DOK4 and DOK5: New Dok-Related Genes Expressed in Human T Cells

DOK4 and DOK5: new dok-related genes expressed in human T cells

C Favre*1,AGe´rard*1, E Clauzier, P Pontarotti, D Olive and JA Nune`s 1U119 INSERM, Institut de Cance´rologie et d’Immunologie de Marseille, Universite´ de la Me´diterrane´e, Marseille, France

Dok proteins are adapter proteins involved in signal transduction. Several intracellular proteins expressed in lymphocytes meet the criteria of membrane-associated adapter proteins such as members of the Dok family. To understand the role and the formation of multiprotein networks involving Dok proteins in T lymphocytes, we search for potential additional members of this family. Here, we describe the two new human dok-related genes DOK4 and DOK5 and present data showing the expression of DOK4 and DOK5 genes in T cells. These genes are the orthologues of mouse Dok4 and Dok5 genes. Based on analysis of phylogenetic trees and exon/intron structure of Dok family members, DOK4 and DOK5 define a subfamily within dok genes distinct from DOK1, DOK2 and DOK3. So, Dok-4 and Dok-5 molecules constitute a new group of adapter proteins in T cells, requiring further functional analysis. Genes and Immunity (2003) 4, 40–45. doi:10.1038/sj.gene.6363891

Keywords: Dok proteins; adapter molecules; T cells

Introduction (SH3) domain-containing PTKs such as Src family kinases or the Abl kinase. On the other hand, several T cell activation requires T cell receptor (TcR) signalling tyrosine phosphorylation sites are present creating dock- upon binding to the peptide–MHC complex on the ing sites for Src homology 2 (SH2) domain-containing antigen-presenting cell (APC), and a second antigen- adapter molecules such as Nck, the Ras GTPase-activat- 1 independent signal called co-stimulation. Signal trans- ing protein (RasGAP) or the product of the X-lympho- duction events delivered into T cells after APC contacts, proliferative syndrome gene, SH2D1A/SAP.3,6–8 The are dependent on the formation of intracytoplasmic structure of Dok-1 presents some similarities with other multiprotein networks. Adapter molecules play a key adapter molecules such as Gab proteins or insulin 2 role in the organization of these complexes. These receptor substrate (IRS) proteins.9,10 Two proteins sharing molecules can be major substrates for cytoplasmic extensive sequence homology with the amino-terminal protein tyrosine kinases (PTKs), linking membrane part (PH and PTB domains) of Dok-1 have been cloned: receptors to signaling pathways involved in many Dok-2 (also known as FRIP or Dok-R)11–14 and Dok-3 functions in T cells such as cytokine gene expression, (also known as Dok-L).15,16 These proteins are essentially cell adhesion or proliferation. Identification of these expressed in hematopoietic tissues.15 Among the Dok adapter molecules sets up the first step on dissecting the family members, only Dok-1 and Dok-2 are expressed in implication of signalling networks in T cell functions. T cells. These adapters can be phosphorylated by an Dok-1 protein meets these criteria since this intracel- antigen-independent signal involving costimulatory mo- lular molecule is phosphorylated by PTKs upon receptor lecules such as CD2 or CD28.17–20 stimulation in hematopoietic cells. Dok-1 is constitutively Cloning of three members (Dok1, Dok2 and Dok3) phosphorylated on tyrosine residues in chronic myelo- raises the possibility to perform database searches to genous leukemia cells expressing the oncoprotein Bcr- identify new putative Dok protein members. A first 3 Abl. The amino-terminal part of Dok-1 contains a screening has been performed with a sequence containing pleckstrin homology (PH) domain and a phospho- a high homology between Dok-1, Dok-2 and also Dok- tyrosine-binding (PTB) domain, which are thought to 3.11,14 Among putative proteins displaying a Dok mediate the association with the plasma membrane and homology (DKH) sequence motif, a search has been with phosphotyrosine-containing Y/MxxNxLpY motifs, performed for proteins containing a PH domain followed 4,5 respectively. The carboxy-terminal part of Dok-1 likely by a PTB domain. functions as a molecular platform for signal complex Following these criteria, two new proteins have been assembly induced by activated PTKs. On the one hand, recently identified in mice: Dok-4 and Dok-5.21 These Dok-1 contains some proline-rich regions that may proteins are expressed mostly in non-hematopoeitic cells constitute docking sites for various Src homology 3 and act downstream of PTKs. In the present study, we report the characterization of the human DOK4 and DOK5 genes. We show that these genes are expressed in Correspondence: Jacques A Nune`s, U119 INSERM, 27 Bd Leı¨ Roure, peripheral blood T cells, which raises the possibility of 13009 Marseille Cedex, France. E-mail: [email protected] the role of Dok-4 and Dok-5 proteins in the regulation of *These authors contributed equally to this work. the immune response induced by T cells. DOK4 and DOk5 gene expression in T cells C Favre et al 41 Results the Dok-2 ancestor. However, this cannot be accessed for In silico identification of new Dok adapter the PTB domain of group A due to a lack of resolution. family members Dok-4 and Dok-5 form a monophylogenetic cluster suggesting that the dok genes from group B could derive Analysis of the public databases revealed the presence of from a common ancestor. An important point is that each putative candidate members of the Dok adapter fa- 11,14 human dok gene has its orthologue in mouse. Thus, a mily. These studies have led to the identification of an complex set of five dok genes could predate to the amino acid sequence in the PTB domain displaying a mammalian radiation. high similarity between the first three Dok family members: Dok-1 (human DOK1 and mouse Dok1 genes), Genomic structure of dok genes Dok-2/FRIP/DokR (human DOK2 and mouse Dok2 A gene prediction program was combined to a compar- genes) and also Dok3/DokL (mouse Dokl-pending ison of the matching ESTs, for identifying different gene). This sequence has been defined as a Dok human dok genes, named DOK1 to DOK5. Figure 2 homology (DKH) sequence motif (WPxxxLRxxGx shows a deduced exon/intron structure of the different DxxxFxFExGR, where x is any amino acid residue).11,14 dok genes. The two groups of genes defined by the To identify potential new members of the Dok adapter phylogenetic analysis display a different general exon/ family, we performed public database similarity searches intron structure. The dok genes of group A are composed using this DKH motif and also the sequence of human of four or five putative exons and the dok genes of group DOK1 as probes. Based on the screening with the DKH B are composed of eight putative exons. The putative motif, we identified several candidates containing this exons encoded, in order, a PH domain, a PTB domain signature as it has been shown previously. The DKH and a region containing some phosphorylable tyrosine motif is present in the functional PTB domains of Dok1/ residues and proline-rich sequences. The PH or PTB 2/3. By using a three-dimensional structure prediction domain of Dok from group A is encoded by one or two program, we showed that all the new candidates contain exons. The classification of DOK3 in group A by the a putative PTB domain where the DKH motif is located. phylogenetic analysis suggests that the nature of exon 4 The general structure of Dok1/2/3 displays a PH is a result of the fusion of two ancestral exons. However, domain followed by a PTB domain at their amino- the PH or PTB domain of Dok from group B is encoded terminus. Some of the candidates do not present a PH by four exons. domain upstream the PTB domain. These proteins Analysis of phylogenetic trees and exon/intron struc- correspond to another group of adapter molecules which ture of Dok family members are congruent, since the bind to some receptor tyrosine kinases:SNT-1/2 (suc1- same groups (A and B) can be defined in both associated neurotrophic factor target, also known as experimental approaches. These results could predict FRS2a/b).22 However, we identified five candidates the general exon/intron structure of the two common containing a PH domain followed by a PTB domain. ancestors of the dok genes. The same results were obtained by using human DOK1 sequence for screening public databases. These mole- Expression analysis cules from human and their mouse homologues are The dok family members from group A are mainly denoted as Dok-1, Dok-2, Dok-3, Dok-4 and Dok-5. The expressed in hematopoeitic tissues.15 For group B in sequences of DOK1/2 in human and Dok1/2/3 in mice mouse, Dok4 is broadly expressed in many tissues and have been reported previously.3,7,11–13,15,16 Recently, Dok5 is essentially expressed in brain.21 To establish the Dok4/5 genes have been cloned from mouse tissues.21 expression pattern of DOK4 and DOK5 in humans, The amino acid sequences from human DOK3/4/5 genes Northern blotting analysis was performed (Figure 3). have been deduced (see Material and Methods). Among human tissues, DOK4 and DOK5 are highly expressed in heart and skeletal muscles. An expression of Phylogenetic analysis DOK4 can be clearly detected also in liver, small intestine The human or mouse five dok genes encode for two and lung. An expression of DOK5 can be clearly detected potential functional domains (PH and PTB domains). in brain and kidney. Using this approach, little or no The PH and PTB domains from the human and mouse DOK4 and DOK5 were detectable in other tissues as Dok family members were analyzed separately. If the lymphoid organs. To detect a low expression level of phylogeny trees are congruent, this suggests that both DOK4 and DOK5 transcripts, PCR analysis was used. We domains result from the same evolution story since exon prepared cDNA from heart where dok genes of group B shuffling did not occur during these evolutionary events. are expressed (Figure 3) or from spleen where dok genes The PH and PTB domains were aligned including an of group A are expressed15 and also from resting or outgroup as the PH or PTB domain of IRS-1. Like Dok activated T cells. We used them for PCR with specific proteins, the IRS-1 adapter molecule contains a PH primers for the different dok genes. To verify the RT-PCR domain followed by a PTB domain at the amino- specificity, the PCR products were cloned and se- terminus part.7,11 quenced. As shown in Figure 4, dok genes of group B The two phylogenetic trees are congruent and can are expressed in heart and dok genes of group A are discriminate two groups denoted as A and B, since group expressed in spleen. In group A, only DOK1 and DOK2 A contains DOK1, DOK2, DOK3 and group B contains are expressed in human T cells. These data are consistent DOK4, DOK5 (Figure 1). The presence of two groups is with previously published studies showing that consistent with previously published studies in mouse.21 Dok3 gene is not expressed in mouse T cells.15 In the In group A, the PH domain of Dok-1 and Dok-3 forms new dok group B, DOK4 can be detected in T cells. a monophylogenetic cluster indicating that these genes However, DOK5 is only detectable in T cells could be derived from a common ancestor different from upon stimulated conditions. DOK4, but not DOK5, is

Genes and Immunity DOK4 and DOk5 gene expression in T cells C Favre et al 42 physiological processes in hematopoeitic organs, especially in lymphoid tissues.12,15,16,23,24 Recently, two new Dok family members have been identified in mouse tissues, but the expression of these molecules has not been reported in T cells.21 In search for new genes that may be involved in T cell activation, we investigated the possible existence of new Dok family members expressed in human T cells. By using computer programs for gene prediction and available public databases, we were able to identify two new human genes, named DOK4 and DOK5. Based on analysis of phylogenetic trees (Figure 1) and exon/intron structure (Figure 2) of Dok family members, we identified two groups: on the one hand, DOK1, DOK2 and DOK3 (group A), and on the other DOK4 and DOK5 (group B). Structural studies have shown that PH and PTB domains adopt the same fold25 It is noteworthy that a PH domain or PTB domain is encoded by an equal number of exons into the same group of dok genes (Figure 2). So, PH and PTB domains encoded by dok genes may be derived from a duplication of a common ancestral domain. By finding new human dok genes, we investigated the possibility that these genes are expressed in hematopoietic organs and especially in T cells. Northern blot analysis did not permit detection of DOK4 or DOK5 gene expression in lymphoid tissues like thymus, spleen or peripheral blood leukocytes (Figure 3). However, these genes are expressed in other human tissues consistent with previous data in mouse.21 Using RT-PCR technique that is more sensitive than Northern blot analysis, the expression of the dok genes from groups A and B has been studied in human peripheral blood T cells (Figure 4). In group A, only DOK1 and DOK2 genes are expressed in T cells, consistent with data published in mouse tissues.15 In group B, expression of DOK4 or DOK5 gene can be detected in human peripheral blood T cells. An interesting point is that DOK5 gene is expressed in activated but not resting T cells. This suggests that the expression of an adapter molecule as Dok-5 is regulated upon T cell activation. Taken together, these data point to a possible role of two new dok family members in human T cells. Dok-1 and Dok-2 expressed in T cells seem to play a negative role in T cell function.12,26 These inhibitory effects can be mediated by phosphotyrosyl motifs interacting by recruitment of RasGAP, a negative regulator of Ras/MAP kinase signaling.3,7,11,12 Dok proteins from group A can also attenuate signal transduction pathways by binding other negative regulators such as a lipid phosphatase SHIP or a PTK Figure 1 Phylogenic trees of human and mouse dok family 15,16,27 members. Phylogenics trees were calculated using the sequences Csk. The inhibitory effects could also be explained of PH and PTB domains of dok family members using IRS-1 as by a competition between Dok-1/2/3 and other PTB outgroup. The Dok members cluster in two groups noted as A and domain proteins known as positive regulators.12,28 Dok-4 B. The bootstrap values at the nodes are expressed in percentage. and Dok-5 proteins have been described in mouse to be substrates of the c-Ret receptor tyrosine kinase.21 Dok-4 detectable in spleen. Our results indicate that four dok and Dok-5 do not recruit the RasGAP protein and can genes (DOK1, 2, 4 and 5) can be expressed in human T enhance MAP kinase activation.21 In contrast to Dok-2, cells and the expression of DOK5 is regulated after T cell Dok-4 and Dok-5 can promote the neurite outgrowth activation. induced by c-Ret tyrosine kinase receptor. Dok proteins from the two groups could play an opposite role in neuronal cell system. Discussion Here, we have shown that Dok-4 and Dok-5 are expressed in T cells and Dok-5 expression is regulated Over the past 5 years, a new family of adapter proteins: upon T cell activation. We are now exploring the Dok molecules appears to play a role in diverse potential role of Dok-4 and Dok-5 in T cells with which

Genes and Immunity DOK4 and DOk5 gene expression in T cells C Favre et al 43

Figure 2 Schematic diagram showing the comparison of the genomic structure of the human Dok family members. Exons are shown by open boxes, and introns by the connecting lines. Numbers inside boxes indicate exon lengths in base pairs. The 50 UTR and 30 UTR extremities are not represented. The introns are not drawn to scale. Roman numbers indicate intron phases. The positions of the PH and PTB domains are indicated by the dotted lines. we should be able to address the relevance of the two Research Fund web server using the 3DPSSM program groups of Dok proteins in T cell signaling. (http://www.bmm.icnet.uk/B3dpssm/).

Phylogenic analysis Multiple alignment and phylogeny was performed Materials and methods independently on each domain using the Clustal X Database searching software package available from the National Center A sequence containing a high homology between the for Biotechnology Information web server (http:// first three members of the Dok family (Dok-1, Dok-2 and www.ncbi. nlm.nih.gov) using the sequences of the PH also Dok-3) has been described. This sequence has been and PTB domain of the Doks family members. Phylo- defined as a Dok homology (DKH) sequence motif. DKH genetic studies were performed using the Neighbour sequence (WPxxxLRxxGxDxxxFxFExGR, where x is any Joining method. The reliability was visualized by the amino acid residue) or the sequence of human full-length TreeView software package (http://taxonomy.zoology.gla. Dok1 (GenBankTM accession number NP_001372) was ac.uk/rod/rod.html). subjected to similarity search using the tBLASTN algorithm on the National Center for Biotechnology Genomic organization Information web server (http://www.ncbi.nlm.nih.gov/ The nucleotide sequences of the Doks family members blast/) and on the Institute for Genomic Research web were subjected to similarity search using the BLASTN server (http://www.tigr.org/) against the EST database algorithm on the National Center for Biotechnology (dbEST) and Non-redundant database (nr). Selected Information web server against the human Unfinished clones were obtained from the I.M.A.G.E. consortium High Throughput Genomic Sequences database (htgs). through Resource Center/Primary Database (http:// GENSCAN prediction gene program was used to www.rzpd.de). The clones were propagated, purified identify dok genes from the genomic sequences. These and sequenced from both directions with an automated sequences were submitted to analysis with a splicing sequencer by Genome ExpressTM (Grenoble, France) prediction program NetGene2 from the Center for using insert-flanking vector primers. Biological Sequence Analysis web server (http:// DOK3 sequence was predicted from three ESTs clones www.cbs.dtu.dk/) to determine the position of introns from NCBI database (accession number NM_024872, and exons and intron phase. The intron phase refers to AK026223, BC004564). DOK4 sequence was predicted the location of the intron within the codon; I denotes that from four ESTs clones and one gene product from NCBI the intron occurs after the first nucleotide of the codon, II database (accession number BC001540, BC003541, denotes the intron occurs after the second nucleotide, 0 NM_018110, AK001350, HUAC004382). DOK5 sequence denotes the intron occurs between codons. was predicted from two ESTs clones and three gene products from NCBI database (accession number Northern Blotting + AF132732, HSM800394, XM_030597, NM_018431, Human tissue poly(A) RNA blots (MTN 7780-1 CLON- TM HS805C22). The human and mouse gene nomenclature TECH ) were hybridized with radiolabeled probes belongs to the Human Gene Nomenclature Database corresponding to DOK4, DOK5 and bActin according (http://www.gene.ucl.ac.uk/nomenclature) or the Mouse to the manufacturer’s instructions. Probe for Dok-4 was Genome Database (http://www.informatics.jax.org). performed by digestion of I.M.A.G.E. consortium’s clone (GenBankTM accession number AI969431) by SalI and NotI and therefore DpnI to obtain a length of 400 bp of Structure analysis specific DNA. Probe for DOK5 was performed The sequences of the various Doks molecules were used using PCR against I.M.A.G.E. consortium’s clone for prediction domain studies on the Imperial Cancer (GenBankTM accession number AA480087) with the

Genes and Immunity DOK4 and DOk5 gene expression in T cells C Favre et al 44

Figure 4 DOK genes expression in human T cells as determined by RT-PCR. b2-microglobulin was used as a control gene.

purchased from Clontech Laboratories, Inc. total RNA (2 mg) was reverse-transcribed. Then, cDNA were used for PCR with specific primers for DOK1: sense 50-aggactccctatactcagaccccttg-30 and antisense 50-ccccagtct- tgtcagtccctactcta-30; for DOK2: sense 50-cctactctcggccgcat- gactcact-30 and antisense 50-ctgccagccagaagcagagaaatcct- 30; for DOK3: sense 50-ccatggaccctctggagacccctat-30 and antisense 50-cctgccaggaggagtagatggagtttt-30; for DOK4: sense 50-atgaagagcaggaagctcgggatcta-30 and antisense 50-ggtagatgttctcgtgggtgatctgc-30;forDOK5:sense50-gagca- gacgcctcgggatttatcag-30 and antisense 50-cctccctgcctcaaaa- gtgaaccac-30; or for b2microglobulin: sense 50-ccagcaga- gaatggaaagtc-30 and antisense 50-taagttgccagccctcctag-30. PCR was carried out in a reaction mixture containing 2 ml of cDNA, 20 mM Tris–HCl (pH 8.4), 50 mM KCl, 1.5 mM

MgCl2, 200 mM dNTP, 0.5 mM each primer and 2.5 units of Taq DNA Polymerase (GibcoBRL). The cycling conditions were 941C for 5 min followed by 35 cycles of 941C for 1 min, 551C (or 601C for DOK2) for 1 min, 721C for Figure 3 Gene expression patterns of DOK genes from group B. 1 Northern blot analysis of DOK4 and DOK5 genes in various tissues. 2 min and a final extension at 72 C for 10 min. Equal A filter containing poly(A)+ selected RNA prepared from multiple amounts of PCR products were electrophoresed on 1.5% human tissues was hybridized with a radiolabeled DOK4 and agarose gels and visualized by ethidium bromide DOK5 probe (A and B) or b-actin probe (C). The positions of staining. To avoid the possibility that the bands could migration of RNA molecular weight markers are indicated at left. correspond to amplified genomic DNA, the sense and antisense primers have been designed in different exons. The amplified fragments (492 bp for DOK1, 383 bp for following primers: sense 50-agcgggaacagaatgagaga-30 and DOK2, 471 bp for DOK3, 550 bp for DOK4, 450 bp for antisense 50-tcatgttgctcagctatgcc-30. DOK5 and 498 bp for b2microglobulin) were cloned into pGEM T-Easy vector (Promega) and sequenced from Cells culture both directions using vector specific primers by Genome TM Peripheral blood mononuclear cells (PBMC) from Express (Grenoble, France). healthy donors were prepared with standard Ficoll- Hypaque density gradient separation techniques. PBMC cDNA cloning are loaded into T cells Enrichment Columns (R&D Total RNA, extracted from human T cells stimulated for Systems) to purified Tcell population. Human peripheral 24 h by CD3 plus CD28 mAbs, was used to make random blood lymphocyte-T (PBL-T) were cultured in RPMI 1640 primed cDNA for the RT-PCR. supplemented with 10% FCS and activated for 24 h with PCR was carried out in a reaction mixture containing coated CD3 mAb (289 at 2 mg/ml) and CD28 mAb (248 at 2 ml of the RT-PCR products, 200 mM dNTP, 0.5 mM each a dilution 1:400 in ascitis liquid). appropriate primer and 2.5 units of Taq Advantage DNA Polymerase (CLONTECHTM). The cycling conditions Cellular and tissue expression by PCR analysis were 941C for 5 min followed by 35 cycles of 941C for Total RNA from PBL-T was extracted using Trizol 1 min, 551C for 1 min, 721C for 2 min and a final extension reagent (GibcoBRL, Inc.) following the manufacturer’s at 721C for 10 min. For human DOK4 tagged HA epitope, instructions. Total RNA from spleen and heart were PCR was performed with the following primers: sense

Genes and Immunity DOK4 and DOk5 gene expression in T cells C Favre et al

0 45 5 -atgtacccatacgacgtcccagactacgct atggcgaccaatttcagtga- 9 Hibi M, Hirano T. Gab-family adapter molecules in signal catcgtc-30 and antisense 50-tcactgggatggggtcttggcctcac-30. transduction of cytokine and growth factor receptors, and T For human DOK5 tagged HA epitope, PCR was and B cell antigen receptors. Leuk Lymphoma 2000; 37: 299–307. performed with the following primers: sense 50-atgtacc- 10 Van Obberghen E, Baron V, Delahaye L et al. Surfing the catacgacgtcccagactacgctatggcttccaattttaatgacatagtg-30 and insulin signaling web. Eur J Clin Invest 2001; 31: 966–977. antisense 50-tcagtgctcagatctgtaggctgg-30. The amplifica- 11 Di Cristofano A, Carpino N, Dunant N et al. Molecular cloning tions were cloned into the pGEM-T easy vector (Prome- and characterization of p56dok-2 defines a new family of RasGAP-binding proteins. J Biol Chem 1998; 273: 4827–4830. ga) and sequenced as described above. 12 Nelms K, Snow AL, Hu-Li J, Paul WE. FRIP, a hematopoietic The nucleotide sequences of human DOK4 and DOK5 cell-specific rasGAP-interacting protein phosphorylated in were submitted to GenBank; they have been assigned the response to cytokine stimulation. Immunity 1998; 9: 13–24. accession numbers AF466369 and AF466368, respec- 13 Jones N, Dumont DJ. The Tek/Tie2 receptor signals through a tively. A similar sequence to DOK5 can be found with novel Dok-related docking protein, Dok-R. Oncogene 1998; 17: the accession number XP_030597. An alignment of 1097–1108. predicted amino acid sequences of human Dok-4 and 14 Lock P, Casagranda F, Dunn AR. Independent SH2-binding Dok-5 is available in our web server (http://u119. sites mediate interaction of Dok-related protein with marseille.inserm.fr/do/dok45.html). RasGTPase-activating protein and Nck. J Biol Chem 1999; 274: 22775–22784. 15 Lemay S, Davidson D, Latour S, Veillette A. Dok-3, a novel adapter molecule involved in the negative regulation of Acknowledgements immunoreceptor signaling. Mol Cell Biol 2000; 20: 2743–2754. 16 Cong F, Yuan B, Goff SP. Characterization of a novel member We would like to thank Y Collette for a critical reading of of the DOK family that binds and modulates Abl signaling. this manuscript. This research was supported by the Mol Cell Biol 1999; 19: 8314–8325. Institut National de la Sante´ et de la Recherche Me´dicale, 17 Harriague J, Debre P, Bismuth G, Hubert P. Priming of by a grant "e´quipe labellise´e" from the Ligue Nationale CD2-induced p62Dok tyrosine phosphorylation by CD3 in Contre le Cancer and by Grants 4330 and 5740 from the Jurkat T cells. Eur J Immunol 2000; 30: 3319–3328. Association pour la Recherche contre le Cancer. C Favre 18 Ne´morin JG, Duplay P. Evidence that Lck-mediated phos- was supported by a fellowship from the Association phorylation of p56dok and p62dok may play a role in CD2 signaling. J Biol Chem 2000; 275: 14 590–14 597. pour la Recherche contre le Cancer. 19 Nune`s JA, Truneh A, Olive D, Cantrell DA. Signal transduction by CD28 ligands B7-1 and B7-2: CD28 regulation of tyrosine kinase adapter molecules. J Biol Chem 1996; 271: References 1591–1598. 20 Yang WC, Ghiotto M, Barbarat B, Olive D. The role of tec 1 Schwartz RH. Costimulation of T lymphocytes: the role of protein-tyrosine kinase in T cell signaling. J Biol Chem 1999; CD28 CTLA-4 and B7/BB1 in interleukin-2 production and 274: 607–617. immunotherapy. Cell 1992; 71: 1065–1068. 21 Grimm J, Sachs M, Britsch S et al. Novel p62dok family 2 Leo A, Schraven B. Adapters in lymphocyte signalling. Curr members, dok-4 and dok-5, are substrates of the c-Ret receptor Opin Immunol 2001; 13: 307–316. tyrosine kinase and mediate neuronal differentiation. J Cell 3 Carpino N, Wisniewski D, Strife A et al. p62dok: a constitu- Biol 2001; 154: 345–354. tively tyrosine-phosphorylated GAP-associated protein in 22 Dhalluin C, Yan K, Plotnikova O et al. Structural basis of SNT chronic myelogenous leukemia progenitor cells. Cell 1997; PTB domain interactions with distinct neurotrophic receptors. 88: 197–204. Mol Cell 2000; 6: 921–929. 4 Zhao M, Schmitz AA, Qin Y, Di Cristofano A, Pandolfi PP, Van 23 Di Cristofano A, Niki M, Zhao M et al. p62(dok) a negative Aelst L. Phosphoinositide 3-kinase-dependent membrane regulator of Ras and mitogen-activated protein kinase recruitment of p62(dok) is essential for its negative effect on (MAPK) activity, opposes leukemogenesis by p210(bcr-abl). mitogen-activated protein (MAP) kinase activation. J Exp Med J Exp Med 2001; 194: 275–284. 2001; 194: 265–274. 24 Suzu S, Tanaka-Douzono M, Nomaguchi K et al. p56(dok-2) as 5 Songyang Z, Yamanashi Y, Liu D, Baltimore D. Domain- a cytokine-inducible inhibitor of cell proliferation and signal dependent function of the rasGAP-binding protein p62Dok in transduction. Embo J 2000; 19: 5114–5122. cell signaling. J Biol Chem 2001; 276: 2459–2465. 25 Lemmon MA, Ferguson KM, Schlessinger J. PH domains: 6 Tang J, Feng GS, Li W. Induced direct binding of the adapter diverse sequences with a common fold recruit signaling protein Nck to the GTPase-activating protein-associated molecules to the cell surface. Cell 1996; 85: 621–624. protein p62 by epidermal growth factor. Oncogene 1997; 15: 26 Ne´morin JG, Laporte P, Berube G, Duplay P. p62dok 1823–1832. negatively regulates CD2 signaling in Jurkat cells. J Immunol 7 Yamanashi Y, Baltimore D. Identification of the Abl- and 2001; 166: 4408–4415. rasGAP-associated 62 kDa protein as a docking protein, Dok. 27 Tamir I, Stolpa JC, Helgason CD et al. The RasGAP-binding Cell 1997; 88: 205–211. protein p62dok is a mediator of inhibitory FcgammaRIIB 8 Sylla BS, Murphy K, Cahir-McFarland E, Lane WS, Mosialos signals in B cells. Immunity 2000; 12: 347–358. G, Kieff E. The X-linked lymphoproliferative syndrome gene 28 Jones N, Dumont DJ. Recruitment of Dok-R to the EGF product SH2D1A associates with p62dok (Dok1) and activates receptor through its PTB domain is required for attenuation of NF-kappa B. Proc Natl Acad Sci USA 2000; 97: 7470–7475. Erk MAP kinase activation. Curr Biol 1999; 9: 1057–1060.

Genes and Immunity