DOCSLIB.ORG

Molecular Cloning and Heterologous Expression of Manganese(II)-Oxidizing Enzyme from Acremonium Strictum Strain KR21-2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Cloning and Heterologous Expression of Manganese(II)-Oxidizing Enzyme from Acremonium Strictum Strain KR21-2 Supplementary Material Molecular Cloning and Heterologous Expression of Manganese(II)-Oxidizing Enzyme from Acremonium strictum Strain KR21-2 Fuyumi Tojo 1, Ayumi Kitayama 2, Naoyuki Miyata 2,*, Kunihiro Okano 2, Jun Fukushima 3, Ryuichiro Suzuki 4 and Yukinori Tani 5 1 Akita Research Institute of Food and Brewing, 4-26 Sanuki, Arayamachi, Akita 010-1623, Japan; [email protected] 2 Department of Biological Environment, Akita Prefectural University, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] (A.K.); [email protected] (K.O.) 3 Department of Biotechnology, Akita Prefectural Univ1ersity, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] 4 Department of Biological Production, Akita Prefectural University, Shimoshinjo-Nakano, Akita 010-0195, Japan; [email protected] 5 Department of Environmental Health Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Shizuoka 422-8526, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-18-872-1660 Received: 26 May 2020; Accepted: 16 June 2020; Published: date (Figure S1) Figure S1. Nucleotide and deduced amino acid sequences of mco1 gene from A. strictum KR21-2. Underlined 25 amino acids correspond to the N-terminus of matured Mco1 determined previously (see ref. [23] in the Text). The amino acid residues at positions 149 are predicted signal peptide. Conserved Cu-binding regions are boxed, and bold characters in the box represent the Cu-binding residues. Shaded nucleotide sequences represent introns. Sequences with wavy underline indicate the targets of primers used in PCR amplification of the gene. Figure S2. Neighbor-joining phylogenetic tree showing the relationship of A. strictum KR21-2 Mco1 with related MCOs. These include fungal bilirubin oxidases, laccases, ferroxidases, and L-ascorbate oxidases, along with bacterial spore coat proteins (CotA) and periplasmic Cu efflux system-associated proteins (CueO). The GenBank accession numbers are designated. The percentage bootstrap support from 1000 replicates is indicated at the branch points. Nd, Neonectria ditissima; Ff, Fusarium floridanum; Pf, Pestalotiopsis fici; Wo, Westerdykella ornata; Ln, Lophiotrema nucula; Cf, Colletotrichum fructicola; Por, Pyricularia oryzae; Av, Albifimbria verrucaria; Cn, Colletotrichum nymphaeae; Pco, Podospora comata; Mm, Madurella mycetomatis; Bp, Bacillus pumilus; Bs, Bacillus subtilis; Ec, Escherichia coli; Ca, Citrobacter amalonaticus; Dh, Diaporthe helianthi; Asp, Acremonium sp. HI-25; To, Tolypocladium ophioglossoides; Th, Trametes hirsuta; Lg, Lenzites gibbosa; Cg, Coriolopsis gallica; Pc, Polyporus ciliatus; Gl, Ganoderma lucidum; Ds, Dichomitus squalens; Cm, Coprinellus micaceus; Po, Pleurotus ostreatus; Ch, Colletotrichum higginsianum; Sa, Sodiomyces alkalinus; Gt, Gaeumannomyces tritici; Xm, Xylaria multiplex; Rn, Rosellinia necatrix; El, Eutypa lata; Nc, Neurospora crassa; Sf, Sordaria fimicola; Cl, Coniochaeta ligniaria; Tt, Thermothelomyces thermophilus. Figure S3. Homology model of A. strictum KR21-2 Mco1 and crystal structure of bilirubin oxidase from Albifimbria verrucaria (AvBOx). (a) Overall structure of the Mco1 model shown in ribbon representation and colored as rainbow. N- and C-terminus are marked with N and C, respectively. Four copper ions in AvBOx structure are superimposed and shown as ocher sphere models; (b) Ribbon representation of the overall structure of AvBOx (PDB: 2XLL) colored as rainbow. Four Cu ions are indicated as ocher sphere models with residue number; (c) Close-up view of the Cu-binding sites (T2 and T3) in Mco1 model. The residues coordinating the Cu ions are shown as ball-and-stick models with residue number and colored as described for (a); (d) Close-up view of the Cu-binding sites (T2 and T3) in AvBOx structure; (e) Close-up view of the Cu-binding site (T1) in Mco1 model; (f) Close-up view of the Cu-binding site (T1) in AvBOx structure. (a) (b) Figure S4. SEM images of solid-phase Mn produced by the enzyme reaction. (a) Solid Mn formed in the absence of ZnSO4; (b) Solid Mn formed in the presence of ZnSO4. The right panels in (a) and (b) are EDX elemental maps, which indicate the distribution of Mn (green)/O (red) and Mn (green)/Zn (blue)/O (red), respectively. Bar, 2 m. Table S1. Primers used in this study 1 Primer Nucleotide sequence AKM-P2-F GAATTCCCAAGATGAAGTCCACACTGCTGTTACTG AKM-P1-R TCTAGACAGTGCTACTCAGACAACGAACCGA MCO-Comp-F CCAACGAATTCAAGAAGGATGAGAGTCCTGAATATCCTCTC MCO-Comp-R CCCTCTAGATCAGACAACGAACCGACGGTATC 1 The gene sequence that is hybridized with each primer is indicated in Figure S1. .
Load more

Recommended publications
  • (Gladiolus Grandiflorus Hort.) Corm Rot in Mexico Revista Mexicana De Fitopatología, Vol
    Revista Mexicana de Fitopatología ISSN: 0185-3309 [email protected] Sociedad Mexicana de Fitopatología, A.C. México González-Pérez, Enrique; Yáñez-Morales, María de Jesús; Ortega-Escobar, Héctor Manuel; Velázquez-Mendoza, Juan Comparative Analysis among Pathogenic Fungal Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot in Mexico Revista Mexicana de Fitopatología, vol. 27, núm. 1, enero-junio, 2009, pp. 45-52 Sociedad Mexicana de Fitopatología, A.C. Texcoco, México Available in: http://www.redalyc.org/articulo.oa?id=61211414006 How to cite Complete issue Scientific Information System More information about this article Network of Scientific Journals from Latin America, the Caribbean, Spain and Portugal Journal's homepage in redalyc.org Non-profit academic project, developed under the open access initiative Revista Mexicana de FITOPATOLOGIA/ 45 Comparative Analysis among Pathogenic Fungal Species that Cause Gladiolus (Gladiolus grandiflorus Hort.) Corm Rot in Mexico Enrique González-Pérez1, María de Jesús Yáñez-Morales2, Héctor Manuel Ortega- Escobar1, and Juan Velázquez-Mendoza3, Colegio de Postgraduados, 1Hidrociencias, 2Fitopatología, and 3Forestal, Campus Montecillo, km 36.5 Carr. México-Texcoco, Montecillo, Edo. de México CP 56230. Correspondence to: [email protected] (Received: July 16, 2008 Accepted: February 10, 2009) González-Pérez, E., Yáñez-Morales, M.J., Ortega-Escobar, este cultivo. Todas las especies fueron patogénicas, se H.M., and Velázquez-Mendoza, J. 2009. Comparative analysis agruparon en tres categorías por su agresividad para causar among pathogenic fungal species that cause gladiolus la enfermedad, difirieron en características culturales. Los (Gladiolus grandiflorus Hort.) corm rot in Mexico. Revista análisis moleculares corroboraron las especies identificadas Mexicana de Fitopatología 27:45-52.
    [Show full text]
  • Biological Diversity in the Patent System
    Biological Diversity in the Patent System Paul Oldham1,2*, Stephen Hall1,3, Oscar Forero1,4 1 ESRC Centre for Economic and Social Aspects of Genomics (Cesagen), Lancaster University, Lancaster, United Kingdom, 2 Institute of Advanced Studies, United Nations University, Yokohama, Japan, 3 One World Analytics, Lancaster, United Kingdom, 4 Centre for Development, Environment and Policy, SOAS, University of London, London, United Kingdom Abstract Biological diversity in the patent system is an enduring focus of controversy but empirical analysis of the presence of biodiversity in the patent system has been limited. To address this problem we text mined 11 million patent documents for 6 million Latin species names from the Global Names Index (GNI) established by the Global Biodiversity Information Facility (GBIF) and Encyclopedia of Life (EOL). We identified 76,274 full Latin species names from 23,882 genera in 767,955 patent documents. 25,595 species appeared in the claims section of 136,880 patent documents. This reveals that human innovative activity involving biodiversity in the patent system focuses on approximately 4% of taxonomically described species and between 0.8–1% of predicted global species. In this article we identify the major features of the patent landscape for biological diversity by focusing on key areas including pharmaceuticals, neglected diseases, traditional medicines, genetic engineering, foods, biocides, marine genetic resources and Antarctica. We conclude that the narrow focus of human innovative activity and ownership of genetic resources is unlikely to be in the long term interest of humanity. We argue that a broader spectrum of biodiversity needs to be opened up to research and development based on the principles of equitable benefit-sharing, respect for the objectives of the Convention on Biological Diversity, human rights and ethics.
    [Show full text]
  • Identification of Acremonium Isolates from Grapevines and Evaluation of Their Antagonism Towards Plasmopara Viticola
    Identification of Acremonium isolates from grapevines and evaluation of their antagonism towards Plasmopara viticola Sandra Lo Piccolo, Antonio Alfonzo, Selene Giambra, Gaetano Conigliaro, Luis V. Lopez-Llorca & Santella Burruano Annals of Microbiology ISSN 1590-4261 Ann Microbiol DOI 10.1007/s13213-015-1082-5 1 23 Your article is protected by copyright and all rights are held exclusively by Springer- Verlag Berlin Heidelberg and the University of Milan. This e-offprint is for personal use only and shall not be self-archived in electronic repositories. If you wish to self- archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com”. 1 23 Author's personal copy Ann Microbiol DOI 10.1007/s13213-015-1082-5 ORIGINAL ARTICLE Identification of Acremonium isolates from grapevines and evaluation of their antagonism towards Plasmopara viticola Sandra Lo Piccolo1 & Antonio Alfonzo1 & Selene Giambra1 & Gaetano Conigliaro1 & Luis V. Lopez-Llorca2 & Santella Burruano 1 Received: 8 July 2014 /Accepted: 1 April 2015 # Springer-Verlag Berlin Heidelberg and the University of Milan 2015 Abstract Some endophytic fungal genera in Vitis vinifera, Keywords Fungal endophytes . Phylogeny . RAPD . including Acremonium,havebeenreportedasantagonistsof Inhibition . Sporangia germination . Vitis vinifera Plasmopara viticola.EndophyticAcremonium isolates from an asymptomatic grapevine cultivar Inzolia from Italy were identified by morphological features and multigene phyloge- Introduction nies of ITS, 18S and 28S genes, and their intra-specific geno- mic diversity was analyzed by RAPD analysis.
    [Show full text]
  • Metabolites from Nematophagous Fungi and Nematicidal Natural Products from Fungi As an Alternative for Biological Control
    Appl Microbiol Biotechnol (2016) 100:3799–3812 DOI 10.1007/s00253-015-7233-6 MINI-REVIEW Metabolites from nematophagous fungi and nematicidal natural products from fungi as an alternative for biological control. Part I: metabolites from nematophagous ascomycetes Thomas Degenkolb1 & Andreas Vilcinskas1,2 Received: 4 October 2015 /Revised: 29 November 2015 /Accepted: 2 December 2015 /Published online: 29 December 2015 # The Author(s) 2015. This article is published with open access at Springerlink.com Abstract Plant-parasitic nematodes are estimated to cause Keywords Phytoparasitic nematodes . Nematicides . global annual losses of more than US$ 100 billion. The num- Oligosporon-type antibiotics . Nematophagous fungi . ber of registered nematicides has declined substantially over Secondary metabolites . Biocontrol the last 25 years due to concerns about their non-specific mechanisms of action and hence their potential toxicity and likelihood to cause environmental damage. Environmentally Introduction beneficial and inexpensive alternatives to chemicals, which do not affect vertebrates, crops, and other non-target organisms, Nematodes as economically important crop pests are therefore urgently required. Nematophagous fungi are nat- ural antagonists of nematode parasites, and these offer an eco- Among more than 26,000 known species of nematodes, 8000 physiological source of novel biocontrol strategies. In this first are parasites of vertebrates (Hugot et al. 2001), whereas 4100 section of a two-part review article, we discuss 83 nematicidal are parasites of plants, mostly soil-borne root pathogens and non-nematicidal primary and secondary metabolites (Nicol et al. 2011). Approximately 100 species in this latter found in nematophagous ascomycetes. Some of these sub- group are considered economically important phytoparasites stances exhibit nematicidal activities, namely oligosporon, of crops.
    [Show full text]
  • Cloacal Mycobiota in Wild Females of Caiman Latirostris (Crocodylia: Alligatoridae)
    Revista Mexicana de Biodiversidad 84: 722-726, 2013 722 Nuñez-Otaño et al.- Cloacal mycobiota of DOI:broud-snouted 10.7550/rmb.32425 caimans Research note Cloacal mycobiota in wild females of Caiman latirostris (Crocodylia: Alligatoridae) Micobiota cloacal de hembras de Caiman latirostris (Crocodylia: Alligatoridae) en estado silvestre Noelia Betiana Núñez-Otaño1,2 , Carlos Ignacio Piña1, 2, 3, 4, Thiago Costa Gonçalves Portelinha1, 2, 3 and Angélica Margarita Arambarri5 1Laboratorio de Ecología Animal. Centro de Investigaciones Científicas y Transferencia de Tecnología a la Producción, Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) Dr. Materi y España. CP 3105. Diamante (Entre Ríos), Argentina. 2Laboratorio de Zoología Aplicada: Anexo Vertebrados (FHUC-UNL / MASPyMA). CP. 3000 Santa Fe, Argentina. 3Facultad de Ciencias y Tecnología (UAdER). CP. 3105 Argentina. 4Facultad de Ciencias de la Alimentación (UNER). CP. 3100 Argentina. 5Laboratorio de Hongos Imperfectos. Instituto de Botánica Carlos Spegazzini. Facultad de Ciencias Naturales y Museo. CP. 1900 La Plata (Buenos Aires), Argentina. [email protected] Abstract. There are few reports of cloacal mycobiota on wild reptiles, and in particular, fungal presence and function in Caiman latirostris remains unknown. Our objective was to describe the fungal community present in the cloaca of wild female broad-snouted caimans during their reproductive season determine whether the number of fungi has some relationship with the female’s corporeal condition. Fungi were found in 9 out of 13 cloacal samples and 14 species of fungi were isolated and identified. Three of the species isolated had the highest occurrence values, and 2 of them are pathogenic. In this case, body condition index had no relationship with fungal frequency; the fungi found in this study may have originated from soil habitat and nest substrate that are in constant contact with the cloaca of the C.
    [Show full text]
  • Ecology of Epiphyllous Stages of Endophytes and Implications For
    &DPMPHZPGFQJQIZMMPVTTUBHFTPGFOEPQIZUFTBOEJNQMJDBUJPOTGPSIPSJ[POUBMEJTTFNJOBUJPO .5BEZDI+8IJUF +S 157 &DPMPHZPGFQJQIZMMPVTTUBHFTPGFOEPQIZUFTBOEJNQMJDBUJPOT GPSIPSJ[POUBMEJTTFNJOBUJPO M. TADYCH and J.F. WHITE, JR. Department of Plant Biology and Pathology, Rutgers University, New Brunswick, NJ 08901, USA [email protected] Abstract the spore fall technique. For each leaf an individual Petri dish Experiments were conducted to examine aspects of the ecology with Potato Dextrose Agar (Difco) amended with 20 mg/L of the epiphyllous stage of a Neotyphodium endophyte on penicillin and 40 mg/L streptomycin sulfate (PDA+2) as a trap leaves of Poa ampla (big bluegrass) plants. Conidia were found plate was used. A selected living leaf was placed into the trap to be readily water dispersed and to survive for several weeks plate on the surface of a coarse mesh positioned 2 mm above on leaf surfaces. Neotyphodium was found to colonise excised the medium level. The mesh supported the leaf avoiding direct grass leaves and grow on growing meristems of seedlings. contact with the medium. After 24 h the leaf was removed from The significance of epiphyllous stages of endophytes was also the plate. Precautions were taken to avoid touching the medium evaluated and discussed. or plate’s wall by the leaf while inserting it into, or removing it Keywords: Clavicipitaceae, Neotyphodium, conidia, dissemination, from, the plate. Then the plates were transferred to the laboratory water dispersal, endophytes, epiphytes, epiphyllous, big bluegrass, and incubated in the dark at 22°C for several days. As organisms Poa ampla developed on plates, they were transferred into a new plate with PDA or other appropriate medium and subcultured.
    [Show full text]
  • In Vitro Antagonistic Activity of Fungi Isolated from Sclerotia on Potato Tubers Against Rhizoctonia Solani
    E. DEMİRCİ, E. DANE, C. EKEN Turk J Biol 35 (2011) 457-462 © TÜBİTAK doi:10.3906/biy-1004-98 In vitro antagonistic activity of fungi isolated from sclerotia on potato tubers against Rhizoctonia solani Erkol DEMİRCİ1, Elif DANE2, Cafer EKEN1,3 1Department of Plant Protection, Faculty of Agriculture, Atatürk University, 25240 Erzurum - TURKEY 2Provincial Directorate of Agriculture, Section of Plant Protection, Manisa - TURKEY 3Ardahan University, Ardahan - TURKEY Received: 08.04.2010 Abstract: Forty-fi ve fungal isolates were obtained from sclerotia of Rhizoctonia solani on potato tubers in Erzurum, Turkey. Th e interaction between fungal isolates and R. solani was studied in dual culture technique. Some fungal isolates aff ected R. solani by antibiosis and/or parasitism. Results of the antagonism tests showed that Acremonium sp., Gliocladium viride, Paecilomyces marquandii, Paecilomyces sulphurellus, Penicillium camemberti, Penicillium expansum, Penicillium frequentans (ME-50), Penicillium nigricans, Penicillium olsonii, Penicillium phialosporum, Sporothrix sp. (MCY-4), Sporothrix schenckii, and Verticillium dahliae isolates produced an inhibition zone in front of the R. solani colony to a varying degree. Trichoderma harzianum isolates were able to overgrow the mycelium of R. solani. Physical colony contact was observed between the remaining 21 fungal isolates and R. solani. Furthermore, coiling of hyphae of Acremonium sp., Acremonium strictum, Gliocladium catenulatum, G. viride, and T. harzianum around those of R. solani was commonly observed. Key words: Biocontrol, potato, antibiosis, parasitism, Rhizoctonia solani Patates yumrularındaki sklerotiumlardan izole edilen fungusların Rhizoctonia solani’ye in vitro antagonistik etkileri Özet: Patates yumruları üzerinde bulunan Rhizoctonia solani’nin sklerotiumlarından 45 fungal izolat elde edilmiştir. Fungal izolatlar ve R.
    [Show full text]
  • Acremonium Pneumonia Successfully Treated in Patient with Acute Myeloid Leukemia: a Case Report
    Journal of Bacteriology & Mycology: Open Access Perspective Open Access Acremonium pneumonia successfully treated in patient with acute myeloid leukemia: a case report Abstract Volume 2 Issue 5 - 2016 Invasive fungal infection is a major cause of morbidity and mortality in patients Nikolay N Klimko,1 Sofya N Khostelidi,1 who receive treatment for acute myeloid leukemia (AML). We present the case of Ylia E Melekhina,1 Dmitry A Gornostaev,2 successful treatment of Acremonium spp. pneumonia in patient with acute myeloid 2 leukemia who underwent chemotherapy. Vyacheslav N Semelev, Tatyana S Bogomolova,1 Vadim V Tirenko2 Keywords: mycotic pneumonia, Acremonium spp., acute myeloid leukemia, 1Department of Clinical Mycology, Allergology and Immunology, voriconazole North-Western State Medical University, Russia 2SM Kirov Military Medical Academy, Russia Correspondence: Sofya N Khostelidi, Department of Clinical Mycology, Allergology and Immunology, North-Western State Medical University named after II Mechnikov, 194291, Santyago de Cuba str, Build 1/28 Saint-Petersburg, Russia, Tel +78123035146, Email [email protected] Received: June 30, 2016 | Published: October 04, 2016 Introduction condition worsened (dyspnea was growing) and he was transferred to ICU. He had persistent pyrexia despite treatment with imepenem, Fungal infection remains a significant cause of morbidity and linezolid, and caspofungin. The CT scans of his chest were repeated mortality in patients with AML. Moreover, there has been an increase and revealed a large abscess in the right lower lung. CT of the chest at of the fungal infections incidence caused by moulds such as Mucorales, 14th day revealed interstitial infiltrates with abscess in the right lower 1 2 Fusarium and Scedosporium and other rare micromycetes.
    [Show full text]
  • Full Article-PDF
    Scholarly Journals of Biotechnology Vol. 2(4), pp. 69-78, May 2013 Available online at http:// www.scholarly-journals.com/SJB ISSN 2315-6171 © 2018 Scholarly-Journals Full Length Research Paper Microbial isolation and identification associated with drinking water from various sources in Sokoto Metropolis Umar, S.1 and Baki, A.S.2 1College of Life Sciences and Technology, Beijing University of Chemical Technology, Beijing, China. 2Department of Microbiology, Faculty of Science, Usmanu Danfodiyo University, Sokoto. Accepted 33 April, 2013 The study was aimed at isolation and identification of microbes present in drinking water collected a Sokoto metropolis. A total of twenty (20) samples were collected from 4 different areas. Fungi, isolation were identifies using colonial and morphological characteristics. The results obtained indicated that fungal count range from 1.1x104 to 8.0x103cfu/ml. Six (6) species of fungi which include Aspergillus niger, Aspergillus oryzae, Mucor racemosus, Rhizopus stololnifer, Aspergillus flavus and Talaromyce flavus of fungi, isolated from drinking water indicated that Aspergillus niger with (39.28%) had the highest rate of occurrence followed by Aspergillus aryzae (17.85%), Aspergillus flavus (17.85-%), Mucor racemosus (10.71%), Rhizopus stolonifer (7.14%) and Taloromyce flavus (7.14%) which had the least rate of occurrence. It was observed from this study that all the isolated fungi were potential pathogens that can be deleterious to human health. Key words:- Isolation, microbes, Identification, Aspergillus flavus, Talaromyce flavus. INTRODUCTION Biofilm is made up of aggregates of micro organism, such industry. Many problems in drinking water distribution as bacteria, fungi, diatoms, protozoa, algae and any system are microbial including biofilm growth microbial exogenous materials, which are embedded in a hydrated mediated corrosion and persistence of pathogens extracellular matrix and attached to a solid surface (pipe, (Donlan, 2002).
    [Show full text]
  • The Protean Acremonium. A. Sclerotigenum/Egyptiacum: Revision, Food Contaminant, and Human Disease
    microorganisms Article The Protean Acremonium. A. sclerotigenum/egyptiacum: Revision, Food Contaminant, and Human Disease Richard C. Summerbell 1,2,*, Cecile Gueidan 3, Josep Guarro 4, Akif Eskalen 5, Pedro W. Crous 6, Aditya K. Gupta 7,8, Josepa Gené 4, Jose F. Cano-Lira 4, Arien van Iperen 6, Mieke Starink 6 and James A. Scott 2 ID 1 Sporometrics, 219 Dufferin St. Ste. 20C, Toronto, ON M6K 1Y9 Canada 2 Dalla Lana School of Public Health, University of Toronto, Toronto, ON M5T 3M7, Canada; [email protected] 3 Australian National Herbarium, National Research Collections Australia, CSIRO-NCMI, Canberra, ACT 2601, Australia; [email protected] 4 Unitat de Micologia, Facultat de Medicina i Ciencies de la Salut and IISPV, Universitat Rovira i Virgili, Reus, 43201 Tarragona, Spain; [email protected] (J.G.); [email protected] (J.G.); [email protected] (J.F.C.-L.) 5 Department of Plant Pathology, University of California Davis, Davis, CA 95616, USA; [email protected] 6 Westerdijk Fungal Biodiversity Institute, P.O. Box 85167, 3508 AD Utrecht, The Netherlands; [email protected] (P.W.C.); [email protected] (A.v.I.); [email protected] (M.S.) 7 Division of Dermatology, Department of Medicine, University of Toronto, Toronto, ON M5G 2C4, Canada; [email protected] 8 Mediprobe Research Inc., London, ON N5X 2P1, Canada * Correspondence: [email protected]; Tel.: +1-416-516-1660 Received: 2 June 2018; Accepted: 13 August 2018; Published: 16 August 2018 Abstract: Acremonium is known to be regularly isolated from food and also to be a cause of human disease.
    [Show full text]
  • Fungi in Drinking Water Distribution Systems, Including Water Temperature and Flow Rate, Material of Pipes and Interactions with Bacteria and Protozoa
    Defra Reference: WD 0906 A REVIEW OF FUNGI IN DRINKING WATER AND THE IMPLICATIONS FOR HUMAN HEALTH Final Report April 2011 In association with: Contact BIO Intelligence Service Pierre Sonigo - Arianna De Toni - Kate Reilly + 33 (0) 1 53 90 11 80 [email protected] [email protected] [email protected] This page is left intentionally blank Defra Final Report 2 Review of fungi in drinking water April 2011 Contents Executive summary 5 1. Introduction 9 2. Methodology 11 3. Fungal taxa in treated drinking water 13 3.1. Fungi entering the drinking water distribution system ..............................................................13 3.2. Identification and characterisation of fungi in the drinking water distribution system .......17 4. Fungal ecology in water systems 25 4.1. Abiotic and anthropogenic factors influencing ecology of fungal taxa in water systems ....25 4.2. Biotic factors influencing ecology of fungal taxa in water systems ..........................................34 4.3. Summary of biotic and abiotic factors influencing fungal ecology ...........................................38 5. Impacts on human health 41 5.1. Exposure pathways............................................................................................................................41 5.2. Direct health impacts of fungal infections ....................................................................................43 5.3. Factors that could influence some indirect health impacts .......................................................54
    [Show full text]
  • Sarocladium and Lecanicillium Associated with Maize Seeds and Their Potential to Form Selected Secondary Metabolites
    biomolecules Article Sarocladium and Lecanicillium Associated with Maize Seeds and Their Potential to Form Selected Secondary Metabolites Lidia Błaszczyk 1,* , Agnieszka Wa´skiewicz 2, Karolina Gromadzka 2, Katarzyna Mikołajczak 1 and Jerzy Chełkowski 1 1 Institute of Plant Genetics, Polish Academy of Sciences, Strzeszy´nska34, 60-479 Pozna´n,Poland; [email protected] (K.M.); [email protected] (J.C.) 2 Department of Chemistry, Poznan University of Life Sciences, Wojska Polskiego 75, 60-625 Pozna´n,Poland; [email protected] (A.W.); [email protected] (K.G.) * Correspondence: [email protected]; Tel.: +48-61-65-50-272 Abstract: The occurrence and diversity of Lecanicillium and Sarocladium in maize seeds and their role in this cereal are poorly understood. Therefore, the present study aimed to investigate Sarocladium and Lecanicillium communities found in endosphere of maize seeds collected from fields in Poland and their potential to form selected bioactive substances. The sequencing of the internally transcribed spacer regions 1 (ITS 1) and 2 (ITS2) and the large-subunit (LSU, 28S) of the rRNA gene cluster resulted in the identification of 17 Sarocladium zeae strains, three Sarocladium strictum and five Lecanicillium lecanii isolates. The assay on solid substrate showed that S. zeae and S. strictum can synthesize bassianolide, vertilecanin A, vertilecanin A methyl ester, 2-decenedioic acid and 10-hydroxy-8- decenoic acid. This is also the first study revealing the ability of these two species to produce beauvericin and enniatin B1, respectively. Moreover, for the first time in the present investigation, pyrrocidine A and/or B have been annotated as metabolites of S.
    [Show full text]