UvA-DARE (Digital Academic Repository)
Development of auto-antibodies towards ß2-glycoprotein I in the antiphospholipid syndrome van Os, G.M.A.
Publication date 2011 Document Version Final published version
Link to publication
Citation for published version (APA): van Os, G. M. A. (2011). Development of auto-antibodies towards ß2-glycoprotein I in the antiphospholipid syndrome.
General rights It is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), other than for strictly personal, individual use, unless the work is under an open content license (like Creative Commons).
Disclaimer/Complaints regulations If you believe that digital publication of certain material infringes any of your rights or (privacy) interests, please let the Library know, stating your reasons. In case of a legitimate complaint, the Library will make the material inaccessible and/or remove it from the website. Please Ask the Library: https://uba.uva.nl/en/contact, or a letter to: Library of the University of Amsterdam, Secretariat, Singel 425, 1012 WP Amsterdam, The Netherlands. You will be contacted as soon as possible.
UvA-DARE is a service provided by the library of the University of Amsterdam (https://dare.uva.nl)
Download date:27 Sep 2021 Development of auto-antibodies towards β2-Glycoprotein I in the antiphospholipid syndrome
Gwen M.A. van Os Development of auto-antibodies towards β2-Glycoprotein I in the antiphospholipid syndrome Dissertation, University of Amsterdam, Amsterdam, The Netherlands
Author: G.M.A. van Os Printing: Wöhrman Print Service ISBN: 978-90-8570-764-6
Copyright © 2011, G.M.A. van Os, Amsterdam, The Netherlands All rights reserved. No part of this publication may be reproduced or transmitted in any form by any means, without permission of the author.
Financial support by the Netherlands Heart foundation & the Academic Medical Center for the publication of this thesis is greatfully acknowlodged.
Additional financial support for the printing of this thesis was provided by: Instrumentation laboratory, Novo Nordisc and the NVLE. Development of auto-antibodies towards β2-Glycoprotein I in the antiphospholipid syndrome
ACADEMISCH PROEFSCHRIFT
ter verkrijging van de graad van doctor aan de Universiteit van Amsterdam op gezag van de Rector Magnificus prof.dr. D.C. van den Boom ten overstaan van een door het college voor promoties ingestelde commissie, in het openbaar te verdedigen in de Aula der Universiteit op vrijdag 2 december 2011, te 13.00 uur
door
Gwendolyn Margaretha Adriana van Os geboren te Arnhem gwen m.a. van os Promotiecommissie:
Promotores: Prof. dr. J.C.M. Meijers
Prof. dr. Ph.G. de Groot
Overige leden: Prof. dr. S. Middeldorp
Prof. dr. H. Pannekoek
Prof. dr. T. van der Poll
Prof. dr. P.H. Reitsma
Prof. dr. C.J.M. de Vries
Faculteit der Geneeskunde gwen m.a. van os contents
chapter 1 9 Current insights into laboratory diagnosis and pathophysiology of the antiphospholipid syndrome and aim of this thesis chapter 2 19
β2-Glycoprotein I can exist in two conformations: implications for antigen recognition in the antiphospholipid syndrome chapter 3 41
Induction of auto-antibodies against β2-Glycoprotein I in mice by protein H of Streptococcus pyogenes chapter 4 63
β2-glycoprotein I has a protective function in situations of hyper-responsive von Willebrand Factor: Implications for TTP chapter 5 83
Two different populations of domain I anti-β2GPI antibodies; one inhibits and one stimulates in vitro thrombin generation chapter 6 97 Detection of lupus anticoagulant in the presence of rivaroxaban by Taipan snake venom time chapter 7 105
Auto-antibodies against β2 GPI: Etiology and mechanism of action
appendices 121
Nederlandse samenvatting voor niet-ingewijden 123
List of publications 128
Dankwoord 131
Chapter 1
Current insights into laboratory diagnosis and pathophysiology of the antiphospholipid syndrome
Gwen M.A. van Os, Rolf T. Urbanus, Çetin Ağar, Joost C.M. Meijers, Philip G. de Groot
Hamostaseologie. 2010; 30 (3): 139-143 gwen m.a. van os
10 Introduction
The antiphospholipid syndrome (APS) is a non-inflammatory autoimmune disease characterized by the presence of antiphospholipid antibodies (aPL) in the plasma of patients with venous and/or arterial thrombosis and/or recurrent complications of pregnancy1,2. The presence of aPL in plasma of patients can be detected by either a prolongation of phospholipid dependent coagulation test (lupus anticoagulant, LAC), or by solid phase
immune assays against the protein β2-glycoprotein I (β2GPI) or the phospholipid cardiolipin 3 (anti-β2GPI antibody ELISA and anti-cardiolipin antibody ELISA, respectively) . For a long time there was a lot of confusion on who had the syndrome and who not. To solve this dispute, an international consensus meeting was organized in Sapporo in 1999 to formulate classification criteria for patients with the antiphospholipid 4syndrome . These criteria have been updated in 2004 at another international consensus meeting in Sydney5. The classification criteria were defined for scientific purposes and were aimed to be used as inclusion criteria in patient related studies. They were not defined for diagnostic purposes. The actual practice is that these criteria are now used as a diagnostic tool. This is very unfortunate because the specificity of the different aPL assays to detect the clinical manifestations that characterize APS are disputable and one of the aims of defining the criteria was the validation as biomarker of the different assays used to detect the presence of thrombosis and pregnancy morbidity. The progress made recently on this important topic will be discussed in the next chapter.
Laboratory diagnostics
APS is an exceptional syndrome because the clinical symptoms such as thrombosis occur relatively often but are in most cases not due to the presence of antiphospholipid antibodies. As a consequence, the detection of the presence of aPL in plasma of a patient with thrombosis or complications of pregnancy is the essential step to define the syndrome. aPL is a generic term that describes a collection of closely related but not identical antibodies: 6 LAC activity, anti-cardiolipin antibodies (aCL) or anti-β2GPI antibodies . The fact that the three assays do not measure the same population of antibodies immediately raises two fundamental questions: what are the differences between the different types of antibodies detected with the three assays and which of these three assays is the most relevant one. Meta analyses, case-control cohort studies and prospective studies on the predictive value of the different types of aPL have shown that the antibodies that induce LAC activity correlate by far the best with a history of thrombo-embolic complications7-10. Apparently, an assay that measures a functional activity, inhibition of a clotting reaction, better predicts a thrombotic risk than assays that measure the presence of a heterogeneous population of auto-antibodies that comprise both those that influence a functional activity and those that do not. Another possible reason why the ELISAs developed to detect the presence of pathophysiology of the antiphospholipid syndrome
anti-cardiolipin or anti-β2GPI antibodies perform so badly in these association studies 11 is that they are poorly standardized11-13. A plasma sample that scored positive in one 1 laboratory can score negative in another. Even between laboratories with extensive experience in the detection of aPL antibodies, discordant findings with samples with low titre antibodies are more a rule than an exception. Reliable detection of low titre chapter aCL and anti-β2GPI antibodies is not possible until now. Based on these observations, a number of researchers including one of us, expressed serious doubts whether the aCL ELISA, as it is performed today with the available commercial kits, is specific enough to detect the antiphospholipid syndrome14.
From 1990 on it is known that a subpopulation of aCL is directed against β2GPI and there are many indications that the anti-β2GPI antibodies are in fact the pathological antibodies. However, anti-β2GPI antibodies are also a heterogeneous group of antibodies. Antibodies were found directed against all five domains of the protein. A number of studies from different laboratories have suggested that antibodies directed against an epitope around amino acids Arg39 and Arg43 within domain I of β2GPI correlates best with the observed clinical manifestation of APS15-17. Moreover, addition of isolated domain I to plasma of mice inhibits thrombus formation in a murine model of the antiphospholipid syndrome18. Apparently, antibodies directed against domain
I of β2GPI are more relevant antibodies to measure than antibodies against whole
β2GPI, although we cannot exclude that besides antibodies against domain I other pathological subpopulations of auto-antibodies circulate in blood of APS patients.
From the studies published so far it is evident that LAC is the assay of choice to measure clinically relevant aPL. However, patients that are not only positive for
LAC but also positive for anti-β2GPI antibodies have a higher risk for recurrent thrombosis than patients positive in only one assay19. This is not really a surprise because LAC can not only be caused by antibodies directed against β2GPI but also by antibodies against prothrombin20. There is consensus that the anti-prothrombin antibodies are passive bystanders in the syndrome5, however, not everybody agrees 21 on this point . Nevertheless, the combination LAC and anti-β2GPI antibodies identify those anti-β2GPI antibodies that are able to induce LAC, a subpopulation of aPL that is thought to be responsible for the pathophysiology of APS. In the next paragraph we will discuss how these antibodies could induce a deregulation of the hemostatic balance.
Pathophysiology
Initially it was thought that aPL were directed against anionic phospholipids. We now know that the antibodies are directed against the glycoprotein β2GPI bound to anionic gwen m.a. van os
22,23 12 surfaces . β2GPI is a plasma protein with no obvious function and persons or mice lacking this protein seem to be completely healthy24,25. However, animal studies
have produced ample evidence that the presence of anti-β2GPI antibodies increased thrombus formation after the introduction of a vascular injury26,27. Also, the presence 28 of anti-β2GPI antibodies results in pregnancy loss in a mice model . Clearly, the
antibodies are gain-of-function antibodies that induce an additional function in β2GPI
that is responsible for the increased thrombotic risk. β2GPI seems to be the playmaker of the antiphospholipid syndrome.
29 β2GPI is a glycoprotein with a molecular weight of approximately 45 kDa . It is present in high concentration in plasma (about 200 mg/mL, 3 mM). Although
mRNA of β2GPI has been found in endothelial cells, astrocytes, neurons and in the extravillous cytotrophoblast and syncytiotrophoblast of the placenta, its major site of 30 synthesis is the liver . Originally it was thought that a part of β2GPI in the circulation
was associated with lipoproteins and, as a consequence, β2GPI is also known under the pseudonym apolipoprotein H. Recent evidence, however, showed that the term
apolipoprotein H is a misnomer and that β2GPI is not associated with lipoprotein 31 fractions . β2GPI consists of 5 short consensus repeats or sushi domains, domains that are present in many proteins that function in the complement system. The structure of these conserved domains revealed a common globular fold stabilised by two disulfide bridges. The fifth domain is an exception as it has a 6 amino acid residues insertion and a 19 residue C-terminal extension and a third disulphide bridge which includes a cysteine present at the C-terminal end of the protein. The extra amino acids are responsible for the formation of a large positive patch within domain V that forms the binding site for anionic phospholipids. In the middle of this positive loop there is a flexible hydrophobic loop with a classic Trp-Lys motive, often observed in proteins at the site of insertion into cellular membranes32.
LAC and anti-β2GPI antibodies are exceptional biomarkers for thrombotic complications because they are correlated with an increased risk for both venous- and arterial thrombosis1-3. In general, risk markers related to coagulation factors result in venous thrombosis while risk markers related to platelets correlate with arterial thrombosis. We cannot exclude that the risk for arterial thrombosis and the risk of venous thrombosis
are the consequence of two separate actions of the β2GPI/antibody complexes.
However, the observations that β2GPI after interaction with its auto-antibodies can bind and activate different cells, have strongly fueled the idea that the cause of the observed thrombotic and pregnancy complications is the deregulation of different cells involved in the maintenance of the hemostatic balance33.
The antibody/β2GPI complex has been reported to bind to several cell types, amongst others endothelial cells, monocytes and platelets, all of which play an important pathophysiology of the antiphospholipid syndrome
role in hemostasis. The list of potential binding sites on cells for the β2GPI/antibody 13 complex is ever increasing and includes annexin A2, LRP8 (low density lipoprotein 1 receptor protein 8 = apolipoprotein E receptor 2’), glycoprotein Ibα (GPIbα), low density lipoprotein receptor related protein (LRP), megalin, toll-like receptor 2
(TLR2), toll-like receptor 4 (TLR4), the very low density lipoprotein (VLDL) receptor chapter and PSGL-1 (for an overview see reference 2). Most of these receptors are expressed on a number of cell types at various levels in different combinations. The role of these receptors in the activation of different cell types has been studied by several groups with conflicting results. Based on in-vivo experiments with a mouse model for APS, all these receptors seems to be involved in the anti-β2GPI antibody-induced thrombotic complications34-37, which seems very unlikely. Our group has identified
LRP8 (ApoER2’) as the signaling receptor for anti-β2GPI antibody/β2GPI complexes on platelets and endothelial cells, both in in-vitro studies and in-vivo studies38. Moreover, we have shown that thrombus formation in a mouse model of APS can be inhibited with a recombinant fragment of LRP8 and thrombus formation was strongly reduced when anti-β2GPI antibodies were injected in LRP8 null mice (submitted). Additionally, we have shown that β2GPI/anti-β2GPI antibody complexes can bind with high affinity to purified LRP839. Altogether we propose that LRP8 is an important player in the pathophysiology of APS but we cannot exclude a role of other receptors for β2GPI.
Future directions
No physician or researcher can state that our current knowledge of APS is adequate enough for proper diagnosis and treatment. There are a number of important questions begging for an answer. The knowledge on APS that we have gathered till now strongly suggests that the secret of APS is hidden in the remarkable molecular and cell biology of the protein β2GPI. We need to know what the critical elements are in the recognition of β2GPI by the anti-β2GPI antibodies. Is domain I the only relevant epitope? Why is β2GPI only recognized when it is bound to an anionic surface? What is the physiological function of this abundantly present plasma protein? Why do we so often find auto-antibodies against this specific plasma protein? Is β2GPI the only playmaker of the syndrome or are there also other plasma proteins and auto-antibodies involved? We have to identify the receptors on the cells responsible for antibody/β2GPI complex interaction, and answer the question which cell (platelets, endothelial cells, trophoblasts, monocytes, or others) is the major target for the complexes. Besides thrombosis and fetal loss, many patients suffer from additional clinical manifestations also observed in other microangiopathies, such as thrombocytopenia and hemolysis. Is there a connection? The list of questions is large. We need to answer these questions in the laboratory and confirm the answers in large patient-related studies.
gwen m.a. van os
14 AIM OF THIS THESIS
There are major indiscrepancies in our understanding of the antiphospholipid syndrome (APS). This autoimmune disease is diagnosed when a patient suffers from thrombosis or pregnancy morbidity and has persistent circulating antiphospholipid antibodies. Despite its name the antibodies are not directed towards phospholipids rather to phospholipid binding proteins. The antiphospholipid antibodies are a heterogeneous group and have many antigens. In the early nineties the dominant
antigen was identified as β2GPI. Despite this major breakthrough the understanding and treatment of APS did not alter.
This thesis aims to gain a better understanding of the etiology and function of
antibodies towards β2GPI. To achieve this first the different conformations of β2GPI was studied (Chapter 2). The observed conformational switch provided insight in a
mechanism for which anti-β2GPI antibodies arise. In chapter 3 we study etiology of
the autoantibodies towards β2GPI. Furthermore, the apparent paradox of patients with the antiphospholipid syndrome who have a prolonged coagulation time although they are at higher risk for thrombotic complications was examined in chapter 4. For
chapter 5 we did not study the anti-β2GPI antibodies in disease but β2GPI itself and its role in thrombotic thrombocytopenic purpura. Last the effect of new medication on
plasmas positive for anti-β2GPI antibodies was studied (Chapter 6). In chapter 7 the implications of the findings described in this thesis are connected and discussed in a broader context. pathophysiology of the antiphospholipid syndrome
References 15 1
1. Arnout J, Vermylen J. Current status and implications of autoimmune antiphospholipid antibodies in relation to thrombotic disease. J Thromb Haemost. 2003; 1: 931-42 2. Urbanus R, Derksen R, de Groot P. Current insight into diagnostics and pathophysiology of the antiphospolipid syndrome. Blood Rev. 2008; 22: 93-105 chapter 3 Giannakopoulos B, Passam F, Ioannou Y, Krilis S. How we diagnose the antiphospholipid syndrome. Blood. 2009; 113: 985-994 4. Wilson W, Gharavi A, Koike T et al. International consensus statement on preliminary classification criteria for definite antiphospholipid syndrome: report of an international workshop. Arthritis Rheum. 1999; 42: 1309-1311 5. Miyakis S, Lockshin M, Atsumi T et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost. 2006; 4: 295-306 6. Galli M, Luciani D, Bertolini G, Barbui T. Lupus anticoagulants are stronger risk factors for thrombosis than anticardiolipin antibodies in the antiphospholipid syndrome: a systematic review of the literature. Blood. 2003; 101: 1827-1832 7. Wahl D, Guillemin F, de Maistre E, Perret-Guillaume C, Lecompte T, Thibaut G. Meta-analysis of the risk of venous thrombosis in individuals with antiphospholipid antibodies without underlying autoimmune disease or previous thrombosis. Lupus. 1998; 7: 15-22 8. Kearon C, Gent M, Hirsh J et al. A comparison of three months of anticoagulation with extended anticoagulation for a first episode of idiopathic venous thromboembolism. N Engl J Med. 1999; 25: 901-907 9. Ginsberg J, Wells P, Brill-Edwards P, Donovan D, Moffatt K, Johnston M, Stevens P, Hirsh J. Antiphospholipid antibodies and venous thromboembolism. Blood. 1995; 86: 3685-3691 10. Urbanus R, Siegerink B, Roest M, Rosendaal F, de Groot P, Algra A. Antiphospholipid antibodies and risk of myocardial infarction and ischaemic stroke in young women in the RATIO study: a case-control study. Lancet Neurol. 2009; 8: 998-1005 11. Reber G, Boehlen F, de Moerloose P Technical aspects in laboratory testing for antiphospholipid antibodies: is standardization an impossible dream? Semin Thromb Hemost. 2008; 34: 340-346 12. Reber G, Arvieux J, Comby E et al. Multicenter evaluation of nine commercial kits for the quantitation of anticardiolipin antibodies. The Working Group on Methodologies in Haemostasis from the GEHT (Groupe d’Etudes sur l’Hemostase et la Thrombose). Thromb Haemost. 1995; 73: 444-452 13. Jennings I, Greaves M, Mackie I, Kitchen S, Woods T, Preston F. Lupus anticoagulant testing: improvements in performance in a UK NEQAS proficiency testing exercise after dissemination of national guidelines on laboratory methods. Br J Haematol. 2002; 119: 364-369 14. Galli M, Reber G, de Moerloose P, de Groot P. Invitation to a debate on the serological criteria that define the antiphospholipid syndrome. J Thromb Haemostas. 2008; 6: 399-401 15. Iverson G, Reddel S, Victoria E, Cockerill K, Wang Y, Marti-Renom M, Sali A, Marquis D, Krilis S, Linnik M. Use of single point mutations in domain I of beta 2-glycoprotein I to determine fine antigenic specificity of antiphospholipid autoantibodies. J Immunol. 2002; 169: 7097-7103 16. De Laat B, Derksen R, Urbanus R, de Groot P. IgG antibodies that recognize epitope Gly40-Arg43 in domain I of {beta}2-glycoprotein I cause LAC and their presence correlates strongly with thrombosis. Blood. 2005; 105: 1540-1545 17. Ioannou Y, Pericleous C, Giles I, Latchman D, Isenberg D, Rahman A. Binding of antiphospholipid antibodies to discontinuous epitopes on domain I of human beta(2)-glycoprotein I: mutation studies including residues R39 to R43. Arthritis Rheum. 2007; 56: 280-290 18. Ioannou Y, Romay-Penabad Z, Pericleous C et al. In vivo inhibition of antiphospholipid antibody-induced pathogenicity utilizing the antigenic target peptide domain I of beta2-glycoprotein I: proof of concept. J Thromb Haemost. 2009; 7: 833-842 19. Pengo V, Ruffatti A, Legnani C et al. Clinical course of high risk patients diagnosed with Antiphospholipid Syndrome (APS). J Thromb Haemost. 2009; 8: 237-242 gwen m.a. van os
20. Simmelink M, Derksen R, Arnout J, de Groot P. A simple method to discriminate between ß2-glycoprotein I – and 16 prothrombin-dependent lupus anticoagulants. J Thromb Haemostas. 2003; 1: 740-747 21. Oku K, Atsumi T, Amengual O, Koike T. Antiprothrombin antibody testing: detection and clinical utility. Semin Thromb Hemost. 2008; 34: 335-339 22. McNeil H, Simpson R, Chesterman C, Krilis S. Anti-phospholipid antibodies are directed against a complex
antigen that includes a lipid-binding inhibitor of coagulation: ß2glycoprotein I. Proc Natl Acad Sci USA. 1990; 87: 4120-4124 23. Galli M, Comfurius P, Maassen C et al. Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma cofactor. Lancet. 1990; 335: 1544-1547 24. Hoeg J, Segal P, Gregg R et al. Characterization of plasma lipids and lipoproteins in patients with beta 2-glycoprotein I (apolipoprotein H) deficiency. The fasting plasma lipids, lipoproteins, and apolipoproteins were evaluated in 5 subjects. Atherosclerosis. 1985; 55: 25-34 25. Sheng Y, Reddel S, Herzog H, Wang Y, Brighton T, France M, Robertson S, Krilis S. Impaired thrombin generation in beta 2-glycoprotein I null mice. J Biol Chem. 2001; 276: 13817-13821 26. Jankowski M, Vreys I, Wittevrongel C, Boon D, Vermylen J, Hoylaerts M, Arnout J. Thrombogenicity of beta 2-glycoprotein I-dependent antiphospholipid antibodies in a photochemically induced thrombosis model in the hamster. Blood. 2003; 101: 157-162. 27. Shoenfeld Y, Blank M, Sherer Y. Induction and treatment of the antiphospholipid syndrome--lessons from animal models. Eur J Clin Invest. 2001;31: 736-740 28. Girardi G, Redecha P, Salmon J. Heparin prevents antiphospholipid antibody-induced fetal loss by inhibiting complement activation. Nat Med. 2004; 10: 1222-1226 29. Lozier J, Takahashi N, Putnam F. Complete amino acid sequence of human plasma beta 2-glycoprotein I. Proc Natl Acad Sci U S A. 1984; 81: 3640-3644 30. Ragusa M, Costa S, Cefalù A, Noto D, Fayer F, Travali S, Averna M, Gianguzza F. RT-PCR and in situ hybridization analysis of apolipoprotein H expression in rat normal tissues. Int J Mol Med. 2006; 18: 449-455 31. Ağar C, de Groot P, Levels J, Marquart J, Meijers J. Beta-Glycoprotein I is incorrectly named apolipoprotein H. J Thromb Haemostas. 2009; 7: 235-236 32. Bouma B, de Groot P, van der Elsen J, Ravelli R, Schouten A, Simmelink M, Derksen R, Kroon J, Gros P.
Adhesion mechanism of human ß2-glycoprotein I to phospholipids based on its crystal structure. EMBO J. 1999; 18: 5166-5174 33. Palomo I, Segovia F, Ortega C, Pierangeli S. Antiphospholipid syndrome: a comprehensive review of a complex and multisystemic disease. Clin Exp Rheumatol. 2009; 27: 668-677 34. Satta N, Dunoyer-Geindre S, Reber G, Fish R, Boehlen F, Kruithof E, de Moerloose P. The role of TLR2 in the inflammatory activation of mouse fibroblasts by human antiphospholipid antibodies. Blood. 2007;109: 1507-1514 35. Pierangeli S, Vega-Ostertag M, Raschi E et al. Toll-like receptor and antiphospholipid mediated thrombosis: in vivo studies. Ann Rheum Dis. 2007; 66: 1327-1333 36. Romay-Penabad Z, Liu X, Montiel-Manzano G, Papalardo De Martínez E, Pierangeli S. C5a receptor-defi- cient mice are protected from thrombophilia and endothelial cell activation induced by some antiphospholipid antibodies. Ann N Y Acad Sci. 2007; 1108: 554-566 37. Romay-Penabad Z, Montiel-Manzano M, Shilagard T et al. Annexin A2 is involved in antiphospholipid anti- body-mediated pathogenic effects in vitro and in vivo. Blood. 2009; 114: 3074-3083.
38. Lutters B, Derksen R, Tekelenburg W, Lenting P, Arnout J, de Groot P. Dimers of ß2-glycoprotein I increase platelet deposition to collagen via interaction with phospholipids and the apolipoprotein E receptor 2’. J Biol Chem. 2003; 278: 33831-33838 39. Pennings M, Derksen R, Urbanus R, Tekelenburg W, Hemrika W, de Groot P. Platelets express three different splice variants of ApoER2 that are all involved in signaling. J Thromb Haemostas. 2007; 5: 1538-1544 pathophysiology of the antiphospholipid syndrome
17 1
chapter
Chapter 2
β2-Glycoprotein I can exist in two conformations: implications for antigen recognition in the antiphospholipid syndrome
Gwen M.A. van Os, Çetin Ağar, Matthias Mörgelin, Richard R. Sprenger, J. Arnoud Marquart, Rolf T. Urbanus, Ronald H.W.M. Derksen, Joost C.M. Meijers, Philip G. de Groot
Blood. 2010; 116 (8):1336-1343 gwen m.a. van os
Abstract
The antiphospholipid syndrome is defined by the presence of antiphospholipid antibodies in blood of patients with thrombosis or fetal
20 loss. There is ample evidence that β2-glycoprotein I (β2GPI) is the major antigen for antiphospholipid antibodies. The auto-antibodies recognize
β2GPI when bound to anionic surfaces and not in solution. We showed by
electron microscopy studies, MALDI-TOF MS, LC/MS-MS that β2GPI can exist in at least two different conformations, a circular plasma conformation and an ‘activated’ open conformation. We also showed with surface plasmon resonance that the closed, circular conformation is maintained by
interaction between the first and fifth domain of β2GPI. By changing pH
and salt concentration, we were able to convert the conformation of β2GPI from the closed to the open conformation and back. In the activated open conformation, a cryptic epitope in the first domain becomes exposed that
enables patient antibodies to bind and form an antibody/β2GPI complex. We
also demonstrate that the open conformation of β2GPI prolonged the aPTT when added to normal plasma, while the aPTT is even further prolonged
by addition of anti-β2GPI antibodies. The conformational change of β2GPI and the influence of the auto-antibodies may have important consequences for our understanding of the antiphospholipid syndrome. β2gpi can exist in two conformations
INTRODUCTION
The antiphospholipid syndrome is defined as the presence of antiphospholipid antibodies in blood of patients with thrombosis or fetal loss. The antiphospholipid syndrome is one of the most common causes of acquired thrombophilia1, especially at younger age. In 1990 it was shown that the so-called antiphospholipid antibodies 21 do not recognize phospholipids directly but they interact with phospholipids via the 2
2-4 plasma protein β2-glycoprotein I (β2GPI) . However, the discovery of β2GPI as target for the auto-antibodies did not provide a more in-depth knowledge on the underlying cause of the syndrome. It was unclear which metabolic pathway was disturbed by chapter the auto-antibodies, since no physiological function has convincingly been ascribed to β2GPI to date. Nevertheless, as antibodies against β2GPI can induce thrombosis in 5-7 animal models , the protein β2GPI must hold an important functional clue to our understanding of the syndrome.
β2GPI is a highly abundant 43 kDa protein that circulates at a concentration of approximately 200 µg/mL. β2GPI consists of 326 amino acids arranged in five short consensus repeat domains8,9. The first four domains contain 60 amino acids each, whereas the fifth domain has a 6 residues insertion and an additional 19 amino acid C-terminal extension. The extra amino acids are responsible for the formation of a 10 large positive charged patch within the fifth domain ofβ 2GPI that forms the binding site for anionic phospholipids. The anti-β2GPI antibodies that recognize an epitope located in the first domain correlate better with the thrombotic complications than 11-13 antibodies directed against other domains . Antibodies directed against β2GPI have become one of the serological markers characterizing the antiphospholipid syndrome (APS)14.
After binding to anionic surfaces, β2GPI exposes a cryptic epitope that is recognized by the auto-antibodies present in the antiphospholipid syndrome11,12,15,16. These antibodies only recognize β2GPI when it is bound to a surface and do not recognize β2GPI in solution. Moreover, no circulating immune complexes between antibodies and β2GPI have been detected in patient plasmas17. This seems not to be due to clearance of these complexes from plasma, because plasma levels of β2GPI in antiphospholipid patients 18 are the same as plasma levels of β2GPI in healthy individuals . The crystal structure 9,19 of β2GPI revealed a fishhook-like shape of the molecule . Part of the epitope that is recognized by auto-antibodies consists of amino acids Arg39 and Arg43 in the first domain11,12. The crystal structure indicated that these amino acids are expressed on the surface of domain I of β2GPI and are thus accessible for auto-antibodies. This observation clearly contradicts with the absence of circulating β2GPI/antibody immune complexes in APS patients. The lack of binding of antibodies to β2GPI in solution fits better with a circular structure of β2GPI, a structure that was originally gwen m.a. van os
proposed by Koike et al20. In this hypothetical structure this potential epitope for the auto-antibodies was not exposed on the outside of the molecule. The aim of our study
was to investigate the structure of β2GPI as it occurs in the circulation and to elucidate the changes that occur within the protein when antiphospholipid antibodies interact with the protein. 22
Results
To investigate possible structural differences between β2GPI as it circulates in plasma and
β2GPI in complex with antibodies, we performed negative staining electron microscopy
studies of purified plasmaβ 2GPI in the absence or presence of an anti-domain I β2GPI
antibody (figure 1). Purified β2GPI was visible as a circular structure whereas β2GPI in complex with the antibody showed a fishhook-like structure comparable with the
published crystal structures of β2GPI. These observations suggest that plasma β2GPI circulates in a circular (‘closed’) conformation while after interaction with antibodies,
β2GPI undergoes a major conformational change into a fish-hook structure.
To achieve better understanding of these observed conformational differences, we determined conditions that allowed transition of one conformation into the other.
When we dialyzed purified plasma β2GPI at high pH and high salt conditions, the
circular plasma conformation of β2GPI (figure 2a) was converted into the open
conformation (figure 2b). The open conformation of β2GPI could be converted
back into the circular conformation of β2GPI by dialysis at low pH, as was shown
by electron microscopy (figure 2c). The treatment of β2GPI at low and high pH did not induce an apparent modification of the protein as determined by SDS-PAA gel electrophoresis (figure 2g) and MALDI-TOF MS/MS analysis (not shown).
To quantify the number of open and closed β2GPI molecules present, we randomly
counted 300 β2GPI molecules of plasma purified (figure 2h).
Plasma purifiedβ 2GPI contained 91% circular particles and 9% fishhook-like particles.
Plasma purifiedβ 2GPI first dialyzed against high salt and pH 11.5 followed by dialysis against pH 7.4, contained 3% circular particles and 97% fishhook-like particles
confirming the opening of plasma purified β2GPI. When this open fishhook-like
conformation of β2GPI was dialyzed against pH 3.5 followed by a dialysis against pH 7.4, 89% circular particles and 11% fishhook-like particles were found, confirming
the re-closing of opened β2GPI. β2gpi can exist in two conformations
figure 1. Purified human plasma
β2GPI was visualized with electron microscopy. (A–D) Magnifications
of purified plasmaβ 2GPI show a circular conformation (graphical 23 representation of A–D in E–H). 2
(I–L) Purified plasma훽 2GPI in the presence of antibodies directed chapter against domain I of β2GPI, show upon magnification an open
fish-hook shape ofβ 2GPI (graphical representation of I–L in M–P).
figure 2. Electron microscopy visualization of β2GPI treated at high and low pH. (A) Purified plasma
β2GPI. (B) Plasma β2GPI after dialysis for two days at pH 11.5 with subsequent neutralization to pH
7.4. (C) Plasma 훽2GPI, first dialyzed against pH 11.5, then dialyzed for two days against pH 3.5 and subsequently neutralized to pH 7.4. Graphical representation of A, B and C in D, E and F, respectively. (G) SDS-PAA gel electro-phoresis of purified plasma훽 2GPI (1), 훽2GPI after dialysis against pH 11.5 (2) and 훽2GPI first dialyzed against pH 11.5 followed by dialysis against pH 3.5 (3). All 3 samples show a single band at approximately 43 kDa. (H) The percentages of circular and open conformation in purified plasma훽 2GPI (A), opened 훽2GPI (B) and re-closed 훽2GPI (C). gwen m.a. van os
To confirm that only the open conformation of β2GPI was recognized by patient antibodies, a sandwich ELISA was developed. Microtiter plates were coated with
purified APS patient antibodies and incubated with open or circular β2GPI. The
amount of β2GPI bound from the solution was detected with a peroxidase-conjugated
anti-β2GPI antibody. Patient antibodies bound to open fish-hook conformation of
24 β2GPI, while they did not recognize the circular conformation (figure 3a). When a
mouse monoclonal antibody directed against domain IV of β2GPI was coated, both
conformations of β2GPI were recognized. When cardiolipin was coated on the surface
and incubated with open or circular β2GPI in the presence of purified APS patient
antibodies, the patient antibodies recognized both conformations of β2GPI (figure
3b). To determine the amount of open β2GPI in normal plasma, we also incubated different dilutions of normal plasma with the coated patient antibodies and compared
the signal with open β2GPI dissolved in buffer. We found that less than 0.1% of the
β2GPI in the circulation was in the open conformation (data not shown).
β2GPI is present in high concentration in plasma and depletion of β2GPI from normal plasma does not influence the results of coagulation assays21,22. When antibodies
towards β2GPI were added to plasma, clotting times prolonged in a β2GPI dependent
figure 3. (A) ELISA plates were coated with
purified anti-β2GPI IgGs isolated from APS
patients. Circular or open β2GPI was added
and binding of β2GPI was measured with a
polyclonal anti-β2GPI antibody labeled with
HRP. Open conformation of β2GPI (black bars),
circular conformation of β2GPI (grey bars). As
a control for β2GPI concentration, a mouse
monoclonal anti-domain IV of β2GPI antibody was used. Bars represent means ± SD (n=3). (B) ELISA plates were coated with cardiolipin and a serial dilution (0.4 – 50 μg/mL) of
circular (•) or open (▴) β2GPI was added, subsequently followed by addition of purified
APS patient IgG antibodies. Binding of β2GPI was measured with a goat anti-IgG alkaline phosphatase conjugated antibody. β2gpi can exist in two conformations
way. This effect of anti-β2GPI antibodies is known as lupus anticoagulant activity.
We investigated whether the open and circular forms of β2GPI acted differently on coagulation.
When circular plasma β2GPI was added to normal plasma (figure 4a) or β2GPI depleted plasma (data not shown), no effect on the dilute aPTT was observed 25
When 15 mg/mL open β2GPI was added to plasma or β2GPI depleted plasma, the 2 aPTT prolonged for more than 10 seconds. In order to investigate whether besides opening of β2GPI there was an additional effect of anti-β2GPI antibodies, we studied chapter whether addition of anti-β2GPI could further prolong the clotting time induced by open β2GPI. Addition of antibody and open β2GPI together to normal plasma gave an additional anticoagulant effect on top of the effect of open β2GPI alone (figure 4b)
The additional effect of anti-β2GPI antibodies on the aPTT was observed with every concentration of open β2GPI tested (data not shown).
To better understand the conformational changes of β2GPI, we trypsinized both forms of β2GPI and analyzed the peptides formed with MALDI-TOF MS (data not shown) and LC-MS/MS. Under non-denaturing conditions, specific peptides were more abundantly
figure 4. The effects of circular and open β2GPI on the aPTT
were determined. Circular and open β2GPI were added to normal pool plasma (NPP). (A) Control is NPP; circular is NPP
with addition of 15 mg/mL plasma β2GPI; circular to open is
NPP to which 15 mg/mL plasma β2GPI treated at pH 11.5 was added and circular to open to circular is NPP to which 15 mg/
mL plasma β2GPI first incubated at pH 11.5 and subsequently
treated at pH 3.5 was added. (B) Control is NPP; anti-β2GPI
is NPP to which 15 mg/mL purified monoclonal anti-ß2GPI
antibody was added; anti-β2GPI + circular β2GPI is NPP
with addition of pre-incubated (5 min) anti-β2GPI antibody
and plasma β2GPI and anti-β2GPI + open β2GPI is NPP with
addition of pre-incubated (5 min) anti-β2GPI antibody and
plasma β2GPI first incubated at pH 11.5 and subsequently treated at pH 3.5 (both 15 mg/mL). Bars represent means ± SD (n=3). gwen m.a. van os
formed from the open form than the circular form. In particular, the amino acids Lys19, Arg39 and Arg43 in domain I and Lys305 and Lys317 in domain V were not or less accessible to trypsin in the circular form while they were accessible in the open form (figure 5). When the digestion with trypsin was performed under denaturing conditions, in the presence of an MS-compatible detergent, an identical panel and
26 abundance of peptides was formed from both conformations of β2GPI (data not shown).
In the circular conformation, interaction between different domains of β2GPI is necessary and from the mass spectrometry data an interaction between domain I and
V was suggested. To study this, we have cloned the individual domains of β2GPI and studied their mutual interactions with surface plasmon resonance. As shown in figure 6, domain V interacted with domain I, while no interaction was found between domain
figure 5. Comparison of
LC-MS surveys of β2GPI. LC-MS analyses of open
and circular β2GPI are depicted. The molecular masses of detected tryptic peptides are indicated. Comparison of these 2 analyses shows that in the open
conformation of β2GPI (top panel) cleavage has taken place of the amino acids Lys19, Arg39, Arg43 (domain I), Lys305 and Lys317 (domain V) indicated by the black arrows, whereas they are not or less visible in the circular conformation
of β2GPI (bottom panel) indicated by the white arrows. β2gpi can exist in two conformations
I and domain IV of β2GPI. The interaction between domains I and V was found to be completely dependent on the presence of zinc ions. The dissociation constant between -9 domain I and V of β2GPI was ~0.8·10 M. These observations suggest that to maintain the circular structure of β2GPI, domain V of β2GPI interacts with domain I (figure 7).
27 Discussion 2
Here we have shown that plasma β2GPI exists in two different conformations. Plasma chapter derived β2GPI is in a circular conformation, as was shown by electron microscopy observations. Analysis of the different conformations with MALDI-TOF MS, LC-MS/ MS and surface plasmon resonance confirmed an interaction between domain I and V. As a result of the interaction with domain V, the epitope on domain I for the auto-antibodies that characterize the antiphospholipid syndrome is not available for binding by the antibodies (figure 3). This also explains why no circulating immune complexes between β2GPI and the antibodies are observed in APS. After exposure to anionic structures, such as negatively charged phospholipids, β2GPI binds, opens
figure 6. Binding of domain I to domain IV and V was investigated with surface plasmon resonance. Domain I of β2GPI (150 RU) was immobilized to a CM5 sensor chip and increasing concentrations (25 – 200 nM) of domain IV or domain V were applied to the chip. Binding of domain V to domain I in a concentration dependent manner was observed. No detectable interaction could be observed between domain IV and domain I. gwen m.a. van os
up and exposes the epitope of the auto-antibodies and the antibodies are able to 12 recognize β2GPI . The interaction with antibodies probably stabilizes β2GPI in the open conformation.
There is a large difference between the (low) affinity of patient antibodies and the 23 28 (high) affinity of murine monoclonal antibodies for β2GPI . The affinity of the murine monoclonal antibody 3B7 for domain I is probably higher than the affinity
of domain V for domain I, resulting in opening of β2GPI. The affinity of the patient antibodies could be too low to compete with domain V for binding to domain I. Only when anionic phospholipids compete for the binding to domain V with domain I,
figure 7. Depicted are β2GPI with its five domains (DI-DV) as it is in complex with anti-β2GPI
antibodies (A) and a proposed model of plasma β2GPI (B). The black dots indicate the amino acids not accessible for trypsin. The black arrow indicates the location of the amino acids involved in
the recognition of anti-β2GPI antibodies. In the circular conformation the black circle indicates the
concealing of the amino acids involved in the binding site of anti-β2GPI antibodies as a result of
interaction between domain I and V of β2GPI. β2gpi can exist in two conformations
the affinity of the patient antibodies is sufficient to bind to domain I. This explains why after addition of a monoclonal antibody we could observe the open form with electron microscopy.
We were not able to show an interaction between β2GPI and anionic phospholipids vesicles by electron microscopy, because our efforts to prepare complexes between 29 negatively charged vesicles and β2GPI resulted in agglutination of the vesicles which 2 made the samples inappropriate for electron microscopy. Hammel et al24 mentioned already that they observed increased turbidity of their solutions of liposomes and chapter β2GPI, and that particle aggregation was responsible for the turbidity increase. Moreover, they observed an unexpected decrease in intensity of the fluorescent signal 27 of the tryptophan residues, which could only be explained by agglutination of β2GPI . In addition, in their article they observed with calorimetric and circular dichroism studies, conformational changes when β2GPI was incubated with cardiolipin vesicles. They assumed that a partial loss of tertiary structural elements had taken place upon lipid association which fits with the observations we have made in this manuscript.
22 Depletion of β2GPI from normal plasma does not influence coagulation . In contrast to the circular conformation; the open fish-hook like conformation of β2GPI has a profound effect on the aPTT. Therefore, we propose that the conformation of β2GPI in plasma is predominantly than 0.1% was in the open conformation. Analysis of purified β2GPI with electron microscopy suggested that 9% of the molecules were in the open conformation but this high percentage was probably a technical problem due to adsorption of β2GPI to the copper grids.
Addition of β2GPI in a fish-hook conformation to normal plasma prolonged the aPTT but addition in combination with anti-β2GPI antibodies prolonged the clotting time of normal plasma even more. This suggests that the change in conformation alone can cause prolongation of the aPTT, but upon dimerization of β2GPI by the antibodies the clotting time is further prolonged21.T o express lupus anticoagulant activity, a conformational change within β2GPI is essential, whereas dimerization of β2GPI by the antibodies is necessary to express full lupus anticoagulant activity.
In 1998, Koike et al proposed a circular structure for β2GPI which was constructed based on the NMR coordinates of short consensus repeat domains of human factor H20. No attention has been paid to this proposed structure any more once the fish hook conformation of β2GPI was published that was deduced from resolution of the crystal structure9,19. Here we show that both conformations can exist and that both conformations can be converted into each other by changing pH and salt concentration. As this interaction can be influenced by changing pH and salt concentration, we speculate that there is a hydrophilic interaction between the two domains. gwen m.a. van os
The crystallization of β2GPI was performed under extreme buffer and salt conditions, circumstances that probably interfered with the hydrophilic interaction and favored
the open form of β2GPI. The existence of two different conformations has important
consequences for functional studies on β2GPI. We have shown that we can change one conformation into the other by changing the in vitro conditions. This means that
30 researchers performing studies with β2GPI have to consider with which conformation
of β2GPI their experiments were performed. The presence of β2GPI in a certain conformation is among others dependent on the presence of anionic surfaces but
also on the method of purification of β2GPI. Our findings may have impact on the interpretation of research findings in the field of APS as the outcome of many laboratory
experiments strongly depends on the conformation of β2GPI as we have shown for the 25 26 27 effect of β2GPI on clotting Schousboe et al , Brighton et al , Mori et al and Shi 28 et al suggested that binding of β2GPI to either FXI or FXII results in inhibition of the intrinsic pathway of coagulation in in vitro systems. A counterargument against these in vitro observations was that the aPTT of normal plasma is independent of 29 the plasma levels of β2GPI; levels that can vary significantly . Moreover, deficiency 30 of β2GPI did not result in a prolongation of the aPTT . Here we can provide an explanation for these conflicting results. Apparently, the experiments were performed
with β2GPI in an open conformation while plasma β2GPI is in the inactive circular conformation. The open conformation is necessary to express the inhibitory activity on the contact activation of blood coagulation.
We performed direct binding experiments with domain I and domain V. We calculated a dissociation constant of ~0.8 nM, but the fit of the binding curves in the surface plasmon resonance experiments was not optimal. There are theoretical and practical reasons for this suboptimal fit. In the circular conformation, the binding between domain I and V takes place between two domains present in the same molecule, which is incomparable to the interaction between two domains freely present in solution. The concentration of domain I in the vicinity of domain V will be increased, because domain I is via domains II-IV covalently connected to domain V. This will enhance binding through mass action effects. There is also an entropy term that must be considered. Domains I and V present in one molecule have less mutual mobility than domains I and V in solution. This loss of freedom is entropy unfavorable. When domain I and V are part of the same molecule, the entropy of the system has decreased and the interaction between domains I and V becomes thermodynamically favorable. We had also technical problems measuring the kinetics of the interaction of domain I and domain V. At higher concentrations, we observed a mutual interaction between domains V, which interfered with the kinetic measurements. This mutual interaction between domains V might be of interest, because it could explain the increase in
binding affinity ofβ 2GPI for anionic phospholipids when it forms a complex with the
antibodies. It is possible that after dimerization of β2GPI, that takes place via binding β2gpi can exist in two conformations
of the antibodies, subsequently two-dimensional array formation can occur31,32 on anionic phospholipids via domain V-domain V interactions. For annexin A5, the formation of these two dimensional aggregates is essential for its inhibitory potential on coagulation33,34.
To better understand the epitopes responsible for the maintenance of the circular 31 conformation of β2GPI, we have performed enzymatic digestions on both forms of 2
β2GPI under both native and denatured conditions and analyzed the peptides formed by LC-MS/MS. The amino acids Lys19, Arg39 and Arg43 in domain I and Lys305 and
Lys317 in domain V were not accessible for trypsin in the circular form while they were chapter accessible in the open form. After addition of a detergent prior to digestion, the same panel and abundance of peptides was formed with trypsin from both conformations of β2GPI. These observations suggest that these particular amino acids are hidden from the solution in the circular form and exposed to the solution in the open form of β2GPI, indicating that epitopes within domain I and domain V are involved in the maintenance of the circular conformation of β2GPI.
Originally we have suggested that patient antibodies are not able to bind to plasma
β2GPI because the epitope Arg39-Arg43 in β2GPI for the antibodies is covered by a negatively charged carbohydrate side chain12. The conformational change that is induced in β2GPI after binding to phospholipids should interfere with the intramolecular interaction of the carbohydrate side chain with the epitope for the antibodies, which subsequently results in the exposure of the epitope for the antibodies. This idea was further elaborated by Kondo et al35 who demonstrated increased sialylation of the glycan structures of β2GPI of APS patients, suggesting an altered intramolecular interaction and conformational instability of β2GPI in patients. At the moment we have no information whether differences in sialylation of carbohydrate side chains of β2GPI facilitate the conversion between the open and circular conformation by anti-β2GPI antibodies.
In conclusion, the observations made here on the structural changes that can take place within β2GPI and the subsequent stabilization of this conformation by auto-antibodies can have very important consequences for our understanding of the antiphospholipid syndrome.
gwen m.a. van os
Materials and Methods
Purification of human plasma β2GPI 21 Plasma β2GPI was isolated from fresh citrated human plasma as described previously .
32 Purity of β2GPI was determined with sodium dodecylsulfate polyacrylamide gel
electrophoresis (GE Healthcare; Piscataway, NJ; USA). Purified plasmaβ 2GPI showed a single band with a molecular mass of approximately 43 kDa under non-reducing conditions. The concentration of the protein was determined with the bicinchoninic acid protein assay (Thermo Fisher Scientific LSR; Rockford, IL; USA). MALDI-TOF analysis of the purified protein showed that it was more than 99.9% pure.
Negative staining transmission electron microscopy
β2GPI, in 20 mM Hepes buffer, pH 7.4, was analyzed by negative staining electron 36 microscopy as described previously . Solutions of β2GPI (5-10 nM) with or without
pre-incubation with mouse monoclonal antibody 3B7 against domain I of β2GPI were placed on a carbon coated copper grid and negatively stained with uranyl formate (UF). A 0.75% UF solution was obtained by dissolving 37.5 mg UF (BDH Chemicals Ltd., Poole; UK) in 5 mL boiling water, and stabilized with 5 μL 5 M NaOH. Grids were rinsed for 45 sec with 100 μL 20 mM Tris, 150 mM NaCl, pH 7.4 and blotted on filter paper. Five μL of sample was added to the grid, left for 45 sec and blotted off
with a filter paper. The sample was washed twice with 100 μL H2O drops and blotted off after each wash with a filter paper. Subsequently, the sample was stained for 3 sec with 100 μL 0.75% UF, transferred to another 100 μL drop of 0.75% UF and then stained for an additional 15 to 20 sec. Samples were visualized using a Jeol JEM 1230 transmission electron microscope operated at 60 kV accelerating voltage, and recorded with a Gatan Multiscan 791 CCD camera.
Conformational conversion of β2GPI
Conversion from the closed circular conformation of β2GPI to the open conformation was performed in a Slide-A-Lyzer 3.5K MWCO dialysis cassette (Thermo Fisher) by dialysis against 20 mM Hepes containing 1.15 M NaCl, pH 11.5, for 48 hours at 4°C followed by dialysis with20 mM Hepes, 150 mM NaCl, pH 7.4. Conversion
from the open conformation of β2GPI to the closed conformation was achieved by dialysis against 20 mM Hepes, 150 mM NaCl, pH 3.4, for 48 hours at 4°C followed by dialysis against 20 mM Hepes, 150 mM NaCl, pH 7.4. Samples were concentrated
to a final concentration of 1.0 mg/mL β2GPI with an Ultrafree-0.5 Centrifugal Filter Unit (Millipore; Billerica, MA; USA). Samples were snap-frozen in liquid nitrogen and β2gpi can exist in two conformations
stored at -80°C for analysis. After subjection to electron microscopy, 300 randomly selected β2GPI molecules per treatment were scored for their conformation.
Purification of anti-β2GPI antibodies from sera of APS patients 33 Anti-β2GPI antibodies from APS patients’ sera were purified by applying sera, diluted
1:4 in phosphate buffered saline (PBS), to a HiTrap Protein G column (GE Healthcare). 2
Subsequently, the column was washed with 25 mL PBS and eluted with 25 mL 0.5 M acetic acid, pH 2.8. Eluted samples were dialyzed against PBS and stored at -20°C chapter for analysis. The patient plasmas used were positive for both lupus anticoagulant and anti-β2GPI antibodies and were not selected for anti-domain I positivity. The presence 37 of lupus anticoagulant and anti-β2GPI antibodies was detected as described . Patient samples were collected with approval of the local ethics committee. Informed consent was obtained in accordance with the Declaration of Helsinki.
Immunosorbent assay of β2GPI NUNC MaxiSorpTM High Protein-Binding Capacity ELISA plates (Nalge Nunc International, Denmark) were coated with 1 µg/mL mouse monoclonal anti-domain IV of β2GPI (21B2) or with 1 µg/mL purified APS patient IgG antibodies by incubation in 50 mM carbonate buffer, pH 9.6, 100 µL in each well for 1 hour at room temperature (RT). After washing with 20 mM Tris, 150 mM NaCl and 0.1% Tween-20, pH 7.4 (wash buffer) the plates were blocked by the addition of 200 µL per well of 3% bovine serum albumin (Sigma) in 20 mM Tris, 150 mM NaCl, pH 7.4 (blocking buffer) for 1 hour at RT. After washing the wells three times with wash buffer, 100 µL of circular or open β2GPI (0 - 1 µg/mL in blocking buffer) or pooled normal plasma was added to the wells and incubated for 1 hour at RT. Subsequently, after washing three times with wash buffer, 100 µL of peroxidase-conjugated anti-β2GPI antibodies (Affinity Biologicals Inc, Ancaster, ON; Canada) (1 µg/mL in blocking buffer) was added to the wells and incubated for 1 hour at RT. After the removal of unbound antibodies by washing with wash buffer, peroxidase activity of the bound antibody was measured by addition of 100 µL per well of TMB substrate (Tebu-bio laboratories, Le-Perray-en-Yvelines, France). After 20 minutes, color development was stopped by adding an equal volume of 1.0 M sulphuric acid. The optical density was measured at 450 nm with a spectrophotometer (Molecular Devices Ltd, Berkshire, UK).
Cardiolipin and β2GPI binding assay Fifty µL of a solution of cardiolipin (20 μM) (Sigma) in Tris buffered saline (TBS) pH 7.4, was added to 96 well polyvinyl microtiter plates (Costar, Cambridge, MA; USA) and incubated overnight at 4°C. The plate was blocked by addition of 150 μL per gwen m.a. van os
well of 10% bovine serum albumin (Sigma) in TBS (blocking buffer) for 2 hours at 37°C. After washing the wells three times with TBS, 50 μL serial dilutions of closed
and open β2GPI (0.4 – 50 μg/mL) was added to the wells and incubated for 2 hours at 37°C. Subsequently, after washing three times with TBS, 50 μL of purified APS patient IgG antibodies (5 μg/mL in blocking buffer) was added to the wells and incubated 34 for 1 hour at 37°C. After removal of the unbound patient antibodies, 50 μL goat anti-human IgG alkaline phosphatase conjugated antibodies (Invitrogen, Carlsbad, CA; USA), diluted 1:4000 in TBS, was added to the wells and incubated for 1 hour at 37°C. After washing three times with TBS, 50 µL per well of phosphatase substrate (Sigma) was added and color development was stopped after 30 minutes by addition of 50 µL per well 1.0 M sulphuric acid. The optical density was measured at 405nm.
Analysis of anticoagulant activity of β2GPI by aPTT. A diluted activated partial thromboplastin time (aPTT) clotting assay was used to
analyze the anticoagulant activity of β2GPI. The aPTT was measured with Pathromtin SL and calcium chloride reagents (Siemens Healthcare Diagnostics, Marburg; Germany). All coagulation measurements were carried out in a coagulometer (KC 10, Amelung, Lemgo; Germany). First, 80 μL of human pooled plasma (pool from more
than 200 healthy volunteers) and 20 μL of β2GPI (final concentration of 15 µg/mL) were incubated for 1 min at 37°C. Subsequently, 100 μL of Pathromtin SL reagent (five times diluted in Hepes buffer, pH 7.4) was added to the mixture and incubated
for 3 min at 37°C. After the incubation, 100 μL of 25 mM CaCl2 was added and the clotting time was recorded.
Protein digestion and MALDI-TOF MS
For detection of protected residues, equal amounts of open and circular β2GPI in 20 mM Hepes, 150 mM NaCl, pH 7.4, were incubated for 12 hours at 37˚C with 1:10 unmodified, sequence-grade trypsin (Roche Molecular Biochemicals), followed by reduction with 10 mM DTT (30 minutes at 37˚C) and alkylation of cysteines with 25 mM iodoacetamide (30 minutes at RT). For optimal peptide sequence coverage, the proteins were first incubated with 0.1% Rapigest (Waters, Milford, MA; USA) prior to digestion. This MS-compatible, acid cleavable detergent was then removed by acidification (0.5% TFA), followed by incubation at 37˚C for 30 minutes and centrifugation for 10 minutes at 13,000 x g. For MALDI analysis, the resulting peptide mixtures were dried in a vacuum centrifuge and dissolved in 1% formic acid and 60% acetonitrile. Subsequently, peptides were mixed 1:1 (v/v) with a solution containing 52 mM α-cyano-4-hydroxycinnamic acid (Sigma) in 49% ethanol/49% acetonitrile/2% trifluoroacetic acid and 1 mM ammonium acetate. Prior to dissolving, the α-cyano-4-hydroxycinnamic acid was washed briefly with chilled acetone. The mixture was spotted on a MALDI target plate and allowed to dry at room temperature. Reflectron matrix-assisted laser desorption β2gpi can exist in two conformations
ionization time of flight mass spectrometry (MALDI-TOF MS) spectra were acquired on a Micromass M@LDI (Wythenshawe, Manchester; UK). The acquired peptide spectra were analyzed with Masslynx 3.5 (Micromass).
Peptide and sequence analysis by oMALDI- or LC-MS/MS 35 MALDI-TOF MS/MS peptide sequencing was performed using a QSTAR-XL equipped 2 with an oMALDI interface (Applied Biosystems/MDS Sciex, Toronto, Canada). The generated peptide mixtures were also analyzed by LC-MS/MS as described38 with an
Agilent 1100 series LC system fitted with a nanoscale reversed-phase HPLC setup, chapter coupled to a QSTAR-XL (Applied Biosystems/MDS Sciex). For peptide identification, MS/MS spectra were searched against the Swiss-Prot database with the online MASCOT (Matrixscience) search engine (both available at http://www.matrixscience. com). For relative comparison of peptide abundance, single MS spectra were acquired and deconvoluted using the BioAnalyst 1.1.5 extension to Analyst QS1.1 (Applied Biosystems).
Construction of individual domains of β2GPI
Human β2GPI cDNA (kindly provided by Dr. T. Kristensen from the University of Aarhus, Aarhus; Denmark) was used for the construction of domains I, IV and V of
β2GPI. cDNA was subcloned into a PCR - Blunt II - TOPO vector (Invitrogen) and the separate domains were constructed with a set of two primers with BamHI and NotI restriction sites. For domain I the primers GGATCCGGACGGACCTGTCCCAAGCC and GCGGCCGCTTATACT-CTGGGTGTACATTTCAGAGTG were used. For Domain IV the primers GGATCCAGGGAAGT-AAAATGCCCATTCC and GCG- GCCGCAGATGCTTTACAACTTGGCATGG and for domain V GATCCGCATCTT- GTAAAGTACCTGTGAAAAAAGC and GCGGCCGCTTAGCATGGCTTTACATC- GG were used. The PCR product was cloned into a PCR - Blunt II - TOPO vector and sequence analysis was performed to confirm the sequence of domain I, IV and V. From this vector the PCR product was subcloned into the expression vector HisN-Tev (Promega, Madison, WI; USA).
Protein expression and purification
The individual domains were expressed in HEK293E cells and collected by elution from a Nickel-Sepharose column with a buffer containing 25 mM Tris, 500 mM NaCl and 500 mM imidazol, pH 8.2. Purification on size was performed with a Hi-Load Superdex 200 XK26 column (GE Healthcare). The different domains were more than 95% pure as was checked on a 4-15% SDS–PAA gel (GE Healthcare). gwen m.a. van os
Surface plasmon resonance measurements
Surface Plasmon resonance analysis was performed with a BIAcore 2000 (GE Healthcare). Purified domain I was immobilized (150 RU) on an activated CM-5 sensor chip according to manufacturer’s instructions. Specific binding to the individual domains was corrected for non-specific binding to the deactivated control 36 channel. The non-specific binding was 6 to 20% of total binding depending on the concentration. Recombinant domains IV and V in various protein concentrations in a
buffer containing 20 mM Hepes, 150 mM NaCl, 20 µM ZnCl2, 0.0005% Tween-20, pH 7.4 (flow buffer), was injected for 3 minutes at a flow rate of 30 μL/min. The dissociation was followed for a period of 5 minutes. Regeneration of the sensor chip was achieved by a 10 µL wash of 4 mM EDTA and subsequent equilibration with flow buffer. β2gpi can exist in two conformations
references
1. Giannakopoulos B, Passam F, Ioannou Y, Krilis S. How we diagnose the antiphospholipid syndrome. Blood. 2009; 113: 985-994 2. Galli M, Comfurius P, Maassen C et al Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma protein cofactor. Lancet. 1990; 335: 1544-1547 3. McNeil H, Simpson R, Chesterman C, Krilis S. Anti-phospholipid antibodies are directed against a complex 37 antigen that includes a lipid-binding inhibitor of coagulation: beta 2-glycoprotein I (apolipoprotein H). Proc 2
Natl Acad Sci U S A. 1990; 87: 4120-4124 4. Matsuura E, Igarashi Y, Fujimoto M, Ichikawa K, Koike T. Anticardiolipin cofactor(s) and differential diagnosis of autoimmune disease. Lancet. 1990; 336: 177-178 chapter 5. Blank M, Cohen J, Toder V, Shoenfeld Y. Induction of anti-phospholipid syndrome in naive mice with mouse lupus monoclonal and human polyclonal anti-cardiolipin antibodies. Proc Natl Acad Sci U S A. 1991; 88: 3069-3073 6. Jankowski M, Vreys I, Wittevrongel C, Boon D, Vermylen J, Hoylaerts MF, Arnout J. Thrombogenicity of beta 2-glycoprotein I-dependent antiphospholipid antibodies in a photochemically induced thrombosis model in the hamster. Blood. 2003; 101: 157-162 7. Pierangeli S, Colden-Stanfield M, Liu X et al. Antiphospholipid antibodies from antiphospholipid syndrome patients activate endothelial cells in vitro and in vivo. Circulation. 1999; 99: 1997-2002 8. Lozier J, Takahashi N, Putnam FW. Complete amino acid sequence of human plasma beta 2-glycoprotein I. Proc Natl Acad Sci U S A. 1984; 81: 3640-3644. 9. Bouma B, de Groot PG, van den Elsen JM et al. Adhesion mechanism of human beta(2)-glycoprotein I to phospholipids based on its crystal structure. EMBO J. 1999; 18: 5166-5174 10. Hunt J, Simpson R, Krilis S. Identification of a region of beta 2-glycoprotein I critical for lipid binding and anti-cardiolipin antibody cofactor activity. Proc Natl Acad Sci U S A. 1993; 90: 2141-2145 11. Iverson G, Victoria E, Marquis D. Anti-beta2 glycoprotein I (beta2GPI) autoantibodies recognize an epitope on the first domain of beta2GPI. Proc Natl Acad Sci U S A. 1998; 95: 15542-15546 12. de Laat B, Derksen R, van Lummel M, Pennings M, de Groot P. Pathogenic antibeta2- glycoprotein I antibodies recognize domain I of beta2-glycoprotein I only after a conformational change. Blood. 2006; 107: 1916-1924 13. Ioannou Y, Romay-Penabad Z, Pericleous C, Giles I, Papalardo E, Vargas G, Shilagard T, Latchman DS, Isenberg DA, Rahman A, Pierangeli S. In vivo inhibition of antiphospholipid antibody-induced pathogenicity utilizing the antigenic target peptide domain I of beta2-glycoprotein I: proof of concept. J Thromb Haemost. 2009; 7: 833-842 14. Miyakis S, Lockshin MD, Atsumi T et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost. 2006; 4: 295-306 15. Yamaguchi Y, Seta N, Kaburaki J, Kobayashi K, Matsuura E, Kuwana M. Excessive exposure to anionic surfaces maintains autoantibody response to beta(2)-glycoprotein I in patients with antiphospholipid syndrome. Blood. 2007; 110: 4312-4318 16. Kuwana M, Matsuura E, Kobayashi K, Okazaki Y, Kaburaki J, Ikeda Y, Kawakami Y. Binding of beta 2-glycoprotein I to anionic phospholipids facilitates processing and presentation of a cryptic epitope that activates pathogenic autoreactive T cells. Blood. 2005; 105: 1552-1557 17. Biasiolo A, Rampazzo P, Brocco T, Barbero F, Rosato A, Pengo V. [Anti-beta2 glycoprotein I-beta2 glycoprotein I] immune complexes in patients with antiphospholipid syndrome and other autoimmune diseases. Lupus. 1999; 8: 121-126 18. Kaburaki J, Kuwana M, Yamamoto M, Kawai S, Matsuura E, Ikeda Y. Disease distribution of beta 2- glycoprotein I-dependent anticardiolipin antibodies in rheumatic diseases.Lupus. 1995; 4 Suppl 1: S27-31 19. Schwarzenbacher R, Zeth K, Diederichs K, Gries A, Kostner G, Laggner P, Prassl R. Crystal structure of human beta2-glycoprotein I: implications for phospholipid binding and the antiphospholipid syndrome. EMBO J. 1999; 18: 6228-6239 gwen m.a. van os
20. Koike T, Ichikawa K, Kasahara H, Matsuura E. Epitopes on beta2-GPI recognized by anticardiolipin antibodies. Lupus. 1998; 7 Suppl 2:S14-7 21. Oosting J, Derksen R, Entjes H, Bouma B, de Groot P. Lupus anticoagulant activity is frequently dependent on the presence of beta 2- glycoprotein I. Thromb Haemost. 1992; 67: 499-502 22. Willems G, Janssen M, Pelsers M, Comfurius P, Galli M, Zwall R, Bevers E. Role of divalency in the highaffinity binding of anticardiolipin antibody-beta 2-glycoprotein I complexes to lipid membranes. Biochemistry. 1996; 35: 38 13833-13842 23. Bozic B, Cucnik S, Kveder T, Rozman B. Avidity of anti-beta-2-glycoprotein I antibodies. Autoimmun Rev. 2005; 4: 303-308 24. Hammel M, Schwarzenbacher R, Gries A, Kostner G, Laggner P, Prassl R. Mechanisms of the interaction of beta(2)-glycoprotein I with negatively charged phospholipids membranes. Biochemistry. 2001; 40: 14173-14181 25. Schousboe I, Rasmussen M. Synchronized inhibition of the phospholipid mediated autoactivation of factor XII in plasma by beta 2-glycoprotein I and anti-beta 2-glycoprotein I. Thromb Haemost. 1995; 73: 798-804 26. Brighton T, Hogg P, Dai Y, Murray B, Chong B, Chesterman C. Beta 2-glycoprotein I in thrombosis: evidence for a role as a natural anticoagulant. Br J Haematol. 1996; 93: 185-194 27. Mori T, Takeya H, Nishioka J, Gabazza E, Suzuki K. beta 2-Glycoprotein I modulates the anticoagulant activity of activated protein C on the phospholipid surface. Thromb Haemost. 1996; 75: 49-55 28. Shi T, Iverson G, Qi J, Cockerill K, Linnik M, Konecny P, Krillis S. Beta 2-Glycoprotein I binds factor XI and inhibits its activation by thrombin and factor XIIa: loss of inhibition by clipped beta 2-glycoprotein I. Proc Natl Acad Sci U S A. 2004; 101: 3939-3944 29. Arnout J, Meijer P, Vermylen J. Lupus anticoagulant testing in Europe: an analysis of results from the first European Concerted Action on Thrombophilia (ECAT) survey using plasmas spiked with monoclonal antibodies against human beta2-glycoprotein I. Thromb Haemost. 1999; 81: 929-934 30. Yasuda S, Tsutsumi A, Chiba H, Yanai H, Miyoshi Y, Takeuchi R, Horita T, Atsumi T, Ichikawa K, Matsuura E, Koike T. beta(2)-glycoprotein I deficiency: prevalence, genetic background and effects on plasma lipoprotein metabolism and hemostasis. Atherosclerosis. 2000; 152: 337-346 31. Gamsjaeger R, Johs A, Gries A, Gruber H, Romanin C, Prassl R, Hinterdorfer P. Membrane binding of beta2- glycoprotein I can be described by a two-state reaction model: an atomic force microscopy and surface plasmon resonance study. Biochem J. 2005; 389: 665-673 32. Rand J, Wu X, Quinn A, Chen P, Hathcock J, Taatjes D. Hydroxychloroquine directly reduces the binding of antiphospholipid antibody beta2-glycoprotein I complexes to phospholipid bilayers. Blood. 2008; 112: 1687-1695 33. van Genderen H, Kenis H, Hofstra L, Narula J, Reutelingsperger C. Extracellular annexin A5: functions of phosphatidylserine-binding and twodimensional crystallization. Biochim Biophys Acta. 2008; 1783: 953-963 34. de Laat B, Wu X, van Lummel M, Derksen R, de Groot P, Rand J. Correlation between antiphospholipid antibodies that recognize domain I of beta2-glycoprotein I and a reduction in the anticoagulant activity of annexin A5. Blood. 2007; 109: 1490-1494 35. Kondo A, Miyamoto T, Yonekawa O, Giessing A, Østerlund E, Jensen O. Glycopeptide profiling of beta-2- glycoprotein I by mass spectrometry reveals attenuated sialylation in patients with antiphospholipid syndrome. J Proteomics. 2009; 73: 123-133 36. Engel J, Furthmayr H. Electron microscopy and other physical methods for the characterization of extracellular matrix components: laminin, fibronectin,collagen IV, collagen VI, and proteoglycans. Methods Enzymol. 1987; 145: 3- 78 37. Urbanus R, Siegerink B, Roest M, Rosendaal F, de Groot P, Algra A. Antiphospholipid antibodies and risk of myocardial infarction and ischaemic stroke in young women in the RATIO study: a case-control study. Lancet Neurol. 2009; 8: 998-1005 38. Kramer G, Sprenger R, Back J et al. Identification and quantitation of newly synthesized proteins in Escherichia coli by enrichment of azidohomoalaninelabeled peptides with diagonal chromatography. Mol Cell Proteomics. 2009; 8: 1599-1611 β2gpi can exist in two conformations
39 2
chapter
Chapter 3
Induction of auto-antibodies against β2-Glycoprotein I in mice by protein H of Streptococcus pyogenes
Gwen M.A. van Os, Joost C.M. Meijers, Çetin Ağar, Mercedes Valls Serón, Arnoud Marquart, Per Åkesson, Rolf T. Urbanus, Ronald H.W.M. Derksen, Heiko Herwald, Matthias Mörgelin, Philip G. de Groot
Journal of Thrombosis and Haemostasis
Accepted for publication gwen m.a. van os
Abstract
The antiphospholipid syndrome (APS) is characterized by the persistent
presence of auto-antibodies against β2-Glycoprotein I (β2GPI). β2GPI can exist in two conformations. In plasma it is a circular protein, whereas it adopts a fish-hook shape after binding to phospholipids. Only the latter
conformation is recognized by patient antibodies. β2GPI has been shown 42 to interact with Streptococcus pyogenes.
Here we evaluated the potential of S. pyogenes derived proteins to
induce auto-antibodies against β2GPI. Four S. pyogenes surface proteins
(M1 protein, protein H, SclA and SclB) were found to interact with β2GPI.
Only binding to protein H induces a conformational change in β2GPI, thereby exposing a cryptic epitope for APS-related auto-antibodies. Mice were injected with the four proteins. Only mice injected with protein H developed antibodies against the patient antibody related epitope
in domain I of β2GPI. Patients with pharyngotonsillitis caused by S. pyogenes who developed antibodies towards protein H also generated anti-β GPI antibodies. 2 Our study demonstrated that a bacterial protein can induce a
conformational change in β2GPI resulting in the formation of
auto-antibodies against β2GPI. This constitutes a novel mechanism for
the formation of auto-antibodies against β2GPI. induction of auto-antibodies against β2gpi
Introduction
The antiphospholipid syndrome (APS) is characterized by the persistent presence of antiphospholipid antibodies in plasma samples of patients with thrombotic events or obstetrical complications1. The presence of these auto-antibodies can be measured with a prolongation of clotting assays, known as lupus anticoagulant and with an ELISA set-up with either cardiolipin or β2-Glycoprotein I (β2GPI) as antigen.
Although the names of the assays suggest otherwise, β2GPI is the major antigen for the 2,3 auto-antibodies detected with all three assays . β2GPI is a 43 kDa protein consisting of five complement control protein domains. The first domain contains an epitope recognized by the subpopulation of auto-antibodies that correlate best with the clinical 43 manifestations, whereas domain V contains a patch of positively charged amino acids 3 with a hydrophobic insertion loop harboring the phospholipid binding site4,5. The epitope within domain I of β2GPI recognized by the auto-antibodies includes amino
6-9 chapter acids R39-R43 . The auto-antibodies do not recognize this epitope when β2GPI circulates in blood. However, β2GPI undergoes a major conformational change when it binds to anionic phospholipids. β2GPI circulates in blood in a circular conformation but when it binds to negatively charged phospholipids with its positively charged 10 domain V, the interaction of domain V with domain I of β2GPI is disturbed . The closed conformation of β2GPI opens up and the site within domain I containing amino acids R39-R43 becomes exposed on the outside of the molecule4,10. This epitope can now be recognized by auto-antibodies that characterize the syndrome11.
Several publications have linked infections to the cause of APS, but the etiology of the auto-antibodies is not well understood. So far no evidence is available that links the presence of anti-β2GPI antibodies to infections, although this idea is generally accepted. Sene et al.12 summarizeD in their review that auto-antibodies found during an infection are directed against cardiolipin, independently of β2GPI, but many publications have shown otherwise14-20. A theory to explain the formation of auto-antibodies directed against β2GPI is molecular mimicry, in which the immune system develops antibodies directed against viral or bacterial antigens that mimic peptide sequences present in self proteins21. However, only limited evidence has been published that molecular mimicry can induce auto-antibodies against β2GPI and lupus anticoagulant activity characteristic for the serology of APS22,23. It has been suggested that children with varicella infection and a co-infection with streptococcal infections are prone to develop lupus anticoagulant24. Streptococcus pyogenes is an important bacterial pathogen of humans causing a variety of diseases, ranging from a mild phenotype to life threatening infections25. In this article we demonstrate that S. pyogenes surface protein H can interact with β2GPI and induces a conformational switch within this protein. This conformational switch is sufficient to induce auto-antibodies against
β2GPI in vivo. gwen m.a. van os
Results
26 It has been shown that β2GPI interacts with S. pyogenes . We have isolated different surface proteins from S. pyogenes and studied their interaction with plasma purified
β2GPI. Surface plasmon resonance studies revealed that β2GPI binds to all four tested S. pyogenes surface proteins: M1 protein (figure 1a), protein H (figure 1b), streptococcal collagen-like proteins A (figure 1c) and B (figure 1d) (SclA and SclB).
Biacore experiments with the individual domains of β2GPI revealed that interaction
sites were located within domains I and V of β2GPI for all four S. pyogenes proteins.
Competition experiments showed that the binding of protein H to β2GPI could be
44 inhibited completely by the addition of 10 mg/mL domain I of β2GPI but not with the same concentration of domain V suggesting that the interaction between protein H
and β2GPI predominantly takes place via domain I of β2GPI.
Binding to a negatively charged surface induces a conformational change within β2GPI, resulting in the exposure of the epitope that is recognized by the auto-antibodies. To
establish whether interaction of β2GPI with the four bacterial proteins coincides with
a conformational change, EM pictures were taken from β2GPI (figure 2a) and β2GPI after incubation with M1 protein (figure 2b), protein H (figure 2c), SclA (figure 2d) or SclB (figure 2e). M1 protein and protein H are linear proteins, whereas SclA 27 and SclB consist of a linear segment and an additional globular domain . β2GPI remained in a circular conformation when bound to M1 protein, SclA or SclB, but
after interaction with protein H, the conformation of β2GPI changed from a circular into a fish-hook shape conformation (figure 2c). The EM pictures of protein H and
β2GPI clearly showed that protein H binds with the first domain ofβ 2GPI, because the stretched end of the fish-hook interacts with protein H.
To further establish whether protein H induces a conformational change within
β2GPI, we determined if auto-antibodies isolated from patients could recognize
β2GPI bound to the bacterial proteins in solution. Total IgG was isolated from three different patients suffering from APS, coated on a microtiter plate and incubated with
plasma-purified β2GPI. No binding of plasma β2GPI could be observed. Additionally,
no binding of β2GPI to the patient antibodies could be recorded, when the antibodies
were incubated with β2GPI in combination with M1 protein, SclA or SclB. However,
the patient antibodies recognized plasma derived β2GPI in the presence of protein H
(figure 2f-h), indicating that after interaction with protein H, β2GPI changed its conformation from a circular to a fish-hook shape form thereby exposing the cryptic
epitope for the antibodies. Total IgG from patients’ plasmas negative for anti-β2GPI
but positive for anticardiolipin antibodies did not bind to β2GPI (figure 2i-k). induction of auto-antibodies against β2gpi
To determine if a conformational change of β2GPI is sufficient to induce the development of auto-antibodies against β2GPI, groups of 8 mice were injected at six successive time points for 4 weeks apart with the S. pyogenes surface proteins: M1 protein, protein H, SclA or SclB. The proteins were injected without any adjuvant. After the first boost, all mice started to develop antibodies directed against the injected respective bacterial protein (data not shown). After two protein boosts, mice challenged with protein
H developed anti-murine β2GPI IgM antibodies (figure 3b). After 4 protein boosts, mice injected with protein H developed anti-murine β2GPI IgGs. Anti-β2GPI IgG or
45 3
chapter
figure 1. Binding analysis of β2GPI to bacterial protein was investigated with surface plasmon resonance. β2GPI, domain I, domain II, domain IV and domain V were immobilized on C-1 sensor chips and binding of 50nM (A) M1 protein, (B) protein H, (C) SclA and (D) SclB was investigated by surface plasmon resonance. After adjusting for binding to a blank signal, the response of the bacterial proteins at equilibrium was determined and the amount of bound bacterial protein per fmol immobilized β2GPI or domain of β2GPI was calculated. gwen m.a. van os
IgM antibodies did not develop in mice injected with the other three proteins, not even after 6 boosts (figure 3a). None of the mice developed IgA antibodies against
murine β2GPI. The antibodies induced in the mice injected with protein H did not
only recognise murine β2GPI but also human β2GPI. This is not surprising because the overall identity between the proteins of both species is 76% and the cryptic epitope
in β2GPI for the auto-antibodies in domain I is completely conserved between human and mouse. This high identity enabled the analysis of the domain specificity of these
antibodies with recombinant domains of human β2GPI. The auto-antibodies against
β2GPI that developed in mice challenged with protein H were mainly directed against domain I (figure 3c). 46 The plasmas of the eight mice collected after booster 6 with protein H were pooled and total IgG was isolated. figure 3d shows that IgG derived from these mice prolonged the activated partial thromboplastin time (aPTT) when added to human
A figure 2a. The conformation
of β2GPI in the presence of bacterial proteins. Figure 2B-E Electron microscopy pictures, arrows point at
β2GPI. (A) Plasma β2GPI, in a circular conformation. Bar represents 100 nm. (B) First panel M1 protein, other
panels β2GPI incubated with
M1 protein, β2GPI remains in a closed conformation. (C) First panel protein H,
B remaining panels β2GPI incubated with protein H,
β2GPI is in the fish-hook conformation. (D) First panel C SclA, remaining panels
β2GPI incubated with SclA,
β2GPI remains in a closed conformation. (E) First panel D SclB, remaining panels
β2GPI incubated with SclB,
β2GPI remains in a closed E conformation. Bar in Figure E represents 25 nm. induction of auto-antibodies against β2gpi
plasma. No prolongation was observed with IgG from control mice. The prolongation induced by the added IgG disappeared when the aPTT was performed in the presence of high phospholipid concentrations, the classic confirmation of the presence of lupus anticoagulant activity. In contrast, no lupus anticoagulant was observed when a dilute Russell’s viper venom time (dRVVT) based assay was used (figure 3e). Total IgG was also isolated from pooled plasma of mice injected 6 times with M1 protein. These IgGs did not show LAC activity (data not shown).
47 3
chapter
figure 2b. Figure 2F- M: ELISA plates were coated with purified IgG from three different APS patients, three different SLE patient and pooled normal plasma (NPP), and a control plate was also coated with anti-β2GPI moAb. The plates were incubated with 1 µg/ml plasma β2GPI alone, in a 1:1 molar ratio with M1 protein, protein H, SclA or SclB, or with the individual bacterial proteins.
Binding of β2GPI was measured with a polyclonal anti-β2GPI antibody. gwen m.a. van os
48
figure 3. Mice were injected 6 times four weeks apart with bacterial proteins. Blood was drawn
before injection and 2 weeks after each injection. (A) The level of anti-β2GPI IgG after 6 boosts with
a bacterial protein. (B) Development in time of the levels of anti-β2GPI antibodies after injection
with protein H. (C) Domain specificity of the anti-β2GPI antibodies in mice injected with protein H after 6 protein boosts. (D) aPTT and (E) dRVVT after addition of 10 µg/ml mouse IgG purified from mice injected with protein H or normal pooled mouse IgG to human plasma. Data are presented as mean + standard deviation. induction of auto-antibodies against β2gpi
The total IgG isolated from the pooled plasma of mice injected with protein H was coated to ELISA wells. As a control, a murine monoclonal antibody (moAb) against human β2GPI was used that recognized both fish-hook shape and circular β2GPI.
The IgG from mice injected with protein H did not recognize plasma derived β2GPI, whereas interaction was found when the IgGs were incubated with β2GPI that was converted into a fish-hook like structure (figure 4). The control antibody recognized both plasma β2GPI and fish-hook shape β2GPI at a comparable level. These data indicate that the antibodies present in mice boosted with protein H recognize a cryptic epitope in plasma β2GPI.
Mice developed auto-antibodies towards their own β2GPI upon challenge with protein 49 H of S. pyogenes. To determine if there is a similar mechanism in humans, anti-protein 3
H and anti-β2GPI IgG were measured in patients that suffered from S. pyogenes infections. Samples were collected from three different patient groups: patients with sepsis, erysipelas and pharyngotonsillitis. Three out of 13 patients with sepsis were chapter positive for anti-β2GPI antibodies and anti-protein H antibodies (Table 1). Of the 19 erysipelas patients included in this study, 6 were positive for both anti-β2GPI IgG and antibodies towards protein H. Of the 6 pharyngotonsillitis patients, 4 were positive for both anti-β2GPI antibodies and anti-protein H antibodies. The anti-β2GPI IgG in these four patients were mainly directed against the first domain ofβ 2GPI (figure 5).
figure 4. Control monoclonal antibody anti-β2GPI or IgG from mice that were immunized with protein H were coated on an ELISA plate and incubated with either circular or fish-hook shape
β2GPI. Binding of β2GPI was determined with a polyclonal antibody directed against β2GPI. As a
control, a moAb anti-domain I anti-β2GPI antibody (3B7) was used. This antibody recognizes both
circular and fish-hookβ 2GPI. gwen m.a. van os
table 1. The presence of anti-protein H and
anti-β2GPI IgG and IgM was determined in three patient groups with a Streptococcus pyogenes infection: sepsis, erysipelas and pharyngotonsillitis.
50
Negative anti-protein H IgG/M &
Negative anti-β2GPI IgG/M 1 6 2 Positive anti-protein H IgG/M &
Negative anti-β2GPI IgG/M 9 7 0 Negative anti-protein H IgG/M &
Positive anti-β2GPI IgG/M 0 0 0 Positive anti-protein H IgGM &
Positive anti-β2GPI IgG 3 6 4
figure 5. The presence of anti-β2GPI antibodies in human with S. pyogenes infection.
Domain specificity of anti-β2GPI IgG of pharyngotonsillitis patients. induction of auto-antibodies against β2gpi
discussion
A role for infections in the development of antiphospholipid antibodies has been an important topic of investigation over the years12-20. In this paper we describe for the first time thein vivo development of auto-antibodies towards a cryptic epitope within native β2GPI. The interaction of protein H from S. pyogenes with plasma derived β2GPI resulted in a conformational change in β2GPI. The conformational change resulted in the exposure of an epitope in domain I of β2GPI which is normally shielded from the circulation. Domain I is of particular interest because this epitope is recognized by auto-antibodies identified in patients with APS with the highest correlation with 9,27 thrombosis . Exposure of this cryptic epitope in β2GPI due to binding of protein 51
H to β2GPI resulted in the development of auto-antibodies against β2GPI in all 8 3 mice injected with protein H. The observations made in this mouse model were supported in individuals with S. pyogenes infections where the presence of anti-β2GPI antibodies coincides with antibodies against protein H. Thirteen out of 32 patients chapter with S. pyogenes infection developed both anti-β2GPI antibodies and anti-protein
H antibodies. No individuals were found with anti-β2GPI antibodies but without anti-protein H antibodies. The percentage of individuals positive for anti-β2GPI antibodies was the highest in the group suffering from pharyngotonsillitis. Due to intracellular survival in the throat, S. pyogenes could establish a reservoir of bacteria causing recurrent pharyngotonsillitis infections28. We hypothesize that recurrent or long lasting infections are a necessary condition to induce anti-β2GPI antibodies. It remains to be determined if these infections result in transient or persistent anti-β2GPI antibodies. Although it is generally accepted that transient anti-cardiolipin antibodies are not a risk factor for thrombosis29, no information is available whether there is a difference in risk between transient or permanent presence of auto-antibodies against
β2GPI except for the time period that they circulate. It has been shown that antibodies against β2GPI that are present in patients with cytomegalovirus infections correlate with thrombosis30,31.
The anti-β2GPI antibodies found in mice after injection with protein H possessed lupus anticoagulant activity when measured in an aPTT based assay but not when measured with a dRVVT (figure 3d and e). There is ample evidence that many APS patients are only positive in coagulation tests representing the intrinsic coagulation system, probably because the aPTT used is very sensitive for lupus anticoagulant32. Alternatively, lupus anticoagulant activity is caused by a heterogeneous population of antibodies and we may have induced a specific aPTT-dependent lupus anticoagulant activity by injection mice with protein H. gwen m.a. van os
Many studies have shown that the presence of anti-β2GPI auto-antibodies is associated with infections in mice. The prevailing theory to explain this correlation is molecular mimicry. Sequence similarities between foreign and self proteins are sufficient to induce a loss of immune tolerance resulting in the formation of auto-antibodies. The group of
Shoenfeld has shown homology between the peptide TLRVYK in domain III of β2GPI and various microbial agents and the presence of these antibodies in mice resulted in fetal resorption14. The importance of these observations for the human situation is questionable, since there are no indications that antibodies against domain III correlate with increased thrombotic manifestations and their presence only weakly correlates with recurrent spontaneous abortions in patients with APS33. In another study, Gharavi 52 et al.34 injected mice with a peptide derived from cytomegalovirus with homology to
an amino acid sequence present in domain V of β2GPI. They found the induction
of IgM antibodies directed against β2GPI with functional properties comparable as found in APS. However, these antibodies were not observed in patients with acute cytomegalovirus infections35. In a third study, Krause et al.15 identified cross reactivity
between antibodies against the cell wall of Saccharomyces cerevisiae and β2GPI in patients with APS. However, the presence of these antibodies was not associated with any specific manifestations of APS. Sequence analysis showed a complete lack
of homology between protein H and β2GPI. Moreover, the epitope within domain I is not linear, but a 3D conformational epitope created by the constraints of two disulphide bridges within this domain. It is unlikely that domains of protein H have
adopted the short consensus repeat (SCR)-like conformation of domain I of β2GPI, because protein H lacks disulphide bridges. Moreover, oxidized recombinant domain
I of β2GPI, but not reduced recombinant domain I, was recognized by APS patient antibodies, indicating the importance of intact disulphide bridges in the recognition of 36 domain I of β2GPI by patient antibodies . Altogether, it seems highly unlikely that the antibody development after injection with protein H was due to molecular mimicry.
Rose37 suggested that infectious agents can serve as adjuvant. An important role of an adjuvant in the induction of antibodies is the unfolding of the injected protein, resulting in the exposure of antigenic epitopes normally shielded from the circulation38. Here we show that this mechanism can also induce the development of auto-antibodies
against the self-protein β2GPI. A problem in the understanding of the link between infection and autoimmunity is the observation that many different infections can induce the same autoimmune condition. Indeed, at least 14 distinct micro-organisms have been associated with the etiology of antiphospholipid antibodies13. We recently reported that binding to anionic phospholipids resulted in a conformational change 12 in β2GPI . Recently we have found that binding of LPS also induces a conformational 39 change in β2GPI . It has been shown previously that injection with LPS leads to the 40 development of auto-antibodies towards β2GPI in rabbits . We have now identified
protein H as a third inducer of a conformational change in β2GPI. We hypothesize that induction of auto-antibodies against β2gpi
53 3
chapter
figure 6. Schematic representation of the etiology of anti-β2GPI antibodies. β2GPI exists in plasma in the circular conformation. When β2GPI comes into contact with bacteria, the surface protein H from S. pyogenes can alter the conformation of β2GPI to a fish-hook conformation. In this fish-hook shape conformation a cryptic epitope becomes exposed. During a long lasting infection and probably repetitive interactions between β2GPI and protein H, the fish-hook shape conformation of
β2GPI triggers the immune system, resulting in the development of antibodies towards this cryptic epitope in domain I of β2GPI. We kindly acknowledge A. Barendrecht for the creation of this figure. gwen m.a. van os
other (bacterial, viral, parasite or self) proteins or anionic phospholipids exposed on apoptotic cells or microparticles could also induce this conformational change and we
speculate that proteins present on other microorganisms may also bind to β2GPI and
induce a conformational change. We propose that the conformational change in β2GPI
is the common denominator in the development of auto-antibodies against β2GPI.
Recently, we have found that M1 protein and protein H of S. pyogenes bind full-length
β2GPI and thereby prevent the processing of β2GPI by proteases from neutrophils into antibacterial peptides24. Here we provide evidence that the body has developed an alternative strategy to fight S. pyogenes infection. The induction of auto-antibodies
54 could help the plasma proteins in their defense mechanism. Antibodies towards β2GPI could support the immune system by a stimulating role in the clearance of apoptotic
cells. The presence of anti-β2GPI antibodies increased the rate of clearance of phosphatidylserine exposing bodies more than two fold41,42. This theory is supported by the frequently detected prolonged aPTT in children with recent infections43 and
the presence of transient anti-β2GPI antibodies and anti-cardiolipin antibodies assays in infectious diseases44. In a recent commentary in Blood, Greinacher suggested that positively charged plasma proteins with a poorly understood function, such as
β2GPI and Platelet Factor 4, may be representatives of an up to now unrecognized charge-related system in host defense45.
figure 6 represents a schematic representation of our current view on the development
of anti-β2GPI antibodies. β2GPI is present in plasma in a circular conformation. A lasting infection with S. pyogenes can lead to the interaction of the surface protein H
and β2GPI. This interaction leads to a conformational change in β2GPI to the fish-hook
shape. Fish-hook shaped β2GPI reveals a cryptic epitope which is normally shielded from the circulation. This (repetitive) exposure of the cryptic epitope induces the
development of anti-β2GPI antibodies.
MATERIALS AND METHODS
Proteins and purification
46 Human β2GPI was purified as previously described . Plasma purified β2GPI had a
closed conformation as shown by electron microscopy. Closed β2GPI was converted into the fish-hook conformation by dialysing it against 20mM Hepes (N-2-hydroxyeth- ylpiperazine-N’-2-ethanesulfonic acid) containing 1.15M NaCl, pH 11.5, for 48 hours at 4°C followed by dialysis with 20mM Hepes, 150mM NaCl, pH 7.4 (10). cDNA
of murine β2GPI was commercially obtained (Genescript, Piscataway NJ; USA). The cDNA was subcloned into the expression vector HisN-Tev (Promega, Madison, WI; induction of auto-antibodies against β2gpi
USA) and expressed in HEK293E cells. Murine β2GPI was purified via its His-tag with Nickel-Sepharose beads and eluted by 25 mM Tris(hydroxymethyl)aminomethane,
500 mM NaCl and 500 mM imidazole, pH 8.2. Human β2GPI cDNA was used for 6 the construction of the individual domains I, II, IV and V of β2GPI as described . M1 protein, protein H, Scl A and Scl B were purified as described earlier47-49. Protein concentrations were determined using the bicinchoninic acid protein assay (Thermo Fisher Scientific LSR; Rockford, IL; USA).
Surface plasmon resonance
Surface plasmon resonance was performed using a BIAcore 2000 (GE Healthcare, 55
Piscataway, NJ; USA). Purified human derived β2GPI or recombinant domain I, 3 domain II, domain IV and domain V were immobilized on an activated C-1 sensor chip according to manufacturer’s instructions. Binding to the proteins was corrected for non-specific binding to an unmodified control channel. M1 protein, protein H, chapter SclA or SclB in various protein concentrations in a buffer containing 20 mM Hepes, 150 mM NaCl, 15 µM ZnCl2, 0.005% Tween-20, pH 7.4 (flow buffer), were injected for 3 minutes at a flow rate of 30 μl/min. The dissociation was followed for a period of 10 minutes. Regeneration of the sensor chip was achieved by a 30 seconds wash of 1/6 ionic buffer (92 mM KSCN, 0.366 M MgCl2, 0.184 M Urea, 0.366 M Guanidine) and subsequent equilibration with flow buffer.
IgG purification of APS patients
Anti-β2GPI antibodies from 3 individual APS patients’ sera were purified by applying sera, diluted 1:4 in phosphate buffered saline (PBS), to a HiTrap Protein G column (GE Healthcare). Subsequently, the column was washed with 25 ml PBS and eluted with 25 ml 0.5 M acetic acid, pH 2.8. Eluted samples were dialyzed against PBS and stored at -20°C for analysis. The patient plasmas were positive for both lupus anticoagulant and anti-β2GPI antibodies. The presence of lupus anticoagulant and 50 anti-β2GPI IgG and IgM was detected as described . Patient samples were collected with approval of the local ethics committee of the University Medical Center Utrecht. Informed consent was obtained in accordance with the Declaration of Helsinki.
Negative staining transmission electron microscopy
β2GPI in TBS buffer, pH 7.4, was analyzed by negative staining electron microscopy as 51 described previously . Solutions of β2GPI (5-10 nM) with or without pre-incubation with M1 protein, protein H, SclA or SclB were placed on a carbon coated copper grid and negatively stained with uranyl formate. gwen m.a. van os
Immunosorbent assay with patient antibodies
NUNC MaxiSorpTM High Protein-Binding Capacity ELISA plates (Nalge Nunc International, Denmark) were coated with 5 µg/ml purified IgG isolated from plasmas of three APS patient in 50 mM carbonate buffer, pH 9.6, 100 μl in each well overnight at 4°C. After washing with TBS-T (50 mM Tris, 150 mM NaCl and 0.1% Tween-20, pH 7.4, wash buffer) the plates were blocked with 250 µl 2% BSA
in TBS-T (block buffer) for 1h at 37°C. After washing, 100 μl 1 µg/ml β2GPI was incubated per well alone or in combination with 1 μg/ml protein H, M1 protein, SclA
or SclB. β2GPI was detected by an in house polyclonal rabbit anti-β2GPI antibody and a peroxidase-conjugated anti-rabbit antibody (DAKO Ltd, Cambridgeshire, United 56 Kingdom). Peroxidase activity was measured by addition of 100 μl per well of TMB substrate (Tebu-bio laboratories, Le-Perray-en-Yvelines, France), color development was stopped by adding 50 μl of 1 M sulphuric acid to each well. The optical density was measured at 450nm with a spectrophotometer (Molecular Devices Ltd, Berkshire, UK).
Immunisation protocol
Forty-eight BALB/c cAnNCrl mice (Charles River Laboratories, France) were injected intraperitoneally every 4 weeks with 200 µl PBS containing 25 µg human serum albumin, M1 protein, protein H, SclA, SclB or buffer in the absence of any adjuvant. Two weeks previous to the first protein boost and every 2 weeks after the boosts, 200 µl blood was drawn in 3.2% citrate via the submandibular veins. Each mouse was boosted 6 times. Two weeks after the last protein boost the mice were sacrificed and blood was collected in 3.2% citrate via a heart puncture. All experimental protocols were approved by the institutional Animal Care and Use committee of the University Medical Center Utrecht.
Characterization of mouse antibodies
Hydrophobic Costar 2595 plates (Costar, Cambridge, MA; USA) were coated with 1 μg/ml protein H, M1 protein, SclA or SclB diluted in TBS (20 mM Tris, 150 mM NaCl, pH 7.4). Hydrophilic Costar 9102 plates were coated with 5 μg/ml recombinant
mouse or plasma purified human β2GPI. After washing with wash buffer, the plates were blocked with 200 ml block buffer for 1h at room temperature. After washing, 100 µl of 1:100 diluted mouse plasma in TBS high salt (50 mM Tris, 500 mM NaCl, pH 7.4) was applied. After washing, 100 µl of 1:5000 anti-mouse IgG (Jackson Immunoresearch laboratories, West Grove, PA, USA) in block buffer was applied to each well. After removal of unbound antibodies by washing with wash buffer, peroxidase activity of the bound antibody was measured as described above. Human
and mouse β2GPI were also coated on a 9102 costar plate and tested in the same induction of auto-antibodies against β2gpi
protocol as described for the presence of anti-β2GPI antibodies. The mouse plasma was also tested for the presence of anti-β2GPI IgM and IgA (both from Sigma Aldrich, St. Louis, MO, USA). Hydrophobic Costar 2595 plates (Costar, Cambridge, MA, USA) were coated with recombinant human domain I, domain II, domain IV, domain V or domain III-V in 50 mM carbonate buffer pH 9.6, 100 µl in each well overnight at 4°C, and tested in the same protocol as described for the presence of anti-β2GPI antibodies.
Mouse IgG isolation
Plasmas of mice injected 6 times with protein H were pooled, diluted 1:10 in TBS, and 57 applied to a Protein G column (GE Healthcare). Subsequently, the column was washed 3 with 15 ml of TBS and eluted with 0.1 M glycine, pH 2.4. Fractions containing IgG were pooled and dialysed against TBS. This was also done for non-immunized pooled mouse plasma. IgG (5 µg/ml, 100 µl) was coated in 100mM NaHCO3 in NUNC chapter MaxiSorpTM High Protein-Binding Capacity ELISA plates (Nalge Nunc International) overnight at 4°C. After washing with wash buffer, the plates were blocked with block buffer for 1h at 37°C. After washing, 100 μl 1 µg/ml of either fish-hook shape or circular β2GPI was incubated for 2 hours and β2GPI was detected by a polyclonal 10 anti-β2GPI HRP conjugated antibody (Cedarlane laboratories, Ontario, Canada) .
Coagulation assays
Both an activated partial thromboplastin time (aPTT) and a diluted Russell’s viper venom time (dRVVT) clotting assay were used to analyze the anticoagulant activity of mouse IgG. The aPTT was measured with PTT-LA (Diagnostica Stago, Gennevilliers, France) and Actin FS (Siemens Healthcare Diagnostics, Marburg; Germany). The dRVVT was measured by LA-1 and LA-2 (both from Siemens Healthcare Diagnostics). All coagulation measurements were carried out in a coagulometer (KC 10, Amelung, Lemgo; Germany). First, 50 µl of normal pooled plasma (pool of 200 healthy volunteers) was mixed with 10 µg/ml of mouse IgG. This was incubated at 37°C for 2 minutes; subsequently 50 µl PTT-LA or Actin FS was added and incubated for 2 minutes. Coagulation was initiated by the addition of 50 µl of CaCl2 (25 mM) and clotting time was recorded. For the dRVVT, first 50 µl of normal pooled plasma was mixed with 10 µg/ml mouse IgG. This was incubated at 37°C for 2 minutes; subsequently the dRVVT mixture (at 37°C) was added and clotting time was recorded.
Patient samples
Serum samples were collected from patients treated at the Clinic for Infectious Diseases, Lund University Hospital, Lund, Sweden. Thirteen patients had S. pyogenes gwen m.a. van os
bacteraemia, and four of these presented with streptococcal toxic shock syndrome (STSS) including circulatory failure. Six patients with pharyngotonsillitis were included in the study. Acute-phase serum (days 1-3 after onset of symptoms) were collected from all patients. Nineteen patients treated for erysipelas were also sampled. They had typical signs of a bacterial skin infection, with fever and a rapid spreading of a painful erythema on a lower limb or arm. From these patients, acute-phase sera were collected between days 0 and 5 after onset of symptoms. The study was approved by the Research Ethics Committee of Lund University. For these patient
samples, the presence of anti-protein H or anti-β2GPI IgGs was determined according to the same protocol as for the mice, except for the use of conjugated anti-human IgG 58 alkaline phosphatase (Sigma). The plasmas from the pharyngotonsillitis patients were
also tested for β2GPI domain specificity. Patients were considered to be positive for antibodies when the antibody level exceeded the mean + 3 SD of a plasma pool of 40 healthy individuals. induction of auto-antibodies against β2gpi
ReferenceS
1. Levine JS, Branch DW, Rauch J. The antiphospholipid syndrome. N Engl J Med. 2002; 346: 752-63 2. Galli M, Comfurius P, Maassen C, Hemker HC, de Baets MH, van Breda-Vriesman PJ, Barbui T, Zwaal RF, Bevers EM. Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma protein cofactor. Lancet. 1990; 335: 1544-47 3. McNeil HP, Simpson RJ, Chesterman CN, Krilis SA. Anti-phospholipid antibodies are directed against a complex antigen that includes a lipid-binding inhibitor of coagulation: beta 2-glycoprotein I (apolipoprotein H). Proc Natl Acad Sci U S A. 1990; 87: 4120-24 4. Bouma B, de Groot PG, van den Elsen JM Ravelli RB, Schouten A, Simmelink MJ, Derksen RH, Kroon J, Gros P. Adhesion mechanism of human beta(2)-glycoprotein I to phospholipids based on its crystal structure. EMBO J. 1999; 18: 5166-74. 5. Schwarzenbacher R, Zeth K, Diederichs K Gries A, Kostner GM, Laggner P, Prassl R. Crystal structure of human 59 beta2-glycoprotein I: implications for phospholipid binding and the antiphospholipid syndrome. EMBO J. 1999;
18: 6228-39 3
6. Iverson GM, Victoria EJ, Marquis DM. Anti-beta2 glycoprotein I (beta2GPI) autoantibodies recognize an epitope on the first domain of beta2GPI. Proc Natl Acad Sci U S A. 1998; 95: 15542-46
7. de Laat B, Derksen RH, Urbanus RT, de Groot PG. IgG antibodies that recognize epitope Gly40-Arg43 in chapter domain I of beta 2-glycoprotein I cause LAC, and their presence correlates strongly with thrombosis. Blood. 2005; 105: 1540-44 8. Ioannou Y, Pericleous C, Giles I Latchman DS, Isenberg DA, Rahman A. Binding of antiphospholipid antibodies to discontinuous epitopes on domain I of human beta(2)-glycoprotein I: mutation studies including residues R39 to R43. Arthritis Rheum. 2007; 56: 280-90 9. Iverson GM, Reddel S, Victoria EJ Cockerill KA, Wang YX, Marti-Renom MA, Sali A, Marquis DM, Krilis SA, Linnik MD. Use of single point mutations in domain I of beta 2-glycoprotein I to determine fine antigenic specificity of antiphospholipid autoantibodies. J Immunol. 2002; 169: 7097-03
10. Ağar C, van Os GM, Morgelin M, Sprenger RR, Marquart JA, Urbanus RT, Derksen RH, Meijers JC, de Groot PG. Beta2-glycoprotein I can exist in 2 conformations: implications for our understanding of the antiphospholipid syndrome. Blood. 2010; 116: 1336-43 11. de Laat B, Derksen RH, van Lummel M Pennings MT, de Groot PG. Pathogenic anti-beta2-glycoprotein I antibodies recognize domain I of beta2-glycoprotein I only after a conformational change. Blood. 2006; 107: 1916-24 12. Sène D, Piette JC, Cacoub P. Antiphospholipid antibodies, antiphospholipid syndrome and infections. Autoimmun rev. 2008; 7: 272-77 13. von Landenberg P, Lehmann HW, Knöll, A Dorsch S, Modrow S. Antiphospholipid antibodies in pediatric and adult patients with rheumatic disease are associated with parvovirus B19 infection. Arthritis Rheum. 2003; 48: 1939–47 14. Frauenknecht K, Lackner K, von Landenberg P. Antiphospholipid antibodies in pediatric patients with prolonged activated partial thromboplastin time during infection. Immunobiol. 2005; 210: 799-05 15. Brito P, Penas S, Carneiro A, Palmares J, Reis FF. Spectral-domain optical coherence tomography features of acute syphilitic posterior placoid chorioretinitis: the role of autoimmune response in pathogenesis. Case Report Ophthalmol. 2011; 1: 39-44 16. Galrão L, Brites C, Atta ML, Atta A, Lima I, Gonzalez F, Magalhães F, Santiago M. Antiphospholipid antibodies in HIV-positive patients. Clin Rheumatol. 2007; 11: 1825-30 17. Koutroubakis IE, Petinaki E, Anagnostopoulou E, Kritikos H, Mouzas IA, Kouroumalis EA, Manousos ON. Anti-cardiolipin and Anti-β2-glycoprotein I Antibodies in Patients with Inflammatory Bowel Disease. Dig Dis Sci. 1998: 11; 2507-12 18. Boin, F, Franchini, S, Colantuoni, E Rosen A, Wigley FM, Casciola-Rosen L. Independent association of anti– β2-glycoprotein I antibodies with macrovascular disease and mortality in scleroderma patients. Arthr Rheum. 2009; 60: 2480–89 gwen m.a. van os
19. Santiago M, Martinelli R, Ko A, Reis EA, Fontes RD, Nascimento EG, Pierangeli S, Espinola R, Gharavi A. Anti-beta2 glycoprotein I and anticardiolipin antibodies in leptospirosis, syphilis and Kalaazar. Clin Exp Rheumatol. 2001; 19: 425–30 20. Huh JY, Yi DY, Hwang SG, Choi JJ, Kang MS. Characterization of antiphospholipid antibodies in chronic hepatitis B infection. 2011. Korean J Hematol. 2011: 46; 36-40 21. Sherer Y, Blank M, Shoenfeld Y. Antiphospholipid syndrome (APS): where does it come from? Best Practice & Research Clinical Rheumatology. 2007; 21: 1071-8 22. Blank M, Krause I, Fridkin Keller N, Kopolovic J, Goldberg I, Tobar A, Shoenfeld Y. Bacterial induction of autoantibodies to beta2-glycoprotein-I accounts for the infectious etiology of antiphospholipid syndrome. J Clin Invest. 2002; 109: 797-04 23. Krause I, Blank M. Cervera R. Font J, Matthias T, Pfeiffer S, Wies I, Fraser A, Shoenfeld Y. Cross-reactive epitopes on beta2-glycoprotein-I and Saccharomyces cerevisiae in patients with the antiphospholipid syndrome. Ann N Y 60 Acad Sci. 2007; 1108: 481-88 24. Manco-Johnson MJ, Nuss R, Key N Moertel C, Jacobson L, Meech S, Weinberg A, Lefkowitz J. Lupus anticoagulant and protein S deficiency in children with postvaricella purpura fulminans or thrombosis. J Pediatr. 1996; 128: 319-23 25. American academy of Pediatrics. Group A Streptococcal infections. In: Pickering LK, Kimberlin DW, Lorber M. eds 2003 Red Book: report of committee of infectious diseases, 26th ed. Elk Grove Village, IL. Page 616-28 26. Nilsson M, Wasylik S, Morgelin M Olin AI, Meijers JC, Derksen RH, de Groot PG, Herwald H, The antibacterial activity of peptides derived from human beta-2 glycoprotein I is inhibited by protein H and M1 protein from Streptococcus pyogenes. Mol Microbiol. 2008; 67: 482-92 27. Pahlman LI, Marx PF, Morgelin M Lukomski S, Meijers JC, Herwald H. Thrombin-activatable fibrinolysis inhibitor binds to Streptococcus pyogenes by interacting with collagen-like proteins A and B. J Biol Chem .2007;282:24873-81. 28. Osterlund A, Popa R, Nikkila T Scheynius A, Engstrand L. Intracellular reservoir of Streptococcus pyogenes in vivo: a possible explanation for recurrent pharyngotonsillitis. Laryngoscope. 1997; 107: 640-47 29. Uthman IW, Gharavi AE. Viral infections and antiphospholipid antibodies. Semin Arthritis Rheum. 2002;31:256-63. 30. Asherson RA, Cervera R. Microvascular and microangiopathic antiphospholipid-associated syndromes (“MAPS”): Semantic or antisemantic? Autoimmun R. 2008: 7; 164-67 31. Delbos V, Abgueguen P, Chennebault JM, Pichard E. Acute cytomegalovirus infection and venous thrombosis: Role of antiphospholipid antibodies. J Infect. 2007: 54; e47-e50 32. Pengo V, Tripodi A, Reber G, Rand JH, Ortel TL, Galli M, de Groot PG. Update of the guidelines for lupus anticoagulant detection. Subcommittee on Lupus Anticoagulant/Antiphospholipid Antibody of the Scientific and Standardisation Committee of the International Society on Thrombosis and Haemostasis. J Thromb Haemost 2009; 7: 1737-40 33. Blank M, Shoenfeld Y, Cabilly S Heldman Y, Fridkin M, Katchalski-Katzir E. Prevention of experimental antiphospholipid syndrome and endothelial cell activation by synthetic peptides. Proc Natl Acad Sci U S A 1999; 96: 5164-68 34. Gharavi AE, Pierangeli SS, Espinola RG Liu X, Colden-Stanfield M, Harris EN. Antiphospholipid antibodies induced in mice by immunization with a cytomegalovirus-derived peptide cause thrombosis and activation of endothelial cells in vivo. Arthritis Rheum 2002; 46: 545-52 35. Orts J, Colomina J, Zuniga A Guerrero A. Cytomegalovirus infection and antiphospholipid syndrome in humans. Arthritis Rheum. 2003; 48: 3296-97 36. Pozzi N, Banzato A, Bettin S Bison E, Pengo V, De Fillippis V. Chemical synthesis and characterization of wild-type and biotinylated N-terminal domain 1-64 of beta2-glycoprotein I. Protein Sci. 2010; 19: 1065-78 37. Rose NR. Molecular autoimmunity. San Diego; Academic Press Inc; 1991. 38. Maas C, Hermeling S, Bouma B Jiskoot W, Gebbink MF. A role for protein misfolding in immunogenicity of biopharmaceuticals. J Biol Chem. 2007; 282: 2229-36 induction of auto-antibodies against β2gpi
39. Agar C, de Groot PG, Mörgelin M, Monk SD, van Os GM, Levels JH, de Laat B, Urbanus RT, Herwald H, van der Poll T, Meijers JC. {beta}2-glycoprotein I: a novel component of innate immunity. Blood. 2011; 117: 6939 -6947 40. Gotoh M, Matsuda J. Induction of anticardiolipin antibody and/or lupus anticoagulant in rabbits by immunization with lipoteichoic acid, lipopolysaccharide and lipid A. Lupus. 1996; 6: 593-97 41. Dombroski D, Balasubramanian K, Schroit AJ. Phosphatidylserine expression on cell surfaces promotes anti- body-dependent aggregation and thrombosis in beta2-glycoprotein I-immune mice. J Autoimmun 2000; 14: 221-29
42. Balasubramanian K, Schroit AJ. Characterization of Phosphatidylserine-dependent β2-Glycoprotein I Macrophage Interactions. J Biol Chem. 1998; 273: 29272-77 43. Gallistl S, Muntean W, Leschnik B, Meyers W. Longer aPTT values in healthy children than in adults: no single cause. Thromb Res. 1997; 88: 355-59 44. Galli M, Barbui T. Antiphospholipid syndrome: clinical and diagnostic utility of laboratory tests. Semin Thromb 61 Hemost. 2005; 31: 17-24 3 45. Greinacher A. Opposites attract. Blood. 2010; 115: 440-41 46. Horbach DA, van Oort E, Donders RC Derksen RH, de Groot PG. Lupus anticoagulant is the strongest risk
factor for both venous and arterial thrombosis in patients with systemic lupus erythematosus. Comparison chapter between different assays for the detection of antiphospholipid antibodies. Thromb Haemost. 1996; 76: 916-24. 47. Åkesson P, Schmidt KH, Cooney J, Björck L. M1 protein and protein H: IgGFc- and albumin-binding streptococcal surface proteins encoded by adjacent genes. Biochem J. 1994; 300: 877-86 48. Åkesson P, Cooney J, Kishimoto F, Björck L. Protein H- a novel IgG binding bacterial protein. Mol immunol. 1990; 27: 523-31 49. Påhlman LI, Marx PF, Morgelin M Lukomski S, Meijers JC, Herwald H. Thrombin-activatable Fibrinolysis Inhibitor Binds to Streptococcus pyogenes by Interacting with Collagen-like Proteins A and B. Journ Biol Chem. 2007; 282: 24873-81 50. Urbanus RT, Siegerink B. Roest M Rosendaal FR, de Groot PG, Algra A. Antiphospholipid antibodies and risk of myocardial infarction and ischaemic stroke in young women in the RATIO study: a case-control study. Lancet Neurol. 2009; 8: 998-1005 51. Engel J, Furthmayr H. Electron microscopy and other physical methods for the characterization of extracellular matrix components: laminin, fibronectin, collagen IV, collagen VI, and proteoglycans. Methods Enzymol. 1987; 145: 3-78
Chapter 4
β2-Glycoprotein I has a protective function in situations of hyper-responsive von Willebrand Factor: Implications for TTP
Vivian Du, Gwen M.A. van Os, Johanna A. Kremer Hovinga, Ilze Dienava, Jacques Wollersheim, Rob Fijnheer, Philip G. de Groot, Bas de Laat
Submitted for publication gwen m.a. van os
ABSTRACT
Recently, it has been shown that β2-glycoprotein I (β2GPI) binds to von Willebrand Factor (VWF) when it is in its GPIbα binding conformation (active VWF), thereby impairing the platelet binding capacity of VWF. Given the presence of active VWF multimers in TTP, we speculated on a
role for β2GPI in acute TTP. β2GPI plasma levels were measured in patients during an acute attack of TTP (n=38) and in patients with a history of
TTP (n=34). Median β2GPI plasma levels in TTP patients during acute TTP episodes and in remission were 95 ± 46 µg/mL and 163 ± 80 µg/ mL, respectively, while healthy controls showed significantly higher values 64 (median 220 ± 99 µg/mL). In addition it was found that the increased
amount of β2GPI bound to circulating erythrocytes and platelets blood of healthy individuals incubated with active VWF or in blood from patients with an acute episode of TTP. When platelets were perfused over cultured
endothelial cells, β2GPI was able to inhibit platelet adhesion to VWF strings released from these endothelial cells. The inhibition of platelet adhesion
was dependent on domain I of β2GPI. Our findings suggest that β2GPI can inhibit spontaneous platelet adhesion to active VWF, which might result in a decreased disease activity.
protective function of β2gpi in ttp
Introduction
Thrombotic thrombocytopenic purpura (TTP) was first described by Moschowitz as a life-threatening disease1 characterized by thrombocytopenia, microangiopathic hemolytic anaemia, fever, renal and neurological manifestations2. In the majority of cases the disease is the result of a severe deficiency of ADAMTS13 activity due to the presence of circulating inhibitory autoantibodies3. VWF is stored in endothelial cells within the Weibel-Palade bodies as ultra large (UL) multimers. When released, the UL multimers are processed by ADAMTS13. ADAMTS13 deficiency results in increased levels of UL VWF multimers in the circulation. These UL VWF multimers can bind platelets spontaneously via the A1 domain of VWF. Our knowledge on TTP and its association with the absence of ADAMTS13 activity has increased significantly the last years, although the pathophysiology of TTP is still not completely understood. A severe ADAMTS13 deficiency is found in the majority of patients clinically diagnosed with TTP but the absence of ADAMTS13 activity does not automatically result in TTP-like clinical symptoms. In addition, clinical remission can be achieved in patients 65 suffering from an acute TTP episode despite a persistently severe ADAMTS13 4 deficiency4. Together this suggests that additional factors that can regulate VWF activity. chapter
Recently, we have shown that β2-glycoprotein I (β2GPI), a protein abundantly present in plasma, is able to inhibit platelet deposition to VWF by binding to the A1 5 domain of VWF, the GPIbα binding site . Furthermore, β2GPI appeared to have an approximately one-hundred fold higher affinity for VWF in its active GPIbα binding conformation than in its native conformation6. It has been shown that the nanobody AU/VWFa-11, a llama derived VHH that only recognizes VWF in its GPIb binding conformation, recognized all VWF multimers from TTP patients in a gel-based assay, thereby suggesting that A1 domains present in all multimers of VWF circulating in a TTP patient are at least partly in its GPIα binding conformation5.
RESULTS
β2GPI levels in plasmas of 38 patients with an acute TTP episode (UMC Utrecht population) were lower compared to healthy controls (95 ± 50 vs 220 ± 98 µg/mL, p<0.01) (figure 1a). The TTP patient population from Geneva was divided into two groups based on Bethesda score. The patients with a Bethesda score > 3 has significantly lower β2GPI levels compared to patients with a Bethesda score between 1 and 2 (119 ± 74 vs. 86 ± 36 µg/mL, p<0.05) (figure 1b) Patients suffering with a history of more than one TTP attack showed lowered β2GPI levels in plasma compared to patients in remission experiencing a single TTP attack (175 ± 65 vs. 138 ± 16 µg/ gwen m.a. van os
mL p= 0.28) (figure 1c). β2GPI plasma levels were also lower in 34 TTP patients in remission (Utrecht cohort) than in the healthy population (163 ± 80 vs. 220 ± 99 µg/mL, p<0.05). From eight patients plasma samples were obtained both during an acute episode (95 ± 46 µg/mL) and after the remission (155 ± 40 µg/mL, p<0.05). We
observed an increase in β2GPI plasma levels when these patients achieved remission (figure 1d).
We observed a positive correlation between ADAMTS13 activity and β2GPI levels in TTP patients in remission (Pearson r=0.51, p<0.01, figure 2a). Although no
66
figure 1. β2GPI plasma levels in TTP patients and healthy controls. (A) Plasma β2GPI levels of patients during an episode of acute TTP, TTP patients in remission and healthy volunteers
(p<0.001). (B) β2GPI levels of patients during an episode of acute TTP in relation to the
Bethedascore (p<0.05). (C) β2GPI levels of 18 patients in relation to the risk of recurrence
(Between 1 and 2 no significant difference p=0.28). (D) Plasma levels of β2GPI of 7 patients measured during an acute phase of TTP and when they were in remission (p< 0.05). protective function of β2gpi in ttp
correlation between β2GPI levels and VWF antigen levels (Pearson r=0.11, p<0.54, data not shown) was found, an inverse correlation between β2GPI levels and VWF in its GPIbα binding conformation was observed (Pearson r=-0.37, p<0.05, figure 2b). One TTP patient donated blood before developing his/her first acute TTP episode. It was possible to retrieve plasma samples withdrawn before the first TTP episode which were stored as quarantine plasma. figure 2c shows that the levels of ADAMTS13 and β2GPI correlate very well in time.
67 4
chapter
figure 2. Correlation of β2GPI plasma levels (34 patients UMC population) and ADAMTS13 (A) and VWF activation factor (active VWF) (B, Pearson r=0.51, p<0.001 and (B) VWF activation factor,
Pearson r= -0.37, p<0.05. (C). β2GPI concentration (µg/mL) and ADAMTS13 activity levels (%) is a patient with TTP from which plasma samples were stored from before his/her TTP episode because he/she was a blood donor. gwen m.a. van os
During an acute episode of TTP, β2GPI levels decrease about 50%. This cannot be explained by binding to and clearance via VWF alone on molar basis. Therefore
alternative ways of β2GPI clearance related to TTP must be present. TTP is characterized by low platelet number and the presence of fragmentocytes. We hypothesized that
β2GPI was cleared together with platelets and erythrocytes, therefore we measured
β2GPI binding to platelets and erythrocytes. Platelets obtained from healthy
individuals showed an increase in β2GPI binding to their surface when incubated with either VWF-R1306W (type 2B) (18.2 ± 10.6 %) or endothelial-derived VWF (34.8 ± 6.1 %, p<0.001) compared to plasma purified VWF (13.7 ± 8.4%) (figure
3a). For erythrocytes we observed increased binding of β2GPI when VWF-R1306W (type 2B) (8.4 ± 8.0 %) or endothelial-derived VWF (13.1 ± 6.7 %, p< 0.01) was added compared to plasma purified VWF (7.4 ± 6.3 %) (figure 3b). The binding of
β2GPI to platelets and erythrocytes was significantly increased when the erythrocytes were incubated with endothelal cell derived VWF compared to plasma derived VWF (p<0.05). 68
To investigate whether the increase presence of β2GPI on platelets and erythrocytes is
also observed in patient during an acute episode of TTP, we measured β2GPI binding to erythrocytes and platelets of healthy donors in the plasma of 7 patients with either an acute episode of TTP and three plasmas of patients in a remission state. figure 4a and 4b show that during an acute TTP episode in plasma of patients VWF antigen and active VWF are not significantly different compared to patients in remission, for
figure 3. β2GPI binding to platelets and erythrocytes in the presence of different VWF
preparations. The presence of β2GPI on (A) platelets and (B) erythrocytes were studied with FACS
analysis. Significant increased binding ofβ 2GPI was observed for platelets for both Type 2B and UL VWF and for erythrocytes only in the presence of UL VWF. * p<0.05, ***p<0001. protective function of β2gpi in ttp
platelets 13.3 % ±3.8 was observed to be β2GPI positive in plasma during an acute TTP phase compared to 10.7 % ± 4.8 in plasma obtained in a remission state. For the erythrocytes the we observed 5.1% ± 3.8 compared to 4.2% ± 2.2. No correlation between the amount of β2GPI positive cells and VWF antigen level was observed.
However the amount of VWF activation factor correlated with the amount of β2GPI positive platelets (Spearman R= 0.452, p=0.12) and erythrocytes (Spearman R = 0.652, p= 0.01).
69 4
chapter
figure 4. β2GPI binding to platelets and erythrocytes. Washed platelets (A) and erythrocytes (B) derived from healthy volunteers were incubated with plasma from 7 TTP patients during an acute
TTP attack and during remission. Binding of β2GPI to platelets and erythrocytes was detected using FACS analysis. 13.3 % ±3.8 Platelets were observed to be β2GPI positive in plasma during an acute TTP phase compared to 10.7 % ± 4.8 in plasma obtained in a remission state. For the erythrocytes the we observed 5.1% ± 3.8 compared to 4.2% ± 2.2. For both platelets as erythrocytes there is no significant difference in binding ofβ 2GPI to cells observed. The amount of β2GPI positive erythrocytes or platelets did not correlate with VWF antigen levels (platelets Spearman R= -0.083, p=0.78, erythrocytes R=0.024, p=0.93). However VWF activation factor correlates with the amount of β2GPI positive cells (platelets Spearman R= -0.452, p=0.121, erythrocytes R=0.652, p=0.0115). gwen m.a. van os
Previously, we have shown that β2GPI inhibits platelet VWF interaction via binding 6 to the A1 domain of VWF . Here we explored which domain of β2GPI is involved
in the binding to VWF. Direct binding of VWF to β2GPI was investigated by surface
plasmon resonance. First, β2GPI was coated to a Biacore CM5 chip and subsequently perfused with mutant VWF containing type 2B gain-of-function mutation, R1306W.
VWF R1306W but not wt VWF was able to interact with β2GPI (figure 5a). Next
A B 150 150
100 70 100 DI 150
100 50 50 50
Response units (RU) units Response DII
Respons units (RU) units Respons 0 0 100 200 300 400 Response units (RU) units Response DIV Time (sec) DV 0 0 0 10 20 30 40 0 50 100 150 200 VWF (nM) β 2GPI domains (nM) C 125 125 D
100 100
75 75 800
50 50
25 25 Respons units (RU) units Respons (RU) units Respons
0 0 600 0 100 200 300 400 0 100 200 300 400 Time (sec) Time (sec)
800 400 600 125 125
100 100 400
75 75 200 200
50 50 (RU) units Respons
Respons units (RU) units Respons 0 25 25 Respons units (RU) units Respons 0 100 200 300 400 Respons units (RU) units Respons Time (sec) 0 0 0 100 200 300 400 0 100 200 300 400 0 Time (sec) Time (sec) 0 10 20 30 40 VWF (nM)
figure 5. Binding of β2GPI to VWF. In panel A β2GPI was coated to a CM5 sensor chip. Binding of
VWF-R1306W (0-40 nM) was measured. (B) Binding of the individual domains of β2GPI to the A1 domain of VWF containing a gain-of-function mutation (R1306Q). Association was observed for 3 minutes under the same condition as described for Panel A and B. (C) Clockwise starting top left
domain I, II, IV, V interaction with the A1 domain of VWF (R1306Q). (D) As (A) for domain I of β2GPI. protective function of β2gpi in ttp
we coated the VWF A1 domain containing the gain-of-function-mutation R1306Q to a C1-sensor chip and perfused the separate domains of β2GPI (I, II, IV or V) over the chip. Only substantial binding with domain I was observed (figure 5b and 5c). In addition also Domain I was coated to a CM5 chip and subsequently perfused with mutant VWF containing type 2B gain-of-function mutation, R1306W. VWF R1306W but not wt VWF was able to interact with domain I (figure 5d).
To further establish the interference of β2GPI in VWF/platelet interaction, VWF ristocetin induced platelet-agglutination studies with washed platelets was performed.
Ristocetin was added to recombinant VWF (10 µg/mL) in the presence of either β2GPI
(2 and 4 µM), domain-deleted mutants of β2GPI, or the antibodies RAG35 (anti-VWF
A1, 50 µg/mL) and RAG201 (anti-VWF A3, 50 µg/mL). Full-length β2GPI and mutants containing domain I of β2GPI were able to inhibit VWF-induced platelet-agglutination, whereas β2GPI mutants lacking domain I did not. RAG-35 also completely inhibited VWF mediated platelet agglutination while RAG-201 did not (figure 6). 71
To further establish a role for β2GPI in the regulation of VWF platelet interactions, in 4 vitro perfusion studies were performed. Dong et al. have shown that platelets perfused over activated endothelial cells were able to form beads-on-a-string like patterns which are thought to mimic the formation of VWF-platelet microthrombi in the absence of chapter ADAMTS1324. Endothelial cells were stimulated with 25 µM histamine for 3 minutes, followed by the perfusion of platelets in the absence or presence of RAG-35 (50 and
figure 6. Inhibition of platelet
agglutination by β2GPI. Agglutination of washed platelets was initiated by the addition of ristocetin and VWF in the presence of either
β2GPI (2 and 4 µM), recombinant
domains of β2GPI (1 µM) or anti-VWF antibodies RAG201 and RAG35). *p<0.05,**p<0.01, ***p<0.001. gwen m.a. van os
100 µg/mL, figure 7a) or β2GPI (2 and 4 µM, figure 7b), respectively. Both β2GPI and RAG-35 inhibited platelet binding to endothelial-derived VWF dose-dependently.
Next, we investigated if domain I of β2GPI was involved in inhibiting platelet-binding to endothelial derived VWF. 10 µM domain I but not domain II-V added to the platelet suspension was able to block platelet adhesion to endothelial-derived VWF strings (figure 7c).
72
figure 7. The influence ofβ 2GPI on platelet adhesion to endothelial derived VWF. For these experiments endothelial cells were activated by adding 25 µM histamine to the culture medium for 3 minutes followed by perfusion of platelets over the endothelial layer at a shear-stress of 15
dynes/cm2. (A) RAG356, (B) β2GPI, (C) domain I of β2GPI and domains II-V of β2GPI was added to the perfusion solution to investigate a possible effect on platelet adhesion onto endothelial-derived VWF. **p< 0.01, ***p<0.001. protective function of β2gpi in ttp
To investigate whether this inhibitory effect was due to direct binding of β2GPI to the endothelial-derived VWF, we coated latex beads of similar size and weight as platelets with purified plasma β2GPI or albumin. First, we confirmed that for endothelial cells stimulated with histamine and perfused with platelets the beads-on-a-string patterns appeared (figure 8a). When β2GPI coated latex beads were perfused over histamine activated endothelial cells beads-on-a-string formation took place similar to the strings observed after perfusion with platelets (figure 8b), while no such strings were observed after perfusion with bovine serum albumin-coated beads (data not shown).
Beads coated with domain I of β2GPI were also able to adhere to the VWF strings released by endothelial cells (figure 8c).
73 4
figure 8. (A) Endothelial chapter cells stimulated with histamine and perfused platelets. In detail at panel C. Binding of
β2GPI coated beads to endothelial-derived VWF
under flow.β 2GPI (B),
or domain I of β2GPI (D) were coated onto latex beads and added normal plasma and perfused at a shear rate of 300 sec-1 over histamine treated endothelial cells. gwen m.a. van os
DISCUSSION
We have recently reported that β2GPI can act as inhibitor of platelet adhesion by binding to the A1 domain of VWF in vitro, thereby preventing the interaction between VWF and platelet receptor GPIbα6. This inhibition of platelet adhesion might lead to
reduced thrombus formation. This was supported by the observation that lower β2GPI plasma levels in patients correlate with a history of myocardial infarction despite 8 high VWF levels . These findings suggest thatβ 2GPI can counteract the prothrombotic effect of VWF.
We found lower levels of β2GPI in patients with an acute episode of TTP and increased
binding of β2GPI to platelets and erythrocytes in plasma of TTP patients during an
acute episode. Recently we have published that β2GPI can function as a scavenger for LPS, by binding LPS and clearing it from the circulation9. Here we propose VWF in its GPIb binding conformation as a second component that can be neutralised in
74 the circulation by β2GPI.These observations were supported by the relation found
between β2GPI plasma levels and the ADAMTS13 activity and the inverse relationship
between the levels of β2GPI and “active” VWF in patients with TTP. Combined with a
positive correlation between β2GPI positive cells and VFW activation factor. Combined
with a positive correlation between β2GPI positive cells and VFW activation factor.
Apparently, the more active VWF is present in the circulation, the lower level of β2GPI
is observed, suggesting consumption of β2GPI when active VWF is present.
Additionally, a positive relation between ADAMTS13 activity and β2GPI levels was observed. One patient who was a voluntary blood donor for a long period suffered from a TTP attack. It was possible to retrieve two plasma samples stored from this
person from the period before the TTP attack. The plasma β2GPI levels paralleled ADAMTS13 activity over the whole period of time. Whether the observed drop of
β2GPI plasma concentration precedes or is the result of an acute TTP episode remains to be elucidated.
Due to the large variation in β2GPI plasma levels in a healthy population, it is difficult to use these levels as a measurement of disease state. In the present study we have
found a significant decrease in β2GPI levels in TTP patients during an episode of TTP and to a lesser extent in patients with a history of TTP. The large variation in plasma
levels β2GPI in healthy volunteers does not make β2GPI as an attractive diagnostic marker of the amount of active VWF present in the circulation although it can be informative in individuals when baseline levels are known.
It has been previously shown that β2GPI inhibits platelet adhesion to VWF by binding to the A1 domain of VWF (6). Here, we show that the binding site for VWF is located protective function of β2gpi in ttp
within domain I of β2GPI. Unfortunately, domain I of β2GPI is not an attractive potential inhibitor of platelet thrombus formation in patients with TTP because it has been shown that injection of murine domain into mice in the absence of adjuvant results 10 in the formation of auto-antibodies . Auto-antibodies against β2GPI are one of the criteria that define the antiphospholipid syndrome, a syndrome clinically characterized by thrombosis and pregnancy morbidity11. Arad et al. recently showed that purified auto-antibodies towards the first domain of β2GPI strongly increase a thrombotic response in a mouse thrombosis model13. The use of domain I as an anti-thrombotic drug has recently been suggested for use in APS13 but the recent insights into the aetiology of auto-antibodies against β2GPI is a strong contraindication of using domain I in patients.
An increased binding of β2GPI to platelets and erythrocytes in plasma of TTP patients during an attack compared to in remission was observed. During a TTP attack platelet count drops and erythrocytes haemolyse. We speculate that the drop in β2GPI plasma levels observed results from the clearance of β2GPI together with platelets and 75 fragmentocytes. 4
During the last years insight into the disease process of TTP has increased tremendously.
Severe ADAMTS13 deficiency at initial presentation with an acute episode, chapter anti-ADAMTS13 antibody isotype and/or activity has been shown to be of prognostic use to predict outcome and risk of relapse14-16. In addition, there may be a role for high levels of coagulation factor VIII facilitating cleavage of VWF by ADAMTS1317. Here, we have demonstrated that β2GPI might contribute to the clinical picture of TTP.
MATERIALS AND METHODS
Patients
For this study we investigated two patient populations, a healthy population and one individual blood donor. Population 1 GENEVA population. Citrated blood (0.129 M) from 38 patients diagnosed with an acute episode of acquired TTP referred for ADAMTS13 activity determination to the University Clinic of Hematology and Central Hematology Laboratory, Inselspital, Bern, Switzerland. All patients presented with thrombocytopenia (platelet count <150x109/l) and microangiopathic hemolytic anaemia with fragmented erythrocytes on the blood smear without an apparent alternative or underlying disease responsible for these findings as well as a severe ADAMTS13 deficiency (<5% of the normal) due to a functional inhibitor. ADAMTS13 activity and functional inhibitors were determined by the quantitative immunoblotting assay3,18. Population 2: UMC gwen m.a. van os
UTRECHT population. Citrated plasma (0.109 M) was drawn from 34 patients in remission after a first acute TTP episode regularly seen at the University Medical Center in Utrecht, The Netherlands. From 8 patients plasma samples during an acute attack were obtained. Single blood donor: Citrated plasma (0.109 M) was drawn from one patient during and after an acute TTP episode. This patient was a blood donor before the diagnosis of TTP and plasma samples of his/her were stored. Healthy volunteers: Citrated plasma (0.109 M) was drawn from 54 healthy volunteers, who were not taking any medication. All patients and healthy volunteers gave informed consent and the study was approved by the Medical Ethical Institutional Review Board of the hospitals involved.
Diagnostic assays
ADAMTS13 activity (FRETS-VWF73 assay), VWF antigen and VWF activity levels 76 were determined as described before5,19. ADAMTS13 antibody titre were measured by a commercially available ELISA and performed according to the instructions of the manufacturer (Technoclone, Vienna, Austria). An in house enzyme-linked 20 immunosorbent assay (ELISA) was used to measure β2GPI plasma levels . In short,
murine monoclonal antibody 2B2 directed against β2GPI was diluted in Tris-buffered saline pH 7.4 (TBS) and coated overnight at 4°C onto an ELISA plate (Costar, New York, USA). Subsequently the plates were washed 3 times with TBS/ 0.1% Tween, blocked with a 3% bovine serum albumin (BSA)/ TBS solution for 1 hour at 37°C and washed again 3 times. Subsequently patient plasma diluted 1:1000 (v/v) in 3% BSA/TBS/0.1% Tween was added. Serial dilutions of normal pool plasma that
had been calibrated against a purified plasma-derived β2GPI standard were used as reference standard. After 1 hour at 37°C the plates were washed and incubated with
a polyclonal rabbit-anti human β2GPI antibody (Kordia, Leiden, the Netherlands) at a final concentration of 5 μg/mL in 3% BSA/TBS/0.1% Tween. After extensive washing, plates were incubated with a peroxidase-labelled goat-anti-rabbit antibody (DAKO, Glostrup, Denmark) for 1 hour. Staining was performed using an ortho-phenylene
diamine (OPD) solution (4 mg/mL OPD diluted in 0.1 M NaH2PO4.2H2O/0.1 M
Na2HPO4•H2O) and the colour reaction was stopped by the addition of 1 M H2SO4. Absorbance was measured at 490 nm.
Proteins
21 β2GPI was purified as previously described . In short: citrated plasma (0.109 M) of three healthy blood donors was obtained from Sanquin Blood Supply Foundation (Amsterdam, the Netherlands) and dialyzed against 0.04 M Tris/0.01 M succinate/0.005% polybrene/1 mM EDTA /1 mM benzamidin /43 mM NaCl /0.02% protective function of β2gpi in ttp
NaN3. Dialyzed plasma was applied to a DEAE-Sephadex column, the flow-through was collected and subjected to a Sp-Sepharose column and bound β2GPI was eluted with a linear salt-gradient. Subsequently this was subjected to a protein-G-Sepharose column for IgG depletion. The effluent pool was added to a heparin-Sepharose column and bound β2GPI was eluted with a linear salt-gradient (138 mM to 550 mM NaCl).
To achieve full purity β2GPI was applied to gel filtration column and > 99% purity was achieved.
Recombinant mutants of β2GPI (DI, D-II, DI-II-III, DI-IV, DI-V, DII-V, DIV-V) were a generous gift of La Jolla Pharmaceutical Company (La Jolla, CA, USA). The individual domains I, II, IV and V were home-made as described and expressed in HEK293E cells22. WT-VWF and a VWF-2B mutant (VWF-R1306W) were cloned into expression vector PC-DNA 3.1 and subsequently expressed in HEK293T cells with furin activity. Expressed proteins were purified from serum-free medium using an affinity-column coupled with anti-human VWF antibody, RAG-201. Analysis by gel electrophoresis 77 showed that all recombinant proteins were purified to homogeneity. Both wt VWF and 4 VWF R1306W, analyzed using 0.1% SDS, 1% agarose gel electrophoresis, showed the complete set of multimers. Recombinant VWF A1-domain containing the R1306Q mutation was produced and purified as described before23. chapter
VWF antibodies
Monoclonal antibodies towards VWF RAG201 and RAG35 have been previously described24. Both are monoclonal mouse-anti-human VWF antibodies, RAG201 recognizes the VWF A3 domain thereby inhibiting collagen binding. RAG35 recognizes the VWF A1 domain inhibiting GPIbα binding to VWF. Both antibodies have been purified from hybridoma medium using protein A-Sepharose column. Purity was examined by SDS-PAGE and binding of both antibodies to recombinant and plasma-purified VWF was assessed with an ELISA set up.
β GPI exposure on platelets and erythrocytes 2
β2GPI bound to erythrocytes and platelets was detected by flow cytometric analysis (FACS). Briefly, 1 µl whole blood was added to 100 µl Hepes buffer (10 mM Hepes, 150 mM NaCL, 1 mM MgSO4•7 H2O, 5 mM KCl, pH 7.4), a FITC conjugated anti-β2GPI antibody was added to the above reaction system together with PE conjugated anti-CD235a antibody. Samples were further diluted with 0.2% formaldehyde. Totally 60 000 events were counted by FACS. Erythrocyte population was selected by PE conjugated anti-CD235a antibody, an erythroid cell marker. The platelet population was selected based on forward scatter and side scatter. gwen m.a. van os
Platelet agglutination
Freshly drawn blood from healthy volunteers, declining the intake of any medication known to interfere with platelet function, was collected into 0.109 M trisodium citrate. Washed platelets were isolated as described before25. Agglutination studies were performed on an optical aggregometer (Chrono-log Corporation, Havertown, PA, USA). Agglutination was initiated by the addition of ristocetin (1.5 mg/mL) in the
presence of recombinant wild type (WT) VWF, various domains of β2GPI or antibodies towards VWF.
Binding studies
Protein interactions were studied by SPR analysis using a Biacore 3000 and a Biacore T100 biosensor system (both Biacore, Uppsala, Sweden). Recombinant full-length
β2GPI and domain I of β2GPI (La Jolla Pharmaceutical Company, La Jolla, CA, USA) were covalently coupled to an activated CM5 sensor chip (Enzyme Research 78 Laboratories, Swansea, UK) to reach a density of approximately 0.5 nM/mm2. No protein was coupled to the control channel. Association of VWF-R1306W to bound
β2GPI and domain I of β2GPI was recorded for 3 minutes in 100 mM NaCl, 2 mM
CaCl2, 0.005% Tween-20, 20 mM Hepes (pH 7.4) at a flow rate of 20 µl/min at 25°C. The VWF A1 domain containing the R1306Q mutation was coupled to a C1-sensor chip to reach a density of approximately 0.03 nM/mm2. Subsequently full-length
β2GPI and the separate domains of β2GPI were studied for association to the coupled VWF-R1306Q mutant.
Perfusion studies
To investigate platelet-binding to histamine-stimulated human umbilical vein endothelial cells (HUVEC) under conditions of flow, HUVEC were isolated from human umbilical cords and cultured on fibronectin-coated coverslips as described before26. Twenty-four hours prior to the experiments, the endothelial cells were washed three times with prewarmed HEPES-buffered balanced salt (HBBS; 138.3
mM NaCl/ 25 mM HEPES/ 0.82 mM CaCl2/ 5.36 mM KCl/ 0.61 mM MgCl2/ 1 mM α,D-glucose, pH 7.4) followed by the addition of FCS-free medium (EBM-2, Clonetics, Walkersville, MD, USA). The next day the endothelial cells on the coverslips were transfered into a flow chamber and the endothelial cells were perfused with culture medium (EBM-2 medium, Clonetics, San Diego, CA, USA). Subsequently, endothelial cells were activated by adding 25 µM histamine to the culture medium for 3 minutes. Platelets or protein-coated beads in culture medium were perfused over the endothelial cell layer at a shear-rate of 15 dynes/cm2 as described before. Platelet/ bead-adhesion to (histamine-activated) endothelial cells was visualized using bright field microscopy (Zeiss, Jena, Germany). protective function of β2gpi in ttp
Protein-coupling to latex-beads
To investigate binding of β2GPI to endothelial cell-derived VWF, β2GPI or albumin were coupled to 1 µm carboxylated modified latex (CML) beads (Invitrogen). To do so, the beads were washed 3 times with 0.1 M phosphate buffer (pH 8.1) and resuspended in 0.1 M phosphate buffer containing 2 mg/mL 1-ethyl-3-(3-dimeth- ylaminopropyl)carbodiimide (EDAC) (Invitrogen). After overnight incubation, the beads were centrifuged and resuspended in 0.1 M phosphate buffer containing 1 mg/ mL β2GPI or 1 mg/mL albumin and incubated for 24 hours. Subsequently, the mixture was centrifuged and the supernatant buffer was removed for protein measurement to determine coupling efficiency. The beads used in these studies showed coupling efficiency of at least 90%.
Statistics
Measurements are presented as average ± standard deviation. Differences between 79 groups were calculated using an unpaired two tailed t-test, Spearman correlation
coefficient was calculated to determine the relationship between two parameters. A 4 p value <0.05 was considered statistically significant. Calculations were done with GraphPad Prism version 5.00 for Windows, GraphPad Software, San Diego California chapter USA. gwen m.a. van os
REFERENCES
1. Moschcowitz E. Hyaline thrombosis of the terminal arterioles and capillaries: a hitherto undescribed disease. Proc N Y Pathol Soc 1924; 21-24 2. Sadler JE, Moake JL, Miyata T, George JN. Recent Advances in Thrombotic Thrombocytopenic Purpura. Hematology Am Soc Hematol Educ Program. 2004: 407-423. 3. Furlan M, Robles R, Galbusera M, Remuzzi G, Kyrle PA, Brenner B, Krause M, Scharrer I, Aumann V, Mittler U, Solenthaler M, Lämmle B. von Willebrand factor-cleaving protease in thrombotic thrombocytopenic purpura and the hemolytic-uremic syndrome. N Engl J Med. 1998; 339: 1578-84. 4. Hulstein JJ, de Groot PG, Silence K, Veyradier A, Fijnheer R, Lenting PJ. A novel nanobody that detects the gain-of-function phenotype of von Willebrand factor in ADAMTS13 deficiency and von Willebrand disease type 2B. Blood. 2005; 106: 3035-42. 5. Groot E, Fijnheer R, Sebastian SA, de Groot PG, Lenting PJ. The active conformation of von Willebrand factor in patients with thrombotic thrombocytopenic purpura in remission. J Thromb Haemost. 2009; 7: 962-669 6. Hulstein JJ, Lenting PJ, de Laat B, Derksen RH, Fijnheer R, de Groot PG. beta2-Glycoprotein I inhibits von Willebrand factor dependent platelet adhesion and aggregation. Blood. 2007; 110: 1483-1491 7. De Laat B, de Groot PG, Derksen RH, Urbanus RT, Mertens K, Rosendaal FR, Doggen CJ. Association between beta2-glycoprotein I plasma levels and the risk of myocardial infarction in older men. Blood. 2009; 114: 80 3656-3661 8. Agar C, de Groot P, Mörgelin M, Monk S, van Os G, Levels J, de Laat B, Urbanus R, Herwald H, van der Poll T, Meijers J. {beta}2-glycoprotein I: a novel component of innate immunity. Blood. 2011; 117: 6939-6947 9. Miyakis S, Lockshin M, Atsumi T et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thrombos Haemos. 2006; 4: 295-306 10. de Laat B, van Berkel M, Urbanus RT, Siregar B, de Groot P, Gebbink M, Maas EC. Immune responses against domain I of β(2) -glycoprotein I are driven by conformational changes. Arthritis Rheum. 2011; doi: 10.1002/ art.30633
11. Arad A, Proulle V, Furie R, Furie B, Furie B. β₂-Glycoprotein-1 autoantibodies from patients with antiphospholipid syndrome are sufficient to potentiate arterial thrombus formation in a mouse model. Blood. 2011;117: 3453-3459 12. Ioannou Y, Romay-Penabad Z, Pericleous C et al. In vivo inhibition of antiphospholipid antibody-induced pathogenicity utilizing the antigenic target peptide domain I of beta2-glycoprotein I: proof of concept. J Thromb Haemost. 2009: 7: 833-842 13. Peyvandi F, Lavoretano S, Palla R, Feys HB, Vanhoorelbeke K, Battaglioli T, Valsecchi C, Canciani MT, Fabris F, Zver S, Réti M, Mikovic D, Karimi M, Giuffrida G, Laurenti L, Mannucci PM. ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission. Haematologica. 2008;93:232-239 14. Ferrari S, Mudde GC, Rieger M, Veyradier A, Kremer Hovinga JA, Scheiflinger F.IgG subclass distribution of anti-ADAMTS13 antibodies in patients with acquired thrombotic thrombocytopenic purpura. J Thromb Haemost. 2009; 7: 1703-1710 15. Kremer Hovinga JA, Vesely SK, Terrell DR, Lämmle B, George JN. Survival and relapse in patients with thrombotic thrombocytopenic purpura. Blood. 2010; 115: 1500-1511 16. Cao W, Krishnaswamy S, Camire RM, Lenting PJ, Zheng XL. Factor VIII accelerates proteolytic cleavage of von Willebrand factor by ADAMTS13. Proc Natl Acad Sci U S A. 2008; 105: 7416-7421 17. Studt JD, Böhm M, Budde U, Girma JP, Varadi K, Lämmle B. Measurement of von Willebrand factor-cleaving protease (ADAMTS-13) activity in plasma: a multicenter comparison of different assay methods. J Thromb Haemost. 2003;1:1882-1887 18. Eckmann CM, De Laaf RT, Van Keulen JM, Van Mourik JA, De Laat B. Bilirubin oxidase as a solution for the interference of hyperbilirubinemia with ADAMTS-13 activity measurement by FRETS-VWF73 assay. J Thromb Haemost. 2007; 5: 1330-1331 protective function of β2gpi in ttp
19. Horbach DA, van Oort E, Tempelman MJ, Derksen RH, de Groot PG. The prevalence of a non-phospholipid- binding form of beta2-glycoprotein I in human plasma: consequences for the development of anti-beta2-glyco- protein I antibodies. Thromb Haemost. 1998; 80: 791–797 20. Oosting JD, Derksen RHWM, Hackeng TM, et al. In vitro studies of antiphospholipid antibodies and its cofactor,
β2-glycoprotein I, show negligible effects on endothelial cell mediated protein C activation. Thromb Haemost. 1991; 66: 666-671 21. Huizinga EG, Tsuji S, Romijn RA, Schiphorst ME, de Groot PG, Sixma JJ, Gros P. Structures of glycoprotein Ibalpha and its complex with von Willebrand factor A1 domain. Science. 2002; 16: 1176-1189 22. Stel HV, Sakariassen KS, Scholte BJ, Veerman EC, van der Kwast TH, de Groot PG, Sixma JJ, van Mourik JA. Characterization of 25 monoclonal antibodies to factor VIII-von Willebrand factor: relationship between ristocetin-induced platelet aggregation and platelet adherence to subendothelium.Blood. 1984; 63: 1408-1415 23. Brinkman HJ, Mertens K, Holthuis J, Zwart-Huinink LA, Grijm K, van Mourik JA. The activation of human blood coagulation factor X on the surface of endothelial cells: a comparison with various vascular cells, platelets and monocytes. Br J Haematol. 1994; 87: 332-342 24. Dong JF, Moake JL, Nolasco L, Bernardo A, Arceneaux W, Shrimpton CN, Schade AJ, McIntire LV, Fujikawa K, López JA.ADAMTS-13 rapidly cleaves newly secreted ultralarge von Willebrand factor multimers on the endothelial surface under flowing conditions. Blood. 2002; 100: 4033-4039
81 4
chapter
Chapter 5
Two different populations of domain I anti-β2GPI antibodies; one inhibits and one stimulates in vitro thrombin generation
Gwen M.A. van Os, M. Ninivaggi, Çetin Ağar, Coen Hemker, Theo Lindhout, Joost C.M. Meijers, Phillip G. de Groot, Bas de Laat gwen m.a. van os
Abstract
Antiphospholipid antibodies are associated with thrombosis in vivo and
with a prolonging clotting time in vitro. Beta2-Glycoprotein I (β2GPI) is the major antigen in the antiphospholipid syndrome. This protein can exist in two conformations, a circular conformation present in plasma that can change into a fish-hook conformation. Only the fish-hook conformation is
able to interact with anti-β2GPI patient antibodies. Here we aim to elucidate the apparent paradox of anticoagulant antiphospholipid antibodies in vitro and their association with thrombosis in vivo.
To investigate the effect of β2GPI and anti-β2GPI antibodies on coagulation calibrated automated thrombography (TG-CAT) was used. We observed
that β2GPI in a fish-hook conformation but not in a circular conformation was able to inhibit coagulation when initiated with low tissue factor. Murine 84
and human anti-β2GPI antibodies, with affinity for β2GPI regardless of its conformation decreased peak height and increased lag time for the TG, displaying the classic lupus anticoagulant activity in vitro. However, murine and human anti-domain I monoclonal antibodies with affinity
only for fish-hook shaped β2GPI, showed an increased peak height and a shortened lag time when TG was initiated with low TF concentrations (0.5 and 1pM TF).
Patient plasmas can contain two different populations of antibodies
directed against domain I of β2 GPI. The two antibody populations differ
in two respects, they recognize different epitopes on domain I of β2GPI and they have a diametrically opposite effect on thrombin generation in vitro. two populations of anti-β2gpi antibodies
Introduction
The antiphospholipid syndrome (APS) is characterized by the persistent presence of circulating antiphospholipid antibodies in plasma of patients with a history of 1 thrombotic events and/or obstetrical complications . β2-Glycoprotein I (β2GPI) is regarded as the major antigen in this syndrome2,3. This protein is a 43 kDa glycoprotein consisting of five complement control protein domains connected by 3 or 4 amino acids that form flexible linkers. Domain I contains an epitope recognized by a population of autoantibodies that highly correlates with the clinical manifestations of APS4,5,6, whereas the fifth domain contains a patch of positively charged amino acids and a hydrophobic insertion loop together harboring the phospholipid binding 7,8 site . β2GPI circulates in blood in a circular conformation and upon binding to negatively charged surfaces with its positively charged Vth domain, the conformation of β2GPI is changed into a fishhook-like shape. When the circular conformation of
β2GPI changes into a fish-hook shaped conformation a cryptic site within domain
I becomes exposed on the outside of the protein. β2GPI can now be recognized by thrombosis-related anti-domain I antibodies9,10. Recently, an interesting theory was proposed in the etiology of auto-antibodies against β2GPI. It was hypothesized that patient antibodies are induced due to continuous exposure to fish-hook conformation 11 of β2GPI in the circulation which can be caused by the interaction of β2GPI with e.g. bacterial proteins12. 85 5 An informative way to measure effects of antiphospholipid antibodies on coagulation is thrombin generation. Thrombin generation can be measured by the conversion of a thrombin-sensitive fluorescent probe by thrombin generated during ongoing chapter coagulation. Hemker et al.13 designed a method by which thrombin generation can be quantified, adjusted for substrate depletion and inner-filter effect by adding a calibrator in fixed dose (alpha-2M-thrombin). Calibrated automated thrombography (TG-CAT) has been described by several groups as a method to detect antiphospholipid antibodies with lupus anticoagulant activity. Anticoagulant antiphospholipid antibodies prolong lag times and decrease peak heights and sometimes the endogenous thrombin potential (ETP)14.
The characterization of the APS is based on a paradox; clinically the disease is characterized by thrombotic events1, while it is diagnosed by a phospholipid dependent delay in the coagulation15. The experiments described in this manuscript tried to provide an explanation for this paradox. We have found a subpopulation of anti-domain I anti-β2GPI antibodies that under certain conditions displays a prothrombotic phenotype in vitro. gwen m.a. van os
Results
Recently, we published that β2GPI can exist in two conformation, a circular plasma conformation and fish-hook like conformation in complex with the auto-antibodies (10). We have identified two human and two murine monoclonal antibodies directed against domain I. The monoclonal antibody (moAb) P1-117 (human) and 4F3 (mouse)
recognize only fish-hook shapedβ 2GPI, 3B7 (mouse) and P2-6 (human) recognize both
circular and fish-hook shaped β2GPI. This indicates that 4F3 and P1-117 recognize a
cryptic epitope in β2GPI that becomes accessible when β2GPI changes into a fish-hook shaped conformation (table 1). In our laboratory we observed that antibodies
recognizing only the fish-hook shaped conformation of β2GPI does not display lupus anticoagulant activity (figure 1a and 1b). P2-6 remains to be tested.
In order to investigate the effect of the different monoclonal antibodies on coagulation in vitro, the TG-CAT-method to measure thrombin generation was applied. The different monoclonal antibodies (3B7, 4F3, P2-6 and P1-117) were diluted in plasma to a final concentration of 100 μg/mL. When TG was initiated with a highTF concentration (5 pM TF) no effect of the antibodies was observed on either peak height (PH), lag time (LT) or endogenous thrombin potential (ETP) (data not shown). When TG was initiated with 0.5 pM TF we observed for moAb 3B7 (recognizing 86 both conformations of beta2GPI) an increased lag time and decreased peak height compared to normal pooled plasma TG (LT: 11.8 vs. 9.5 minutes p<0.05, PH: 144.2 vs. 221 nM thrombin p<0.05) indicating normal lupus anticoagulant activity. A similar pattern we observed for P2-6, (LT: 10.5 vs. 9.5 minutes p<0.05, PH: 143.1 vs. 221 nM thrombin p<0.05). However, in the presence of moAb P1-117 and 4F3
(both recognizing only fish-hook shapedβ 2GPI) a shorter lag time and increased peak height compared to normal pool plasma was observed (LT: 9.0 (P1-117 p<0.05 vs NP) vs. 7.8 (4F3 p<0.05 vs NP) vs. 9.5 (NP), PH: 295.0 (P1-117 p<0.05 vs NP) vs. 316.3 (4F3 p<0.05 vs NP) vs. 221 (NP). This indicates that both P1-117 and 4F3 promote thrombin generation (figure 2).
table 1: Characterization of the anti-β2GPI moAbs.
Antibody Origin Type Circular β2GPI Fish-hook β2GPI Domain 3B7 Mouse IgG + + DI
4F3 Mouse IgG - + DI P1-117 Human IgG - + DI
P2-6 Human IgG + + DI two populations of anti-β2gpi antibodies
For the moAb 3B7 the LAC was neutralized in the presence of an excess of phospholipids (figure 3). For both the moAbs 4F3 and P1-117 an increasing concentration of phospholipids did not influence the lag time (figure 3a). It further increased peak height, although at 32 µM we observed a decrease for 4F3 (figure 3b). As for the LAC the ETP remained uninfluenced by an excess of phospholipids (figure 3c).
87 5
figure 1. Lupus anticoagulant activity of the monoclonal anti-β2GPI antibodies. (A) LAC ratio for the aPTT. (B) LAC ratio for the dRVVT. Dotted line is set at 1.15 and is the threshold for LAC, based on chapter 99th percentile of 40 healthy individuals.
figure 2. Thrombin generation
of plasma spiked with anti-β2GPI antibodies (P1-117, P2-6, 4F3 and 3B7), initiated by 0.5 pM tissue factor and 4 μM phospholipids. The antibody recognizing both conformations of
β2GPI (3B7, P2-6) showed delayed and less thrombin generation, whereas the antibodies recognizing
a cryptic epitope in β2GPI (P1-117 and 4F3) showed faster and increased thrombin generation. gwen m.a. van os
The differential effects of the moAbs on thrombin generation appeared to be related
to the conformation of β2GPI. Therefore the effect of both conformations on thrombin
generation was tested. Plasma purified circular β2GPI did not affect thrombin generation when initiated with any concentration of TF (figure 4a). Additionally,
fish-hook shapedβ 2GPI inhibited thrombin generation (figure 4c, 4d, 4e). figure 4c
shows that an increase in TF abrogated the inhibitory effect of fish-hook shapedβ 2GPI on thrombin generation. By initiating TG with 0.5 pM TF a dose dependent effect of
open β2GPI is observed (figure 4b).
88
figure 3. Various concentrations of phospholipids were incubated with plasma spiked with
anti-β2GPI moAbs. 3B7 recognizes both conformations of β2GPI; P1-117 and 4F3 only the open conformation. (A) Lagtime was increased with increased phospholipid concentration, for moAb 3B7 the increase in lag time was neutralized with higher phospholipid concentration. Lag time for moAb P1-117 and 4F3 remained uninfluenced. (B) Peak height remained stable with increasing phospholipid concentration for NP and in the presence of 3B7, peak height varied for 4F3 and increased for P1-117. (C) Endogenous thrombin potential slightly decreased in the presence of higher phospholipid concentrations, a similar effect is observed for 3B7. No overall effect was observed for plasma spiked with either P1-117 or 4F3. two populations of anti-β2gpi antibodies
The effects of P1-117 and 4F3 on thrombin generation were only observed at low tissue factor concentration, suggesting that the antibodies modulate one of the feedback amplification loops of coagulation. It is known from the literature that β2GPI binds 16,17 both to thrombin and factor XI . Therefore we have studied the effects of β2GPI with or without the antibodies on the conversion of factor XI to XIa by thrombin. To do so, we incubated the different MoAb with β2GPI and mixed this with FXI followed by activation with thrombin. For both the moAbs P1-117 and 4F3 we observed an enhanced FXI activation, whereas no effect was observed for Moab 3B7 (figure 5).
The antibodies in the absence of β2GPI did not influence FXI activation.
89 5
chapter
figure 4. Thrombin generation in the presence of β2GPI. TG was initiated with tissue factor in
NPP spiked with either closed or open β2GPI in the presence of 4 µM phospholipids. (A) TG initiated with 5 and 1 pM TF in the presence of 50 µg/ml circular β2GPI showed no effect. (B) Dose dependent effect on thrombin generation of β2GPI bound to phospholipids is observed when TG is initiated with low TF. Values are average ± SD. TG initiated with either (C) 5, (D) 1 or (E) 0.5 pM
TF with and without 50 µg/ml open β2GPI. No effect of open β2GPI is observed on TG when this is initiated with high TF. However, when the TF concentration declines a decrease in thrombin generation is observed. gwen m.a. van os
Discussion
Publications about the role of β2GPI in coagulation are diverged and no, pro- and 18,19,20 anticoagulant effects of β2GPI have been claimed . The association between the 21,22,23 presence of anti-β2GPI antibodies and thrombosis is well established in animals and man24,25. Although the lupus anticoagulant correlates stronger with the risk for
thrombosis in human, a weak correlation is also found for anti-β2GPI antibodies,
especially for the subpopulation of anti-β2GPI antibodies that are directed to domain I 26,27 of this protein . The observation that β2GPI can exist in two different conformations in combination with a panel of human and murine monoclonal antibodies prompted
us to more closely analyze the complicated interaction of β2GPI with hemostasis. To do so, we have used thrombin generation assays to analyze the hemostatic balance
more subtle. We showed that that plasma β2GPI itself did not influence the thrombin
generation time. Auto-antibodies that recognize domain I of β2GPI irrespectively of its conformation inhibited thrombin generation, expressing a classic lupus anticoagulant.
Interestingly, auto-antibodies againstβ2GPI that recognize domain I only when
β2GPI is in its open conformation decreased thrombin generation when coagulation is started with low tissue factor concentrations, expressing what one could call a lupus ‘procoagulant’ activity. As expected, the effects of the antibodies with a lupus anticoagulant activity could be neutralized when the phospholipid concentrations 90 in the assays is increased, mimicking the lupus anticoagulant confirmation assay. In
figure 6. Effect of anti-β2GPI in thrombin mediated FXI activation. MoAbs β2GPI was preincubated with the moAbs and mixed with FXI. FXI (30nM) was activated by thrombin (10nM) for 5 minutes
at 37°C. Moab anti-β2GPI P1-117 and 4F3 stimulate the activation of FXI by thrombin. two populations of anti-β2gpi antibodies
contrast, the effects of the antibodies with lupus procoagulant activity strengthened when the phospholipid concentrations are increased.
16,17 It has been shown that β2GPI binds to both factor XI and thrombin . These observations, in combination with the observation that the lupus procoagulant effect is only observed at low tissue factor concentrations, prompted us to study the effects of the anti-β2GPI antibodies on the thrombin mediated factor XI activation, an amplification loop in coagulation that is not detected with classic lupus anticoagulant assays. We could show that the antibodies that only recognizeβ2GPI in its open conformation accelerated the conversion of factor XI by thrombin, thereby explaining the observed lupus procoagulant effect of these antibodies. This immediately explains why this effect of anti-β2GPI antibodies on coagulation in the classic lupus anticoagulant assays remained unobserved before.
The relevance of this newly identified subpopulation of auto-antibodies againstβ 2GPI for the pathophysiology of the antiphospholipid syndrome remains to be established. Nevertheless, the observations made in this study showed that there is an urgent need to further characterize the different subpopulations of auto-antibodies against domain I of β2GPI. It has been shown extensively that auto-antibodies against domain
I of β2GPI correlate much better with the clinical manifestations that characterize APS. We have shown here that there are at least two different antibody populations 91 that recognize domain I with completely different characteristics. Our next step is to 5 develop assays specific for both antibody populations and correlate their presence with the clinical manifestations of APS.
chapter
MATERIALS AND METHODS
Proteins
Plasma β2GPI was isolated from fresh citrated human plasma from 3 healthy donors 28 as previously described . Purity of β2GPI was determined with sodium dodecyl sulfate (SDS)–polyacrylamide (PAA) gel electrophoresis (GE Healthcare). Purified plasma
β2GPI showed a single band with a molecular mass of approximately 43 kDa under non-reducing conditions. The concentration of the protein was determined with the bicinchoninic acid protein assay (Thermo Fisher Scientific LSR). This purified β2GPI is in the circular plasma conformation, this is switched to the fish-hook conformation as previously described10.
Recombinant proteins. Human β2GPI cDNA (kindly provided by Dr. T. Kristensen from the university of Aarhus, Denmark) was used to construct full length recombinant
β2GPI. cDNA was subcloned into a PCR-Blunt II- TOPO vector (Invitrogen) and the gwen m.a. van os
protein was constructed with a set of two primers with BamHI and NotI restrictions sites; 5’ GGATCCGGACGGACCTGTCCCAAGCC 3’ and 5’ GCGGCCGCT- TAGCATGGCTTTACATCGG 3’. The PCR product was cloned into a PCR-Blunt II-TOPO vector, and sequence analysis was performed to confirm the sequence of
β2GPI. From this vector, the PCR product was subcloned into the expression vector HisN-Tev (Promega). Individual domain I and domain V were cloned as previously described10.
Protein expression and purification
Recombinant β2GPI and the separate domains were expressed in HEK293E cells and collected from a nickel Sepharose column with an elution buffer (25 mM tris(hydroxymethyl)aminomethane, 500 mM NaCl, 500 mM imidazole, pH 8.2). To increase purity, proteins were loaded to a Hi-load Superdex 200 XK26 column
(GE Healthcare). β2GPI and the separate domains were > 95% pure as checked on a 4-15% SDS-PAA gel (GE Healthcare). Normal pooled plasma. Normal pooled plasma (NPP) was obtained from more than 200 healthy individuals. Blood was drawn in 3.2% citrate and spun down twice 92 at 2000 x g. All healthy individuals gave written informed consent and the Ethical Review Board of the Academic Medical Center Amsterdam, the Netherlands.
Antibodies
Two monoclonal mouse-anti-human β2GPI antibodies: 3B7 and 4F3 were purified from hybridoma medium using protein G-Sepharose. P1-117 was obtained from an APS patient as previously described29. The antibodies were >99% pure as checked on a 4-15% SDS-PAA gel (GE Healthcare).
Thrombin generation assay
Thrombin generation was triggered by different concentrations of tissue factor (TF). To quantify thrombin generation the TG-CAT-method was used as previously described13. In short 80 µL of test plasma and 20 µL of activator (TF or XIa with 4 µM phospholipid (PC/PS/PE, 60/20/20)) was added to a round-bottom ELISA plate (Immunolon2HB, Thermolab System, Helsinki, Finland). The plate containing the test plasma and trigger reagent was heated at 37°C for 10 minutes. Thrombin
generation was initiated by adding 20 µL Z-GGR-AMC (2.5 mM) and CaCl2 (100 mM). Calibration was performed by adding thrombin calibrator (final thrombin activity of 100 nM) to the test sample. The obtained thrombogram provided the lag two populations of anti-β2gpi antibodies
time (minutes), endogenous thrombin potential (ETP, nM.minutes) and thrombin peak height (nM).
Coagulation assays
The LAC activity of anti-β2GPI moAbs was investigated in normal pooled plasma. Antibodies were preincubated in NPP for 2 minutes at 37°C. A dRVVT was performed according to the protocol of the manufacturer (LA Screen; Life Diagnostics, Sydney, Australia) and confirmed with LA-2. APTT was determined with a LAC-sensitive PTT-LA assay (Diagnostica Stago, Asnières, France) the screen was confirmed with Actin FS a lupus anticoagulant independent reagent (Siemens Healthcare Diagnostics, Marburg; Germany).
93 5
chapter gwen m.a. van os
References
1. Miyakis S, Lockshin M, Atsumi T, Branch DW, Brey RL, Cervera R, Derksen RHWM, de Groot PG, Koike T, Meroni PL, Reber G, Shoenfeld Y, Tincani A, Viachoviannopoulos PG, Krilis SA. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost. 2006; 4: 295-306 2. Galli M, Comfurius P, Maassen C, Hemker H, de Baets M, van Breda-Vriesman P, Barbui T, Zwaal R, Bevers E. Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma protein cofactor. Lancet. 1990; 335: 1544-1547 3. McNeil H, Simpson R, Chesterman C, Krillis S. Anti-phospholipid antibodies are directed against a complex antigen that includes a lipid-binding inhibitor of coagulation: beta 2-glycoprotein I (apolipoprotein H). Proc Natl Acad Sci USA. 1990; 87: 4120-4124
4. Iverson GM, Victoria EJ, Marquis DM. Anti-beta2 glycoprotein I (β2GPI) autoantibodies recognize an epitope on the first domain ofβ2 GPI. Proc Natl Acad Sci USA. 1998; 95: 15542-15546 5. de Laat B, Derksen R, Urbanus R, de Groot PG. IgG antibodies that recognize epitope Gly40-Arg43 in domain I of beta 2-glycoprotein I cause LAC, and their presence correlates strongly with thrombosis. Blood. 2005; 105: 1540-1545 6. Ioannou Y, Pericleous C, Giles I, Latchman D, Isenberg D, Rahman A. Binding of antiphospholipid antibodies to discontinuous epitopes on domain I of human beta(2)-glycoprotein I: mutation studies including residues R39 to R43. Arthritis Rheum. 2007; 56: 280-290 7. Bouma B, de Groot P, van den Elsen J, Ravelli R, Schouten A, Simmelink M, Derksen R, Kroon J, Gros P. Adhesion mechanism of human beta(2)-glycoprotein I to phospholipids based on its crystal structure. EMBO J. 1999; 18: 5166-5174. 8. Schwarzenbacher R, Zeth K, Diederichs K, Gries A, Kostner G, Laggner P, Prassl R. Crystal structure of human beta2-glycoprotein I: implications for phospholipid binding and the antiphospholipid syndrome. EMBO J. 1999; 94 18: 6228-6239 9. de Laat B, Derksen RH, van Lummel M, Pennings M, de Groot PG. Pathogenic anti-beta2-glycoprotein I antibodies recognize domain I of beta2-glycoprotein I only after a conformational change. Blood. 2006; 107: 1916-1924
10. Ağar C, van Os G, Mörgelin M, Sprenger R, Marquart J, Urbanus R, Derksen R, Meijers J, de Groot P. Beta2-gly- coprotein I can exist in 2 conformations: implications for our understanding of the antiphospholipid syndrome. Blood. 2010; 116: 1336-1343 11. De Laat B, Zappelli C, van Berkel M, Sirregar B, de Groot PG, Mertens K, Gebbink M, Maas C. Immune responses against domain I of beta2-glcyoprotein I are depentendent on protein conformation. J Thromb Haemost. 2009: 7; supl. 2: OC-MO-112 12. Van Os GM, Meijers JC, Ağar C, Valls Serón M, Marquart JA, Åkesson P, Urbanus RT, Derksen RH, Herwald H, Mörgelin M and de Groot PG Induction of auto-antibodies against β2Glycoprotein I in mice and men by protein H of Streptococcus pyogenes. J Thromb Haemost. 2011; doi: 10.1111/j.1538-7836.2011.04532.x. 13. Hemker HC, Giesen P, AlDieri R, Regnault V, Smed E, Wagenvoord R, Lecompte T, Beguin S. The calibrated automated thrombogram (CAT): a universal routine test for hyper- and hypocoagulability. Pathophysiol Haemost Thromb. 2002; 32: 249-253 14. Devreese K, Peerlinck K, Hoylaerts MF. Thrombotic risk assessment in the antiphospholipid syndrome requires more than the quantification of lupus anticoagulants Blood. 2010: 115: 870-878. 15. Galli M, Luciani D, Bertolini G, Barbui T. Lupus anticoagulants are stronger risk factors for thrombosis than anticardiolipin antibodies in the antiphospholipid syndrome: a systematic review of the literature. Blood. 2003: 101: 1827-32. 16. Shi T, Iverson G, Qi J, Cockerill K, Linnik M, Konecny P, Krillis S. Beta 2-Glycoprotein I binds factor XI and inhibits its activation by thrombin and factor XIIa: loss of inhibition by clipped beta 2-glycoprotein I. Proc Natl Acad Sci USA. 2004; 101: 3939-3944 17. Shi T, Giannakopoulos B, Iverson GM, Cockerill KA, Linnik MD, Krilis SA. Domain V of beta2-glycoprotein I two populations of anti-β2gpi antibodies
binds factor XI/Xia and is cleaved at Lys317-Thr318. J Biol Chem. 2005; 280: 907-912 18. Brighton, TA, Hogg PJ, Dai YP, Murray BH, Chong BH Cheterman CN, Beta2-glycoprotein I in thrombosis: evidence for a role as a natural anticoagulant. Br. J. Haematol. 1996; 93: 185-194 19. Schousboe I. beta 2-Glycoprotein I: a plasma inhibitor of the contact activation of the intrinsic blood coagulation pathway. Blood.1985; 66: 1086-1091 20. Mori T, Takeya H, Nishioka J, Gabazza E, Suzuki K. beta 2-Glycoprotein I modulates the anticoagulant activity of activated protein C on the phospholipid surface. Thromb Haemost. 1996; 75: 49-55 21. Arad A, Proulle V, Furie RA, Furie BC and Furie B. Beta2-glycoprotein-1 autoantibodies from patients with antiphospholipid syndrome are sufficient to potentiate arterial thrombus formation in a mouse model Blood 2011 117: 3453-3459 22. Jankowski M, Vreys I, Wittevrongel C, Boon D, Vermylen J, Hoylaerts MF, Arnout J. Thrombogenicity of Beta2- glycoprotein I–dependent antiphospholipid antibodies in a photochemically induced thrombosis model in the hamster. Blood. 2003; 101: 157-162 23. Pierangeli SS, Harris EN. Antiphospholipid antibodies in an in vivo thrombosis model in mice. Lupus. 1994; 3: 247-51 24. Galli M, Borrelli M, Jacobsen EM, Marfisi RM, Finazzi G, Marchioli R, Wisloff F, Marialli S, Morboeuf O, Barbui T. Clinical significance of different antiphospholipid antibodies in the WAPS (warfarin in the antiphospholipid syndrome) study. Blood. 2007; 4; 1178-1183 25. Forastiero R, Martinuzzo M, Pombo G, Puente D, Rossi A, Celebrin L, Bonaccorso S, Aversa L. A prospective study of antibodies to β2-glycoprotein I and prothrombin, and risk of thrombosis. J. Thrombos Haemost. 2005; 6: 1231-1238 26. Banzato A, Pozzi N, Frasson R, De Filippis V, Ruffatti A, Bison E, Padayattil SJ, Denas G, Pengo V. Antibodies to Domain I of β(2)Glycoprotein I are in close relation to patients risk categories in Antiphospholipid Syndrome (APS). Thromb Res. 2011 [Epub ahead of print] 27. De Laat B, Derksen RH, Reber G, Musial J, Swadzba J, Bozic B, Cucnik S, Regnault V, Forastiero R, Woodhams 95 BJ, De Groot PG. An international multicentre-laboratory evaluation of a new assay to detect specifically lupus 5
anticoagulants dependent on the presence of anti-beta2-glycoprotein autoantibodies. J Thromb Haemost. 2011; 9: 149-53 28. Oosting JD, Derksen RH, Entjes HT, Bouma BN, de Groot PG. Lupus anticoagulant activity is frequently dependent on the presence of beta 2-glycoprotein I. Thromb Haemost 1992; 67: 499-502 chapter 29. Dienava-Verdoold, Boon-Spijker M, de Groot P, Brinkman H, Voorberg J, Mertens K, Derksen R, de Laat B. Patient-derived monoclonal antibodies directed towards beta2 glycoprotein-1 display lupus anticoagulant activity. J Thromb Haemos 2011; 9: 738–747
Chapter 6
Detection of lupus anticoagulant in the presence of rivaroxaban by taipan snake venom time
Gwen M.A. van Os, Bas de Laat, Pieter Willem Kamphuisen, Joost C.M. Meijers, Phillip G. de Groot
J. Thromb. Haemos. 2011; 9(8): 1657-1659 gwen m.a. van os
According to the consensus classification criteria, an individual is diagnosed with the antiphospholipid syndrome (APS) when the following conditions are met: the persistent presence of circulating antiphospholipid antibodies and a history of thrombosis or pregnancy morbidity1. The dominant antigenic target recognized by 2 the APS auto-antibodies is β2-Glycoprotein I (β2GPI) . The clinical manifestations correlate best with the prolongation of phospholipid-dependent clotting assays; the lupus anticoagulant (LAC)3. To prevent thrombotic complications, patients diagnosed with APS are maintained on anticoagulant treatment. This treatment itself prolongs clotting assays and therefore interferes with detection of the LAC. There is no consensus on the treatment of patients with APS4,5 and there is room for alternative treatment. One of the recently developed anticoagulants is rivaroxaban, a direct factor Xa inhibitor6. Rivaroxaban has been developed for both prophylaxis and treatment of thrombosis. Studies are ongoing to determine the efficacy of rivaroxaban in patients diagnosed with APS7. Here we studied the interference of rivaroxaban in different assays developed for the detection of LAC.
All plasmas were collected in 0.109 M citrate. Normal pooled plasma (NPP) was obtained from more than 200 healthy individuals. Plasmas of thirteen SLE patients were used, none of the patients received anticoagulants at the time of blood withdrawal. Six SLE patients were positive for antiphospholipid antibodies and had a history of thrombotic complications, the 7 other patients were negative for antiphospholipid antibodies and had no history of thrombosis. The study was approved by the local ethics committee and written informed consent was obtained from all healthy individuals and patients in accordance to the declaration of Helsinki. Monoclonal antibodies were added to NPP to create artificial LAC positive plasmas: one human
98 anti-β2GPI IgG against domain I (ab1, 250 µg/mL) and two mouse anti-human β2GPI IgG; one directed towards domain I (ab2, 100 µg/mL), and one directed to domain
IV of β2GPI (ab3, 250 µg/mL). The stock of rivaroxaban was dissolved in DMSO (Dimethylsulfoxide), this was further diluted in TBS buffer (20 mM Tris, 150 mM NaCl, pH 7.4). Before use the solution was heated to 37°C to completely dissolve the rivaroxaban. Control plasmas received the same amount of DMSO. 250 ng/mL rivaroxaban was added to NPP a concentration in the middle of the therapeutic range6,8 and clotting times were recorded with a KC-10A micro coagulometer (Amelung, Lemgo, Germany). To determine the presence of LAC, three different assays were used consisting of a screen and confirmation assay. aPTT:screen PTT-LA (Diagnostica Stago, Arnières sur Seine, France) and confirm Actin FS (Siemens Healthcare). dRVVT: screen LA-1 (Siemens Healthcare Diagnostics, Marburg, Germany) and confirm LA-2 (Siemens Healthcare Diagnostics). For the Snake venom assay: screen Taipan snake venom time9 (Sigma Aldrich, St. Louis, MO) and confirm Ecarin venom time (Sigma Aldrich). For the Taipan snake venom time assay, after incubation of rivaroxaban and antibodies, 25 µL of Bell and Alton platelet substitute (cat no BAPS040, Diagen, detection of lac in the presence of rivaroxaban
Thame, UK reconstituted in 10 mL of H2O) was added and incubated for 2 minutes before activating prothrombin with 25 µL of 5 µg/mL Taipan snake venom dissolved
in 25 mM CaCl2. Ecarin time was initiated with 25 µL of 5 units/mL Ecarin venom in
table 1. The LAC ratio was determined for normal pooled plasma (NPP), NPP spiked with anti-β2GPI antibodies (ab1 = human monoclonal antibody against domain I; ab2 = mouse monoclonal antibody directed against domain I; ab3 = mouse monoclonal antibody against domain IV of β2GPI) and 13 well characterized patients. The LAC ratio was determined in the absence (-) or presence (+) of rivaroxaban (250 ng/mL). The patients were selected on the presence or absence of LAC in a diagnostic setting with aPTT and dRVVT-based assays. Conditions for which the diagnosis would change due to the presence of rivaroxaban are indicated in bold. Anti-CL: anti-cardiolipin antibodies, anti-FII: anti-prothrombin antibodies. NA = not measured. A normalized LAC ratio for the dRVVT and aPTT above 1.15 was considered positive and for Taipan snake venom time/Ecarin venom time the ratio was 1.17. Cut-offs were based on the 99th percentile of a healthy population.
99 6
chapter gwen m.a. van os
25 mM CaCl2. The LAC ratio was calculated by dividing the normalized ratio (result test sample/result NPP) for the LAC screen test by the normalized ratio of the LAC confirm test10.
The addition of rivaroxaban to NPP prolonged all conventional assays (PTT-LA, Actin FS, LA-1 and LA-2). The aPTT screen and confirm assays had comparable prolongations, resulting in a normalized LAC ratio that was hardly influenced. However, for the dRVVT screen assay a stronger prolongation of the coagulation time was observed compared to the dRVVT confirm assay. This lead to an increased normalized LAC ratio, as also has been published before11. Rivaroxaban did not influence either the Taipan venom time or the Ecarin time and therefore the normalized LAC ratio for the snake venom times remained stable (table 1).
When NPP was spiked with anti-β2GPI antibodies, all three assays to detect the presence of LAC became positive. Addition of rivaroxaban increased the LAC ratio when determined with a dRVVT. When LAC was determined with an aPTT, the ratio increased in one sample, decreased in one other, and in one it became negative. The
LAC ratio of the Taipan/Ecarin clotting times in the presence of anti-β2GPI antibodies did not change after addition of rivaroxaban.
Thirteen patients suffering from systemic lupus erythematodes (SLE) were selected. For 6 patients with a positive LAC ratio (patients A-F), the LAC ratio was not influenced when measured with the Taipan/Ecarin venom assays, but slightly increased when the LAC ratio was measured with the aPTT, and strongly influenced when the LAC ratio was measured with the dRVVT in the presence of rivaroxaban. Addition of rivaroxaban 100 to the LAC positive plasmas did not influence the outcome of LAC determination. When rivaroxaban was added to the plasma of the 7 SLE patients (G-M) negative for LAC, different results were observed. When the LAC ratio was measured with an aPTT in the presence of rivaroxaban, 3 of the 7 patients became positive for LAC. No influence of rivaroxaban on the Taipan/Ecarin time was observed.
Here we show that the presence of rivaroxaban in plasma samples at pharmacological concentrations can change the results of LAC determinations as measured with the officially recommended assays for the detection of LAC: the aPTT and the dRVVT. The effect of rivaroxaban on the aPTT is subtle. When plasma was used from SLE patients know to be negative for LAC, approximately 40% of these plasmas became (weakly) positive after addition of rivaroxaban. An aPTT clotting time will in general only increase when the levels of one of the clotting factors that determine the aPTT decreases below ~50%12. However, when a weak inhibitor is combined with slightly decreased levels of clotting factors, individually not strong enough to influence the aPTT, the combined effect could prolong the aPTT enough to become positive in LAC detection of lac in the presence of rivaroxaban
testing. Taipan and Ecarin are two snake venoms that contain a direct activator of prothrombin. The ratio between the Taipan and Ecarin clotting times is useful to determine the presence of LAC9. Our experiments show that the Taipan/Ecarin ratio is a sensitive assay to measure the presence of LAC and that this ratio is not affected by the presence of rivaroxaban.
101 6
chapter gwen m.a. van os
REFERENCES
1. Miyakis S, Lockshin M, Atsumi T et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost. 2006; 4: 295–306 2. De Laat B, Derksen R, Urbanus R, de Groot P. IgG antibodies that recognize epitope Gly40-Arg43 in domain I of β2–glycoprotein I cause LAC, and their presence correlates strongly with thrombosis. Blood. 2005; 105: 1540-1545 3. Galli M, Luciani D, Bertolini G, Barbui T. Lupus anticoagulants are stronger risk factors for thrombosis than anticardiolipin antibodies in the antiphospholipid syndrome: a systematic review of the literature. Blood 2003; 101: 1827–1832 4. Derksen R, de Groot P. Towards evidence-based treatment of thrombotic antiphospholipid syndrome. Lupus. 2010; 19: 470-474 5. Ruiz-Irastorza G, Cuadrado M, Ruiz-Arruza I et al. Evidence-based recommendations for the prevention and long-term management of thrombosis in antiphospholipid antibody-positive patients: Report of a Task Force at the 13th International Congress on Antiphospholipid Antibodies. Lupus. 2011; 20: 206-218 6. Kubitza D, Becka M, Wensing G, Voith B, Zuehlsdorf M. Safety, pharmacodynamics, and pharmacokinetics of BAY 59-7939 – an oral, direct factor Xa inhibitor – after multiple dosing in healthy male subjects. Eur J Clin Pharmacol. 2005; 61: 873–880 7. Cohen H and Machin S. Antithrombotic treatment failures in antiphospholipid syndrome: the new anticoagulants. Lupus. 2010; 19: 486-491 8. Graff J, von Hentig N, Misselwitz F, Kubitza D, Becka M, Breddin H, Harder S. Effects of the Oral, Direct Factor Xa Inhibitor Rivaroxaban on Platelet-Induced Thrombin Generation and Prothrombinase Activity. J Clin Pharmacol. 2007; 47: 1398-1407 9. Moore G, Smith M, Savidge G. The ecarin time is an improved confirmatory test for the taipan snake venom time in warfarinized patients with lupus anticoagulant. Blood coagul fibrin. 2003; 14: 307-312 10. Pengo V, Tripodi A, Reber G, Rand J, Ortel T, Galli M, De Groot P. Update of the guidelines for lupus anticoagulant detection. Subcommittee on Lupus Anticoagulant/Antiphospholipid antibody of the scientific and standardization committee of the international society of thrombosis and haemostasis. J Thromb Haemost. 2009; 7: 1737-1740 102 11. Merriman E, Kaplan Z, Butler J, Malan E, Gan E, Tran H. Rivaroxaban and false positive lupus anticoagulant testing. Thromb Haemost 2010; 105: 385-386 12. Burns E, Goldberg S, Wenz B. Paradoxic effect of multiple mild coagulation factor deficiencies on the prothrombin time and activated partial thromboplastin time. Am J Clin Pathol. 1993; 100: 94-98 detection of lac in the presence of rivaroxaban
103 6
chapter
Chapter 7
Auto-antibodies against
β2GPI: Etiology and mechanism of action
General discussion and summary
Gwen M.A. van Os gwen m.a. van os
The antiphospholipid syndrome
The antiphospholipid syndrome (APS) is an autoimmune disease characterized by the persistent presence of antiphospholipid antibodies (aPL) in plasma of patients with thrombotic events and/or recurrent fetal loss1. Although the name of the syndrome suggests otherwise, phospholipids are not the antigen but rather proteins with affinity for anionic phospholipids. The presence of aPL antibodies can be detected in three ways: with prolongation of clotting assays, known as lupus anticoagulant (LAC), and
with two different ELISA set-ups with either cardiolipin or β2-Glycoprotein I (β2GPI) as antigens. Although the outcome of these tests can vary strongly, auto-antibodies 2,3 towards β2GPI should be the major determinant in all three assays . As the definition of APS stated that only persistently present aPL are considered relevant, the tests should be positive twice, 12 weeks apart. aPL are often present during infections and by measuring at two separate occasions falsely positive results for these tests due to infections can be excluded and APS can be properly diagnosed4.
β2GPI: THe main antigen
β2GPI is considered to be the major antigen in the antiphospholipid syndrome.
β2GPI is a plasma protein belonging to the complement control protein (CCP) family and it consists of five separate domains. Domain I to domain IV contain each ~60 amino acids folded together by two disulfide bridges. Domain V is slightly larger and contains an extra disulfide bridge. The extra amino acids constitute a phospholipid
binding site. β2GPI is highly glycosylated and its glycans comprise approximately of
20% the weight of the protein. Recently, we showed that β2GPI can exist in two
conformations (Chapter 2 of this thesis). In plasma, β2GPI is in a closed conformation, which cannot be not recognized aPL. After interaction with anionic phospholipids, the conformation is forced to an open fish-hook shaped structure, similar to the structure revealed by crystallography5,6. This fish-hook conformation can be recognized by aPL. 106 The clinical relevant epitope for the auto-antibodies is located within the first domain 7,8,9,10 of β2GPI around amino acids Arg39-Arg43 . Interaction with phospholipids or a 11 hydrophilic ELISA tray switches the conformation of β2GPI .
Origin of anti- GPI antibodies β2
Several studies have successfully linked the presence of anticardiolipin antibodies to a history of infections. However, when these patient groups were tested for the presence 12 of anti-β2GPI antibodies no correlation was found . Antibodies are generated by general discussion
the immune system to neutralize non-self substances in your body. The antibody recognizes a unique epitope of the foreign material and by binding to this epitope the antibody marks the pathogen and identifies it for neutralization cells of the immune system. Occasionally the immune system does not function properly and antibodies towards self proteins are developed. The general consensus is that the auto-antibodies are induced by an infection. There are two theories that try to explain why antibodies towards self proteins are developed (a) molecular mimicry and (b) the infectious agent as adjuvant: the exposure of cryptic epitopes normally not exposed to the circulation.
Until recently most evidence about the origin of anti-β2GPI antibodies pointed in the direction of molecular mimicry. However, the discovery that β2GPI can exist in two completely different conformations draw our attention to the hypothesis of an infection as adjuvant. The next part presents data published in the search to the origin of autoantibodies against β2GPI.
Molecular mimicry
Infectious agents can contain epitopes that are similar to epitopes of self-proteins. An immune response towards the infectious agent may additionally result in a response towards the self-proteins. Sequence similarities between foreign and self proteins can be sufficient to induce a loss of immune tolerance resulting in the formation of autoantibodies. The group of Shoenfeld has shown homology between the peptide 13 TLRVYK in domain III of β2GPI and various microbial agents . Additionally, it was shown that the presence of antibodies against this peptide in mice resulted in fetal resorption. The value of these observations for the human situation is questionable, since there are no indications that antibodies against domain III correlate with increased thrombotic manifestations and their presence only weakly correlates with recurrent spontaneous abortions in patients with APS14. It should also be considered that the third domain of β2GPI is highly glycosylated, making peptide sequences in domain III unavailable for antibody recognition. In another study, Gharavi et al.15 injected mice with a peptide derived from cytomegalovirus with homology to 107 an amino acid sequence present in domain V of β2GPI. They found the induction 7 of IgM antibodies directed against β2GPI with functional properties comparable as found in APS. However, these antibodies were not observed in patients with acute cytomegalovirus infections16. In a third study, Krause et al.17 identified cross reactivity chapter between antibodies against the cell wall of Saccharomyces cerevisiae and β2GPI in patients with APS. However, the presence of these antibodies was not associated with any specific clinical manifestations of APS. In conclusion, it seems possible to induce auto-antibodies towards β2GPI with peptides derived from infectious agents in mice, but there are no indications that the same auto-antibodies can be found in patients gwen m.a. van os
with APS. The lack of a correlation of these induced antibodies with thrombosis and fetal loss suggested to us that molecular mimicry is not a favorable theory to explain
the etiology of anti-β2GPI antibodies.
Neo epitope of β2GPI
A more likely mechanism for the development of antibodies towards β2GPI is in our opinion the neo-epitope theory. This theory claims that by altering the conformation of a self-protein, the proteins are no longer recognized as self and antibodies can develop towards the newly exposed epitopes. The conformational switch we have
observed for β2GPI fits with this theory. This conformational change of β2GPI can be induced by various factors. In chapter 3 of this thesis we report that a cell membrane
protein of S. pyogenes, protein H, is capable of switching the conformation of β2GPI.
β2GPI is not the only protein in the circulation that can be the subject of substantial conformation changes (ref factor H). The question arises why, compared to other
plasma proteins, auto-antibodies are formed against β2GPI so often. A possible
explanation is that the exposure of the neo-epitopes in β2GPI occurs more often than
in other plasma proteins. Theoretically the conformational switch in β2GPI can be facilitated in different ways via: (a) intrinsic (by the protein itself), (b) endogenous and (c) exogenous factors.
table 1 : Presence of anti-β2GPI antibodies during an infection
Disease serotype ref Various infections IgG 27 108 Acute syphilitic posterior placoid chorioretinitis IgM 28 Inflammatory bowel disease IgG 29 Macrovascular disease IgA, IgM 30 Vasculitis in combination with infection IgG, IGM 31 Leptospirosis, syphilis, kala-azar IgG, IgM 32 Varicella chicken pox IgM 33 HIV IgG, IgM, IgA 34 Hepatitis B IgG, IgM 35 E. coli, Proteus sp. and Klebsiella sp IgG 36 S. pyogenes IgG, IgM 37 general discussion
Intrinsic
β2GPI is a protein that shows a certain variation for both the coding sequence as well as the extent of glycosylation. These might be of influence on the ability to change the conformation of the protein. There are three well studied polymorphisms in the coding region of β2GPI leading to amino acid substitutions: Val247Leu, Cys306Gly and Trp316Ser with respective frequencies between 0.30-0.50, 0.00-0.04 and 0.00-0.06, depending on the ancestry18,19. Although several publications claim a correlation between polymorphism Val247Leu and anti-β2GPI antibodies, the overall consensus is that a correlation between auto-antibody formation and polymorphisms in β2GPI is lacking20,21.
β2GPI is a highly glycosylated protein with 4 N-linked glycan sites. Three glycosylation sites are located within Domain III at amino acids 143, 164 and 174 and the fourth site is present at amino acid 234 in domain IV. The glycans of the amino acid 164, 174, and 234 are directed to the inside of the fish hook according to the crystal structure5,6, whereas the glycan attached to Asn143 is located to the outside the protein. A hypothesis has been formulated that this glucose blocks the Arg39-Arg43 epitope11. This hypothesis has been developed further by Kondo et al. 2009 who showed that some APS patients have β2GPI molecules with a reduced number of sialic acids in the glycan structure at Asn14322. They suggest that the alteration of the glycan alters the electrostatic properties leading to an instable conformation of β2GPI and exposure of the cryptic Arg39-Arg43 site. Additionally, it has been suggested that advanced glycosylation at certain lysine residues in β2GPI can interfere with its conformation thereby triggering dendritic cells. This alteration of conformation might also trigger auto-antibody formation23. All these findings are the result of in vitro biochemical research and only confirmed in very small selected patient groups. To establish whether changes in glycosylation of β2GPI play a role in the development of auto-antibodies, these findings need to be confirmed in larger patient populations.
Endogenous 109
The conformation of GPI is altered after binding to phospholipids in such a way 7 β2 that after binding it is possible to interact with the auto-antibodies11. Additionally, immunization of mice with GPI bound to phospholipids leads to auto-antibody
β2 chapter 24 development towards β2GPI . This suggests that the presence of phospholipid surfaces could play a role in the exposure of neo-epitopes and anti-β2GPI development. Indeed, Yamaguchi et al. showed that excessive exposure of anionic surfaces maintained 25 the auto-antibody response to β2GPI in APS patients . These studies suggest that the etiology of anti-β2GPI antibodies lies in interaction of β2GPI with an anionic phospholipid surface. In this respect it is of interest that β2GPI is involved in the clearance of apoptotic bodies and anionic microparticles (refs). Extensive apoptosis gwen m.a. van os
can be a trigger to form auto-antibodies against β2GPI.
Exogenous
The conformation of β2GPI can also be altered by interaction with proteins of pathogens, as we have shown for protein H of S. pyogenes (Chapter 3). Despite the
lack of larger studies on the presence of anti-β2GPI antibodies in patient populations suffering from infections, there are numerous case reports on the presence of
anti-β2GPI antibodies after an infection (table 1). The lack of studies on a correlation
between infection and anti-β2GPI antibodies is not surprising given that the frequency 26 of anti-β2GPI antibodies is low in the healthy population .
Although we cannot identify a single cause for the etiology of anti-β2GPI antibodies, we hypothesize that the common denominator for the auto-antibody formation is the switch in conformation of the protein from a closed circular to an open fish hook conformation revealing the cryptic epitope in domain I. This open structure triggers the formation of antibodies.
It has been convincingly established that the permanent presence of auto-antibodies
towards β2GPI correlate with an increased risk of thrombus formation. However, these life-threatening clinical manifestations might be an unwanted side effect of an advantageous role that these auto-antibodies might have in innate immunity. There is in vitro evidence that the antibodies support the scavenging of LPS and
the clearance of apoptotic bodies. The induction of autoantibodies towards β2GPI during e.g. an infection might possibly help the innate immune system in its defense against infectious agents. As these antibodies are often reported in patients as response
to different infectious diseases, they might help β2GPI in fighting the infection, by
maintaining β2GPI in its open conformation, the conformation in which it can function as a scavenger for cellular debris and bacterial products38. The presence of 39,40 110 anti-β2GPI antibodies might increase the efficiency of these processes . It has been suggested recently that a group of plasma proteins characterized by a positive charge
and unclear function, like β2GPI and PF4, have a role in the innate immunity by clearing undesired proteins from the circulation41. Indeed recently it was found that
β2GPI in its open conformation can bind complement factor C3 and mediates cleavage of this complement factor42.
Auto-antibodies against β2GPI in leprosy patients
Auto-antibodies towards β2GPI are an important characteristic to identify patients with APS. As SLE is very often the underlying disease in patients with APS, there general discussion
is a high incidence of these antibodies in patients with SLE. However, there is also one other patient population with a high incidence of these auto-antibodies: patients with leprosy. Leprosy is a chronic infection caused by mycobacterium leprae and the symptoms are dependent on the hosts’ response to the infection, however thrombotic and pregnancy complications are lacking. Approximately, 50% of these patients 43,44 develop anti-β2GPI IgM . These patients also frequently develop anticardiolipin antibodies and LAC. The antibodies towards β2GPI are mainly directed against domain V45 and, as in the human situation, isolated auto-antibodies from these patients do not display thrombotic effects in an in vivo mouse model46. This is in contrast to the anti-β2GPI antibodies isolated from APS patients which are mainly directed against domain I. The reason why these antibodies arise patient with leprosy and why they are directed specifically towards the fifth domain ofβ 2GPI remains unclear.
The pathogenic mechanism behind the anti-β2GPI antibodies is properly multi factorial. The antibodies can activate endothelial cells, monocots (See chapter 1 for a complete overview). However the study of Arad et al. shows that minimal levels of anti-β2GPI antibodies are required with a minimum of incubation time for the 53 thrombotic effect . This points to a direct interaction of β2GPI/anti-β2GPI complex for thrombus formation. We have shown (Chapter 5) that β2GPI has an anticoagulant function in thrombus formation. When β2GPI is bound to phospholipids it shows anticoagulant effect by the inhibiting the activation of FXI to FXIa. With the addition of anti-β2GPI antibodies recognizing a cryptic epitope in β2GPI, this anticoagulant effect turns over to a procoagulant effect. We observed faster and increased thrombin formation and hypothesize this to be due to release of FXI of β2GPI due to anti-β2GPI antibodies.
Consequences of anti- GPI antibodies β2
Anti-β2GPI antibodies prolong the coagulation time in vitro while in vivo they are a surrogate biomarker for a prothrombotic state. Antibodies directed against β2GPI 111 47 strongly increase the affinity ofβ 2GPI for phospholipids , leading to competition with 7 coagulation factor for phospholipids in coagulation assays in vitro. However, β2GPI auto-antibodies potentiate thrombus formation in vivo. The mechanism by which these chapter auto-antibodies induce a procoagulant state remains unknown. Anti-β2GPI antibodies by themselves do not cause thrombosis; they enhance a thrombotic response when thrombus formation is triggered by e.g. vascular damage48.
Several population studies have shown that the presence of antibodies towards β2GPI are correlated with an increased risk for thrombosis49,50,51. Auto-antibodies against
β2GPI consist of a heterogeneous population of antibodies and it has been shown that gwen m.a. van os
antibodies towards the epitope of amino acids Arg39-Arg43 in domain I correlate much better with the risk for thrombosis than the total population of auto-antibodies 42 against β2GPI in a population of APS patients . Studies have shown that either total
IgG from APS patients, moAb anti-β2GPI antibodies or human purified anti-β2GPI antibodies when injected into mice lead to a stronger prothrombotic response in mice that were subjected to a thrombosis model48,53,54,55.
The pathogenic mechanism behind the anti-β2GPI antibodies is probably multi-factorial. The antibodies can activate endothelial cells and monocytes (See chapter 1 for a complete overview). However the study of Arad et al. shows that minimal levels
of anti-β2GPI antibodies are required with a minimum of incubation time for the 53 thrombotic effect . This points to a direct interaction of β2GPI/anti-β2GPI complex for
thrombus formation. We have shown that anti-β2GPI antibodies recognizing a cryptic epitope have prothrombotic properties in vitro in contrast to antibodies recognizing
other epitopes of β2GPI (Chapter 3).
persistent presence of anti- GPI antibodies β2
There are numerous publications reporting the presence of anti-β2GPI antibodies in plasmas of patients with infections or other diseases. It is unclear from these publications whether the presence of these antibodies is transient of persistent. The general consensus is that these infection-related antibodies are transiently present but no studies have been published showing that these antibodies disappear after
the infections. It is completely unclear why and when auto-antibodies against β2GPI become persistently present.
Genetic variation in the coding region of the protein does not correlate with the presence of antiphospholipid antibodies20,21. There is no scientific evidence that APS is a genetic disorder; the disease cannot be inherited from parents to children. However, 112 there are indications that it can cluster in families indicating a genetic predisposition. APS is often observed together in association with other autoimmune diseases, the most important one being systemic lupus erythematosus (SLE). For SLE, a genome wide association study has been performed studying 317.501 single-nucleotide polymorphisms (SNP). Eight genomic regions have been identified to be associated with SLE56. Two of these SNPs were also found to be associated with APS: STAT4 and BLK with Odds ratios just above 257. As expected for APS or autoimmune diseases in general there is a suggestion of an underlying genetic component although this cannot fully explain the origin of the disease. general discussion
Treatment of APS
APS is a rare disease and only a few small studies have been published comparing different treatments. Treatment of APS patients is rather eminence-based than evidence-based. There is now consensus on the treatment of thrombotic complications in APS patients58,59. In the past, the patients were treated with high intensity vitamin K-antagonists, however, the recent guidelines suggest the same intensity as patients with thrombosis due to other causes. The controversy is how long the treatment should be and whether patients with antiphospholipid antibodies but without an event should receive prophylactic treatment. Currently, new anticoagulant medication is developed that specifically targets one coagulation factor, like thrombin or FXa. The efficacy for these new anticoagulants in APS patients remains to be established60.
There are novel targets for drug development for treatment of patients with auto-antibodies against β2GPI. These drugs should interfere with binding of the antibodies to β2GPI, inhibit the binding of β2GPI to anionic surfaces or prevent 61 binding of β2GPI-antibody complexes to receptors on cells. Ioannou et al. developed a recombinant peptide resembling domain I and showed in a mouse thrombosis model that these peptides can function as decoy and can neutralize the effects of anti-β2GPI antibodies. Injection of mice with these peptides lead to a smaller thrombus size after an induced vessel wall injury. A second idea based on the use of peptides is the blocking of the phospholipid binding site in β2GPI, thereby preventing its interaction with 62 phospholipids leading to a diminished interaction of antibodies with β2GPI . A third inhibitor of pathogenic β2GPI is the dimeric A1-A1. A1 is the part of Apolipoprotein ER2 (ApoER2), a receptor expressed on platelets, endothelial cells and monocytes that interacts with domain V of β2GPI. This interaction results in activation of these cells and animal studies have shown that deficiency of this receptor attenuates the effects 113 of antiphospholipid antibodies in a mouse model of thrombosis. Although these three 7 approaches could all be promising it remains to be established whether this works in vivo. Furthermore, it should be excluded that the use of peptides mimicking parts of chapter β2GPI trigger the formation of autoantibodies towards β2GPI.
Future directions
To complete our findings of the etiology of theβ anti- 2GPI antibodies it needs to be investigated whether these antibodies have the same clinical characteristics as gwen m.a. van os
observed for APS patients. The conformational switch of β2GPI from a closed circular to an open fish hook conformation can be considered the common denominator of
the occurrence of auto-antibodies against β2GPI. However, many questions remain. The experiments with protein H (Chapter 3) showed that multiple protein boosts
are needed before auto-antibodies directed against β2GPI can arise. We need a better
understanding under which conditions β2GPI opens up and which time window is necessary for the induction of these auto-antibodies. This automatically leads to the second important question: what are the determinants that result in a switch from
temporary to permanently presence of auto-antibodies towards β2GPI. Current data are insufficient to answer this question. It is clear that antibodies directed against
β2GPI are not uncommon during infectious diseases and are transiently present. The
conditions to maintain the persistent presence of anti-β2GPI antibodies as observed for APS patients is unknown. By gaining more insight in these conditions, these can possibly be avoided and APS can be prevented.
114 general discussion
References
1. Giannakopoulos B, Passam F, Ioannou Y, Krilis S. How we diagnose the antiphospholipid syndrome. Blood. 2009; 113: 985-994 2. Galli M, Comfurius P, Maassen C et al. Anticardiolipin antibodies (ACA) directed not to cardiolipin but to a plasma protein cofactor. Lancet. 1990; 335: 1544-1547 3. McNeil H, Simpson R, Chesterman C, Krilis S. Anti-phospholipid antibodies are directed against a complex antigen that includes a lipid-binding inhibitor of coagulation: beta 2-glycoprotein I (apolipoprotein H). Proc Natl Acad Sci U S A. 1990; 87: 4120-4124 4. Miyakis S, Lockshin M, Atsumi T et al. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). 2006; J Thrombos Haemos; 4: 295-306 5. Bouma B, de Groot P, van den Elsen J, Ravelli R, Schouten A, Simmelink M, Derksen R, Kroon J, Gros P. Adhesion mechanism of human beta(2)-glycoprotein I to phospholipids based on its crystal structure. EMBO J. 1999; 18: 5166-74 6. Schwarzenbacher R, Zeth K, Diederichs K, Gries A, Kostner G, Laggner P, Prassl R. Crystal structure of human beta2-glycoprotein I: implications for phospholipid binding and the antiphospholipid syndrome. EMBO J. 1999; 18: 6228-6239 7. Iverson G, Victoria E, Marquis D. Anti-beta2 glycoprotein I (beta2GPI) autoantibodies recognize an epitope on the first domain of beta2GPI. Proc Natl Acad Sci U S A. 1998; 95: 15542-15546 8. de Laat B, Derksen R, Urbanus R, de Groot P. IgG antibodies that recognize epitope Gly40-Arg43 in domain I of beta 2-glycoprotein I cause LAC, and their presence correlates strongly with thrombosis. Blood. 2005; 105: 1540-1545 9. Ioannou Y, Pericleous C, Giles I, Latchman D, Isenberg D, Rahman A. Binding of antiphospholipid antibodies to discontinuous epitopes on domain I of human beta(2)-glycoprotein I: mutation studies including residues R39 to R43. Arthritis Rheum. 2007; 56: 280-290 10. Iverson G, Reddel S, Victoria E et al. Use of single point mutations in domain I of beta 2-glycoprotein I to determine fine antigenic specificity of antiphospholipid autoantibodies. J Immunol. 2002; 169: 7097-7103 11. de Laat B, Derksen R, van Lummel M, Pennings M, de Groot P. Pathogenic anti-beta2-glycoprotein I antibodies recognize domain I of beta2-glycoprotein I only after a conformational change. Blood. 2006; 107: 1916-1924 12. Sène D, Piette J, Cacoub P. Antiphospholipid antibodies, antiphospholipid syndrome and infections. Autoimmun Rev. 2008; 7: 272-277 115 13. Blank M, Krause I, Fridkin M, Keller N, Kopolovic J, Goldberg I, Tobar A, Shoenfeld Y. Bacterial induction of
autoantibodies to beta2-glycoprotein-I accounts for the infectious etiology of antiphospholipid syndrome. J Clin 7 Invest. 2002; 109: 797-804 14. Blank M, Shoenfeld Y, Cabilly S, Heldman Y, Fridkin M, Katchalski-Katzir E. Prevention of experimental
antiphospholipid syndrome and endothelial cell activation by synthetic peptides. Proc Natl Acad Sci U S A. chapter 1999; 96: 5164-5168 15. Gharavi A, Pierangeli S, Espinola R, Liu X, Colden-Stanfield M, Harris E. Antiphospholipid antibodies induced in mice by immunization with a cytomegalovirus-derived peptide cause thrombosis and activation of endothelial cells in vivo. Arthritis Rheum. 2002; 46: 545-552 16. Orts J, Colomina J, Zuniga A, Guerrero A. Cytomegalovirus infection and antiphospholipid syndrome in humans. Arthritis Rheum. 2003; 48: 3296-3297 17. Krause I, Blank M, Cervera R, Font J, Matthias T, Pfeiffer S, Wies I, Fraser A, Shoenfeld Y. Cross-reactive epitopes on beta2-glycoprotein-I and Saccharomyces cerevisiae in patients with the antiphospholipid syndrome. Ann N Y gwen m.a. van os
Acad Sci. 2007; 1108: 481-488 18. Leduc M, Shimmin L, Klos K, Hanis C, Boerwinkle E, Hixson J. Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 2008; 49: 2648-2656 19. Kamboh M, Sanghera D, Mehdi H, Nestlerode C, Chen Q, Khalifa O, Naqvi A, Manzi S, Bunker C. Single nucleotide polymorphisms in the coding region of the apolipoprotein H (beta2-glycoprotein I) gene and their correlation with the protein polymorphism, anti-beta2glycoprotein I antibodies and cardiolipin binding: description of novel haplotypes and their evolution. Ann Hum Genet. 2004; 68: 285-299 20. Camilleri R, Mackie I, Humphries S, Machin S, Cohen H. Lack of association of beta2-glycoprotein I polymorphisms Val247Leu and Trp316Ser with antiphospholipid antibodies in patients with thrombosis and pregnancy complications. Br J Haematol. 2003; 120: 1066-1072
21. Swadzba J, Sanak M, Iwaniec T, Dziedzina S. Valine/Leucine247 polymorphism of β2-glycoprotein I in patients with antiphospholipid syndrome: lack of association with anti-β2-glycoprotein I antibodies. Lupus. 2006; 15: 218-222 22. Kondo A, Miyamoto T, Yonekawa O, Giessing A, Østerlund E, Jensen O. Glycopeptide profiling of beta-2- glycoprotein I by mass spectrometry reveals attenuated sialylation in patients with antiphospholipid syndrome. J Proteomics. 2009; 73: 123-133 23. Buttari B, Profumo E, Capozzi A, Facchiano F, Saso L, Sorice M, Riganò R. Advanced glycation end products of human {beta}2glycoproteinI modulate the maturation and function of DCs. Blood. 2011; 117: 6152-6161 24. Subang R, Levine J, Janoff A, Davidson S, Taraschi T, Koike T, Minchey S, Whiteside M, Tannenbaum M, Rauch J. Phospholipid-bound beta 2-glycoprotein I induces the production of anti-phospholipid antibodies. J Autoimmun. 2000; 15: 21-32 25. Yamaguchi Y, Seta N, Kaburaki J, Kobayashi K, Matsuura E, Kuwana M. Excessive exposure to anionic surfaces maintains autoantibody response to beta(2)-glycoprotein I in patients with antiphospholipid syndrome. Blood. 2007; 110: 4312-4318 26. De Angelis V, Siegerink B, Algra A, Rosendaal FR, van Os G, de Groot P, Derksen R, Meroni P, Doggen C,
Urbanus R. Antibodies against domain I of β2-glycoprotein I are not associated with arterial thrombosis in the general population. Lupus. 2010; 19: A–022 27. Landenberg P, Lehmann H, Knöll A, Dorsch S, Modrow S. Antiphospholipid antibodies in pediatric and adult patients with rheumatic disease are associated with parvovirus B19 infection. Arthritis Rheum. 2003; 48: 1939–1947 28. Brito P, Penas S, Carneiro A, Palmares J, Reis F. Spectral-domain optical coherence tomography features of acute syphilitic posterior placoid chorioretinitis: the role of autoimmune response in pathogenesis. Case Report Ophthalmol. 2011; 1: 39-44 29. Koutroubakis I, Petinaki E, Anagnostopoulou E, Kritikos H, Mouzas I, Kouroumalis E, Manousos O. Anti-cardiolipin and Anti-β2-glycoprotein I Antibodies in Patients with Inflammatory Bowel Disease. Dig dis sci. 1998; 11: 2507-2512 116 30. Boin F, Franchini, S, Colantuoni E, Rosen A, Wigley F, Casciola-Rosen L. Independent association of anti– β2-glycoprotein I antibodies with macrovascular disease and mortality in scleroderma patients. Arthr Rheum. 2009; 60: 2480–2489 31. Bonaci-Nikolic B, Andrejevic S, Pavlovic M, Dimcic Z, Ivanovic B, Nikolic M. Prolonged infections associated with antineutrophil cytoplasmic antibodies specific to proteinase 3 and myeloperoxidase: diagnostic and therapeutic challenge. Clin Rheumatol. 2010; 29: 893-904 32. Santiago M, Martinelli R, Ko A, Reis E, Fontes R, Nascimento E, Pierangeli S, Espinola R, Gharavi A. Anti-beta2 glycoprotein I and anticardiolipin antibodies in leptospirosis, syphilis and Kalaazar. Clin Exp Rheumatol. 2001; 19: 425–430 33. Viseux V, Darnige L, Carmi E, Chaby G, Poulain J, Cevallos R, Lok C, Denoeux J. Pulmonary embolism and transitory anti-beta2-GPI antibodies in an adult with chicken pox. Lupus. 2000; 9: 558-560 34. Galrão L, Brites C, Atta M, Atta A, Lima I, Gonzalez F, Magalhães F, Santiago M. Antiphospholipid antibodies in HIV-positive patients. Clin Rheumatol. 2007; 11: 1825-1830 general discussion
35. Huh J, Yi D, Hwang S, Choi J, Kang M. Characterization of antiphospholipid antibodies in chronic hepatitis B infection. Korean J Hematol. 2011: 46; 36-40
36. Stojanović M, Inić-Kanada A, Popović Z, Zivković I, Dimitrijević L. Changes in pools of autoantibodies and anti-bacterial antibodies in patients suffering from recurrent infections of the urinary tract and undergoing bacterial immunization treatment. Immunol Lett. 2004; 94: 123-33
37. Van Os GM, Meijers JC, Ağar C, Valls Serón M, Marquart JA, Åkesson P, Urbanus RT, Derksen RH, Herwald H, Mörgelin M and de Groot PG Induction of auto-antibodies against β2Glycoprotein I in mice and men by protein H of Streptococcus pyogenes. J Thromb Haemost. 2011; doi: 10.1111/j.1538-7836.2011.04532.x. 38. Dombroski D, Balasubramanian K, Schroit AJ. Phosphatidylserine expression on cell surfaces promotes anti- body-dependent aggregation and thrombosis in beta2-glycoprotein I-immune mice. J Autoimmun. 2000; 14: 221-229
39. Balasubramanian K, Schroit AJ. Characterization of Phosphatidylserine-dependent β2-Glycoprotein I Macrophage Interactions. J Biol Chem 1998; 273: 29272-29277
40. Ağar C, de Groot P, Mörgelin M, Monk S, van Os G, Levels J, de Laat B, Urbanus R, Herwald H, van der Poll T, Meijers J. {beta}2-glycoprotein I: a novel component of innate immunity. Blood. 2011; 117: 6939-6947 41. Greinacher A. Opposites attract. Blood. 2010; 115: 440-441
42. Gropp K, Weber N, Reuter M, Micklisch S, Kopka I, Hallström T, Skerka C. β2glycoprotein I (β2GPI), the major target inthe anti-phospholipid syndrome (APS), is a special human complement regulator. Blood. 2011; 118: 2274-2783 43. de Larrañaga G, Forastiero R, Martinuzzo M, Carreras L, Tsariktsian G, Sturno M, Alonso B. High prevalence of antiphospholipid antibodies in leprosy: evaluation of antigen reactivity. Lupus. 2000; 9: 594-600 44. Forastiero R, Martinuzzo M, de Larrañaga G. Circulating levels of tissue factor and proinflammatory cytokines in patients with primary antiphospholipid syndrome or leprosy related antiphospholipid antibodies. Lupus. 2005; 14: 129-136 45. Arvieux J, Renaudineau Y, Mane I, Perraut R, Krilis S, Youinou P. Distinguishing features of anti-beta2 glycoprotein I antibodies between patients with leprosy and the antiphospholipid syndrome. Thromb Haemost. 2002; 87: 599-605
46. Forastiero R, Martinuzzo M, de Larrañaga G, Vega-Ostertag M, Pierangeli S. Anti-β2glycoprotein I antibodies from leprosy patients do not show thrombogenic effects in an in vivo animal model. J Thromb Haemost. 2011; 9: 859-861 47. Willems GM, Janssen MP, Pelsers MAL, Comfurius P, Galli M, Zwaal RFA, Bevers E. Role of divalency in the high affinity binding of cardiolipin antibody-β2-glycoprotein I complexes to lipid membranes. Biochemistry 1996; 35: 13833-42 48. Fischetti F, Durigutto P, Pellis V et al. Thrombus formation induced by antibodies to beta2-glycoprotein I is complement dependent and requires a priming factor. Blood. 2005; 106: 2340-2346 49. Galli M, Luciani D, Bertolini G, Barbui T. Lupus anticoagulants are stronger risk factors for thrombosis than anticardiolipin antibodies in the antiphospholipid syndrome: a systematic review of the literature. Blood. 2003; 117 101: 1827-1832
50. Urbanus R, Siegerink B, Roest M, Rosendaal F, de Groot P, Algra A. Antiphospholipid antibodies and risk of 7
myocardial infarction and ischaemic stroke in young women in the RATIO study: a case-control study. Lancet Neurol. 2009; 8: 998-1005
51. de Laat B, de Groot P, Derksen R, Urbanus R, Mertens K, Rosendaal F, Doggen C. Association between beta2- chapter glycoprotein I plasma levels and the risk of myocardial infarction in older men. Blood. 2009; 114: 3656-61 52. de Laat B, Pengo V, Pabinger I et al. The association between circulating antibodies against domain I of beta2- glycoprotein I and thrombosis: an international multicenter study. J Thromb Haemost. 2009; 7: 1767-1773
53. Arad A, Proulle V, Furie R, Furie B, Furie B. β₂-Glycoprotein-1 autoantibodies from patients with antiphospholipid syndrome are sufficient to potentiate arterial thrombus formation in a mouse model. Blood. 2011;117: 3453-3459 54. Jankowski M, Vreys I, Wittevrongel C, Boon D, Vermylen J, Hoylaerts M, Arnout J. Thrombogenicity of beta 2-glycoprotein I-dependent antiphospholipid antibodies in a photochemically induced thrombosis model in the gwen m.a. van os
hamster. Blood. 2003; 101: 157-162 55. Pierangeli S, Harris E. Antiphospholipid antibodies in an in vivo thrombosis model in mice. Lupus. 1994; 3: 247-251 56. Harley J, Alarcón-Riquelme M, Criswell L et al. Genome-wide association scan in women with systemic lupus erythematosus identifies susceptibility variants in ITGAM, PXK, KIAA1542 and other loci. Nat Genet. 2008; 40: 204-210 57. Yin H, Borghi M, Delgado-Vega A, Tincani A, Meroni P, Alarcón-Riquelme M. Association of STAT4 and BLK, but not BANK1 or IRF5, with primary antiphospholipid syndrome. Arthritis & Rheumatism. 2009; 60: 2468-2471 58. Derksen R, de Groot P. Towards evidence-based treatment of thrombotic antiphospholipid syndrome. Lupus. 2010; 19: 470-474 59. Ruiz-Irastorza G, Crowther M, Branch W, Khamashta M. Antiphospholipid syndrome. Lancet. 2010; 376: 1498-1509 60. Cohen H, Machin J. Antithrombotic treatment failures in antiphospholipid syndrome: the new anticoagulants? Lupus. 2010; 19: 486-491 61. Ioannou Y, Romay-Penabad Z, Pericleous C et al. In vivo inhibition of antiphospholipid antibody-induced pathogenicity utilizing the antigenic target peptide domain I of beta2-glycoprotein I: proof of concept. J Thromb Haemost. 2009; 7: 833-842
62. Blank M, Baraam L, Eisenstein M, Fridkin M, Dardik R, Heldman Y, Katchalski-Katzir E, Shoenfeld Y. β(2)- Glycoprotein-I based peptide regulate endothelial-cells tissue-factor expression via negative regulation of pGSK3β expression and reduces experimental-antiphospholipid-syndrome. J Autoimmun. 2011; 1: 2-17
118 general discussion
119 7
chapter
Appendices gwen m.a. van os
122 appendices: nederlandse samenvatting
APPENDIX 1: Nederlandse samenvatting voor niet-ingewijden
Hemostase is het mechanisme dat het lichaam in staat stelt een bloeding te stoppen. Wanneer een bloedvat beschadigd raakt treedt er eerst vasoconstrictie op, hierdoor vernauwt het bloedvat zich zodat er minder bloed wegstroomt. Tegelijkertijd binden de bloedplaatjes aan de beschadigde cellen van de vaatwand en vormen een plug die de beschadiging afdekt en de bloeding stopt. Om deze plug te versterken vindt er ook bloedstolling plaats. Hierbij zorgt een keten van bloedstollingsfactoren voor de aanmaak van fibrine die de plug verstevigt. Het proces van hemostase zorgter ook voor dat de bloedstolling stopt zodat de plug niet oneindig doorgroeit. Wanneer de vaatwand is hersteld zorgt het hemostase mechanisme er ook voor dat de plug
123
figuur 1. Schematische representatie van β2GPI in de open en gesloten structuur. Het is mogelijk om te wisselen tussen deze conformaties door te varieren in zoutconcentratie en de pH. gwen m.a. van os
wordt afgebroken en opgeruimd. Hemostase is in evenwicht, wanneer dit evenwicht uit balans is kan dit leiden tot verhoogde bloedstolling (trombose) of juist te weinig bloedstolling (bloeding).
Het antifosfolipiden syndroom (APS) is een auto-immuunziekte waarbij de hemos- tatische balans uit evenwicht is en patiënten een verhoogd risico op een trombose en zwangerschapscomplicaties hebben. Een auto-immuunziekte ontstaat doordat het lichaam een eigen cel of eiwit als vreemd ziet en hiertegen antistoffen gaat ontwik-
kelen. Bij APS worden vooral antistoffen gevonden tegen het eiwit β2-glycoproteïne
I (β2GPI). In het laboratorium wordt deze ziekte vastgesteld door een immunologi-
sche techniek waarbij direct antistoffen tegen cardiolipine of β2GPI worden gemeten. Ook kan de stoltijd van bloedplasma gemeten worden. Bij APS patiënten is dit vaak verlengd, echter wanneer er nu een overmaat aan fosfolipiden wordt toegevoegd aan het patiënten plasma wordt deze verlenging geneutraliseerd. Wanneer dit het geval is spreken wij van een lupus anticoagulant (LAC). Er is gekozen om mijn onderzoek te
focussen op het eiwit β2GPI, het ontstaan van antistoffen tegen dit eiwit en hoe deze antistoffen werken in het lichaam.
Het is mogelijk een kristalstructuur van een eiwit te maken. Hierin kan je zien waar welke aminozuren (bouwstenen van een eiwit) zitten en hoe die zich ten op zichte
van elkaar verhouden. Wanneer we kijken naar de structuur van β2GPI zien we de bindingsplaats van de antistoffen aan de buitenkant van het eiwit zitten. Toch kunnen
patiënten anti-β2GPI antistoffen niet aan het eiwit binden wanneer β2GPI in oplossing
is, maar wel wanneer β2GPI gebonden aan een oppervlakte is. Deze tegenstelling is
opgelost doordat we gevonden hebben dat β2GPI in twee conformaties kan voorko- men (figuur 1). Een open structuur in de vorm van een vishaak zoals de kristalstruc-
tuur er uit ziet. Deze vorm is in staat om te binden aan anti-β2GPI antistoffen. Maar
β2GPI komt in plasma voor in een gesloten, circulaire structuur. Deze circulaire vorm
bindt niet aan antistoffen. Het is mogelijk om de ene conformatie van β2GPI over te laten gaan in de ander door de zoutconcentratie en pH te wisselen (hoofdstuk 2). Deze zoutconcentratie en pH wisselingen zijn extreem en komen fysiologisch niet voor. Het is daarom van belang om te onderzoeken of deze conformatie wisselingen ook fysio- logisch kunnen plaatsvinden.
In het verleden is al aangetoond dat β2GPI kan binden aan oppervlakte eiwitten van 124 de bacterie Streptococcus pyogenes. Vier eiwitten van S. pyogenes; M1-eiwit, eiwit H,
SclA en SclB, kunnen binden aan β2GPI. Met de elektronenmicroscoop zijn wij in staat
deze eiwitten in beeld te brengen. Met deze techniek zagen wij dat β2GPI inderdaad bindt aan deze bacteriële eiwitten. Binding aan M1, SclA en SclB lieten geen confor-
matie verandering van β2GPI zien. Alleen de binding aan eiwit H induceert een confor-
mationele verandering in β2GPI, de gesloten conformatie opende zich. Muizen werden appendices: nederlandse samenvatting
geïnjecteerd met deze vier eiwitten. Alleen muizen geïnjecteerd met eiwit H ontwik- kelden antilichamen tegen β2GPI. Deze anti-β2GPI antilichamen zijn gericht tegen een cryptische epitoop in domein I van β2GPI. Dit toont aan dat naast de wijziging van de pH en zoutconcentratie ook een bacterieel eiwit de conformationele verandering in
β2GPI kan induceren. Dit resulteerde in de vorming van autoantilichamen tegen β2GPI (hoofdstuk 3 en figuur 2)
Er wordt veel onderzoek gedaan naar antilichamen tegen β2GPI, deze antilichamen vormen immers een risico voor trombose. Omdat de concentraties van β2GPI in het plasma sterk varieert tussen individuen wordt dit niet gebruikt als marker voor ziekten. Toch zien we in bepaalde ziekten een verlaagd plasma concentratie van β2GPI. Trombotische trombocytopenische purpura (TTP) is een bloedziekte waarbij bloed- stolsels gevormd worden in de kleine bloedvaten. Het wordt gekenmerkt door hoge en actieve von Willebrand (vWF) multimeren en een laag aantal bloedplaatjes. β2GPI bindt aan geactiveerd von Willebrand Factor (VWF), waardoor VWF geen bloedplaat- jes meer kan binden en er dus minder goed een bloedstolsel wordt gevormd. β2GPI plasma niveaus werden gemeten bij patiënten tijdens een acute aanval van TTP (ge- middeld 95 µg/ml) en bij patiënten met een voorgeschiedenis van TTP (148 µg/ml) en gezonde controles (220 µg/ml). We hebben gevonden dat tijdens een acute aanval van
TTP β2GPI in complex met vWF aan bloedplaatjes en rode bloedcellen bindt en we veronderstellen dat deze samen geklaard worden uit de circulatie (hoofdstuk 4).
Antilichamen tegen β2GPI bij APS patiënten leiden tot een verhoogd risico op trombose terwijl de stoltijd van het plasma van patiënten vaak verlengd is. In ons laboratorium hebben we twee groepen anti-β2GPI antilichamen gevonden. De eerste groep herkent
β2GPI ongeacht haar conformatie en de tweede groep herkent alleen β2GPI in zijn open vishaak conformatie. De verschillen tussen deze antilichamen werden getest in de trombine generatie test. Bij deze test meet je de vorming van trombine, deze stof ac- tiveert fibrinogeen tot het vormen van een stolsel. Anti-β2GPI antilichamen, die beide vormen van β2GPI herkennen hadden een remmend effect op de trombine vorming., Dit komt overeen met een verlenging van de stoltijd. Monoklonale antilichamen, die
β2GPI alleen herkende in de open conformatie, leidden tot een verhoogde trombine, hetgeen past bij een trombotisch fenotype. Blijkbaar kunnen bij APS patiënten 2 groepen antistoffen aanwezig zijn; een groep die de stolling versnelt en een die de stolling vertraagt (hoofdstuk 5). 125 Patiënten met het antifosfolipiden syndroom gebruiken vaak antistollingsmedicatie om een trombose te voorkomen. Deze behandeling stoort de bepaling van de stoltijd omdat de medicatie op zich zelf al de stoltijd verlengt. Momenteel worden er veel nieuwe antistollingsmedicijnen ontwikkeld waarvan rivaroxaban er een is. Rivarox- aban remt geactiveerd factor X. Wanneer dit medicijn wordt toegevoegd aan plasma gwen m.a. van os
figuur 2. Schematisch weergave van de vorming van antistoffen tegen β2GPI. VBNB,VLNR: (1)
126 β2GPI en de bacterie Streptococcus pyogenes met verschillende manteleiwitten.(2) β2GPI bindt
aan protein H van de bacterie. (3) Hierdoor verandert de conformatie van β2GPI, van een circulaire
naar een vishaak vorm. (4) De vishaak β2GPI bevat een epitope waartegen het lichaan antistoffen ontwikkeld. appendices: nederlandse samenvatting
van gezonde individuen leidt dit tot een vals-positief lupus anticoagulant signaal in de dilute Russell’s Viper Venom time (dRVVT). Rivaroxaban had geen invloed op de aPTT LAC ratio van normaal plasma, maar zorgde voor een enigszins verhoogde ratio in plasma van patiënten met APS. Voor plasma’s van een aantal individuen negatief voor LAC, leidt de aanwezigheid van rivaroxaban tot een vals-positief LAC signaal in de aPTT. Een alternatieve manier om een LAC te bepalen is door directe trombine activering met het fosfolipiden-afhankelijke Taipan slangengif en het fosfolipiden- onafhankelijke slangengif Ecarine. De verhouding van de Taipan tijd over Ecarin tijd wordt niet beïnvloed door de aanwezigheid van rivaroxaban, zowel in de afwezig- heid en aanwezigheid van antifosfolipiden antilichamen. Deze studie toont aan dat rivaroxaban kan interfereren met conventionele LAC testen. De Taipan tijd/Ecarin tijd verhouding kan een goed alternatief voor de detectie van LAC bij patiënten die behandeld worden met rivaroxaban (hoofdstuk 6).
127 gwen m.a. van os
Appendix 2: List of publications
Van Os GM, Meijers JC, Ağar C, Valls Serón M, Marquart JA, Åkesson P, Urbanus RT, Derksen RH, Herwald H, Mörgelin M and de Groot PG Induction of auto-antibodies
against β2Glycoprotein I in mice and men by protein H of Streptococcus pyogenes. Accepted for publication in J Thromb. Haemos. doi: 10.1111/j.1538- 7836.2011.04532.x
Van Os GM, de Laat B, Kamphuisen PW, Meijers JCM and de Groot PG. Detection of lupus anticoagulant in the presence of rivaroxaban by taipan snake venom time. J Thromb. Haemos. 2011; 9(8): 1657-1659
Ağar C, de Groot PG, Mörgelin M, Monk SD, van Os GM, Levels JH, de Laat B, Urbanus RT, Herwald H, van der Poll T, Meijers JC. -glycoprotein I: a novel β2 component of innate immunity. Blood. 2011; 117(25): 6939-47
Van Os GM*, Ağar C*, Mörgelin M, Sprenger RR, Marquart JA, Urbanus RT,
Derksen RH, Meijers JC, de Groot PG. β2glycoprotein I can exist in 2 conformations: implications for our understanding of the antiphospholipid syndrome. Blood. 2010; 116(8): 1336-43. *Both authors contributed equally
Van Os GM, Urbanus RT, Ağar C, Meijers JC, de Groot PG. Antiphospholipid syndrome. Current insights into laboratory diagnosis and pathophysiology. Hamostaseologie. 2010; 30: 139-43.
128 appendices
List of Other publications
Van Os GM, Meijers JC, Ağar C, Valls Serón M, Marquart JA, Åkesson P, Urbanus RT, Derksen RH, Herwald H, Mörgelin M and de Groot PG. Induction of auto-antibodies against β2Glycoprotein I in mice and men by protein H of Streptococcus pyogenes. J Thromb Haemost. 2011; 9 supplement; O-WE-036 Young investigator award.
Van Os GM, de Laat B, Kamphuisen PW, Meijers JC and de Groot PG. Detection of lupus anticogulant in the presence of rivaroxabon using taipan snake venom time. J Thromb Haemost. 2011; 9 supplement; P-TU-355
Van Os GM, Herwald H, Mörgelin M, Marquart A, Derksen RH, Meijers JC and de Groot PG. Induction of anti-β2GPI antibodies by S. pyogenes surface protein H. Symposium “Dutch society for thrombosis and haemostatis” 2010 Science Award.
Van Os GM, Herwald H, Mörgelin M, Marquart A, Derksen RH, Meijers JC, and de
Groot PG. Induction of anti-β2GPI auto-antibodies by S. pyogenes surface protein H. Lupus 2010; 19 (1 supplement)
Van Os GM, Meijers JCM, Urbanus RT, Derksen RHWM, de Groot PG. A rapid assay to distinguish between β2Glycoprotein I dependent and prothrombin dependent lupus anticoagulant. J Thromb Haemost. 2009; 7 supplement 2: OC-MO-030 Young investigator award.
129 gwen m.a. van os
130 appendices
Appendix 3: dankwoord
Eindelijk mijn proefschrift is af. Promoveren doe je niet alleen, zonder hulp van velen had mijn boekje er niet zo mooi uitgezien. Hierbij wil ik iedereen bedanken die mij op welke wijze ook heeft geholpen met het tot stand brengen van dit proefschrift. Zonder mensen te kort te doen wil ik een aantal in het bijzonder bedanken.
Allereerst mijn beide promotoren Prof. Dr. Ph. G. de Groot en Prof. Dr. J.C.M. Meijers. Beste Flip en Joost; een beter duo van promotoren had ik niet kunnen wensen. Ik wil jullie bedanken voor het mooie project en alle begeleiding, discussies en gezelligheid de afgelopen vier jaar.
Ook de samenwerking met Lund heeft veel bijgedragen aan mijn proefschrift. Ik nam eiwitten mee en stuurde werk naar jullie op. Heiko bedankt voor alle kennis over protein H en Streptococcus, Matthias bedankt voor de schitterende foto’s, er liggen geloof ik nog wel wat gridjes klaar om bekeken te worden.
De patiënten en minidonoren, belangeloos helpen jullie mee aan wetenschappelijk onderzoek. Zonder jullie was er niets te onderzoeken, hartelijk bedankt.
Collega’s van het LKCH en het EVG wil ik bedanken voor alle hulp en discussie maar meer nog voor de gezelligheid in de AIO kamer en daarbuiten. Het werk was een stuk leuker met tussendoor de een-, twee-, drie- en viertjes, de koekjes voor de telefoons, wekkers en verjaardagen, de taartcompetities en natuurlijk het vrijdagmiddag-vier- uur-bier-uurtje.
Hoewel ik met sommige vrienden eindeloos de OIO projecten kon vergelijken en meedenken over vervolgstappen was het ook heerlijk wanneer we gewoon met z’n allen gingen eten en wandelen (Biohazard), naar de kroeg (Schoonhovengroep), of van alles en nog wat (Utrecht). Bedankt voor alle ontspanning en gezelligheid.
Lieve Inge, Jochem, Sander, Charles en Joke; bedankt voor jullie interesse en hulp met alles.
Mijn lieve ouders; jullie onvoorwaardelijke steun voor alles. Of het nu om mijn studiekeuze ging, keuze voor een baan, het kopen van een huis altijd stonden jullie 131 klaar met advies en praktische hulp. Ik ben jullie erg dankbaar voor alle steun en liefde.
Lieve Krispijn, je liefde, geduld en af en toe een peptalk had ik niet kunnen missen. Je bent fantastisch!