 2047.3 AGG GGTp tRNAGlu II 1439.1 pGGG Up tRNAGlu II 2361.3 AGG GGA Cp tRNAGlu II
Figure 3.2 (b) Figure 3.2 (d) m/z Base composition tRNA m/z Base composition tRNA isoacceptor isoacceptor 1343.2 GAG Up tRNAPhe 1027.2 GmGCp tRNATyr II 1358.2 GGG Cp tRNAPhe 1326.2 AGA Cp tRNATyr II 1671.3 AGG ACp tRNAGlu II 1342.2 GAG Cp tRNATyr II 2047.3 AGG GGTp tRNAGlu II 2031.3 GAA GGTp tRNATyr II 2361.3 AGG GGA Cp tRNAGlu II 3019.4 AAA GGG AGCp tRNATyr II 1439.1 pGGG Up tRNAVal III 1439.1 pGGG Up tRNAVal III 3754.6 m6AAG GAG GGG m7GUp tRNAVal III 3754.6 m6AAG GAG GGG m7GUp tRNAVal III 1343.2 GAG Up tRNAPhe 1358.2 GGG Cp tRNAPhe
3.3.3.2 RNase TA. For RNase TA optimization, commercially available standard tRNAs tRNATyr I, tRNAPhe, tRNAGlu II and tRNAVal III of E. coli origin were used. RNase TA was prepared from RNase T1 by using an enzyme engineering technology which leads to a specifically cleaving single stranded RNA at adenosine (A) residues with a preference of 10:1 in comparison to guanosine (G) [Technical note, AppliChem Inc.]. The digestion reaction was terminated at the cyclic phosphate intermediate, to limit digestion to adenosine, but not guanosine residues. The m/z values of all signature digestion products of E. coli and B. subtilis cyclic intermediates are listed in Table 3.2 and Table 3.6. RNase U2 (from Pierce Milwaukee
LLC, Milwaukee, WI) was also used to compare the specificity and digestion efficiency with
79
RNase TA. Initially, tRNATyr I and tRNAGlu II were used individually with different
enzyme/substrate ratios, digestion times, and other reaction parameters to obtain optimized
digestion (Figure 3.3).
(a)
2500 978.4
2000 1895.9 1500 1284.5 a.i. 1363.5
1000 2295.8 1717.2
500 3158.7 3384.1
1000 1500 2000 2500 3000 3500 m/z
(b)
20000 1527.0
15000 1018.6
a.i. 10000 1709.1
5000 2987.3 2163.3 0 1000 1500 2000 2500 3000 m/z
Figure 3.3 RNase TA digestion of (a) tRNATyr I and (b) tRNAGlu II with their expected digestion products.
80
Later it was extended to more complex systems by examining a mixture of four standard tRNAs
tRNATyr I, tRNAPhe, tRNAGlu II and tRNAVal III (Figure 3.4). The presence of particular unique or
signature digestion products among standard tRNAs corroborates the presence of cognate tRNAs
in the reaction mixture.
1000 T yr I, V a l III T yr I, P h e V a l III Val III 800 Phe
600 a.i. Tyr, Phe I Glu II 400 Tyr I
Glu II
200
0 1000 1200 1400 1600 1800 2000 2200 2400 m/z
Figure 3.4 RNase TA digestion of four standard tRNAs – tRNATyr I, tRNAVal III, tRNAPhe, and tRNAGlu II. Unique digestion products are marked.
3.3.3 Total tRNA mixture analysis of E. coli
Total tRNA mixture of E. coli were digested individually with RNase T1, RNase A, and
RNase TA, followed by the analysis with MALDI-MS. Seven Type I signature products (for
isoaccepting tRNAs of Arg III, Gln II, Leu I, Leu III, Tyr II, Val III), thirteen Type II signature products (for tRNA families of Asn, Asp, Cys, Glu, Gly, His, Ini, Lys, Met, Phe, Trp, Trp, Tyr,
Pro), and seven Type III signature products (for tRNAs of Ala I/II, Glu II/III, Ile I/II, Leu II/III,
Ser I/IV, Ser III/IV/V, Val II/III) were detected by MALDI mass spectrometry from RNase T1
81
digestion E. coli tRNAs. With RNase A, ten Type 1 signature products (for tRNA isoacceptors
of Arg V, Gln II, Gly I, Gly II, Gly III, Ser I, Ser II, Ser III, Ser V, and Val III), seven type II
signature products (for tRNA families of Asp, Ini, Phe, Sec6, Thr, Trp, and Tyr), and two Type
III signature products (for tRNAs of Ala II/III, and Arg III/IV) were identified. Ten Type I
signature products (for tRNA isoacceptors of Ala I, Arg III, Gly III, Ile I, Ile II, Ser I, Ser IV, Thr
II, Val II, and Pro II), six Type II signature products (for tRNA families of Asn, Gln, Lys, Met,
Phe, and Trp), and three Type III signature products (for tRNAs of Arg I/II, Ile I/II, Val I/II)
were detected with MALDI-MS analysis after ribonuclease TA digestion. (Table 3.3)
3.3.4 Total tRNA mixture analysis of B. subtilis
A mixture of tRNAs isolated from B. subtilis strain 168 was digested with three
ribonucleases independently and analyzed by MALDI-MS without prior separation or
purification steps. In B. subtilis, three Type I signature products (for tRNA isoacceptors of Asn
II, Glu II, and Ser I), fifteen Type II signature products (for tRNAs of Ala, Arg, Gln, Glu I/II,
Gly, His I/II, Ile, Ini, Leu, Met, Pro, Thr, Trp, Tyr I/II, and Val), and one Type three signature
product (for tRNA of Ser I/II) are detected with RNase T1 digestion followed by analysis with
MALDI-MS. There are about two Type I signature products (for tRNA isoacceptors of Glu II,
and Lys I) and eight Type II signature products (Arg, Asp, Cys, Leu, Met, Pro, Trp, and Val)
detected from RNase A digestion. For RNase TA, three Type I signature products (for tRNA
isoacceptors of Asn I, Ser II, and Ser III), thirteen Type II signature products (Ala, Asp, Gln,
Gly, Glu I/II, His I/II, Ile, Ini, Leu, Lys I/II, Phe, Trp, and Val) and one Type III signature
products (for tRNA of Ser II/III) were identified with MALDI-MS. (Table 3.7)
82
3.4 Discussion
3.4.1 Ribonuclease digestion
In this methodology, the detection of tRNAs in a complex mixture is solely dependent on
the identification and detection of signature digestion products. Generating more signature
products should improve tRNA detection. By using three different ribonucleases separately, the
number of detected signature digestion products by MALDI-MS increased detection of tRNAs.
By detecting Type I signature digestion products it is possible to identify unambiguously the
individual isoaccepting tRNAs, whereas by identifying Type II signature products, the entire
family of particular tRNAs consisting of one tRNA or more than one tRNA isoacceptors can be
detected. With Type III signature products, a subset of isoacceptors within a tRNA family can be identified.
Unlike ribonuclease T1 and ribonuclease A, cyclic phosphate intermediates are generated from ribonuclease TA to identify signature digestion products. They yield the same coverage as complete digestion in detecting tRNAs but cannot be used further for relative and absolute quantification with stable 16O- or 18O isotope labeling.
McClosky et al. used urea for unfolding of 16S rRNA of Thermotoga maritime, a bacterial thermophile optimally grown at about 80 °C, for digestion with RNase U2 [146]. High temperature promotes the unfolding of RNA as does chaotropic agents like urea or formamide
[147, 148]. However, addition of urea with heat did not improve tRNA digestion in my experiments. Heat decomposes formamide to carbon monoxide and ammonia, and ammonia is responsible for hydrolyzing RNA very quickly [149]. Though any chaotropic agent or heat was not required for the complete digestion of E. coli tRNAs. B. subtilis was heated to 90 °C for 15-
30 min prior to digest to unfold its tertiary structure.
83
3.4.2 Detection of tRNAs in E. coli and B. subtilis
Combining the experimentally detected signature products of all three ribonucleases,
about 96% of the tRNA isoacceptors of E. coli were identified. Four isoaccepting tRNAs (Ala
III, Glu II, Glu III, and Tyr I) do not have a signature product. However, Type II and Type III signature products are available for those tRNAs. Considering tRNA families, all of those possess at least one or more detectable signature products (Table 3.10).
Table 3.11 List of combined signature digestion products of E. coli with all three ribonucleases. Bold ones are experimentally detected by MALDI-MS.
Type of List of tRNA isoacceptors detected by signature digestion products signature products Type I Ala I, Ala II, Arg I, Arg II, Arg III, Arg IV, Arg V, Asn, Asp, Cys, Gln I, Gln II, Glu I, Gly I, Gly II, Gly III, His, Ile I, Ile II, Ile III, Ini I, Ini II, Leu I, Leu II, Leu III, Lys, Met, Phe, Pro I, Pro II, Pro III, Sec6, Ser I, Ser II, Ser III, Ser IV, Ser V, Thr I, Thr II, Trp, Tyr II, Val I, Val II, Val III, Type II Asn, Asp, Cys, Gln I/II, Glu I/II/III, Gly I/II/III, His, Ini I/II, Lys, Met, Phe, Pro I/II/III, Sec6, Thr I/II, Trp, Tyr I/II, Type III Ala I/II, Ala II/III, Arg I/II, Arg III/IV, Glu I/II, Glu II/III, Gly I/II, Ile I/II, Ini I/II, Leu I/III, Leu II/III, Pro I/II, Pro I/III, Pro II/III, Ser I/IV, Ser III/V, Val I/II, Val II/III,
Combining the experimentally detected signature products from all of the three
ribonucleases, about 93% of the tRNA isoacceptors of B. subtilis were identified. There are no
signature products individually for tRNA isoacceptors of His I and His II. Considering tRNA
families, all can be identified (Table 3.11).
84
Table 3.12 List of combined theoretical signature digestion products of B. subtilis with all three ribonucleases. Bold ones are experimentally detected by MALDI-MS.
Type of List of tRNA isoacceptors detected by signature digestion products signature products Type I Ala, Arg, Asn I, Asn II, Asp, Cys, Gln, Glu I, Glu II, Gly, Ile, Ini, Leu, Lys I, Lys II, Met, Phe, Pro, Ser I, Ser II, Ser III, Thr, Trp, Tyr I, Tyr II, Val, Type II Ala, Arg, Asn I/II, Asp, Cys, Gln, Glu, Gly, His, Ile, Ini, Leu, Lys, Met, Phe, Pro, Thr, Trp, Tyr, Val, Type III Ser I/III, Ser II/III,
3.4.3 MALDI-MS of total tRNA mixtures of E. coli and B. subtilis
Combining data from all three ribonuclease digestion, 22 Type I signature products are experimentally detected identifying the same numbers of tRNA isoacceptors, sixteen Type II and eleven Type III signature digestion products were also detected in the same way. Nineteen tRNA families of E. coli are identified with RNase T1 digestion, 13 tRNA families are identified from
RNase A digestion, and 15 tRNA families are detected by RNase TA digestion. At least one or more of the tRNA isoacceptors of tRNA families identified by all three of the ribonucleases include Ala, Arg, Asn, Gln, Gly, Phe, Ser, and Val. tRNA families of Asn, Asp, Ile, Ini, Lys,
Met, Thr, Tyr, and Pro are detected by at least two ribonucleases. All of the 22 tRNA families are identified from at least one ribonuclease digestion (Table 3.10, Figures 3.5 and 3.6).
With RNase T1 digestion, 17 tRNA families are identified by MALDI-MS, whereas with the RNase A and RNase TA, the number of tRNA families identified were 10 and 15, respectively. One or more of the isoacceptors of tRNA Glu, Leu, Trp, and Val were identified by all three ribonucleases. tRNA families of Arg, Asn, Asp, Gln, Gly, His, Ile, Ini, Lys, Met, and
Pro were detected by at least two ribonucleases (Table 3.10, Figures 3.7, 3.8 and 3.9). All 21 tRNA families of B. subtilis were identified from at least one ribonuclease.
85
15000 Met
Gln
Gly Gly 10000 a.i.
Thr Sec6 5000 In i Gly
Arg Ala Gly Asp Ser Ala Phe Tyr ValTrp
0 500 1000 1500 2000 2500 3000 3500 4000 m/z
Figure 3.5 RNase A digestion of E. coli total tRNA mixture.
2500
Met
2000
1500 Pro
a.i. Ala
1000 Gly, Trp
Asn
Gln Arg 500 Lys ValMetSer
0 1000 1500 2000 2500 m/z
Figure 3.6 RNase TA digestion of E. coli total tRNA mixture.
86
1200
1000 His Arg Ala Arg 800 Gln
a.i. SerIle , P ro 600 In i Ala
400 Met Thr Tyr Val Gly 200 In i, A s n Val GluSer Leu 0 1000 1500 2000 2500 3000 3500 4000 m/z
Figure 3.7 RNase T1 digestion of B. subtilis total tRNA mixture.
25000
Tyr 20000
15000 a.i. 10000
Glu Asp Trp Leu Cys 5000
Pro Trp Arg Met Val 0
1000 1200 1400 1600 1800 2000 2200 2400 2600 2800 m/z
Figure 3.8 RNase A digestion of B. subtilis total tRNA mixture.
87
3000 Ile
2500
2000
a.i. Ser 1500 Ser
1000 Ala Leu Asn Trp His 500 Gly Phe
0 1000 1200 1400 1600 1800 2000 2200 2400 m/z
Figure 3.9 RNase TA digestion of B. Subtilis total tRNA mixture.
Table 3.13 lists the frequency of tRNA isoacceptors in a typical E. coli cell and the
results found in my MALDI-MS experiments with a multiple ribonuclease approach. All of the
major (>2% of total transfer RNAs) tRNAs (tRNAAla II/III, tRNAArg I/II, tRNAAsp, tRNACys tRNAGlu I/II/III, tRNAGly I/III, tRNAGly II, tRNAIle I/II/III, tRNALeu I, tRNALeu II, tRNALeu III, tRNALys, tRNASer II, and tRNAVal III) and the remaining minor tRNAs are detected by at least one
ribonuclease.
88
Table 3.13. E. coli tRNA abundances and detection by MALDI-MS using signature digestion peaks. Major tRNAs are in shaded area.
tRNA % out Detected by MALDI-MS using signature digestion peaks with isoacceptors %of total RNase T1 RNase A RNase TA tRNA tRNAAla I 0.95 tRNAAla I & III no yes tRNAAla II/III 5.04 tRNAAla I & III yes no signature peak tRNAArg I/II 7.37 no signature peak no yes tRNAArg III 1.34 yes tRNAArg III & IV yes tRNAArg IV 0.65 no tRNAArg III & IV no tRNAArg V 0.99 no no no tRNAAsn 1.85 yes no yes tRNAAsp 3.72 yes yes no tRNACys 2.46 yes no no tRNAGln I 1.36 no no tRNAGln I & II tRNAGln II 1.18 yes yes tRNAGln I & II tRNAGlu I/II/III 7.32 tRNAGlu II & III no No signature peak tRNAGly I/III 3.31 tRNAGly I, II & III yes tRNAGly III tRNAGly II 6.76 tRNAGly I, II & III yes no tRNAHis 0.99 yes no signature peak no tRNAIle I/II /III 5.39 tRNAIle I & II no tRNAIle I & II tRNAIni I 1.88 tRNAIni I & II tRNAIni I & II no tRNAIni II 1.11 tRNAIni I & II tRNAIni I & II no tRNALeu I 4.57 yes no no tRNALeu II 6.94 yes no signature peak no tRNAleu III 2.49 yes no no tRNALys 2.97 yes no signature peak lys tRNAMet 1.09 yes no yes tRNAPhe 1.60 yes yes yes tRNAPro I 0.90 tRNAPro I/II/III no signature peak no tRNAPro II 1.38 tRNAPro I/II/III no signature peak yes tRNAPro III 1.11 tRNAPro I/II/III no no tRNASec6 0.34 no yes no tRNASer I 0.53 tRNASer I & IV yes yes tRNASer II 2.18 no yes no tRNASer III/ IV 1.18 tRNASer III, IV & V tRNASer III tRNASer III & IV tRNASer V 2.01 tRNASer III, IV & V yes no tRNAThr I 1.70 no tRNAThr I & II yes tRNAThr II 0.16 no tRNAThr I & II no tRNATrp 1.46 yes yes yes tRNATyr I 1.19 tRNATyr I & II tRNATyr I & II no signature peak tRNATyr II 1.95 yes tRNATyr I & II no signature peak tRNAVal I 0.98 no signature peak no no tRNAVal II 0.97 tRNAVal II & III no signature peak yes tRNAVal III 5.96 yes yes yes
89
3.5 Conclusion
Signature digestion products enable the identification of tRNA isoacceptors and tRNA families from a complex cellular mixture with mass spectrometry without prior purification steps. The unambiguous detection of individual tRNA isoacceptors is directly related to the number of signature digestion products identified for a particular isoaccepting tRNA. Exploring three ribonucleases, RNase T1, RNase A, and RNase TA, not only enhances the number of signature digestion products, but also increases the number experimentally detected by MALDI-
MS. These three ribonucleases enable the identification of the 22 tRNA families of E. coli and the 21 tRNA families of B. subtilis. This approach can be extended to the relative quantification of ribonucleic acid.
Acknowledgement
We are grateful to Professor Steven T. Gregory, Department of Molecular Biology, Cell
Biology and Biochemistry, Brown University, RI for providing the total tRNA mixture of B.
Subtilis.
90
CHAPTER 4: RELATIVE QUANTIFICATION OF SMALL RNA
4.1 Introduction
E. coli has about 79 genes coding for 46 different tRNA acceptor species [150]. As seen in Table 4.1, the distribution of these tRNA species is not uniform. Thus, the tRNAs present at relatively higher concentrations (major tRNAs) are those cognate to the preferred codons of the genes coding the highly expressed proteins of rapidly growing bacteria [142, 143].
Table 4.1 The numbers of gene copies, next to each unmodified anticodon species, are shown in a universal codon table. The values in parentheses indicate the relative codon usage (0.1%) in E. coli.
U C A G U Phe (16.9) Ser (11.3) Tyr (14.1) Cys (4.3) U GAA 2 (19.1) GGA 2 (10.1) GUA 3 (13.9) GCA 1 (5.9) C Leu UAA 1 (9.9) UGA 1 (5.6) ochr (2.1) opal (0.7) A e CAA 1 (10.7) CGA 1 (7.3) amber (0.2) Trp CCA 1 (11.1) G C Leu (9.0) Pro (5.8) His (10.5) Arg ACG 4 (28.3) U GAG 1 (9.3) GGG 1 (3.4) GUG 1 (10.9) (21.4) C UAG 1 (2.5) UGG 1 (7.4) Gln UUG 2 (13.1) (2.6) A CAG 4 (56.7) CGG 1 (24.5) CUG 2 (30.9) CCG 1 (3.6) G A Ile (26.0) Thr (11.2) Asn (14.8) Ser (6.3) U GAU 3 (30.2) GGU 2 (23.8) GUU 3 (25.1) GCU 1 (15.0) C CAU 1 (2.6) UGU 1 (5.5) Lys UUU 3 (38.4) Arg UCU 1 (1.4) A Met CAU 3 (26.2) CGU 1 (11.4) (12.2) CCU 1 (0.9) G CAU 2 G Val (23.4) Ala (19.3) Asp (30.8) Gly (31.0) U GAC 2 (13.9) GGC 2 (22.5) GUC 3 (23.4) GCC 4 (30.8) C UAC 4 (13.2) UGC 3 (20.9) Glu UUC 4 (45.5) UCC 1 (5.5) A (24.5) (33.7) (19.0) CCC 1 (8.6) G
91
There are approximately 473 human tRNAs genes that are grouped into 49 isoacceptor
families to decode 21 amino acids (including selenocysteine) specified by the genetic code. Pan
and coworkers described the first comparative analysis of tRNA expression levels in eight
human tissues using microarray methods [151].
I have demonstrated endoribonuclease mediated cleavage and MALDI-MS for the
detection of tRNAs from eubacteria by their signature digestion products in Chapters 2 and 3 in
this dissertation. Our research group also reported the relative quantification of ribonucleic acids
using 18O-labeling and mass spectrometry [152]. The goal of this project is to develop an approach, using both of the above techniques, for the determination of relative quantification of tRNAs of E. coli grown in two different media by means of their signature digestion products and 18O stable isotope labeling coupled with MALDI-MS.
4.2 Experimental
4.2.1 Materials. Escherichia coli strain MRE 600 was purchased from American Type Culture
Collection (ATCC, Manassas, VA). E. coli tRNAVal III (Cat.# R2645-10UN), tRNATyr I (R0258-
10UN), tRNAGlu II (Cat.# R6519-10UN), tRNAPhe (R4018-1MG), diammonium hydrogen citrate
(DAHC, Cat.# 09833) and 2,4,6-trihydroxyacetophenone (THAP, Cat.# 91928) were purchased
from Sigma-Aldrich (St. Louis, MO) and used as received. RNase T1 (Cat.# 10109193001) was
obtained from Roche Molecular Biochemicals (Indianapolis, IN). Sep-Pak C18 cartridges (Cat.#
WAT051910) were obtained from Waters (Milford, MA). MOPS minimal (Cat.# M2106) and
EZ Rich defined media (Cat.# M2105) were purchased from Teknova (Half Moon Bay, CA).
18O-labeled water (Normalized, 95% atom 18O, Cat.# 603090-1G) was from Isotec (Miamisburg,
OH). Synthetic oligonucleotides (dT3, dT5, dT15, and dT20) were obtained from the University of
92
Cincinnati DNA Core Facility. Nanopure water (18 MΩ), from a Barnstead (Dubuque, IA)
nanaopure system, was autoclaved before use.
4.2.2 Bacterial Cultures. E. coli strain MRE 600 was grown in MOPS minimal medium (10X
MOPS mixture (10%), 0.132 M K2HPO4 (1%), sterile water (88%), 20% glucose (1%), % are by
volume), which is a modification of Neidhardt supplemented MOPS minimal media and in EZ
Rich defined medium (10X MOPS mixture (10%), 0.132 M K2HPO4 (1%), 10X ACGU (10%),
5X supplement EZ (20%), sterile water (58%), 20% glucose (1%), % are by volume). E. coli
cells were grown in aerobically at 37 °C with vigorous shaking (300 rpm) in an incubator shaker
(Innova 4000, New Brunswick Scientific, Edison, NJ). Cells were harvested at a cell density
corresponding to an A540 of 0.50.
4.2.3 Isolation of small RNAs. Total tRNA from E. coli grown in both MOPS minimal and
EZ rich defined media were isolated using the mirVana miRNA isolation kit from Ambion
(Austin, TX). The isolation procedure was described in Chapter 2. The purity and concentration of the isolated RNA were determined from the A260/A280 absorbance ratio [134]. If the RNA
isolation process was done later, then the disrupted cells were submerged in an RNAlater solution and stored at -20 °C.
4.2.4 Enzyme purification. Ribonuclease T1 (E.C. 3.1.27.3) was precipitated from its original suspension by the use of acetone. The purification procedure was described in Chapter 2.
4.2.5 RNase T1 digestion and stable isotope labeling. For 16O-labeled water, approximately
10 µg of RNA was added to 500 units of RNase T1 and 5 µL of 220 mM ammonium acetate
buffer. The reaction mixtures were incubated for an hour at 37 ºC. For 18O-labeled water,
approximately 10 µg of RNA was added to 5 µL of 220 mM ammonium acetate buffer, placed in
93
a speedvac and evaporated to dryness. Approximately 500 units of RNase T1 was placed in athe speedvac and evaporated to dryness. The RNA sample was then reconstituted in 18O-labeled water and combined with RNase T1. The RNA/enzyme mixtures were incubated for an hour at
37 ºC. The minimum enzyme-to-substrate ratio was estimated to be ~50 units per µg of RNA.
Aliquots from 16O- and 18O-labeled digestion products of tRNAs were mixed at specified proportions and then analyzed by MALDI-MS.
4.2.6 Mass spectrometry. All mass spectrometry experiments were performed on a Bruker
Reflex IV MALDI-TOF from Bruker Daltonics (Billerica, MA) having a 3-m effective flight path, a two-stage gridless ion reflector, pulsed ion extraction, and a nitrogen laser (λ=337 nm).
All MALDI spectra were acquired in negative polarity and in reflectron mode. The sample and matrix preparation as well as data analysis are described in Chapter 2.
4.3 Results
4.3.1 Quantification approach.
E. coli cells were grown in MOPS minimal medium and EZ rich defined medium.
Isolated tRNAs were digested with RNase T1. Stable isotope labeled and unlabeled water were added during digestion. Aliquots from two samples were mixed in equal proportions and analyzed with MALDI mass spectrometry. Relative quantification is achieved by comparing the ion abundance ratios of relevant signature digestion products for any particular tRNA. This research strategy is shown in Figure 4.1
94
Culture of E. coli cells in defined media
Isolation of small RNAs
Digestion of tRNAs with RNase T1 Qualitative Quantitative
Analysis in MALDI-MS Label with 18O-water & mix with unlabeled tRNAs
Match peaks with theoretical Analysis in MALDI-MS digestion products
Measure relative intensity ratio of labeled/unlabeled
Figure 4.1 Overall relative quantification scheme.
Among two sets of tRNAs, one set is digested in the presence of 18O-labeled water and
the other is digested in the presence of 16O-labeled water. Stable isotopes are incorporated during
tRNA digestion. Both digestions are done simultaneously under similar experimental conditions.
After enzymatic digestion, aliquots from both samples are combined in equal ratios and analyzed
with MALDI-MS. The basic principle of this approach is shown in Figure 4.2.
95
HO O B2
OH O OH B2 O POH O RNase 18O digestion O 18 H2 O product O OH B1 O 18 - O P O 16O digestion - product O OH OH Combine and mix with Matrix RNA sample 1
HO O B2 OH MALDI-MS O OH O B2 O POH RNase
O 16 O OH H2 O 16 O P O- O B1 - Relative quantification of O tRNA OH OH RNA sample 2
Figure 4.2 18O- and 16O-labeling approach for relative quantification.
4.3.2 Determination of ion abundance ratio:
For the determination of relative quantification of a particular digestion product, it is necessary to know the ion abundance ratios of its unlabeled and labeled peaks (A and A+2) extracted from the MALDI mass spectrum as shown in Figure 4.3.
Ion Abundance Ratio
1.4 18O-labeled product 1.2 16O-labeled product 1
0.8 0.6 0.4 intensity Relative 0.2
0 A A+1 A+2 A+3 A+4 Peak 96
Figure 4.3 Ion abundance ratio for simple peak.
Peak A has a contribution only from the 16O- digestion product whereas peak A+2 has
contribution both from 16O- and 18O-labeled digestion products. For a single digestion product
peak, with no other poduct ions within ±3 Da, the ion abundance ratio of the 18O- and 16O-
labeled digestion products is calculated by equation 4.1 [152]. The ratios of the isotopic pair ion
abundances of digestion products provide a measure of the relative quantity of the tRNA pairs.
18 I A O [( I A + 2 ) − a 2 * I A ] 16 I A O = I A (4.1)
Where,
16 IA represents the monoisotopic peak abundance of the O product,
18 IA+2 represent the combination of the monoisotopic peak abundance of the O digestion product
and the A+2 isotopic peak abundance of the 16O digestion product,
16 a2 represents the A+2 isotopic peak abundance contribution from the O digestion products.
For overlapping peak pairs, e.g., when two digestion product peaks are located 1 Da away
from each other in the spectrum, the ion abundance ratio calculated from equation 4.1 is not
accurate. For example, digestion products of CCAAAGp (m/z 1960.3) and UAACAGp (m/z
1961.3) are separated by 1 Da. In this situation, the isotopic peak abundances of A, A+1, A+2,
A+3 have different contributions from different digestion products (Figure 4.4).
97
Ion abundance ratio 18O-labeled 2nd product 18O-labeled 1st product 2 16O-labeled 2nd product 1.8 1.6 16O-labeled 1st product 1.4 1.2 1 0.8 0.6
relative intensityrelative 0.4 0.2 0 A A+1 A+2 A+3 peak
Figure 4.4 Ion abundance ratios when overlapping digestion products are present.
Peak A has a contribution only from the lower molecular weight (first) 16O-labeled
digestion product, peak A+1 has contribution from both first 16O- (blue portion in Figure 4.4)
and higher molecular weight (second) 16O-labeled (purple) products, peak A+2 has contribution
from first 16O- , second 16O- , and first 18O-labeled (yellow) products, and A+3 has contribution
from first 16O- and 18O-, and second 16O- and 18O-labeled (green) products.
To determine the ion abundance ratio of the lower molecular weight digestion product
18 16 (IA O/IA O) of the overlapping pair (e.g., m/z 1960.3), it is also necessary to know the ion
16 16 abundances (IB O) of the second product (e.g., m/z 1961.3), where IB O = (IA+1 – a1*IA ) and a1 represents A+1 isotopic peak abundance contribution from the first 16O-labeled product. The ion
abundance ratio of first digestion products (e.g., m/z 1960.3) with 18O- and 16O-labels can be
determined by using Equation 4.2.
18 I A O [ I A + 2 − (a 2 * I A + b 1 * I B )] 16 = I A O I A (4.2)
98
Where,
16 IA represents the monoisotopic peak abundance of the O-labeled first digestion product,
18 IA+2 represent the combination of the monoisotopic peak abundance of the O digestion product,
A+1 isotopic peak abundance of the 16O-labeled second digestion product, and the A+2 isotopic
peak abundance of the 16O-labeled first digestion product,
16 a1, and a2 represent the A+1, and A+2 isotopic peak abundance contribution from the O- labeled first digestion products.
16 b1 represents the A+2 isotopic peak abundance contribution from the O-labeled second
digestion products.
18 16 To determine the ion abundance ratio of second digestion product (IB O/IB O) of the overlapping pair (e.g., m/z 1961.3), it is also necessary to know the ion abundance contributions of the 16O- and 18O-labeled first and second digestion product on peak A+3 position. Peak A+3 =
18 18 18 (IB O + a3*IA + b2*IB + c1* O). Rearranging this equation, IB O = (IA+C – (a3*IA + b2*IB +
18 18 c1* O)). The ion abundance ratio of second digestion product (e.g., m/z 1961.3) with their O- and 16O-labels can be determined by using Equation 4.3.
18 18 I B O [ I A + 3 − ( a 3 * I A + b 2 * I B + c 1 * I A O )] 16 = I B O I B (4.3)
Where,
16 IA represents the monoisotopic peak abundance of the O-labeled first digestion product,
18 IA+3 represent the combination of the monoisotopic peak abundance of the O digestion product
and the A+2 isotopic peak abundance of the 16O digestion product,
99
a3 represents the A+3 isotopic peak abundance contribution from the 16O-labeled first digestion products.
16 b2 represents the A+3 isotopic peak abundance contribution from the O-labeled second digestion products.
18 c1 represents the A+3 isotopic peak abundance contribution from the O-labeled first digestion product, which is similar to a1.
With 18O-labeled water of 95% purity, ion abundance ratios should be multiplied by a correction factor of 1.1053 (for heavy-to-light sample).
4.3.3 Selection of peaks for relative quantification.
To evaluate the feasibility of the method, a sample mixture of five commercially available tRNAs (tRNAGlu II, tRNALys, tRNATyr I, tRNAPhe, and tRNAVal III) were used. After digestion with RNase T1 followed by of MALDI mass spectrometry, several digestion products arise. Although most of the digestion peaks are detected in the spectra, not all of those can be used for quantification for different reasons.
As seen in Table 4.2, many digestion products are common to two or more tRNAs and are not signature digestion products, e.g., m/z 1914, 1304, 1294, 1000, 997, and 976. Several digestion products arise from the 3´-OH terminus of the tRNA sequence (m/z 2450, 1511) which cannot incorporate 18O during enzymatic digestion. Within this table, signature digestion
100
Table 4.2 List of digestion products with RNase T1 digestion of a tRNA mixture. The digestion products in shaded area are non-quantifiable signature digestion peaks. m/z Sequence tRNAGlu II tRNALys tRNAPhe tRNATyr I tRNAVal
5856.831 AAUCCUUCCCCCACCACCA 5856.831 4964.632 ACUSUU6APCAAUUGp 4964.632 4820.644 CACCUCCCUVAC=AGp 4820.644 4098.614 ACUQUA*APCUGp 4098.614 4001.59 UCAUCACCCACCA 4001.59 3319.505 AA*APCCCCGp 3319.505 3208.424 CCCUSUC/CGp 3208.424 3182.428 AAUCCCCUAGp 3182.428 2806.337 UCCCCUUCGp 2806.337 2657.349 U7XCCUUGp 2657.349 2450.405 ACCCACCA 2450.405 2243.293 AAUCCUGp 2243.293 1961.28 UAACAGp 1961.28 1960.296 CCAAAGp 1960.296 1936.284 ACACCGp 1936.284 1914.241 UCAUCGp 1914.241 1914.241 1913.257 AUCCCGp 1913.257 1906.207 4UCCCGp 1906.207 1649.189 AU4AGp 1649.189 1609.2 UCPAGp 1609.2 1608.216 CUCAGp 1608.216 1608.216 1608.216 1607.232 CCCAGp 1607.232 1511.271 CACCA 1511.271 1434.233 7XCGp 1434.233 1343.164 A4AGp 1343.164 1333.186 7UCGp 1333.186 1304.159 APUGp 1304.159 1304.159 1302.191 CACGp 1302.191 1294.163 TPCGp 1294.163 1294.163 1294.163 1294.163 1294.163 1279.164 UCCGp 1279.164 1278.18 CCCGp 1278.18 1027.16 C#Gp 1027.16 1021.161 AAGp 1021.161 1000.15 DAGp 1000.15 1000.15 997.15 CAGp 997.15 997.15 997.15 997.15 979.138 DDGp 979.138 976.138 CDGp 976.138 976.138 975.107 UUGp 975.107 974.123 UCGp 974.123 973.139 CCGp 973.139 877.178 CCA 877.178 692.109 AGp 692.109 692.109 692.109 692.109 692.109 669.082 UGp 669.082 668.098 CGp 668.098 668.098 443.023 pGp 443.023 443.023 443.023 443.023 443.023 363.057 Gp 363.057 363.057 363.057 363.057 363.057
101
products that are possible quantitative signature digestion products include tRNAGlu II (m/z,
1607.2, 1609.2, 1936.3, 1961.3, 2806.3), tRNALys (m/z 1434.2, 2243.3), tRNATyr I (m/z 1021.2,
1027.2, 1906.2, 1960.3), tRNAVal III (m/z 1649), and tRNAPhe (m/z 1278.2, 1279.2, 2657.3).
However, accurate quantification requires signature digestion peaks of reasonable (at least 3)
signal-to-noise ratio, and quantification is preferred for the digestion peaks that differ by > 2 Da.
Based on these additional criteria, the following digestion peaks qualify as quantifiable signature digestion peaks (Q-SDPs) in this experiment: tRNAGlu II (m/z 1936.3, 1961.3), tRNALys (m/z
2243.3), tRNATyr I (m/z 1021.2, 1960.3), and tRNAVal III (m/z 1649).
To test whether relative quantification is feasible using Q-SDPs from a simple mixture of
five tRNAs, a series of standard tRNAs were labeled with 16O and 18O during digestion and
combined at various ratios (light to heavy at ratios of 1:1, 1:2.5, 1:5, 2.5:1, and 5:1). The results
are shown in Table 4.3.
The calculated average ion abundance ratios from three separate spectra for the standard
tRNAs mixtures at 5 different heavy-to-light ratios are listed in Table 4.3. From this result, it is
found that the coefficient of variation (%CV) and error increses at more exreme heavy-to-light
ratios. The 5:1 or 1:5 measurements are less accurate than the 1:2.5 or 2.5:1 measurements. From
these data, a calibration curve was generated by plotting the measured ion abundance ratio versus the concentration of heavy-to-light digestion products within the range of 1:2.5 to 2.5:1. A representative calibration curve for six different digestion products from four different standard
tRNAs is shown in Figure 4.5.
102
Table 4.3 Ion abundance ratio of standard tRNAs mixture. tRNAs m/z sequence Theoretical ratio Exp. Ratio % CV of ion intensity of ion intensity [Heavy/light] [heavy/light] [n = 3] tRNATyr I 1021.2 AAGp 5 3.15 ± 0.23 7.30 2.5 1.92 ± 0.14 7.29 1 0.944 ± 0.14 14.8 0.4 0.433 ± 0.027 6.47 0.2 0.293 ± 0.013 4.43 1960.3 CCAAAGp 5 1.97 ± 0.26 13.1 2.5 1.69 ± 0.22 13.0 1 0.792 ± 0.30 3.78 0.4 0.57 ± 0.11 19.2 0.2 0.308 ± 0.11 35.7 tRNALys 2243.3 AAUCCUGp 5 1.58 ± 0.14 8.86 2.5 1.56 ± 0.07 4.48 1 0.767 ± 0.031 4.04 0.4 0.429 ± 0.012 2.79 0.2 0.316 ±0.043 13.6 tRNAGlu II 1936.3 ACACCGp 5 1.03 ± 0.025 2.42 2.5 1.01 ± 0.13 12.8 1 1.04 ± 0.108 10.3 0.4 1.12 ± 0.091 8.12 0.2 1.37 ± 0.16 1.6 1961.3 UAACAGp 5 2.15 ± 0.38 17.6 2.5 1.17 ± 0.60 51.2 1 0.83 ± 0.02 2.41 0.4 0.177 ± 0.041 23.1 0.2 0.237 ± 0.067 28.27 tRNAVal III 1649.2 AU4AGp 5 1.60 ± 0.37 23.1 2.5 1.61 ± 0.04 2.48 1 1.25 ± 0.22 17.6 0.4 0.807 ± 0.10 12.3 0.2 0.754 ± 0.067 8.89
103
Dynamic range Series1 Series2 2.5 Series3 Series4 2 Series5 Series6 Linear (Series1)
O] 1.5 Linear (Series2) 16 Linear (Series3) O/I
18 1 Linear (Series4) [I Linear (Series5) Linear (Series6) 0.5
0 0 0.5 1 1.5 2 2.5 3 [Heavy]/[Light]
Figure 4.5 Dynamic range for isotope labeling generated from the data presented in Table 4.3 of the RNase T1 digestion products of four standard tRNAs.
From Figure 4.5, Series 1, tRNATyr I, m/z 1021.2, y = 0.697x + 0.1928, R2 = 0.9959 Series 2, tRNATyr I, m/z 1960.3, y = 0.5459x + 0.3077, R2 = 0.9914 Series 3, tRNALys, m/z 2243.3, y = 0.5367x + 0.221, R2 = 0.9998 Series 4, tRNAGlu II, m/z 1936.3, y = 0.0462x + 1.1167, R2 = 0.7708 Series 5, tRNAGlu II, m/z 1961.3, y = 0.4255x + 0.1725, R2 = 0.8318 Series 6, tRNAVal III, m/z 1649.2, y = 0.355x + 0.7608, R2 = 0.9114
Three signature products, Tyr I (m/z 1021.2), Tyr I (m/z 1960.3), Lys (m/z 2243), yield
slopes of > 0.50 with a good linearity (R2 >0.99) over this range. Most of the signature products
have a coefficient of variation (%CV) below 25% within this range. From the above data, it is
also found that the 18O-labeled products are under-represented when measured. This may be due
to incomplete incorporation of 18O into the RNA digest, a back-exchange reaction in the
digestion process, some of the 18O-water may be converted to 16O-water during sample handing
and preservation or unwanted ribonucleic acid contaminants present in the standard tRNAs. For
104
this reason, accurate quantification will require a calibration curve. Figure 4.7 is a representative
MALDI mass spectrum obtained from the standard tRNA mixture prepared at a 1:1 (heavy:light) ratio.
tRNATyr I / tRNAGlu II
600 se 600 300 a.i.
1960 1964 XA i Titl 300
0 1800 2700 3600 m/z Figure 4.6 Representative MALDI mass spectra of RNase T1 digestion products obtained from the standard tRNA mixture prepared at a heavy-to-light ratio of 1:1. Inset: expanded view of RNase T1 digestion product of tRNATyr I and tRNAGlu II used for quantification.
4.3.4 Relative quantification of E. coli tRNAs.
After examining a simple mixture of five tRNAs, this same method was extended to the relative quantification of tRNAs isolated from E. coli grown in two different culture media.
Isolated E. coli tRNAs were digested with RNase T1, labeled with 16O- or 18O-labeled water, and after mixing at equal proportion (1:1 ratio) the samples were analyzed with MALDI mass
105
spectrometry. There are 19 tRNA families that are identified by RNase T1. As discussed earlier,
not all of the experimentally detected peaks can be used for relative quantification by this
approach. By reviewing Table 4.4 and considering the information discussed earlier, signature
digestion products that are possible for using quantification are tRNAArg III (m/z 1327.2), tRNAAsp
(m/z 2572.4), tRNAGln II (m/z 1951.3, 1655.2), tRNAGlu (m/z 1936.3, 1961.3), tRNALeu I (m/z
2289.4), tRNALeu III (m/z 2571.4), tRNALeu II/III (m/z 1996.3), tRNAMet (m/z 2242.4), tRNASer I/IV
(m/z 2403.5), tRNASer III/IV/V (m/z 1350.1), tRNATyr (m/z 1960.3), tRNATyr II (m/z 1937.3) and 5S
RNA (m/z 1655.3). However, for accurate quantification it is necessary to use the peaks with a
signal-to-noise ratio of at least 3:1 with minimal or no signature product overlap. Based on those
considerations, ten signature digestion products can be used as Q-SDPs in the experiments.
These signature digestion peaks are representative of the diverse tRNA population and include
5S rRNA. Two of the signature products from tRNATyr and tRNAGlu were chosen to examine the
consistency of the experimental values. Signature peaks of several major (> 2% of total tRNAs)
and minor tRNAs (< 2% of total tRNA) were also selected. For digestion peaks which have overlapping peaks within ±1 Da, Equations 4.2 and 4.3 were used to calculate ion abundance
ratios.
106
Table 4.4. Experimentally detected tRNAs from E. coli tRNA pool using signature peaks by RNase T1-mediated cleavage and MALDI-MS. Shaded area consist of non-quantifiable signature digestion products.
(isoaccepting) tRNAs Signature peaks Sequence of the digestion product m/z Type tRNAAla I & III 2427.4 III CUC CAC CA tRNAArg III 1327.2 I AUA Gp tRNAAsp 2572.4 II AAU ACC UGp tRNAAsn 3214.4 II UAU m7GUC ACU Gp tRNACys 2941.4 II Us4UA ACA AAGp tRNAGln II 1951.3 I m2AΨA CCGp tRNAGlu II 1655.2 I AAU AGp tRNAGlu II & III 3182.5 III AAU CCC CUA Gp tRNAGlu 1936.3 II ACA CCGp tRNAGlu 1961.3 II UAACAGp tRNAGly II 1656.3 I AAU AGp tRNAGly 1487.2 II CUC CA tRNAHis 3512.5 II AAU CCC AUU Agp tRNAIle I & II 2121.4 III CCU ACC A tRNAIni 3197.4 II TΨC AAA UCC Gp tRNALeu I 2289.4 I ACA CAA Gp tRNALeu II 3721.6 I UCC CCC CCC UCGp tRNALeu III 2571.4 I CCC AAU Agp tRNALeu II & III 1996.3 III AAD DGmGp tRNALys 2450.5 II ACC CAC CA tRNAMet 2242.4 II AAU CCC Gp tRNAPhe 3319.6 II Aams2i6A AΨC CCC Gp tRNASer I & IV 2403.5 III Ams2i6AA ACC Gp tRNASer III, IV, &V 1350.1 III AAA Gp tRNATrp 3944.0 II UcmU CCA ms2i6AAA CCGp tRNATyr 1960.3 II CCA AAGp tRNATyr II 1937.3 I UCA CAGp tRNAVal III 4821.4 I CAC CUC CCU cmo5UACm6AAGp tRNAVal II & III 4002.6 III UCA UCA CCC ACC A 5S RNA 1655.3 AAA CGp
Ten signature peaks from seven tRNAs , tRNAArg III (m/z 1327.2), tRNAGln II (m/z 1951.3), tRNAGlu (m/z 1936.3, 1961.3), tRNAGly II (m/z 1656.3), tRNAMet (m/z 2242.4), tRNASer III/IV/V
107
(m/z 1350.1), tRNATyr (m/z 1960.3), tRNATyr II (m/z 1937.3), and from 5S RNA (m/z 1655.3) were examined. Experimental results of E. coli tRNAs grown in two different culture media
Table 4.5 Average ion abundance ratio for denoted heavy/light mixtures of the selected tRNA digestion products of E. coli. tRNAs m/z sequence experiment Exp. ratio of Avg. of % CV number ion intensity three studies [n = 6] [heavy/light] [n = 3] tRNAArg III 1327.2 AUA Gp 1 3.15 ± 0.23 5.04 2 1.92 ± 0.14 1.20 6.92 3 0.944 ± 0.14 4.49 tRNASer III/IV/V 1350.1 AAA Gp 1 0.433 ± 0.027 19.0 2 0.293 ± 0.013 0.795 9.22 3 1.97 ± 0.26 13.35 5S RNA 1655.3 AAA CGp 1 1.69 ± 0.22 8.08 2 0.792 ± 0.30 0.906 7.36 3 0.57 ± 0.11 8.28 tRNAGly II 1656.3 AAU AGp 1 0.308 ± 0.11 19.7 2 1.58 ± 0.14 0.863 12.9 3 1.56 ± 0.07 20.41 tRNAGlu 1936.3 ACA CCGp 1 0.767 ± 0.031 34.0 2 0.429 ± 0.012 0.792 18.8 3 0.316 ±0.043 16.4 tRNATyr II 1937.3 UCA CAGp 1 1.03 ± 0.025 16.1 2 1.01 ± 0.13 0.769 6.63 3 1.04 ± 0.108 24.6 tRNAGln II 1951.3 m2AΨACCGp 1 1.12 ± 0.091 13.9 2 1.37 ± 0.16 1.25 10.3 3 2.15 ± 0.38 15.2 tRNATyr 1960.3 CCA AAGp 1 1.17 ± 0.60 20.7 2 0.83 ± 0.02 0.761 9.01 3 0.177 ± 0.041 10.3 tRNAGlu 1961.3 UAACAGp 1 0.237 ± 0.067 28.1 2 1.60 ± 0.37 0.698 14.7 3 1.61 ± 0.04 10.5 tRNAMet 2242.4 AAUCCCGp 1 1.25 ± 0.22 16.1 2 0.807 ± 0.10 1.087 17.9 3 0.754 ± 0.067 14.5
(MOPS minimal and EZ rich defined media) on three separate days are listed in Table 4.5 with their standard deviations and percent of coefficient of variation. Samples of tRNAs grown in
MOPS minimal media were labeled with 16O whereas tRNA samples grown in EZ rich defined
108
media were labeled with 18O. For each experiment, six samples were analyzed and their average
values are listed. Figure 4.7 is a representative MALDI mass spectrum obtained from a sample
prepared from equal amount of total tRNA mixtures of E. coli grown in two culture media.
1000 tRNAGln Tyr Glu 800 tRNA , tRNA
1250 600
1000 400
200 750
a.i. 0 1953 1960 1967 500
250
0
1000 1500 2000 2500 3000 3500 4000 m/z
Figure 4.7 Representative MALDI mass spectra of RNase T1 digestion products obtained from a E. coli tRNA mixture prepared from equal amount. Inset: expanded view of RNase T1 digestion product of tRNAGln, tRNATyr, and tRNAGlu used for quantification.
By reviewing Table 4.5, it is found that the results showed similar trends (ion abundance
ratios of heavy vs. light) for all three sets of experiments. For tRNAs of Arg III, Gln II, and Met,
the 18O/16O ratio is >1 signifying increased expression in the EZ Rich medium. For tRNAs of Ser
III/IV/V, Gly II, Glu, Tyr II, Tyr and Glu, the 18O/16O ratio is <1 signifying decreased expression
in the EZ Rich medium. No change was detected for 5S rRNA. The data reveals that, in rapidly growing bacterial cells, tRNAArg III, tRNAGln II, and tRNAMet grow more abundantly than in cells
grown in minimal medium. The opposite holds for tRNASer III/IV/V, tRNAGly II, tRNAGlu, tRNATyr
109
II, tRNATyr and tRNAGlu. There is almost no change at all for 5S RNA in two different growth
cultures. Two digestion product peaks of tRNATyr (m/z 1960.3, 1937.3) and tRNAGlu (m/z
1961.3, 1936.3) showed similar patterns in all three experiments.
4.3.5 Compare to other studies.
Kurland and co-worker tested the predictions of a model that accounts for the codon preferences of bacteria in terms of growth maximization strategy. According to this model, the tRNA species cognate to minor and major codons should be regulated differently under different growth conditions: the isoacceptors cognate to major codons should increase at fast growth rate while those cognate to minor codons should decrease at fast growth rates. In their experiment, five major tRNAs species (tRNAMet, tRNAIni I, tRNAIni II, tRNALeu II, and tRNALeu III ) increased
both as a relative fraction of total tRNA and in absolute concentration with increasing growth
rates. The opposite result was found for two minor tRNAs (tRNALeu I, tRNALeu III) [153].
Emilsson et al reported the analysis of the growth-rate dependence of another 12 tRNA species.
They found that the level of three major tRNA species (tRNAs of Gly II, Pro I, Arg I/II) increased with increasing growth rates. Conversely, four minor tRNAs (tRNAs of Gly I, Pro II,
Pro III, Arg V) decreased with increasing growth rates. In contrast, they also found that three minor tRNAs (tRNAs of Gly III, Arg III, Arg IV) increased with increasing growth rates. Such findings suggested that there are additional constraints on the accumulation of these tRNA species that may be distinct from those required to optimize the kinetic efficiency of translation
[154]. Dong et al reported that tRNAs of E. coli cognate to abundant codons increase in concentration as the growth rate increases but not as dramatically as might be anticipated. The levels of most of the tRNA isoacceptors cognate to less abundant codons remains unchanged
110
with increasing growth rates [141]. Three tRNAs that were found to increase here have a relative
amount of >1% of total tRNAs. In Kurland and co-worker’s study the amount of these tRNAs
were increased in different proportions. tRNAArg III was increased by 33%, tRNAGln II was
increased by 81% and tRNAMet was increased by 52%, compared to normal media. Emilsson
also reported an increase of tRNAArg III [154]. Four tRNAs that are decreased at higher growth
rate in my study were unchanged or have increased concentration in Dong’s study e.g., tRNA of
Ser III/IV/V (9.5%), Gly II (43%), Tyr (34%), and Glu (76%),% increase in parentheses. The
variations may be due to difference in culture environment or the E. coli strain (MRE 600 vs.
W1485) used for this study.
4.4 Discussion
This relative quantification technique with stable isotope label is an extension of my
previously described signature digestion product approach. 16O- and 18O-labeled digestion products differ by only 2 Da. Several digestion product peaks overlap within that range. If two peaks are located 1 Da apart from each other, the true ion abundance ratio can not be obtained by
Equation 4.1. To overcome that difficulty, I introduced Equations 4.2 and 4.3 to calculate the relative ion abundances when overlapping peaks are present. If more than three peaks are within at 1 Da of each other, it is extremely challenging to get accurate ratios even using Equation 4.2 and 4.3. Peaks without any interfering peak nearby have a %CV of <25, which is considered reasonable for MALDI-MS [152]. The choice of the Q-SDP is extremely important. Multiple digestion peaks from the same tRNA may be used to test the consistency of the experimental values. For a complex sample like total tRNAs of E. coli, quantification ranges should be between 1:2.5 and 2.5:1.
111
It is extremely necessary to digest tRNAs completely to incorporate 18O. The 18O-labeled water I used is 95% 18O and 5% 16O. Under longer-term storage conditions or during sample handling, the amount of 18O converted to 16O is unknown. Though the RNase T1 reaction was thought to be irreversible, recent studies suggest that some back exchange may occur during digestion [155]. Sample preparation is of utmost importance for quantification of the ng levels of samples being used. Inadequate mixing of the sample or sample matrix can be a source of error for this type of analysis. Because the quantification is obtained from the ion abundance ratios of heavy-to-light digestion product peaks without any prior purification step, any peak interferences from contaminants would limit the accuracy of the measurements.
4.5 Conclusion
I extended the signature digestion product approach for the relative quantification of tRNAs of E. coli where 48 isoaccepting tRNAs and 5S RNAs are present. This method can be used without any prior purification steps with complex samples. Equations were derived to analyze the ion abundance ratios of two peaks within 1 Da. However, more studies are needed to validate this technique for complex biological systems. Chapter 5 describes the extension of this method to larger RNAs.
112
CHAPTER 5: EXTENDED APPLICATIONS OF SIGNATURE DIGESTION PRODUCTS
5.1 General introduction
After developing and optimizing the signature digestion product approach for the
characterization of transfer RNAs of eubacteria, my next goal was to extend it to other
ribonucleic acids and for eukaryotic systems. 16S and 23S rRNAs are large molecules with 1542
and 2904 nucleotides, respectively. Posttranscriptional modifications in rRNA have been
recognized and reported [156], although rRNAs are not as heavily modified as tRNAs. 16S
rRNA gene sequencing is used as a rapid tool for identification of microorganisms [157].
Mitochondria, though containing their own genome, import the vast majority of their
macromolecular components from the cytoplasm [158]. RNAs that function in mitochondria, in contrast to the majority of mitochondrial proteins, are generally encoded by the mitochondrial genome. However, it is well established today that the transport of nucleus-encoded tRNAs into mitochondria is occurring in a number of evolutionary distinct organisms such as plants, the yeast Saccharomyces cerevisiae and many protozoans [159]. In the yeast Saccharomyces
cerevisiae, two nuclear DNA-encoded tRNAs were reported as mitochondrially targeted, tRNAGln [160] and tRNALys I [161]. Mitochondrial tRNA import might have some exciting practical applications. However, the identification of numerous specific tRNAs simultaneously in a complex mixture is challenging due to their almost similar secondary and tertiary structures.
Contemporary methods are able to identify tRNA import in smaller extent [160, 161]. But global identification of imported tRNAs are rare. On the other hand, tRNA import to mitochondria from the cytosol in diverse living systems makes it a semi-universal phenomenon.
113
Part A. Relative quantification of large ribosomal rRNAs of E. coli by their signature digestion products.
5.2 Introduction
Prior studies which quantified rRNA have relied on gel electrophoresis with radio-
labeling [162, 163], northern hybridization [164], or LC/ESI-MS [146]. Many of these methods
require radio-labeled samples, and some require multiple analysis techniques, thus improved
approaches are worth pursuing. The goal of this particular project is to quantify the large
ribosomal RNAs (16S and 23S rRNAs) of E. coli by means of their ribonuclease digestion
products and stable isotope labeling coupled with mass spectrometry.
5.3 Experimental
5.3.1 Materials. Escherichia coli strain MRE 600 was purchased from American Type Culture
Collection (ATCC, Manassas, VA). Diammonium hydrogen citrate (DAHC, Cat.# 09833) and
2,4,6-trihydroxyacetophenone (THAP, Cat.# 91928) were purchased from Sigma-Aldrich (St.
Louis, MO) and used as received. RNase T1 (Cat.# 10109193001) and RNase A (Cat.#
10109142001) was obtained from Roche Molecular Biochemicals (Indianapolis, IN). Sep-Pak
C18 cartridges (Cat.# WAT051910) were obtained from Waters (Milford, MA). MOPS minimal
(Cat.# M2106) and EZ Rich defined media (Cat.# M2105) was purchased from Teknova (Half
Moon Bay, CA). 18O-labeled water (Normalized, 95% atom 18O, Cat.# 603090-1G) was from
Isotec (Miamisburg, OH). Synthetic oligonucleotides (dT3, dT5, dT15, and dT20) were obtained
from the University of Cincinnati DNA Core Facility. Nanopure water (18 MΩ), from a
Barnstead (Dubuque, IA) nanaopure system, was autoclaved before use.
114
5.3.2 Bacterial Cultures. E. coli strain MRE 600 was grown simultaneously in MOPS
minimal medium (10X MOPS mixture (10%), 0.132 M K2HPO4 (1%), sterile water (88%), 20% glucose (1%), % are by volume), which is a modification of Neidhardt supplemented MOPS minimal media and in EZ Rich defined medium (10X MOPS mixture (10%), 0.132 M K2HPO4
(1%), 10X ACGU (10%), 5X supplement EZ (20%), sterile water (58%), 20% glucose (1%), % are by volume). E. coli cells were grown in aerobically at 37 °C with vigorous shaking (300 rpm) in an incubator shaker (Innova 4000, New Brunswick Scientific, Edison, NJ). Cells were harvested at a cell density corresponding to an A540 of 0.50.
5.3.3 Isolation of large RNAs. Total RNA from E. coli grown in both MOPS minimal and EZ
rich defined media were isolated using the mirVana miRNA isolation kit from Ambion (Austin,
TX). Briefly, E. coli cells were centrifuged at 10,000 rpm for 10 min in a Sorvell RC 5C
centrifuge. After centrifugation, the media solution was discarded and pellets were collected.
After washing with phosphate-buffered saline at pH 7.2 several times, lysis/binding buffer
solution was added to the disrupted cells.
For immediate analysis, one-tenth volume of the mirVana homogenate solution was
added to the disrupted microbial cells and the mixture was incubated for 10 min on ice. A
volume of acid-phenol:chloroform equal to the initial lysate volume was added. The aqueous
phase was carefully recovered and was transferred to a fresh tube. One-third volume of 100%
ethanol was added and mixed thoroughly. The lysate/ethanol mixture was passed through a filter
cartridge and the filtrate containing small RNAs was discarded. The filter containing
immobilized large RNAs was washed with mirVana wash solution I and the flow-through was
discarded. The filter cartridge was transferred into a fresh collection tube and nuclease-free
water was added to the center of the filter. The solution was spun for 20-30 s at 10,000 rpm to
115
recover the large ribosomal RNA. The eluent, which contained the rRNAs, was collected and
stored at -20 ºC prior to further analysis. The purity and concentration of the isolated RNA were
determined from the A260/A280 absorbance ratio [134]. If the RNA isolation process was done
later, then the disrupted cells were submerged in an RNAlater solution and stored at -20 °C.
5.3.4 Enzyme purification. Ribonuclease T1 was precipitated from its original suspension by
the use of acetone. The purification procedure was described in Chapter 2.
5.3.5 RNase T1 digestion and stable isotope labeling. For 16O-labeled water, approximately
10 µg of rRNA was added to 500 units of RNase T1 and 5 µL of 220 mM ammonium acetate
buffer. The reaction mixtures were incubated for an hour at 37 ºC. For 18O-labeled water,
approximately 10 µg of rRNA was added to 5 µL of 220 mM ammonium acetate buffer and
placed in a speedvac to evaporate for complete dryness. Approximately 500 units of RNase T1
was also placed in the speedvac and dried completely. The dried RNA sample was reconstituted in 18O-labeled water and then added to the RNase T1. The rRNA/enzyme mixtures were
incubated for an hour at 37 ºC. The minimum enzyme-to-substrate ratio was estimated to be ~50
units per µg of RNA. Aliquots from 16O- and 18O-labeled digestion products of RNAs were
mixed at specified proportions and then analyzed by MALDI-MS.
5.3.6 Mass spectrometry. All mass spectrometry experiments were performed on a Bruker
Reflex IV MALDI-TOF from Bruker Daltonics (Billerica, MA) having a 3-m effective flight
path, a two-stage gridless ion reflector, pulsed ion extraction, and a nitrogen laser (λ=337 nm).
All MALDI spectra were acquired in negative polarity and in reflectron mode. The sample and
matrix preparation as well as data analysis are described in Chapter 2.
116
5.4 Results
E. coli cells were grown at MOPS minimal medium and EZ rich defined medium. Cells
were harvested and total RNAs were first separated with acid phenol-chloroform extraction.
Large rRNAs (16S and 23S rRNAs) were separated from smaller ones by ethanol precipitation onto glass bead cartridge. After determining the purity and concentration, large rRNA mixtures were digested with ribonucleases followed by analysis using MALDI-MS without any prior purification. rRNAs from MOPS minimum media and EZ rich defined medium were labeled with 16O and 18O during enzymatic digestion. The experimental scheme is presented below
(Figure 5.1):
Large RNA isolation
Organic and solid- phase extraction
Total E. coli cells
Quantification by Isotope labeling RNase digestion & & MALDI-MS Isotope labeling
Matrix: THAP Cleaves purine / Co matrix: DAHC pyrimidine residues Negative ion & yielding several Reflectron mode oligonucleotides
Figure 5.1 Overall research scheme for large rRNAs.
Theoretically, 27 signature digestion products from 16S rRNA and about 68 signature
products from 23S rRNA are possible when digested with RNase T1. These signature products
do not overlap with any tRNA digestion products. Among those, about 5 signature products from
16S rRNA and about 13 signature products from 23S rRNA in the range of m/z 1000-3000 that
can be detected by MALDI-MS and can be used for quantification by this approach (Table 5.1).
117
Peaks with a monoisotopic distribution at a signal-to-noise ratio of > 3:1 can be used for 18O- and
16O- based labeling for relative quantification.
Table 5.1 Signature digestion products arise from RNase T1 digestion of total large rRNAs of E. coli. Bold m/z values are detected by MALDI-MS. rRNAs m/z of signature digestion products
16S rRNA 5017.594, 4500.605, 3771.45, 3674.505, 3535.491, 3511.48, 3465.425, 3205.455, 3196.443, 3183.412, 2883.386, 2877.387, 2856.327, 2853.375, 2639.399, 2596.357, 2547.35, 2503.264, 2304.348, 2289.348, 2196.255, 2194.287, 2042.23, 1993.3, 1890.23, 1637.243, 1306.195 23S rRNA 5721.753, 5135.682, 5118.654, 4404.56, 4170.568, 4147.541, 4123.53, 4121.562, 4099.519, 3888.555, 3841.516, 3839.548, 3815.537, 3793.494, 3559.502, 3557.535, 3550.491, 3252.433, 3229.466, 3206.439, 3198.411, 3158.416, 3136.373, 3134.405, 2949.421, 2948.437, 2901.398, 2878.371, 2854.359, 2832.316, 2807.321, 2806.337, 2735.371, 2594.389, 2571.362, 2553.35, 2550.302, 2526.291, 2525.307, 2524.323, 2314.343, 2292.348, 2290.332, 2265.337, 2245.261, 2243.293, 2242.309, 2241.325, 2232.314, 2218.298, 2008.318, 1985.291, 1974.311, 1962.264, 1939.236, 1936.284, 1915.225, 1912.273, 1891.214, 1679.266, 1622.232, 1610.184, 1583.221, 1035.177, 1012.15, 978.139, 722.12, 443.023
Similarly, about 5 signature products from 16S rRNA and 10 signature products from 23S rRNA were detected with RNase A digestion by MALDI-MS and could be used for quantification (Table 5.2).
Table 5.2 Signature digestion products arise from RNase A digestion of total large rRNAs of E. coli. Bold m/z values are detected by MALDI-MS. rRNAs m/z of signature digestion products
16S rRNA 5070.716, 4038.595, 3397.47, 3381.475, 3332.506, 3019.449, 2988.443, 2732.443, 2691.38, 2378.323, 2048.287, 1659.275, 1646.243, 1639.26, 1319.17, 1027.161, 987.154, 267.096 23S rRNA 4336.642, 4022.6, 3725.538, 3709.543, 3396.486, 3380.491, 3316.511, 3067.433, 3052.422, 3035.443, 3020.433, 3012.452, 2987.459, 2707.375, 2706.391, 2690.396, 2674.401, 2361.344, 2330.338, 2314.343, 2049.27, 2032.292, 2017.281, 2015.301, 2009.264, 1969.296, 1968.312, 1936.273, 1717.255, 1703.239, 1665.201, 1663.222, 1640.244, 1632.227, 1357.197, 1340.218, 1304.159, 1094.095, 1003.138, 989.122, 244.069
5.5 Discussion
The signature digestion product approach is an alternative way to quantify large ribosomal RNAs. Here I developed it for the relative quantification of 16S rRNA and 23S rRNA
118
of E. coli. Several signature digestion products were detected with RNase T1 or RNase A by
MALDI-MS. Only one product is enough for each particular rRNA for the quantification. In that
sense, it is comparatively easier than the quantification of tRNAs where more than 20 tRNAs with their numerous isoacceptors are present in the analyte mixture. Complete optimization of this method will need further study which is described in chapter 6 of this dissertation.
5.6 Conclusion
This approach can be used without any prior gel based separation techniques. This approach may be extended to other biological systems related to ribosome or ribosomal rRNAs and its posttranscriptional modifications.
Part B. Detection of Saccharomyces cerevisiae mitochondrial tRNA import of by signature digestion products.
5.7 Introduction
In Chapters 2 and 3, I introduced ribonuclease-mediated cleavage coupled to MALDI-MS
for the detection of individual tRNAs from E. coli and B. subtilis total tRNA pools by means of
signature digestion products of three ribonucleases. Here, as an extended application of that
approach, I describe a multiple ribonuclease mediated cleavage coupled with MALDI-MS for the
detection of cytosolic and mitochondrial tRNAs from Saccharomyces cerevisiae whole tRNA
pool by their signature digestion products which eventually pave the way to detect specific
imported tRNAs in mitochondria in this organism and other higher organisms.
5.8 Experimental
119
5.8.1 Materials. Saccharomyces cerevisiae strain YPH499 was purchased from American
Type Culture Collection (ATCC, Manassas, VA). Whole tRNA mixtures of yeast were procured
from Ambion (Austin, TX). RNase T1 (Cat.# 10109193001) and RNase A (Cat.# 10109142001)
were obtained from Roche Molecular Biochemicals. RNase T1 was used after purification.
Diammonium hydrogen citrate (DAHC, Cat.# 09833)and 2,4,6-trihydroxyacetophenone (THAP,
Cat.# 91928), sodium acetate (Cat.# S2889), ethylenediaminetetraacetic acid (EDTA), sodium
dodecyl sulphate (SDS, Cat.# 55422), phenol, acid phenol-chloroform (Cat.# P2069), and
ethanol (Cat.# 459836) were purchased from Sigma-Aldrich (St. Louis, MO) and used as
received. miRNA wash solution 1 and wash solution 2/3 are from supplied from Ambion
(Austin, TX) as part of their mirVana miRNA isolation kit (Cat.# AM1560). Sep-Pak C18 cartridges were obtained from Waters (Milford, MA) (WAT051910). Synthetic oligonucleotides
(dT3, dT5, dT15, and dT20) were obtained from the University of Cincinnati DNA Core Facility.
Nanopure water (18 MΩ), from a Barnstead (Dubuque, IA) nanaopure system, was autoclaved
before use.
5.8.2 Yeast small RNA isolation
5.8.2.1 Growing yeast cell. The Saccharomyces cerevisiae strain YPH499 cells was
streaked out on a YEPD (ATCC 1245 media, containing yeast extract, 1%; peptone, 2%,
dextrose, 2%) plate and incubated for 3 days at ~30 °C to obtain single colonies. The colonies
were pink in color. One loop-full of colonies was inoculated to a 5 mL vial filled with sterile
YEPD broth and was incubated for a whole day at about 30 °C. The next day, the whole content
of the vial was transferred aseptically to a 250 mL Erlenmeyer flask containing YEPD medium.
The yeast cells were grown at 30 °C with moderate to vigorous shaking (100 to 300 rpm) and
120
harvested to a cell density of OD600 of 1.5-2.0. Dilutions were used to ensure that the UV-Vis spectrophotometer was in the linear range (0.3-0.9 range).
5.8.2.2 Cell harvest and cell wall disruption. A 10-mL aliquot of the yeast culture was removed, and the cells were collected by centrifugation (5000Xg for 5 min) in a 1.5 mL
Eppendorf tube. The supernatant was discarded and the cell pellet was resuspended in 400 µL of sterile AE buffer (50 mM sodium acetate, 10 mM EDTA, pH 5.2, autoclaved). About 40 µL
(1/10 vol of AE buffer) of 10% SDS was added. Approximately 1 mL (equal volume of total solution) of molecular biology grade phenol (pH ~4.52) was then added. The sample was mixed thoroughly and incubated at 65 °C for 4 min. The hot cell lysate solution was rapidly cooled by placing it in the freezer (at -20 °C) for 30 min until the phenol crystals appeared.
5.8.2.3 Total RNA isolation. The sample was removed from the freezer and centrifuged at 12000Xg in a micro-centrifuge for 3 minutes to separate the phases. The upper aqueous phase was carefully recovered without disturbing the protein inter-phase or the bottom organic phase.
An equal volume of acid phenol-chloroform was added to the aqueous materials and mixed thoroughly. The sample was centrifuged for 3 min to separate the phases. The upper aqueous phase was recovered and transferred to a new Eppendorf tube.
5.8.2.4 Small RNA isolation. About 1/3 vol of 100% ethanol was added to the aqueous solution recovered from the organic extraction. A filter cartridge was placed into one of the collection tubes (from Ambion, Austin, TX). The lysate/ethanol mixture from the previous step was placed onto the filter cartridge. The mixture was centrifuged at 10000Xg for ~15 s to pass
121
through the filter. The filtrate (flow-through) was collected and 2/3 vol of 100% ethanol was
added to it. A fresh filter cartridge was placed onto another eppendorf tube. The lysate/ethanol mixture of previous step was pipetted onto the filter. The collection tube was centrifuged at
10000Xg for ~15 s and the flow-through was discarded. The filter cartridge was washed with
miRNA wash solution 1 (once) and wash solution 2/3 (twice). After discarding the flow-through from the last wash, the assembly was spun for a minute to remove any residual fluid from the filter. The filter cartridge was transferred into a fresh collection tube. About 100 µL of sterile water was applied to the center of the filter and spun for ~30 s at top speed to recover the RNA.
The elute containing small RNAs was collected and stored at -20 °C or colder. The purity and concentration of the isolated RNA were determined from the A260/A280 absorbance ratio [134].
5.8.3 Enzyme purification
Ribonuclease T1 was precipitated from its original suspension by the use of cold acetone.
The precipitate was re-suspended and eluted in 1 mL of 75% aqueous acetonitrile from a Sep-
Pak C18 Cartridge. The cartridge was initially equilibrated and washed with acetonitrile and
water, respectively, before being used.
5.8.4 Digestion
Ribonuclease T1: Approximately 10 µg of RNA was added to 500 units of RNase T1 and
5 µL of 220 mM ammonium acetate buffer. The reaction mixture was incubated for an hour at 37
°C. The minimum enzyme-to-substrate ratio was estimated to be ~50 units per µg of RNA.
Ribonuclease A: Powdered RNase A was re-suspended in sterile water before use. One
unit of RNase A was added to ~10 µg of RNA and 5 µL of 220 mM ammonium acetate buffer
and was incubated for 2 h at 37 °C.
122
5.8.5 Mass spectrometry
All mass spectrometry experiments were performed on a Bruker Reflex IV MALDI-TOF
from Bruker Daltonics having a 3-m effective flight path, a two-stage gridless ion reflector,
pulsed ion extraction, and a nitrogen laser (λ =337 nm). All MALDI spectra were acquired in negative polarity and in reflectron mode. The sample and matrix preparation as well as data analysis are described in Chapter 2.
5.9 Results
5.9.1 Ribonuclease digestion products
Reviewing Tables 5.3 and Table 5.4, it is found that there are 21 tRNA families in cytosolic tRNAs of S. cerevisiae with 37 isoaccepting tRNAs. All tRNA isoacceptors except Arg
II, Arg III, Pro I, Ser II, Ser III, Thr I, and Thr II have at least one or more signature digestion
products with RNase T1 digestion. However, signature products are available for tRNAs of Arg
II/III, Pro I/II, Ser I/III, Ser II/III, Ser I/II/III, and Thr I/II. tRNAGln and tRNALys I have several
signature digestion products. With RNase A digestion, all isoaccepting tRNAs except the tRNAs
of Arg II, Arg III, Gln I, Gln II, Gln III, Phe I, Phe II, Pro I, Pro II, Ser II, and Ser III have signature digestion products. However, signature products are available for tRNAs of Arg II/III,
Arg I/II/III, Gln I/II/III, Phe I/II, Pro I/II, and Ser II/III.
123
Table 5.3 Signature digestion products arise from RNase T1 digestion of total cytosolic tRNAs of S. cerevisiae tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 3509.452, 1892.245, 1318.175 Lys Lys I 4927.656, 3157.432, 1998.273, 1982.279, 1663.222 Arg Arg I 3268.476, 2276.221, 1966.284, Lys II 3406.47, 2971.451, 2908.381, 1960.296 2829.364, 1971.18 Arg II none Lys I/II 706.125 Arg III none Met Met 3940.499, 3478.457, 2602.356, 1349.217 Arg II/III 4035.548, 3171.448, 1941.252, Phe Phe I 1938.252 1635.227 Asn Asn 4432.591, 2548.334, 2389.315, Phe II 3542.474 1347.201, 1326.202 Asp Asp 3784.482, 2247.277, 1638.227, Phe I/II 4164.664, 1980.311 1317.191, 1305.191, 1302.191 Cys Cys 2640.408, 2595.36 Pro Pro I none Gln Gln I 2875.419 Pro II 3822.509, 2097.342 Gln II 3533.523, 1628.22 Pro I/II 1943.268, 1475.153, 1306.175 Gln III 3180.46 Ser Ser I 2335.367, 1388.145 Gly I/III 1643.22, 1197.219 Ser II none Gln I/II/III 3856.529, 2591.365, 1951.284, Ser III none 1012.15, 683.097 Glu Glu 4124.562, 2918.346, 2523.339, Ser I/III 3503.452 2523.339, 1962.264, 1632.227, 1316.207 Gly Gly I 3866.559, 1913.257, 1597.236 Ser II/III 3267.458, 2028.333, 1634.195 Gly II 6482.849 Ser I/II/III 1278.18, 1015.149 His His I 3841.516, 1333.186 Thr Thr I none His II 2877.387, 1332.202 Thr II none His I/II 2868.375, 2244.277, 1633.211, Thr I/II 3569.522, 3211.443, 2526.291, 1778.249, 1329.202 Ile Ile 4159.54, 3047.419, 2145.364, Trp Trp 3628.522, 3539.511, 3494.441, 1927.273, 1648.259, 1607.232 2429.346, 1891.214, 1336.185 Ini Ini 3938.531, 2914.417, 1974.311, Tyr Tyr 2947.417, 2625.383, 1970.196, 1817.296, 1675.27, 973.139, 1888.262, 1338.201, 1206.23 772.075 Leu Leu I 3885.542, 3184.396, 1957.283, Val Val I 3556.538, 2878.371, 2804.453, 1027.16 1614.215 Leu II 3197.427, 2855.343, 2733.403, Val II 3521.463, 3158.416, 1959.299, 1944.252, 1944.252 1655.255 Leu III 3886.526, 3673.521, 1041176 2853.375, 2146.248, 1967.279 Val III 1929.288 Leu I/II 1281.132
124
Table 5.4 Signature digestion products arise from RNase A digestion of total cytosolic tRNAs of S. cerevisiae
tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 4009.556, 1305.191 Leu III 3009.44, 2458.289, 1975.295 Arg Arg I 2706.391, 2287.331, 1326.202, Lys Lys I 1686.249, 1289.196 710.026 Arg II none Lys II 3959.566, 3033.451, 2996.421, 1308.179, 731.107, 709.042 Arg III none Met Met 4365.656, 4001.589, 1303.175 Arg II/III 701.097 Phe Phe I none Arg I/II/III 2638.379 Phe II none Asn Asn 4596.659, 2628.383, 1704.223, Phe I/II 3996.572, 2865.483, 2047.291, 995.171, 697.113 1646.243, 643.091 Asp Asp 2593.356, 682.113 Pro Pro I none Cys Cys 2977.425, 1684.295, 1654.258 Pro II none Gln Gln I none Pro I/II 2939.387, 2375.36, 2218.286, 2103.246 Gln II none Ser Ser I 2224.348, 1522.192, 1025.181 Gln III none Ser II none Gln I/II/III 1108.111, 338.05 Ser III none Glu Glu 1632.227, 718.058 Ser II/III 2664.394, 2359.379, 1311.191 Gly Gly I 1991.29 Ser I/II/III 4665.68, 1678.233 Gly II 3592.475, 2032.292, 518.056 Thr Thr I 2973.43 His His I 2362.328, 959.112 Thr II 2989.425 His II 2346.333 Thr I/II 4288.618, 1778.249, 1325.207, 999.118, 972.144 His I/II 3935.543, 667.102 Trp Trp 3649.546, 2684.384, 1751.216, 1616.232, 1317.191, 1241.126, 974.123 Ile Ile 4267.606, 2000.302, 983.123 Tyr Tyr 4918.715, 2361.344, 2335.367, 403.017 Ini Ini 2998.437, 1669.27, 1629.251, Val Val I 1959.263, 1611.216, 982.139, 1422.163 990.154 Leu Leu I 2670.405, 1689.249, 1659.275, Val II 2322.358, 1671.25, 1648.222, 1335.201, 1304.159 1639.211, 749.048 Leu II 4973.721, 2695.4, 2113.242 Val III 2611.367, 2308.343
Reviewing Tables 5.5 and 5.6, it is found that there are 21 tRNA families in
mitochondrial tRNAs of S. cerevisiae with 26 isoaccepting tRNAs. With RNase T1 digestion, all of the tRNA isoacceptors except Ser II and Ser III yield signature digestion products. There are
signature products for Ser II/III, and Ser I/II/III. With RNase A digestion, there are no signature
products for Arg II, Arg III, Phe I, Phe II, Pro I, Pro II, Ser II, and Ser III; although signature
125
digestion products are available for Arg II/III, Arg I/II/III, Phe I/II, Pro I/II, Ser II/III, and ser
I/II/III.
Table 5.5 Signature digestion products arise from RNase T1 digestion of total mitochondrial tRNAs of S. cerevisiae.
tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala I 1326.202 Lys Lys 3674.505, 3502.468, 2890.345, 2876.403 Ala II 1655.255 Met Met 5915.797, 5689.714, 3845.5, 2555.318 Ala I/II 4379.661, 3584.51, 2950.417, Phe Phe 5143.649, 3275.46, 2856.327, 1966.284 1609.2 Arg Arg I 5478.618, 4807.614, 4796.634, Pro Pro 4077.475, 3473.393, 2289.348, 2453.357, 1961.28 1937.268, 1305.191, 1206.23, 1077.116, 1051.172 Arg II 9214.155, 3527.464, 2831.332, Ser Ser I 5041.605, 4526.632, 3820.457, 2246.293, 1964.279 1939.236, 1632.227 Asn Asn 5163.726, 3201.447, 2911.406, Ser II none 2262.313, 917.184 Asp Asp 3231.447, 2615.377, 2600.377, Ser III none 1557.265 Cys Cys 5501.79, 5001.719, 3913.563, Ser II/III 6322.823, 3872.511, 2833.3, 2301.324, 1332.19 2270.304, 2245.261, 1608.216, 1334.17, 1303.175, 998.134, 671.097 Gln Gln 4218.604, 2633.4, 2304.348, Ser I/II/III 877.178 1870.323, 1341.202, 763.063 Glu Glu 5109.715, 2944.429, 2896.406, Thr Thr 5139.666, 4148.525, 3833.489, 2286.324, 907.177 3593.497, 3393.476 Gly Gly 4386.598, 3698.517, 2642.399, Trp Trp 6005.759, 5018.578, 1962.264, 2291.316, 2220.266, 1407.152 1101.127 His His 4480.577, 3368.48, 2879.355, Tyr Tyr 7096.915, 3604.538, 3185.38, 2619.384, 2549.318 2855.343, 1938.252, 1663.222, 977.122, 974.123 Ile Ile 5445.739, 3560.487, 3479.441, Val Val I 4394.661 2429.346, 1801.276, 1656.239, 1306.175 Ini Ini 6387.825, 3822.473, 2892.386, Val II 5028.754 2267.305, 1941.252, 1817.296 Leu Leu 6235.885, 4125.498, 2527.275, Val I/II 3545.499, 2606.365, 2310.336, 1952.268, 1635.227, 1511.271 772.075
126
Table 5.6 Signature digestion products arising from RNase A digestion of total mitochondrial tRNAs of S. cerevisiae. tRNAs Isoaccepting m/z of signature digestion tRNAs Isoaccepting m/z of signature digestion tRNAs products tRNAs products
Ala Ala 4009.556, 1434.158, 1305.191 Lys II 3959.566, 3033.451, 2996.421, 1308.179, 731.107, 709.042 Arg Arg I 2706.391, 2287.331, 1326.202, Met Met 4365.656, 4001.589, 1303.175 710.026 Arg II none Phe Phe I none Arg III none Phe II none Ala II/III 701.097 Phe I/II 3996.572, 2865.483, 2047.291, 1646.243, 643.091 Arg I/II/III 2638.379 Pro Pro I none Asn Asn 4596.659, 2628.383, 1704.223, Pro II none 995.171, 697.113 Asp Asp 2593.356, 682.113 Pro I/II 2939.387, 2375.36, 2218.286, 2103.246 Cys Cys 2977.425, 1684.295, 1654.258 Ser Ser I 2224.348, 1522.192, 1025.181 Glu Glu 1632.227, 718.058 Ser II none Gly Gly I 1991.29 Ser III none Gly II 3592.475, 2032.292, 1438.158, Ser II/III 2664.394, 2359.379, 1311.191 518.056 His His I 2362.328, 959.112 Ser I/II/III 4665.68, 1678.233 His II 2346.333 Thr Thr I 2973.43 His I/II 3935.543, 667.102 Thr II 2989.425 Ile Ile 4267.606, 2000.302, 983.123 Thr I/II 4288.618, 1778.249, 1325.207, 999.118, 972.144 Ini Ini 2998.437, 1669.27, 1629.251, Trp Trp 3649.546, 2684.384, 1751.216, 1422.163 1616.232, 1317.191, 1241.126, 974.123 Leu Leu I 2670.405, 1689.249, 1659.275, Tyr Tyr 4918.715, 2361.344, 2335.367, 1335.201, 1304.159 403.017 Leu II 4973.721, 2695.4, 2113.242 Val Val I 1959.263, 1611.216, 982.139, 990.154 Leu III 3009.44, 2458.289, 1975.295 Val II 2322.358, 1671.25, 1648.222, 1639.211, 749.048 Lys Lys I 1686.249, 1289.196 Val III 2611.367, 2308.343
5.9.1 Optimization of digestion condition.
Digestion with RNase T1 and the MALDI-MS analysis of digestion products were initially optimized with a commercially available total tRNA mixture from Ambion (Austin, TX)
(Table 5.7). About 11 Type I signature products including tRNALys I, 14 Type II including tRNAGln I/II/III, and one Type III signature products of cytosolic origin were identified. From the same MALDI spectra about 18 total tRNAs or tRNA isoacceptors of mitochondrial origin were detected.
127
Table 5.7 List of experimentally detected signature digestion products of commercially available total tRNAs mixture of S. cerevisiae from Ambion with RNase T1.
Organelle Types of signature List of tRNAs / tRNA isoacceptors detected by signature digestion products products
Cytosolic Type I Arg I, Leu I, Leu II, Leu III, Lys I, Lys II, Phe II, Ser I, Val I, Val II, tRNAs Val III, Type II Asp, Asn, Cys, Gln I/II/III, Glu, His I/II, Ile, Ini, Lys I/II, Met, Ser I/II/III, Thr I/II, Trp, Tyr, Type III Ser II/III, Mitochondrial Type I Ala I, Ala II, Arg II, tRNAs Type II Gln, Glu, His, Ile, Ini, Leu, Lys, Met, Phe, Pro, Ser I/II/III, Trp, Val I/II, Type III Ser II/III,
5.9.2 Digestion of total small RNAs with ribonucleases.
5.9.2.1 RNase T1 digestion. The total tRNA mixture of S. cerevisiae was digested with RNase
T1 and then analyzed with MALDI-MS. About 25 tRNA isoacceptors of cytosolic origin were detected (Table 5.6). Among those, eleven are Type I signature products including Lys I, and one is Type III (Ser II/III) signature product, the rest are Type II digestion products. A total of sixteen tRNA isoacceptors of mitochondrial origin were detected in the same spectra. Three
Type I (Ala I, Ala II, and Ser I), one Type III (Ser II/III), with the remaining Type II signature digestion products, including tRNALys were identified (Table 5.8).
Table 5.8 List of theoretical signature digestion products of S. cerevisiae total tRNAs with RNase T1. Bold ones are experimentally detected by MALDI-MS.
Organelle Types of signature List of tRNAs / tRNA isoacceptors detected by signature digestion products products
Cytosolic Type I Arg I, Gln I, Gln II, Gln III, Gly I, Gly II, His I, His II, Leu I, Leu II, Leu tRNAs III, Lys I, Lys II, Phe I, Phe II, Pro II, Ser I, Val I, Val II, Val III Type II Ala, Asn, Asp, Cys, Gln I/II/III, Glu, His I/II, Ile, Ini, Lys I/II, Met, Phe I/II, Pro I/II, Ser I/II/III, Thr I/II, Trp, Tyr, Type III Gln I/III, Leu I/II, Ser II/III, Mitochondrial Type I Ala I, Ala II, Arg I, Arg II, Ser I, Val I, Val II, tRNAs Type II Ala I/II, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Ini, Leu, Lys, Met, Phe, Pro, Ser I/II/III, Thr, Trp, Tyr, Val I/II, Type III Ser II/III,
128
5.9.2.2 RNase A digestion. With the digestion of ribonuclease A followed by MALDI-MS, it
was found that there are 14 tRNA isoacceptors detected. Among those five were Type I, one
Type III, and the rest are Type II signature digestion products including tRNAGln I/II/III (Table
5.9).
Table 5.9 List of theoretical signature digestion products of S. cerevisiae total tRNAs with RNase A. Bold ones are experimentally detected by MALDI-MS.
Organelle Types of signature List of tRNAs / tRNA isoacceptors detected by signature digestion products products
Cytosolic Type I Arg I, Gly I, Gly II, His I, His II, Leu I, Leu II, Leu III, Lys I, Lys II, Ser tRNAs I, Ser II, Ser III, Thr I, Thr II, Val I, Val II, Val III, Type II Ala, Arg I/II/III, Asn, Asp, Cys, Gln I/II/III, Glu, His I/II, Ile, Ini, Met, Phe I/II, Pro I/II, Ser I/II/III, Thr I/II, Trp, Tyr, Type III Arg II/III, Ser II/III,
5.10 Discussion
A model organism and the first eukaryote to have its genome sequenced, Saccharomyces
cerevisiae has been at the forefront of eukaryotic cellular and molecular biology for more than half a century. Yeast cells are generally grown most easily at 28-30 °C on rich complex media
(such as YEPD). Yeast produces a cell wall that acts as a formidable obstruction to rapid recovery of RNA from these eukaryotic cells. Many of the classical method for the isolation of
RNA from yeast involve vortexing yeast cultures in the presence of glass beads. This technique severely damages the fine-structure of these cells in a non-enzymatic manner. This approach is tedious with poor yields, especially to the small preparation level. The RNA separation procedure used here is the usage of phenol and SDS, enhanced by heating, freezing, and then thawing the cell. As the yeast cell freezes, the phenol crystals that form pierce the cell, thereby liberating its contents, DNA is separated from RNA by phenol extraction under acidic
129
conditions, a tactic frequently used for RNA purification under chaotropic conditions. This technique has the advantages of being a rapid isolation procedure and having minimum cell- culturing requirements [165].
In Figure 5.2, the signature digestion products with RNase T1 of different isoaccepting
tRNAs of cytosolic and mitochondrial origin detected with a single MALDI-MS analysis are
compared to their possible theoretical digestion products. Though only one digestion product is
necessary to detect a particular tRNA in the mixture in this particular method, more than one
peak obviously increases the confidence one has with thid data.
The overall goal of this particular project is to identify the tRNA import of mitochondria
in S. cerevisiae cells. It is already mentioned that two tRNAs (tRNAGln and tRNALys I) of
cytosolic origin are transferred to mitochondria for cellular necessity. Here I have done the
preliminary work of optimizing the RNA separation and the ribonuclease digestion of both
cytosolic and mitochondrial tRNAs. By using RNase T1, it is possible to detect tRNALys I with its signature digestion products and with RNase A digestion, tRNAGln is detected with MALDI-MS,
even in the presence of both cytosolic and mitochondrial tRNAs mixtures. Hopefully it will be easier to detect those two tRNAs with purified mitochondria by their digestion products. The next step proposed is the separation of highly purified mitochondria, isolation of the total tRNAs, digestion of those with multiple RNAs followed by analysis with MALDI-MS and detection of the imported tRNAs by their signature products.
130
(a) (b)
100 100
80 80
60 60
40 40 % sequence coverage
(% sequence coverage) 20 20
0 0 Ile Trp Gln Ini Ini Met His Asn Asp Cys Tyr Tyr Thr Thr Gly Glu Glu Pro Lys Leu Leu Val I Phe Phe Ser I Arg I Ala II Ala II Ser II Arg II Val II Ser III Ile Trp Gln Ini Met Ala Asn Asp Cys Tyr Tyr Glu Glu Val I His I Thr I Thr Ser I Gly I Pro I Arg I Lys I Leu I Leu Phe I Phe His II Thr II Thr Ser II Ser Val I & II Gly II Ala I & II Ala Pro II Arg II Lys II Val III Leu II Leu Val II Phe IIPhe Ser III Arg III Leu III Leu Ser II & III Ser & II Ser I, II & III SerI, & II HisII I & Thr I & II & I Thr ProII I & Lys I & II & Lys I Leu I & II & I Leu Phe I & II & I Phe Ser I & II Ser II & III Arg II & IIIArg
Ser I, II & III Mitochondrial isoaccepting tRNAs (Cytosolic isoaccepting tRNAs)
Figure 5.2 Percent of coverage of detected signature digestion products with MALDI-MS compared to theoretical products; (a) cytosolic tRNAs (b) mitochondrial tRNAs.
5.11 Conclusion
This section describes the preliminary research for the detection of tRNA import of mitochondria in S. cerevisiae. After optimization, it can be used to detect tRNA import in other organisms. Though the signature digestion product with multiple ribonuclease approach was introduced for eubacteria but it can be extended to other systems as well.
131
CHAPTER 6: SCOPE
The main purpose of my dissertation research was to develop a novel but facile approach for the characterization of non-protein coding RNAs using MALDI mass spectrometry. My research focused on three specific aims: method development for identification of bacterial tRNAs, extend an existing approach for RNA quantification to mixtures of bacterial tRNAs, and examine the utility of these approaches for analyzing tRNAs of yeast.
As described in Chapter 2, I have developed a methodology known as the signature digestion product approach which can detect a majority of the tRNA species in eubacteria through ribonuclease digestion followed by the analysis of MALDI-MS. The closely related physiochemical properties of tRNAs make their identification challenging. The enzymatic digestion of an individual tRNA by a ribonuclease generates a number of specific digestion products. A comparison of an organism’s complete complement of tRNA ribonuclease digestion products yields a set on unique or signature digestion product(s) that ultimately enable the detection of individual tRNAs from a total tRNA pool. RNase T1 digestion conditions were optimized with commercially obtainable standard tRNAs and later applied to total tRNAs of E. coli. Theoretically it is possible to detect about 71% of all tRNA in E. coli, whereas ~56% of the tRNAs can experimentally detected by MALDI mass spectrometry.
A new approach, discussed in Chapter 3, involving multiple ribonucleases, was developed to increase tRNA detection. Here an RNA sample is digested separately with three ribonucleases, RNase T1, RNase A, and RNase TA, which generates their own sets of signature digestion products for an RNA sample. The digestion conditions of RNase T1, RNase A and
RNase TA with E. coli and B. subtilis were optimized.
132
One of the major problems related to the signature product approach is that
posttranscriptional modifications of majority of RNA’s are not yet known. If signature digestion
products are determined on the basis of DNA sequence there is always a chance for false
positives. I have used cyclic intermediate products of RNase TA digestion of tRNAs. Cyclic
phosphate intermediates can efficiently be used for detection but not for quantification using 16O-
and 18O-labeled stable isotopes. This area can be improved by developing digestion conditions so
that complete digestion of adenosine (A) will be occurred but will not go up to guanosine (G).
As discussed in Chapter 4, I extended my detection methodology to 16O- and 18O isotope labeling for RNA quantification. I did the basic work to develop a methodology for the large scale relative quantification of tRNAs in a complex mixture. After ribonuclease digestion and
18O- and 16O-labeling, numerous digestion peaks are generated. As 16O- and 18O-labeled products
differ by only 2 Da, overlapping peaks complicate quantification. I introduced two equations to
overcome this difficulty and was able to calculate the ion abundance ratios of those interfering
peaks. Meng et al. previously reported an approach which allows for relative quantification of a
standard tRNAVal III across a heavy to light ratio of 3:5 to 5:1 [152]. My preliminary studies on a
mixture of standard tRNAs and total tRNA of E. coli grown in MOPS minimum medium and EZ
rich defined medium found that this approach provides quantitative results from these complex
samples at light-to-heavy ratio between 2.5:1 and 1:2.5 with MALDI mass spectrometry. Not all
of the detected signature ribonuclease digestion products are found suitable for quantification in
this method and selection of an appropriate digestion product ion in the spectra is crucial for accurate results.
One of the major steps to validate this method will be to analyze the same sample with a benchmark method. Comparison from this method will give a clear idea about sample and
133
instrument biases in this quantification method. A comparison of tRNAs digestion in two 18O water solutions (95% vs. 99.9% pure) may give us information about under-expressed 18O- labeled products. The digestion time and back exchange are other areas to explore.
As mentioned in Chapter 5 Part A, I extended the process of relative quantification to large rRNAs, 16S and 23S rRNAs of E. coli. Several signature digestion products were detected for the quantification purpose. Only two well separated peaks (one of each for 16S and 23s rRNAs) with high signal to noise ratio (at least 3) and without any overlapping peaks is sufficient for quantification with the 16O- and 18O-labeled technique. This method should be applicable to
eukaryotic systems as well. For eukaryotic cells the rRNAs should first be separated by gel electrophoresis or other methods before being digested and labeled.
As described in Chapter 5 Part B, I have reported preliminary work related to tRNA
import from cytosol to mitochondria. Initially I worked with total tRNAs of yeast
Saccharomyces cerevisiae containing both nuclear-encoded and mitochondria-encoded transfer
RNAs. I detected both tRNALys I and tRNAGln, the two tRNAs that are imported to mitochondria.
The next steps would be the complete separation of highly purified mitochondria, separate the total tRNAs and detect the two nuclear-encoded tRNAs by using signature digestion product of ribonucleases and MALDI-MS. The technique can be extended to other eukaryotes to identify and quantify tRNA import into mitochondria for a variety of organisms.
From the above discussions it is evident that global characterization of tRNAs or other non-protein coding RNAs will be possible using this signature digestion product approach in a manner similar to peptide mass fingerprinting used in proteomics, allowing RNomics studies of
RNA at the posttranscriptional level.
134
BIBLIOGRAPHY
(1) Lehninger, A.; Nelson, D.; Cox, M. Principles of Biochemistry.; W. H. Freeman & Company: New York, 2000. (2) Johnston, W.; Unrau, P.; Lawrence, M.; Glasner, M.; Bartel, D. Science 2001, 292, 1319- 1325. (3) Eddy, S. Nature Rev. Genet. 2001, 2, 919-929. (4) Großhans, H.; Filipowicz, W. Nature 2008, 451, 414-416. (5) Mattick, J.; Makunin, I. Hum. Mol. Genet. 2006, 15, R17-R29. (6) Jădy, B.; Kiss, T. EMBO J. 2001, 20, 541-551. (7) Blum, B.; Simpson, L. Cell 1990, 62, 391-397. (8) Lau, N.; Seto, A.; Kim, J.; Kuramochi-Miyagawa, S.; Nakano, T.; Bartel, D.; Kingston, R. Science 2006, 313, 363-367. (9) Klattenhoff, C.; Theurkauf, W. Dev. 2008, 135, 3-9. (10) Gillet, R.; Felden, B. Mol. Microbiol. 2001, 42, 879-885. (11) Walter, P.; Ibrahimi, I.; Blobel, G. Cell Biol. 1981, 91, 545-550. (12) Crick, F.; Crook, E., Ed.; Cambridge University Press: London, 1957. (13) Hoagland, M.; Stephenson, M.; Scott, J.; Hecht, L.; Zamecnik, P. J. Biol. Chem. 1958, 231, 241-257. (14) Marquĕz, V.; Nierhaus, K. In Protein synthesis and ribosome structure.; Nierhaus, K., Wilson, D., Eds.; Wiley-VCH Verlag GmbH & Co.: KGaA, Weinheim, 2004, pp 145- 167. (15) Watanabe, Y.; Tsuruit, H.; Ueda, T.; furushima, R.; Takamiya, S.; Kita, K.; Nishikawa, K.; Watanabe, K. J Biol. Chem. 1994, 269, 22902-22906. (16) Auffinger, P.; Westhof, E. In Modification and editing of RNA.; Grosjean, H., Benne, R., Eds.; ASM: Washington, DC, 1998. (17) Kim, S.; Suddath, F.; Quigley, G.; McPherson, A.; Sussman, J.; Wang, A.; Seeman, N.; Rich, A. Science 1974, 185, 435-440. (18) Moras, D.; Comarmond, M.; Fischer, J.; Weiss, R.; Thierry, J.; Ebel, J.; Giegé, R. Nature 1980, 288, 669-674. (19) Grosjean, H. In Fine-tuning of RNA functions by modification and editing.; Grosjean, H., Ed.; Springer-Verlag: Berlin, Heidelberg, 2005, pp 1-22. (20) Limbach, P.; Crain, P.; Pomerantz, S.; McCloskey, J. In tRNA: Structure, biosynthesis, and function.; Söll, D., RajBhandary, U., Eds.; American Society for Microbiology: Washington, DC, 1995. (21) Motorin, Y.; Grosjean, H., Eds. tRNA modification.; Nature Publishing Group: London, 1999. (22) Garrett, R.; Douthwaite, S.; Liljas, A. The ribosome: structure, function, antibiotics and cellular interaction.; ASM: Washington, DC, 2000. (23) Das, A.; Klaver, B.; Berkhout, B. J. Virol. 1995, 69, 3090-3097. (24) Gollnick, P.; babitzke, P. BBA 2002, 1577, 240-250. (25) Wendrich, T.; Blaha, G.; Wilson, D.; Marahiel, M.; Nierhaus, K. Mol. Cell 2002, 10, 779-788.
135
(26) Kannangara, C.; Gough, S.; Bruyant, P.; Hoober, J.; Kahn, A.; Wettstein, D. TIBS 1988, 13, 139-143. (27) Plapp, R.; Strominger, J. J. Biol. Chem. 1970, 245, 3667-3674. (28) Hegde, S.; Shrader, T. J. Biol. Chem. 2001, 2001, 6998-7003. (29) Dunstan, H.; Young, L.; Sprague, K. Mol. Cell Biol. 1994, 14, 3588-3595. (30) Varshavsky, A. Proc. Natl. Acad. Sci. USA 1996, 93, 12142-12149. (31) Florentz, C. Biosci. Rep. 2002, 22, 81-98. (32) Graeber, M.; Müller, U. J. Neurol. Sci. 1998, 153, 251-263. (33) Lafontaine, D.; Tollervey, D. In Encyclopedia of life sciences; Nature Publishing Group., 2001, pp 1-7. (34) Holley, R.; Merril, S. J. Am. Chem. Soc. 1959, 81, 753. (35) Warner, R.; Vaimberg, P. Fed. Proc. 1958, 17, 331. (36) Raymond, S. Anal. Chem. 1958, 30, 1214-1216. (37) RajBhandary, U.; Köhler, C. J. Biosci. 2006, 31, 439-451. (38) Gillam, I.; Millward, S.; Blew, D.; Tigerstrom, M.; Tener, G. Biochemistry 1967, 6, 3043-3056. (39) Nishimura, S.; Harada, F.; Narushima, U.; Seno, T. Biochem. Biophys. Res. Commun. 1967, 142, 133-148. (40) Pearson, R.; Weiss, J.; Kelmers, A. Biochim. Biophys. Acta 1971, 228, 770-774. (41) Holms, W.; Hurd, R.; Reid, B.; Rimerman, R.; Hatfield, G. Proc. Natl. Acad. Sci. USA 1975, 72, 1068-1071. (42) Cayama, E.; Yepez, A.; Rotondo, F.; Bandeira, E.; Ferreras, A.; Triana-Alonso, F. Nucleic Acids Res. 2000, 28, e64. (43) Zhu, R.; Ching, W.; Chung, H.; Rhee, S.; Stadman, T. Anal. Biochem. 1987, 161, 460- 466. (44) Ribeiro, S.; Nock, S.; Sprinzl, M. Anal. Biochem. 1995, 228, 330-335. (45) Chinali, G. J. Biochem. Biophys. Methods 1997, 34, 1-10. (46) Garel, J.; Garber, R.; Siddiqui, M. Biochemistry 1977, 16, 3618-3624. (47) Kanduc, D. 1994. (48) Yokogawa, T.; Kumazawa, Y.; Miura, K.; Watanabe, K. Nucleic Acids Res. 1989, 17, 2623-2638. (49) Kumazawa, Y.; Yokogawa, T.; Hasegawa, E.; Miura, K.; Watanabe, K. J Biol. Chem. 1989, 264, 13005-13011. (50) Kumazawa, Y.; Yokogawa, T.; Tsurui, H.; Miura, K.; Watanabe, K. Nucleic Acids Res. 1992, 20, 2223-2232. (51) Dong, H.; Nilsson, L.; Kurland, C. J. Mol. Biol. 1996, 260, 649-663. (52) Petyuk, V.; Zenkova, M.; Giege, R.; Vlassov, V. FEBS Lett. 1999, 444, 217-221. (53) Mir, K.; Southern, E. Nature Biotechnol. 1999, 17, 788-792. (54) Buvoli, A.; Buvoli, M.; Leinwand, L. RNA 2000, 6, 912-918. (55) Miyauchi, K.; Ohara, T.; Suzuki, T. Nucleic Acids Res. 2007, 35, e24. (56) Michikawa, Y.; Hofhaus, G.; Lerman, L.; Attardi, G. Nucleic Acids Res. 1997, 25, 2455- 2463. (57) Vastola, F.; Pirone, A. Adv Mass Spectrom 1968, 4, 107-111. (58) Vastola, F.; Mumma, R.; Pirone, A. Org Mass Spectrom 1970, 3, 101-104. (59) Mumma, R.; Vastola, F. Org Mass Spectrom 1972, 6, 1373-1376.
136
(60) Posthumus, M.; Kistemaker, P.; Meuzelaar, H.; Ten Noever de Brauw, M. Anal Chem 1978, 50, 985-991. (61) Coates, M.; Wilkins, C. Biomed Mass Spectrom 1985, 12, 424-428. (62) Tanaka, K.; Waki, H.; Ido, Y.; Akita, S.; Yoshida, Y.; Yoshida, T. Rapid Commun Mass Spectrom 1988, 2, 151-153. (63) Karas, M.; Hillenkamp, F. Anal Chem 1988, 60, 2299-2301. (64) Tanaka, K.; Ido, Y.; Akita, S.; Yoshida, Y.; Yoshida, T. Proceedings of the second Japan-China joint symposium on mass spectrometry 1987, 185-188. (65) Dale, M.; Knochenmus, R.; Zenobi, R. Anal Chem 1996, 68, 3321-3329. (66) Dale, M.; Knochenmuss, R.; Zenobi, R. Rapid Commun Mass Spectrom 1997, 11, 136- 142. (67) Kraft, P.; Alimpiev, S.; Dratz, E.; Sunner, J. J Am Soc Mass Spectrom 1998, 9, 912-924. (68) Schurenberg, M.; Dreisewerd, K.; Hillenkamp, F. Anal Chem 1999, 71, 221-229. (69) Dietemann, P.; Edelmann, M.; Meisterhans, C.; Pfeiffer, C.; Zumbuhl, S.; Knochenmuss, R.; Zenobi, R. Helvetica Chim Acta 2000, 83, 1766-1776. (70) Karas, M.; Bachmann, D.; Hillenkamp, F. Anal Chem 1985, 57, 2935-2939. (71) Karas, M.; Bachmann, D.; Bahr, U.; Hillenkamp, F. Int J Mass Spectrom Ion Processes 1987, 78, 53-68. (72) Dreisewerd, K. Chem Rev 2003, 103, 395-425. (73) Jagtap, R.; Ambre, A. Bull Mater Sci 2005, 28, 515-528. (74) Karas, M.; Bahr, U.; Stahl-Zeng, J. In Large ions: Their vaporization, detection and structural analysis; Baer, T., Ng, C., Powis, I., Eds.; Wiley: New York, 1996, pp 27-48. (75) Limbach, P. Spectroscopy 1998, 13, 16-27. (76) Beavis, R.; Chaudhary, T.; Chait, B. Org Mass Spectrom 1992, 27, 156-158. (77) Kussmann, M.; Nordhoff, E.; Rahbek-Nielsen, H.; Haebel, S.; Rossel-Larsen, M.; Jakobsen, L.; Gobom, J.; Mirgorodskaya, E.; Kroll-Kristensen, A.; Palm, L.; Roepstorff, P. J Mass Spectrom 1997, 32, 593-601. (78) Nordhoff, E.; Schürenberg, M.; Thiele, G.; Lübbert, C.; Kloeppel, K.-D.; Theiss, D.; Lehrach, H.; Gobom, J. Int J Mass Spectrom 2003, 226, 163-180. (79) Stahl, B.; Steup, M.; Karas, M.; Hillenkamp, F. Anal Chem 1991, 63, 1463-1466. (80) Dai, Y.; Whittal, R.; Li, L.; Weinberger, S. Rapid Commun Mass Spectrom 1996, 10, 1792-1796. (81) Zheng, J.; Li, N.; Ridyard, M.; Dai, H.; Robbins, S.; Li, L. J Proteome Res 2005, 4, 1709- 1716. (82) Xiang, F.; Beavis, R. Rapid Commun Mass Spectrom 1994, 8, 199-204. (83) Vorm, O.; Roepstorff, P.; Mann, M. Anal Chem 1994, 66, 3281-3287. (84) Dai, Y.; Whittal, R.; Li, L. Anal Chem 1999, 71, 1087-1091. (85) Li, L.; Golding, R.; Whittal, R. J Am Chem Soc 1996, 118, 11662-11663. (86) Zhao, S.; Somayajula, K.; Sharkey, A.; Hercules, D.; Hillenkamp, F.; Karas, M.; Ingendoh, A. Anal Chem 1991, 63, 450-453. (87) Sunner, J.; Dratz, E.; Chen, Y. Anal Chem 1995, 67, 4335-4342. (88) Sze, E.; Chan, T.-W.; Wang, G. J Am Soc Mass Spectrom 1998, 9, 166-174. (89) Wei, J.; Buriak, J.; Siuzdak, G. Nature 1999, 399, 243-246. (90) Skelton, R.; Dubois, F.; Zenobi, R. Anal Chem 2000, 72, 1707-1710. (91) Strupat, K.; Karas, M.; Hillenkamp, F. Int J Mass Spectrom Ion Processes 1991, 11, 89- 102.
137
(92) Beavis, R.; Chait, B. Rapid Commun Mass Spectrom 1989, 3, 432-435. (93) Beavis, R.; Chait, B. Proc Natl Acad Sci USA 1990, 87, 6873-6877. (94) Vermillion-Salsbury, R.; Hercules, D. Rapid Commun Mass Spectrom 2002, 16, 1575- 1581. (95) Beavis, R. Org Mass Spectrom 1992, 27, 653-659. (96) Parr, G.; Fitzgerald, M.; Smith, L. Rapid Commun Mass Spectrom 1992, 6, 369-372. (97) Tang, K.; Allman, S.; Chen, C. Rapid Commun Mass Spectrom 1993, 7, 943-948. (98) Wu, K.; Steding, A.; Becker, C. Rapid Commun Mass Spectrom 1993, 7, 142-146. (99) Tang, K.; Taranenko, N.; Allman, S.; Chang, L.; Chen, C. Rapid Commun Mass Spectrom 1994, 8, 727-730. (100) Lecchi, P.; Le, H.; Pannell, L. Nucleic Acids Res 1995, 23, 1276-1277. (101) Pieles, U.; Zürcher, W.; Schär, M.; Moser, H. Nucleic Acids Res 1993, 21, 3191-3196. (102) Lavanant, H.; Lange, C. Rapid Commun Mass Spectrom 2002, 16, 1928-1933. (103) Zhu, Y.; Chung, C.; Taranenko, N.; Allman, S.; Martin, S.; Haff, L.; Chen, C. Rapid Commun Mass Spectrom 1996, 10, 383-388. (104) Zhu, Y.; Tarnenko, N.; Allman, S.; Martin, S.; Haff, L.; Chen, C. Rapid Commun Mass Spectrom 1996, 10, 1591-1596. (105) Mohr, M.; Bornsen, K.; Widmer, H. Rapid Commun Mass Spectrom 1995, 9, 809-814. (106) Karas, M.; Ehring, H.; Nordhoff, E.; Stahl, B.; Strupat, K.; Hillenkamp, F.; Grehl, M.; Krebs, B. Org Mass Spectrom 1993, 28, 1476-1481. (107) Papac, D.; Wong, A.; Jones, A. Anal Chem 1996, 68, 3215-3223. (108) Harvey, D. Int J Mass Spectrom 2003, 226, 1-35. (109) Xu, N.; Huang, Z.-H.; Watson, J.; Gage, D. J Am Soc Mass Spectrom 1997, 8, 116-124. (110) Schiller, J.; Zschörnig, O.; Petkovi, M.; Müller, M.; Arnhold, J.; K, A. J Lipid Res 2001, 42, 1501-1508. (111) Benard, A.; Arnhold, J.; Lehnert, M.; Schiller, J.; Arnold, K. Chem Phys Lipids 1999, 100, 115-125. (112) Petkovic, M.; Schiller, J.; Muller, M.; Benard, S.; Reichl, S.; Arnold, K.; Arnhold, J. Anal Biochem 2001, 289, 202-216. (113) Schiller, J.; Süb, R.; Arnhold, J.; Fuchs, B.; Leßig, J.; Müller, M.; Petković, M.; Spalteholz; Zschörnig, O.; Arnold, K. Prog Lipid Res 2004, 43, 449-488. (114) Zabrouskov, V.; Al-Saad, K.; Siems, W.; Hill, H.; Knowles, N. Rapid Commun Mass Spectrom 2001, 15, 935-940. (115) Müller, M.; Schiller, J.; Petkovi, M.; Oehrl, W.; Heinze, R.; Wetzker, R.; Arnold, K.; J, A. Chem Phys Lipids 2001, 110, 151-164. (116) Al-Saad, K.; Siems, W.; Hill, H.; Zabrouskov, V.; Knowles, N. J Am Soc Mass Spectrom 2003, 14, 373-382. (117) Petkovi, M.; Schiller, J.; Müller, J.; Müller, M.; Arnold, K.; J;, A. Analyst 2001, 126, 1042-1050. (118) Schiller, J.; Arnhold, J.; Glander, H.; Arnold, K. Chem Phys Lipids 2000, 106, 1450156. (119) Harvey, D. J Mass Spectrom 1995, 30, 1311-1324. (120) Macha, S.; Limbach, P. Curr Opin Solid State Mater Sci 2002, 6, 213-220. (121) Danis, P.; Karr, D.; Xiong, Y.; Owens, K. Rapid Commun Mass Spectrom 1996, 10, 862- 868. (122) Trimpin, S.; Rouhanjpour, A.; Az, R.; Rader, H.; Mullen, K. Rapid Commun Mass Spectrom 2001, 15, 1364-1373.
138
(123) Lewis, W.; Shen, Z.; Finn, M.; Siuzdak, G. Int J Mass Spectrom 2003, 226, 107-116. (124) Carda-Broch, S.; Berthod, A.; Armstrong, D. Rapid Commun Mass Spectrom 2003, 17, 553-560. (125) Zabet-Moghaddam, M.; Heinzle, E.; Lasaosa, M.; Tholey, A. Anal Bioanal Chem 2006, 384, 215-224. (126) Jones, J.; Batoy, S.; Wilkins, C.; Liyanage, R.; Lay Jr., J. J Am Soc Mass Spectrom 2005, 16, 2000-2008. (127) Mank, M.; Stahl, B.; Boehm, G. Anal Chem 2004, 76, 2938-2950. (128) Bungert, D.; Bastian, S.; Heckmann-Pohl, D.; Giffhorn, F.; Heinzle, E.; Tholey, A. Biotechnol Letters 2004, 26, 1025-1030. (129) Zabet-Moghaddam, M.; Krüger, R.; Heinzle, E.; Tholey, A. J Mass Spectrom 2004, 39, 1494-1505. (130) Ham, B.; Jacob, J.; Cole, R. Anal Chem 2005, 77, 4439-4447]. (131) Xu, S.; Li, Y.; Zou, H.; Qiu, J.; Gau, Z.; Guo, B. Anal Chem 2003, 75, 6191-6195. (132) Ren, S.; Guo, Y. J Am Soc Mass Spectrom 2006, 17, 1023-1027. (133) Norris, J.; Porter, N.; Caprioli, R. Anal Chem 2005, 77, 5036-5040. (134) Cherayil, J. D. Transfer RNAs and other soluble RNAs.; CRC Press: Boston, 1990. (135) Sprinzl, M.; Vassilenko, K. S. Nucleic Acids Res. 2005, 33, D139-D140. (136) Rozenski, J.; Crain, P. F.; McCloskey, J. A. Nucleic Acids Res. 1999, 27, 196-197. (137) Hossain, M.; Limbach, P. RNA 2007, 13, 295-303. (138) Kirpekar, F.; Douthwaite, S.; Rosepstorff, P. RNA 2000, 6, 296-306. (139) Nordhoff, E.; Kirpekar, F.; Roepstroff, P. Mass Spectrom. Rev. 1996, 15, 69-138. (140) Knochenmuss, R. Anal Chem 2003, 75, 2199-2207. (141) Dong, H.; Nilsson, L.; Kurland, C. G. J. Mol. Biol. 1996, 260, 649-663. (142) Ikemura, T. J. Mol. Biol. 1981, 146, 1-21. (143) Ikemura, T.; Ozeki, H. Cold Spring Harbor Symp. Quant. Biol. 1983, 47, 1087-1097. (144) Ikemura, T. In Population Genetics and Molecular Evolution; Aoki, T. O. a. K., Ed.; Japan Sci. Soc. Press: Tokyo, 1985. (145) Conrads, T.; Anderson, G.; Veenstra, T.; Pasa-Tolic, L.; Smith, R. Anal. Chem. 2000, 72, 3349-3354. (146) Guymon, R.; Pomerantz, S.; Ison, J.; Crain, P.; McCloskey, J. RNA 2007, 13, 396-403. (147) Timchenko, A.; Langowski, J.; Serdyuk, I. Bioplymers 1993, 33, 1747-1755. (148) Spirin, A. J. Mol. Biol. 1960, 2, 436-446. (149) Hartmann, R.; Binderief, A.; Schon, A.; Westhof, E., Eds. Handbook of RNA biochemistry.; Wiley-VCH: KGaA, Weinheim, 2005. (150) Komine, Y.; Adachi, T.; Inokuchi, H.; Ozeki, H. J. Mol. Biol. 1990, 212, 579-598. (151) Dittmar, K.; Sorensen, M.; Elf, J.; Ehrenberg, M.; Pan, T. EMBO Rep. 2005, 6, 151-157. (152) Meng, Z.; Limbach, P. Anal. Chem. 2005, 77, 1891-1895. (153) Emilsson, V.; Kurland, C. EMBO J. 1990, 9, 4359-4366. (154) Emilsson, V.; Naslund, A.; Kurland, C. J. Mol. Biol. 1993, 230, 483-491. (155) Miyagi, M.; KCS, R. Mass Spectrom. Rev. 2006, 26, 121-136. (156) McCloskey, J.; Rozenski, J. Nucleic Acids Res. 2005, 33, D135-D138. (157) Sacchi, C.; Witnez, A.; Mayer, L.; Morey, R.; Steigerwalt, A.; Boras, A.; Weyant, R.; Popovic, T. Emer. Infec. Dis. 2002, 8, 1117-1123. (158) Entelis, N.; Kolesnikova, O.; Martin, R.; Tarassov, I. Adv. Drug Deliv. Rev. 2001, 49, 199-215.
139
(159) Schneider, A. Trends Cell Biol. 1994, 4, 282-286. (160) Rinehart, J.; Krett, B.; Rubio, M.; Alfonzo, J.; Soll, D. Genes & Dev. 2005, 19, 583-592. (161) Martin, R.; Schneller, J.; Stahl, A.; Dirheimer, G. Biochemistry 1979, 18, 4600-4605. (162) Sarmientos, P.; Cashel, M. Proc. Natl. Acad. Sci. USA 1983, 80, 7010-7013. (163) Schlitt, S.; Russell, P. J. Bacteriol. 1974, 120, 666-671. (164) Kramer, J.; Singleton, F. Appl. Environ. Microbiol. 1992, 45, 1685-1690. (165) Farrell, R. RNA methodologies: a laboratory guide for isolation and characterization.; Elsevier/Academic Press: Amsterdam/Boston, 2005.
140