Supplementary Material Molecular Cloning and Heterologous Expression of Manganese(II)-Oxidizing Enzyme from Acremonium strictum Strain KR21-2

Fuyumi Tojo 1, Ayumi Kitayama 2, Naoyuki Miyata 2,*, Kunihiro Okano 2, Jun Fukushima 3, Ryuichiro Suzuki 4 and Yukinori Tani 5

1 Akita Research Institute of Food and Brewing, 4-26 Sanuki, Arayamachi, Akita 010-1623, Japan; [email protected] 2 Department of Biological Environment, Akita Prefectural University, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] (A.K.); [email protected] (K.O.) 3 Department of Biotechnology, Akita Prefectural Univ1ersity, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] 4 Department of Biological Production, Akita Prefectural University, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] 5 Department of Environmental Health Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Shizuoka 422-8526, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-18-872-1660

Received: 26 May 2020; Accepted: 16 June 2020; Published: date

(Figure S1)

Figure S1. Nucleotide and deduced amino acid sequences of mco1 gene from A. strictum KR21-2. Underlined 25 amino acids correspond to the N-terminus of matured Mco1 determined previously (see ref. [23] in the Text). The amino acid residues at positions 149 are predicted signal peptide. Conserved Cu-binding regions are boxed, and bold characters in the box represent the Cu-binding residues. Shaded nucleotide sequences represent introns. Sequences with wavy underline indicate the targets of primers used in PCR amplification of the gene.

Figure S2. Neighbor-joining phylogenetic tree showing the relationship of A. strictum KR21-2 Mco1 with related MCOs. These include fungal bilirubin oxidases, laccases, ferroxidases, and L-ascorbate oxidases, along with bacterial spore coat proteins (CotA) and periplasmic Cu efflux system-associated proteins (CueO). The GenBank accession numbers are designated. The percentage bootstrap support from 1000 replicates is indicated at the branch points. Nd, Neonectria ditissima; Ff, Fusarium floridanum; Pf, Pestalotiopsis fici; Wo, Westerdykella ornata; Ln, Lophiotrema nucula; Cf, Colletotrichum fructicola; Por, Pyricularia oryzae; Av, Albifimbria verrucaria; Cn, Colletotrichum nymphaeae; Pco, Podospora comata; Mm, Madurella mycetomatis; Bp, Bacillus pumilus; Bs, Bacillus subtilis; Ec, Escherichia coli; Ca, Citrobacter amalonaticus; Dh, Diaporthe helianthi; Asp, Acremonium sp. HI-25; To, Tolypocladium ophioglossoides; Th, Trametes hirsuta; Lg, Lenzites gibbosa; Cg, Coriolopsis gallica; Pc, Polyporus ciliatus; Gl, Ganoderma lucidum; Ds, Dichomitus squalens; Cm, Coprinellus micaceus; Po, Pleurotus ostreatus; Ch, Colletotrichum higginsianum; Sa, Sodiomyces alkalinus; Gt, Gaeumannomyces tritici; Xm, Xylaria multiplex; Rn, Rosellinia necatrix; El, Eutypa lata; Nc, Neurospora crassa; Sf, Sordaria fimicola; Cl, Coniochaeta ligniaria; Tt, Thermothelomyces thermophilus.

Figure S3. Homology model of A. strictum KR21-2 Mco1 and crystal structure of bilirubin oxidase from Albifimbria verrucaria (AvBOx). (a) Overall structure of the Mco1 model shown in ribbon representation and colored as rainbow. N- and C-terminus are marked with N and C, respectively. Four copper ions in AvBOx structure are superimposed and shown as ocher sphere models; (b) Ribbon representation of the overall structure of AvBOx (PDB: 2XLL) colored as rainbow. Four Cu ions are indicated as ocher sphere models with residue number; (c) Close-up view of the Cu-binding sites (T2 and T3) in Mco1 model. The residues coordinating the Cu ions are shown as ball-and-stick models with residue number and colored as described for (a); (d) Close-up view of the Cu-binding sites (T2 and T3) in AvBOx structure; (e) Close-up view of the Cu-binding site (T1) in Mco1 model; (f) Close-up view of the Cu-binding site (T1) in AvBOx structure.

(a)

(b)

Figure S4. SEM images of solid-phase Mn produced by the enzyme reaction. (a) Solid Mn formed in the absence of ZnSO4; (b) Solid Mn formed in the presence of ZnSO4. The right panels in (a) and (b) are EDX elemental maps, which indicate the distribution of Mn (green)/O (red) and Mn (green)/Zn (blue)/O (red), respectively. Bar, 2 m.

Table S1. Primers used in this study 1

Primer Nucleotide sequence AKM-P2-F GAATTCCCAAGATGAAGTCCACACTGCTGTTACTG AKM-P1-R TCTAGACAGTGCTACTCAGACAACGAACCGA MCO-Comp-F CCAACGAATTCAAGAAGGATGAGAGTCCTGAATATCCTCTC MCO-Comp-R CCCTCTAGATCAGACAACGAACCGACGGTATC

1 The gene sequence that is hybridized with each primer is indicated in Figure S1.