Downloaded From

Abnormal T Cell Receptor Signal Transduction of CD4 Th Cells in X-Linked Lymphoproliferative Syndrome

This information is current as Hiroyuki Nakamura, Jodi Zarycki, John L. Sullivan and Jae of October 1, 2021. U. Jung J Immunol 2001; 167:2657-2665; ; doi: 10.4049/jimmunol.167.5.2657 http://www.jimmunol.org/content/167/5/2657 Downloaded from

References This article cites 72 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/167/5/2657.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average by guest on October 1, 2021

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Abnormal T Cell Receptor Signal Transduction of CD4 Th Cells in X-Linked Lymphoproliferative Syndrome1

Hiroyuki Nakamura,* Jodi Zarycki,* John L. Sullivan,† and Jae U. Jung2*

The molecular basis of X-linked lymphoproliferative (XLP) disease has been attributed to mutations in the signaling lymphocytic activation molecule-associated protein (SAP), an src homology 2 domain-containing intracellular signaling molecule known to interact with the lymphocyte-activating surface receptors signaling lymphocytic activation molecule and 2B4. To investigate the effect of SAP defects on TCR signal transduction, herpesvirus saimiri-immortalized CD4 Th cells from XLP patients and normal healthy individuals were examined for their response to TCR stimulation. CD4 T cells of XLP patients displayed elevated levels of tyrosine phosphorylation compared with CD4 T cells from healthy individuals. In addition, downstream serine/threonine

kinases are constitutively active in CD4 T cells of XLP patients. In contrast, TCR-mediated activation of Akt, c-Jun-NH2-terminal kinases, and extracellular signal-regulated kinases in XLP CD4 T cells was transient and rapidly diminished when compared with that in control CD4 T cells. Consequently, XLP CD4 T cells exhibited severe defects in up-regulation of IL-2 and IFN-␥ cytokine Downloaded from production upon TCR stimulation and in MLRs. Finally, SAP speciﬁcally interacted with a 75-kDa tyrosine-phosphorylated protein upon TCR stimulation. These results demonstrate that CD4 T cells from XLP patients exhibit aberrant TCR signal transduction and that the defect in SAP function is likely responsible for this phenotype. The Journal of Immunology, 2001, 167: 2657–2665.

pstein-Barr virus is a human ␥-1 herpesvirus that infects cloning and functional cloning approaches, and has been desig- http://www.jimmunol.org/ most people early in life. Infection after early childhood nated src homology 2 (SH2) domain protein 1A, Duncan’s disease E frequently results in infectious mononucleosis (IM),3 a SH2 protein, or signaling lymphocytic activation molecule systemic illness that is caused by the proliferation of EBV-infected (SLAM)-associated protein (SAP) (18Ð20). SAP is a small protein B lymphocytes and unusually strong NK and virus-specific T lym- of 128 residues that consists of a single SH2 domain with a short phocyte responses (1). EBV has been shown to be associated with carboxyl-terminal region (18Ð20). It has been shown to bind the various diseases in humans (2Ð4). These include Burkitt’s lym- cytoplasmic tail of SLAM and 2B4, cell surface receptors of the phoma, nasopharyngeal carcinoma, Hodgkin’s Disease, and T cell CD2 superfamily, and this interaction has been shown to be crucial lymphomas (5Ð13). to their signal transduction activity. SLAM is expressed on T and by guest on October 1, 2021 A rare disease called X-linked lymphoproliferative disease B lymphocytes, mediates homotypic binding, and promotes T cell (XLP), or Duncan’s disease, is an inherited syndrome character- costimulation, proliferation, and production of Th1 cytokines (21Ð ized by uncontrolled EBV infection leading to severe or fulminant 24). During EBV infection, SLAM-SLAM interactions at the in- IM, acquired agammaglobulinemia, and malignant lymphoma terface between EBV-infected B cells and T cells may promote the (14). It has been suggested that the inability of the immune system development of EBV-specific Th responses. The cytoplasmic re- of XLP patients to control EBV-infected B lymphocytes is likely gion of SLAM contains three tyrosine-based motifs. Surprisingly, due to defects of Th cells, CTLs, and NK cells (15Ð17). The gene SAP binds to one of these motifs irrespective of the phosphoryla- defective in XLP has recently been identified, both by positional tion state of this site, and this binding promotes signaling by pre- venting recruitment of the SH2-containing protein tyrosine phospha- *Department of Microbiology and Molecular Genetics, New England Regional Pri- tase (SHP-2) (20). In XLP patients, SAP deficiency and subsequent mate Research Center, Harvard Medical School, Southborough, MA 01772; and †De- recruitment of SHP-2 may impair SLAM signal transduction, lead- partment of Pediatrics and Molecular Medicine, University of Massachusetts Medical ing to reduced IFN-␥ production by Th cells (20, 25, 26). School, Worcester, MA 01655 Another receptor of the CD2 superfamily, 2B4, contains cyto- Received for publication April 16, 2001. Accepted for publication June 28, 2001. plasmic motifs similar to those found in SLAM. It is expressed on The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance T and NK cells, and the engagement of 2B4 on NK cells has been with 18 U.S.C. Section 1734 solely to indicate this fact. demonstrated to promote spontaneous cytotoxicity and to augment 1 This work was partially supported by U.S. Public Health Service Grants CA31363, secretion of IFN-␥ (27Ð30). Recent studies have demonstrated that CA82057, CA86841, CA91819, CA91819, AI38131, and RR00168 and American the cytoplasmic region of 2B4 also interacts SAP (31). In fact, Cancer Society Grant RPG001102. J.U.J. is a Leukemia and Lymphoma Society Scholar. ligation of the 2B4 ligand on NK cells from a XLP patients failed to initiate cytotoxicity, implying that the defect in SAP function 2 Address correspondence and reprint request to Dr. Jae U. Jung, Tumor Virology Division, Department of Microbiology and Molecular Genetics, New England Re- may contribute to the pathogenesis of XLP syndrome by reducing gional Primate Research Center, Harvard Medical School, 1 Pine Hill Drive, South- NK cell lysis of EBV-infected B cells (31Ð36). borough, MA 01772. E-mail address: [email protected] Despite extensive studies of SAP function in SLAM and 2B4 3 Abbreviations used in this paper in this paper: IM, infectious mononucleosis; XLP, signal transduction, little is known about the role of SAP in TCR- X-linked lymphoproliferative disease; SH2, src homology 2; SLAM, signaling lymphocytic activation molecule; SAP, SLAM-associated protein; SHP-2, SH2-contain- mediated signal transduction. We hypothesize that the inability of ing protein tyrosine phosphatase; HVS, herpesvirus saimiri; TPA, 12-O-tetradeca- the immune system to control EBV-infected B lymphocytes is ␨ noylphorbol-13-acetate; ZAP70, -associated protein-70; GSK, glycogen synthase partly due to defects in Th cell responses (15, 20, 37). To inves- kinase; ERK, extracellular signal-regulated kinases; JNK, c-Jun NH2-terminal kinase; EF1, elongation factor 1; MAPK, mitogen-activated protein kinase; wt, wild type. tigate this hypothesis, we generated continuously growing CD4 Th

cells of XLP patients using herpesvirus saimiri (HVS). HVS has Immunoprecipitation, immunoblotting, and kinase assays been shown to transform primary human T lymphocytes to con- Lysates were precleared with protein A-Sepharose (Pierce, Rockford, IL) tinuous growth, while maintaining the original phenotype and the on ice for 30 min and were then mixed with the appropriate Ab and protein functional properties (38Ð43). Using these cell lines, we demon- A-Sepharose for 12 h at 4¡C. Immunocomplexes were recovered by cen- strated that CD4 Th cells from XLP patients exhibited defects in trifugation and washed three times with lysis buffer. Precleared lysates or TCR signaling, as evidenced by the inability to produce cytokines. immunocomplexes were subjected to SDS-PAGE analysis. Proteins separated by SDS-PAGE were transferred to polyvinylidene difluoride mem- These findings suggest that, in addition to SLAM and 2B4 signal branes (Immobilon-P; Millipore, Bedford, MA). Membranes were blocked transduction, SAP is involved in the TCR signal transduction path- in TBST and 10% nonfat milk, incubated with the indicated primary Abs way and that alteration of the TCR pathway may potentially con- and HRP-conjugated secondary Abs, and subjected to ECL (SuperSignal; tribute to the defective EBV-specific immunity in XLP patients. Pierce). Sources of commercial Abs are as follows: anti-CD3␨ (6B10.2), anti- ␨-associated protein 70 (ZAP70) (LR), anti-Cbl (C-15), anti-SAP (FL-128), Materials and Methods anti-SLAM (N-19), anti-JNK1 (C-17), and anti-glycogen synthase kinase Cell culture and transfection (GSK)-3␤ (0011-A) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA); HRP-conjugated anti-phosphotyrosine (4G10) was obtained HVS-transformed cells were grown with RPMI 1640 medium supple- from Upstate Biotechnology (Lake Placid, NY); and anti-phospho-ERK1/2 mented with 20% FBS (Life Technologies, Rockville, MD), and COS-1 (Thr202/Tyr204), anti-ERK1/2, anti-phospho-p38 mitogen-activated protein cells were grown in DMEM (Life Technologies) supplemented with 10% kinase (MAPK) (Thr180/Tyr182), anti-p38 MAPK, anti-phospho- FBS. A lipofectAMINE PLUS (Life Technologies) transfection procedure stress-activated protein kinase/JNK (Thr183/Tyr185), anti-phospho-Akt was used for transient expression in COS-1 cells. (Ser473), anti-Akt, and anti-phospho-GSK-3␣ and -␤ (Ser21/9) were obtained from Cell Signaling Technology (Beverly, MA). Akt kinase assays In vitro immortalization of primary lymphocytes were performed with the Akt kinase assay kit (Cell Signaling Technology) Downloaded from according to the manufacturer’s instructions. PBMC were isolated from 10 ml heparinized blood specimens from healthy volunteers and two individuals with XLP from a previously well- characterized kindred (44) by centrifugation through lymphocyte separa- Measurements of secreted cytokines tion medium (Organon Teknika, Malvern, PA), followed by washing in A total of 1 ϫ 106 of the indicated cells were cultured in 24-well tissue RPMI 1640 culture medium. PBMC from each individual were individu- culture plates with or without anti-CD3 Ab in 1 ml RPMI 1640 supple- ally washed, resuspended in RPMI 1640, and then distributed in 1 ml mented with 20% FBS. The supernatants were harvested 24 h later, and the ϳ 6 http://www.jimmunol.org/ volumes containing 10 cells into 12-well tissue culture plates. Cells cytokine production was measured by ELISA kits (BD PharMingen, San were infected at a multiplicity of infection ranging from 1 to 5 with 1 ml Diego, CA). purified HVS viral stocks or with 1 ml EBV-containing supernatant from B95-8 cells. Cells were maintained in RPMI 1640 growth medium, which Metabolic labeling and pulse-chase analysis was changed every 3Ð4 days. Immortalization or cell death was assessed microscopically. COS-1 cells were cultured to 70Ð80% confluence in 10-cm-diameter culture dishes. After 48 h of transfection with pEF1-wild-type (wt) SAP or RNA extraction and RT-PCR pEF1-SAP Q99P, cells were rinsed twice with PBS, washed once with labeling medium (RPMI 1640 minus methionine and cysteine; Life Tech- Total RNA from HVS-transformed cells was isolated using TRIzol Re- nologies), and starved for1hbyincubation in the labeling medium. After agent (Life Technologies) according to the manufacturer’s instructions. ␮ 35 35

starvation, 100 Ci [ S]methionine and [ S]cysteine (New England Nu- by guest on October 1, 2021 Approximately 5 ␮g total RNA was reverse-transcribed by SuperScript II Ϫ clear, Boston, MA) was added to the labeling medium, and the cells were RNase H reverse transcriptase (Life Technologies) in a 20 ␮l reaction incubated at 37¡C for 2 h. Following removal of the labeling medium, cells mixture with random hexamers for 50 min at 42¡C. As a control, cDNA were cultured in DMEM supplemented with 10% FBS and chased for 1, 3, synthesis was performed without the reverse transcriptase. One microliter 6, or 9 h. Cells were harvested and lysed with the lysis buffer. of the same cDNA preparation was used for PCR amplification in a 50-␮l volume of final reaction mixture with 0.5 ␮M specific primers (5Ј primer, GCCTGGCTGCAGTAGCAGCGGCATCTCCC; and 3Ј primer, ATGTA Flow cytometric analysis CAAAAGTCCATTTCAGCTTTGAC). Ten microliters of PCR mixtures A total of 5 ϫ 105 cells were washed with PBS containing 2% FCS and was electrophoresed through 2% agarose gel. Expected DNA size from the incubated with FITC-conjugated or PE-conjugated mAbs for 30 min at PCR amplification was 630 bp. 4¡C. After washing, each sample was fixed with 2% paraformaldehyde solution, and flow cytometry analysis was performed with a FACScan (BD Plasmid constructions Biosciences, Mountain View, CA). Sources of commercial Abs are as fol- To make 6ϫ histidine-tagged SAP cDNA and its mutant form, SAP cDNA lows: RPA-2.10 Ab for CD2, HIT3a Ab for CD3, RPA-T4 Ab for CD4, was amplified by using following primers: 5Ј-CGCGAATTCGCCGC HIT8a Ab for CD8, HIT19 Ab for CD19, BerH8 Ab for CD30, HI30 Ab CACCATGGACGCAGTGGCTGTGTATC-3Ј and 5Ј-CGCTCTAGATG for CD45, B159 Ab for CD56, DX2 Ab for CD95, T10B9.1A-31 Ab for ␣␤ GGGCTTTCAGGCAGACATC-3Ј. Each PCR product was cloned into the TCR , and A12 Ab for SLAM were obtained from BD PharMingen; EcoRI and XbaI cloning sites of pEF1/Myc-His A expression vector L243 Ab for HLA-DR was obtained from BD Biosciences; and C1.7.1 Ab (Invitrogen, Carlsbad, CA). The EcoRI/PmeI fragment containing the His- for 2B4 was obtained from Immunotech (Westbrook, ME). tagged SAP sequence was cloned into pLPCX vector (CLONTECH Lab- oratories, Palo Alto, CA). All PCR-amplified DNA fragments were com- Results pletely sequenced to verify the presence of the correct sequence and the Characterization of SAP mutation in XLP patients absence of any other changes. Full-length SAP cDNA of two XLP siblings (Huami and Weljo) Cell stimulation and lysis was amplified from PBMC by RT-PCR, followed by DNA se- For Ab stimulation, 2 ϫ 106 cells were resuspended in 200 ␮l complete quence analysis. PBMC from two healthy volunteers (JJ and SC), medium. After equilibration to 37¡C for 10 min, the cells were stimulated Jurkat T lymphocytes, and BJAB B lymphocytes were used as with polystyrene bead-conjugated anti-CD3 mAb (M-450 CD3 Dynabeads; controls. The full-length SAP gene was detected in PBMC of both Dynal Biotech, Great Neck, NY) for the indicated duration and subse- quently transferred to dry ice. In some cases, 2 ϫ 106 cells were stimulated XLP patients as well as PBMC of healthy individuals and Jurkat T with 20 ng/ml 12-O-tetradecanoylphorbol-13-acetate (TPA) for 6 or 12 h. cells, whereas it was not detected in BJAB B lymphocytes (Fig. 1 Cells were lysed in ice-cold lysis buffer (0.15 M NaCl, 1% Nonidet P-40, and data not shown). DNA sequence analysis revealed that the ␮ 50 mM HEPES buffer (pH 7.5), 2 mM Na2VO3, 10 mM NaF, 10 g/ml SAP genes of both XLP patients harbored a missense mutation at leupeptin, 10 ␮g/ml aprotinin, 10 ␮g/ml pepstatin, and 2 mM PMSF). After 3 incubation in ice for 30 min, lysates were precleared by centrifugation at nucleotide 382 (A C), which changed glutamine at residue 99 to 4¡C for 15 min and used for immunoblotting, immunoprecipitation, or proline. SAP genes from the PBMC of JJ and SC were found to kinase assays. have wt sequences (data not shown). The Journal of Immunology 2659

In vitro immortalization of primary lymphocytes from XLP patients with EBV and HVS Human B and T lymphocytes are efficiently immortalized to cytokine-independent, permanent cell growth by infection with EBV and HVS, respectively (38, 45). In addition, HVS-immortalized lymphocytes have been shown to maintain their original pheno- types and functional properties (38Ð43). Therefore, this in vitro FIGURE 1. Detection of SAP expression by RT-PCR analysis. A total immortalization was used to generate continuously growing, au- of 5 ϫ 106 Jurkat T, BJAB, Huami, Weljo, and SC PBMC were used to tologous B and T lymphocytes of XLP patients. Lymphocytes of isolate total RNA. cDNA synthesis reactions were performed with (ϩ)or two healthy individuals (JJ and SC) were also included as controls. without (Ϫ) reverse transcriptase (RT) and amplified with specific primers EBV and HVS were separately added to aliquots of unstimulated for SAP. Ten microliters of amplified cDNA was electrophoresed through PBMCs from Huami and Weljo, XLP patients, and JJ and SC, a 2.0% agarose gel. The arrow indicates the SAP cDNA. healthy individuals. Months after infection, continuously growing IL-2-independent B and T cells were established. No significant difference in growth rate was observed between XLP and control A6ϫ His-tagged wt SAP and SAP Q99P mutant were ex- lymphocytes after immortalization with EBV or HVS. To examine pressed in COS-1 cells using two different promoters, elongation SAP expression, equal amounts of proteins from HVS-immortal- factor 1 (EF1) promoter and CMV early promoter. An immunoblot ized T cells were used for immunoblot assay with an anti-SAP Ab. assay with an anti-His Ab showed that the steady-state level of the Jurkat T cells were included as controls. This showed that SAP Downloaded from SAP Q99P mutant expression was markedly lower than that of wt protein was readily detected in Jurkat T cells and the HVS-trans- SAP (Fig. 2A). To investigate whether the low level of expression formed JJ and SC T cells, whereas it was not detected in HVS- was attributable to protein stability, COS-1 cells were transfected transformed Huami and Weljo T cells (Fig. 3). with an expression vector containing the wt SAP or SAP Q99P Flow cytometric analysis showed that HVS-transformed control mutant metabolically labeled with [35S]methionine for2hand JJ and SC cells and HVS-transformed XLP Huami and Weljo T chased for 1, 3, 6, and 9 h. Cell were lysed by 1% Nonidet P-40 ϩ ϩ Ϫ cells were CD3 CD4 CD8 T cells, suggesting that these cells http://www.jimmunol.org/ detergent and, 35S-labeled SAP protein was precipitated with an are a population of Th cells. There was no significant difference of anti-His Ab. This showed that the half-life of the SAP Q99P mu- surface expression of CD2, CD3, CD4, CD25, CD45, CD56, tant was drastically reduced compared with that of wt SAP (Fig. CD95, TCR␣␤, HLA-DR, SLAM, and 2B4 lymphocyte Ags other 2B). The wt SAP protein was relatively stable with an approximate than CD30 (data not shown). A large population of the Huami and half-life of9hinculture (Fig. 2B). In contrast, the SAP Q99P Weljo T cells displayed higher surface expression of CD30 than mutant was rapidly degraded and was undetectable after3hof control JJ and SC T cells (data not shown). In addition, no apparent chase (Fig. 2B). These results indicate that the Q99P mutation of difference of surface Ag expressions, including IgM, CD19, CD23, SAP drastically reduces the protein’s stability. CD80, CD86, HLA-DR, and SLAM, was also observed between

EBV-transformed Huami B cells and EBV-transformed JJ and SC by guest on October 1, 2021 B cells (data not shown).

Enhanced tyrosine phosphorylation of XLP CD4ϩ T cells upon TCR stimulation The biochemical event subsequent to TCR stimulation is the induction of tyrosine phosphorylation of a number of cellular proteins (46Ð49). We examined the effects of the SAP mutation on cellular tyrosine phosphorylation upon TCR stimulation. After anti- CD3 Ab stimulation of HVS-transformed JJ and SC CD4 T cells and HVS-transformed Huami and Weljo CD4 T cells, the course of tyrosine phosphorylation induction was observed by immunoblot assay with an anti-phosphotyrosine Ab (Fig. 4). Stimulation with an anti-CD3 Ab rapidly induced cellular tyrosine phosphorylation in all cell lines (Fig. 4). However, the level of tyrosine phosphorylation after anti-CD3 Ab stimulation was not only higher but also more prolonged in Huami and Weljo CD4 T cells than in JJ and SC CD4 T cells (Fig. 4). Speciﬁcally, proteins of 25, 35, 60, 70, 120, and 160 kDa in Huami and Weljo CD4 T displayed an enhanced FIGURE 2. SAP protein expression and stability. A, SAP protein expression. The 6ϫ His-tagged wt SAP and SAP Q99P mutant were expressed from the EF1 promoter of the pEF1 vector and the CMV early promoter of the pLPCX vector. A total of 48 h after transfection with expression vector (lane 1), wt SAP expression vector (lane 2), or SAP Q99P expression vector (lane 3), COS-1 cells were collected and lysed. The same amount of proteins were used for immunoblot analysis with an anti-His Ab. The arrow indicates the SAP protein. B, Stability of SAP protein. A total of 48 h after transfection with pEF1 vector containing wt FIGURE 3. The absence of SAP protein in XLP CD4 T cells. The same SAP or SAP Q99P mutant, COS-1 cells were labeled with [35S]methionine amounts of protein from whole-cell lysates of HVS-transformed JJ, SC, for 2 h and chased as indicated in the ﬁgure. Radioactively labeled cell Huami, and Weljo CD4 T cells and Jurkat T cells were used for immuno- lysates were used for immunoprecipitation with an anti-His Ab. The arrow blot analysis with an anti-SAP Ab. The data were reproduced in three indicates the SAP protein. independent experiments. 2660 ABNORMAL TCR SIGNAL TRANSDUCTION OF XLP T CELLS

FIGURE 4. Enhanced tyrosine phosphorylation in XLP CD4 T cells. A total of 2 ϫ 106 HVS-transformed JJ, SC, Huami, and Weljo CD4 T cells were incubated with an anti-CD3 Ab (␣CD3) at 37¡C for the indicated times and lysed with lysis buffer. The same amounts of protein from precleared cell lysates were used for immunoblot with anti-phosphotyrosine Ab. Arrows indicate the proteins that have an increased tyrosine phosphorylation. The data were reproduced in three independent experiments.

level of tyrosine phosphorylation when compared with those in JJ cated in a variety of cellular functions such as survival, metabo- and SC cells (Fig. 4). In addition, the basal level of tyrosine phos- lism, transcription, and translation (57Ð62). Specific phosphoryla- phorylation was slightly enhanced in the Huami and Weljo CD4 T tions of these kinases have been shown to be critical for their cells compared with the JJ and SC CD4 T cells (Fig. 4). These kinase activation (63, 64). To examine the effect of the SAP mu- results demonstrate that tyrosine phosphorylation upon TCR stim- tation on the downstream serine/threonine kinase activity, in situ ulation is more extensive in HVS-transformed Huami and Weljo kinase activities were monitored after TCR stimulation by immu- CD4 T cells than that in HVS-transformed JJ and SC CD4 T cells. noblot analysis with phospho-specific Abs that react only with the activated forms of these kinases. Upon anti-CD3 Ab stimulation, Downloaded from Enhanced tyrosine phosphorylation of CD3 ␨-chain, ZAP70, and ϩ phosphorylation of ERK1/2, p38, and JNK were markedly in- Cbl in XLP CD4 T cells creased in JJ, Huami, and Weljo CD4 T cells (Fig. 6A). However, To delineate the enhanced tyrosine phosphorylation of XLP CD4 T cells, we further examined the level of tyrosine phosphorylation of several cellular proteins, including CD3␨, ZAP70, and Cbl. These signaling molecules are extensively tyrosine phosphorylated http://www.jimmunol.org/ upon TCR stimulation, and this modification is important for their signal-transducing activity in TCR signal transduction pathway. After stimulation with an anti-CD3 Ab, precleared lysates of HVS- transformed JJ and Huami CD4 T cells were used for immunoprecipitation with anti-CD3␨, anti-ZAP70, and anti-Cbl Abs, followed by immunoblot assay with an anti-phosphotyrosine Ab. Upon TCR stimulation, tyrosine phosphorylation of CD3␨,

ZAP70, and Cbl proteins were induced in both JJ and Huami T by guest on October 1, 2021 cells (Fig. 5A). However, as seen with overall tyrosine phosphorylation, basal and TCR-induced tyrosine phosphorylation of CD3␨, ZAP70, and Cbl was signiﬁcantly higher in Huami CD4 T cells than in JJ CD4 T cells (Fig. 5A). These results demonstrate that XLP CD4 T cells have an enhanced level of basal and TCR-induced tyrosine phosphorylation of CD3␨, ZAP70, and Cbl. Previous reports have demonstrated that SAP interacts with several tyrosine-phosphorylated cellular proteins including Dok1, SLAM, Ku70, and 2B4 (20, 31, 50). To further investigate the role of SAP in the TCR signal transduction pathway, we examined whether SAP interacted with these cellular proteins upon TCR stimulation. After the stimulation with an anti-CD3 Ab, precleared lysates of HVS-transformed JJ CD4 T cells and HVS-transformed Huami CD4 T cells were used for immunoprecipitation with an anti-SAP Ab, followed by immunoblot assay with an anti- phosphotyrosine Ab. This experiment demonstrated that the SAP protein strongly interacted with a 75-kDa tyrosine-phosphorylated FIGURE 5. Tyrosine phosphorylation of cellular proteins and SAP-as- protein upon TCR stimulation (Fig. 5B). However, extensive im- sociated protein. A, Enhanced tyrosine phosphorylation of CD3 ␨-chain, munoblot analyses revealed that the associated protein was not ZAP70, and Cbl in XLP CD4 T cells. A total of 1 ϫ 107 HVS-transformed Dok1, ZAP70, SLAM, 2B4, SHP-2, Ku70, Ku86, or p85 phos- JJ and Huami CD4 T cells were stimulated with an anti-CD3 Ab at 37¡C phatidylinositol 3-kinase (data not shown). This suggests that an for 1 min and lysed. Precleared cell lysates were used for immunoprecipi- additional cellular protein that remains to be identiﬁed may be tation with anti-CD3␨, ZAP70, or Cbl Ab, followed by immunoblot with important for SAP function in TCR-mediated signal transduction. anti-phosphotyrosine Ab. B, Interaction of SAP with a 75-kDa tyrosine- phosphorylated protein. A total of 3 ϫ 107 of HVS-transformed JJ or Altered activation of ERK1/2, JNK, p38, and Akt activities in Huami T cells were stimulated with or without an anti-CD3 Ab at 37¡C for XLP CD4ϩ T cells upon TCR stimulation 1 min. Precleared whole-cell lysates were used for immunoprecipitation with an anti-SAP Ab. Polypeptides of anti-SAP immune complexes were Downstream of the early activation events, three major subfamilies separated by SDS-PAGE, transferred to a nitrocellulose membrane, and of MAPKs, ERKs, JNKs, and p38 kinase are activated upon TCR reacted with an anti-phosphotyrosine Ab. Arrows indicate the tyrosine- stimulation (51Ð56). In addition, Akt/protein kinase B and GSK, phosphorylated 75-kDa protein. The data were reproduced in three inde- which are pleotropic protein serine/threonine kinases, are impli- pendent experiments. The Journal of Immunology 2661

stimulation, and it was strongly activated for a long period time upon TCR stimulation (Fig. 6B). Unlike Akt, no signiﬁcant difference in the activation of GSK-3␣ and -3␤ kinases was observed between JJ and Huami cells (Fig. 6A). These results demonstrate that, despite their constitutive activation, TCR-induced activation of ERK1/2, p38, JNK, and Akt kinases is transient and rapidly declines in HVS-transformed XLP CD4 T cells. In contrast, when these cells were treated with the TPA stimulation that bypasses TCR signal transduction pathway, ERK1/2 and p38 kinase exhibited a similar level of activation in both HVS-transformed JJ and Huami CD4 T cells (Fig. 7). These results indicate that defect in SAP function is speciﬁcally responsible for the abnormal TCR signal transduction.

Defects of cytokine production of XLP CD4 T cells upon SLAM and TCR stimulation Triggering of SLAM and TCR on CD4ϩ T cells has been shown to strongly induce IFN-␥ production (21). In addition, Akt kinase

has been shown to provide the costimulatory signal for up-regu- Downloaded from lation of IL-2 and IFN-␥ production of CD4 Th cells (65). To examine the effect of the SAP defect on cytokine production, 1 ϫ 105 HVS-transformed Huami, Weljo, and JJ CD4 T cells were engaged with an anti-SLAM Ab overnight, and IFN-␥ production was assessed by ELISA. Although Huami and Weljo CD4 T cells had a high level of basal IFN-␥ production, these cells showed http://www.jimmunol.org/ little or no up-regulation of IFN-␥ production upon anti-SLAM FIGURE 6. Abnormal activation of serine/threonine kinases and their stimulation (Fig. 8A and data not shown). In contrast, JJ CD4 T activity in XLP CD4 T cells upon TCR stimulation. A, Alteration of serine/ cells exhibited a low level of IFN-␥ production without stimula- threonine kinase activation in XLP CD4 T cells upon TCR stimulation. A tion, and a significant up-regulation of IFN-␥ production was de- total of 2 ϫ 106 HVS-transformed JJ and Huami CD4 T cells were incu- tected upon anti-SLAM stimulation (Fig. 8A). All three cells dis- bated with an anti-CD3 Ab at 37¡C for the time indicated in the figure and lysed with lysis buffer. The same amount of proteins were used for immu- played an equivalent level of SLAM surface expression (data not noblot analysis with phospho-specific Abs or pan Abs against ERK1/2, shown). p38, JNK, Akt, and GSK-3␣ and -␤. Phospho-specific Abs react only with To further investigate an effect of the SAP mutation on TCR 6 activated forms of respective serine/threonine kinases, and pan Abs react signal transduction, 1 ϫ 10 HVS-transformed Huami, Weljo, and by guest on October 1, 2021 with all forms of respective serine/threonine kinases. p-ERK1 and -2, p- JJ CD4 T cells were stimulated with anti-CD3 Ab overnight, and p38, p-JNK1, p-Akt, and p-GSK-3␣ and -␤ indicate the phosphorylated IFN-␥ and IL-2 cytokine production was assessed by ELISA. As (active) form of these proteins. The data were reproduced in three inde- seen with an anti-SLAM stimulation, control JJ CD4ϩ T cells ϫ 6 pendent experiments. B, Akt enzymatic activity. A total of 5 10 HVS- showed a drastic increase in IFN-␥ and IL-2 production upon anti- transformed JJ and Huami CD4 T cells were incubated with an anti-CD3 CD3 stimulation, whereas Huami and Weljo CD4ϩ T cells did not Ab at 37¡C for 0, 5, and 15 min and lysed with lysis buffer. Precleared cell up-regulate IFN-␥ and IL-2 cytokine production under the same lysates were used for immunoprecipitation with an anti-Akt Ab. After be- ing washed three times with lysis buffer, Akt immune complexes were conditions (Fig. 8B). All three cells displayed an equivalent level subjected to an in vitro kinase assay using purified GSK-3 as a substrate. of CD3 surface expression (data not shown). These results dem- ϩ The data were reproduced in two independent experiments. onstrate that XLP CD4 T cells exhibit defects in the up-regulation of cytokine production upon SLAM and TCR stimulations. a significant level of phosphorylation of ERK1/2, p38, and JNK was detected in Huami and Weljo T cells without TCR stimulation, whereas it was not detected in JJ T cells (Fig. 6A). Conversely, TCR-induced phosphorylation of ERK1/2 and JNK rapidly declined after 5 min of stimulation in Huami and Weljo T cells, whereas it was prolonged until 30 min of stimulation in JJ T cells (Fig. 6A). This indicates that these serine/threonine kinases in HVS-transformed XLP CD4 T cells are transiently activated upon TCR stimulation. Akt kinase of Huami and Weljo T cells also exhibited a pro- nounced difference from that of JJ T cells. Without TCR stimulation, Akt had a significantly higher level of phosphorylation in FIGURE 7. Activation of serine/threonine kinase activity in XLP CD4 ϫ 6 Huami and Weljo T cells compared with JJ T cells. However, as T cells upon TPA stimulation. A total of 2 10 HVS-transformed JJ and Huami CD4 T cells were incubated with 20 ng/ml TPA at 37¡C for the time seen with ERK1/2, p38, and JNK, TCR-mediated phosphorylation indicated in the figure and lysed with lysis buffer. The same amount of of Akt kinase rapidly and drastically declined in Huami and Weljo proteins was used for immunoblot analysis with phospho-specific Abs or T cells (Fig. 6A). Consistently, enzymatic activity of Akt in Huami pan Abs against ERK1/2 and p38. Phospho-specific Abs react only with T cells was constitutively active before stimulation, but it rapidly activated forms of respective serine/threonine kinases, and pan Abs react declined by 15 min of TCR stimulation (Fig. 6B). In contrast, the with all forms of respective serine/threonine kinases. p-ERK1 and -2 and enzymatic activity of Akt in JJ T cells was not active without TCR p-p38 indicate the phosphorylated (active) form of these proteins. 2662 ABNORMAL TCR SIGNAL TRANSDUCTION OF XLP T CELLS

FIGURE 8. Defects of up-regulation of IFN-␥ and IL-2 production in XLP CD4 T cells. A total of 1 ϫ Downloaded from 106 HVS-transformed Huami, Weljo, and JJ CD4 T cells were engaged with an anti-SLAM (A) or anti- CD3 Ab (B) overnight, and production of IFN-␥ and IL-2 was assessed by ELISA. Numbers are represented as the average of two independent experiments. http://www.jimmunol.org/ by guest on October 1, 2021

Defects of cytokine production in XLP CD4ϩ T cells upon MLR TCR signal transduction, XLP CD4ϩ T cells also exhibit severe A MLR induces drastic activation of target cells, which induces a defects in MLR. significant level of cytokine production (66, 67). To further examine T cell responsiveness, we examined the MLR response of Discussion HVS-transformed control CD4 T cells and HVS-transformed XLP A rare disease called XLP, or Duncan’s disease, is an inherited CD4 T cells with autologous or heterologous B lymphocytes by syndrome characterized by uncontrolled EBV infection leading to measuring IL-2 and IFN-␥ cytokine production. After 24 h of mix- severe or fulminant IM, acquired agammaglobulinemia, and ma- ing 1 ϫ 106 autologous B cells and T cells, IFN-␥ and IL-2 pro- lignant lymphoma (14). The molecular basis of XLP disease has duction was measured by ELISA. JJ CD4 T cells produced sig- been attributed to the mutations of SAP gene. In addition, the nificant amounts of IL-2 and IFN-␥ upon syngenic MLR, whereas pathogenesis of the XLP syndrome has been suggested to be due Huami CD4 T cells showed little or no up-regulation of IL-2 and to a defect of SAP function in NK cell lysis of EBV-infected B IFN-␥ production under the same conditions (Fig. 9). To further cells. In this report, we demonstrate that CD4 T cells from XLP examine T cell responsiveness, JJ T cells were mixed with Huami patients exhibit an aberrant TCR signal transduction and that de- B cells, or Huami T cells were mixed with JJ B cells overnight. fects of SAP function are likely responsible for this phenotype. Allogenic MLR response was assessed by measuring IFN-␥ and Furthermore, an abnormal TCR signal transduction pathway in IL-2 production with ELISA. These experiments also showed that XLP CD4 T cells results in inability to up-regulate cytokine pro- Huami CD4 T cells did not induce IL-2 and IFN-␥ production duction in response to several stimuli. These results suggest that, in upon allogenic MLR, whereas JJ CD4 T cells produced significant addition to the lack of NK cell lysis, defects of CD4 Th cell re- amounts of IL-2 and IFN-␥ as they did upon syngenic MLR (Fig. sponses may also contribute to abnormal immune responses in the 9). These results demonstrate that, besides abnormal SLAM and control of EBV-infected B lymphocytes in XLP patients. The Journal of Immunology 2663

interaction is crucial for transducing activating signals via SLAM to induce up-regulation of cytokine production. In contrast, the signal mediated by 2B4 and SAP interaction affects not only the spontaneous cytotoxicity, but also the NK cell activation induced via CD16 and natural cytotoxicity receptors (32). In this report, we demonstrate that, besides SLAM and 2B4 signal transduction, SAP protein is involved in the TCR signal transduction pathway. The lack of a functional SAP protein in XLP CD4 T cells leads to aberrant TCR signal transduction. Because SAP is involved in a variety of cellular activities, its mutation in XLP patients may induce various defects in host immune effectors, including Th cells, CTLs, and NK cells, which lead to the inability of the immune system to control EBV infection. The fact that SAP consists of a single SH2 domain suggests that SAP does not independently transduce signals. Instead, SAP recruits signal transduction molecules to regulate cellular signal transduction networks. Dok1, a major tyrosine-phosphorylated protein downstream of numerous signaling molecules (50), has

been shown to strongly interact with SAP in a tyrosine phospho- Downloaded from rylation-dependent manner (50). Here, we ﬁnd that upon TCR stimulation, the SAP protein strongly interacts with a 75-kDa tyrosine-phosphorylated protein. Our limited study revealed that the 75-kDa protein associated with SAP upon TCR stimulation is not Dok1, ZAP70, SLAM, 2B4, SHP-2, Ku70, Ku86, or p85 phos-

phatidylinositol 3-kinase, indicating that an additional cellular pro- http://www.jimmunol.org/ tein that remains to be identified is likely involved in SAP-mediated signal transduction. In addition, because SAP interacts with a 75-kDa tyrosine-phosphorylated protein upon TCR stimulation, this interaction likely plays an important role in transducing the TCR signal to elicit cellular activation. Further study including an identification of a 75-kDa protein associated with SAP potentially delineates detailed roles of SAP in the TCR signal transduction pathway. Thus, through interactions with cellular signaling mole- FIGURE 9. Defects of MLR-mediated up-regulation of IFN-␥ and IL-2 cules, SAP likely plays pleotropic roles in numerous signal trans- by guest on October 1, 2021 ϫ 6 production in XLP CD4 T cells. A total of 1 10 HVS-transformed duction pathways, and this activity may be relevant to the failure ϫ 6 Huami and JJ CD4 T cells were engaged with 1 10 syngenic or allo- of XLP patients to survive following acute EBV infection (20, genic EBV-transformed Huami and JJ B cells for 24 h, and production of 31Ð36, 44, 72). IFN-␥ and IL-2 was assessed by ELISA. Numbers represent the average of two independent experiments. The host T cell responses are particularly important for control- ling herpesvirus infection. XLP patients appear to be normal in their response to childhood infections before they encounter EBV SAP is a small protein of 128 residues that consists of a single (44, 73). A unique feature of EBV infection is the extraordinary SH2 domain with a short carboxyl-terminal region (18Ð20). A proliferation of activated Ag-specific T cells and the EBV-infected large portion of SAP mutations results in truncation of the pro- B cells (73). For example, as much as 10% of the total B cell population may be infected in the course of normal infection. Dra- duced protein due to either nonsense or frame shift mutation or to ϩ ϩ gross deletion (18Ð20). In addition, several identified mutations matic numbers of responding NK cells and CD4 and CD8 T introduce a change in the most conserved amino acid among SH2 lymphocytes are typically involved in the normal response to pri- domains. These include R32T, C42W, T53I, E67D, and T68I (18, mary EBV infection. Furthermore, the large number of activated 68Ð70). These mutations have been suggested to impair the SH2 effector T cells are associated with the release of cytokines and function of SAP. Because glutamine at residue 99 is located out- inflammatory mediators that ordinarily lead to IM. These factors side of the SH2 domain, Q99P mutation does not appear to affect suggest that EBV infection is the foremost trigger for the pheno- the SH2 function. Indeed, x-ray structural study suggests that typic expression of XLP syndrome due to the excessive T cell Q99P mutation likely disrupts hydrophobic and hydrogen bonding activation. During EBV infection, SLAM-SLAM and MHC II interactions that are necessary for stabilizing the ␤G strand (71). molecule-TCR interactions at the interface between EBV-infected Consistent with this hypothesis, we demonstrate that Q99P muta- B cells and CD4 T cells, or CD48Ð2B4 interaction between EBV- tion of SAP in our XLP patients drastically diminishes its protein infected B cells and NK cells, may promote the development of stability, demonstrated by the undetectable level of SAP protein in EBV-specific Th responses. However, SAP deficiency in XLP pa- XLP CD4 T cells. tients impairs SLAM and 2B4 signal transduction, leading to re- SAP protein functions as a regulator of the signal transduction duced IFN-␥ production by Th cells and decreased cytotoxicity of pathways initiated by at least two distinct surface receptors be- NK cells (20, 31Ð36, 72). In addition, aberrant TCR signal trans- longing to the CD2 family: SLAM, which is expressed on T and B duction in XLP patients may result in abnormalities of CD4 Th cell cells, and 2B4, which is primarily expressed on NK cells (20, 31). function and CD8 cytotoxic T cell function, contributing to the It has been shown that binding of SAP to SLAM prevents an inability of the immune system to control EBV infection. Further association of SLAM with SHP-2 (20). In addition, this molecular study of SAP function in lymphocyte signal transduction pathways 2664 ABNORMAL TCR SIGNAL TRANSDUCTION OF XLP T CELLS will pave the way for new strategies for the treatment and cure of 27. Mathew, P. A., B. A. Garni-Wagner, K. Land, A. Takashima, E. Stoneman, XLP syndrome. M. Bennett, and V. Kumar. 1993. Cloning and characterization of the 2B4 gene encoding a molecule associated with non-MHC-restricted killing mediated by activated natural killer cells and T cells. J. Immunol. 151:5328. Acknowledgments 28. Garni-Wagner, B. A., A. Purohit, P. A. Mathew, M. Bennett, and V. Kumar. 1993. A novel function-associated molecule related to non-MHC-restricted cy- We especially thank Drs. R. Means and S. Lang for critical discussion and totoxicity mediated by activated natural killer cells and T cells. J. Immunol. reading of the manuscript. 151:60. 29. Brown, M. H., K. Boles, P. A. van der Merwe, V. Kumar, P. A. Mathew, and References A. N. Barclay. 1998. 2B4, the natural killer and T cell immunoglobulin superfamily surface protein, is a ligand for CD48. J. Exp. Med. 188:2083. 1. Rickinson, A. B., and E. Kieff. 1996. Epstein-Barr virus. In Fields Virology. 30. Boles, K. S., H. Nakajima, M. Colonna, S. S. Chuang, S. E. Stepp, M. Bennett, B. N. Fields, D. M. Knipe, and P. M. Howley, eds. Lippincott-Raven, New York, V. Kumar, and P. A. Mathew. 1999. Molecular characterization of a novel human p. 2397. natural killer cell receptor homologous to mouse 2B4. Tissue Antigens 54:27. 2. Burkitt, D. 1967. Burkitt’s lymphoma outside the known endemic areas of Africa 31. Tangye, S. G., S. Lazetic, E. Woollatt, G. R. Sutherland, L. L. Lanier, and and New Guinea. Int. J. Cancer 2:562. J. H. Phillips. 1999. Cutting edge: human 2B4, an activating NK cell receptor, 3. Epstein, M. A., B. G. Achong, and Y. M. Barr. 1964. Virus particles in cultured recruits the protein tyrosine phosphatase SHP-2 and the adaptor signaling protein lymphoblasts from Burkitt’s lymphoma. Lancet 1:702. SAP. J. Immunol. 162:6981. 4. Lekstrom-Himes, J. A., J. K. Dale, D. W. Kingma, P. S. Diaz, E. S. Jaffe, and S. E. Straus. 1996. Periodic illness associated with Epstein-Barr virus infection. 32. Parolini, S., C. Bottino, M. Falco, R. Augugliaro, S. Giliani, R. Franceschini, Clin. Infect. Dis. 22:22. H. D. Ochs, H. Wolf, J. Y. Bonnefoy, R. Biassoni, et al. 2000. X-linked lym- 5. Ablashi, D. V., P. H. Levine, T. Papas, G. R. Pearson, and S. D. Kottaridis. 1985. phoproliferative disease: 2B4 molecules displaying inhibitory rather than acti- First international symposium on Epstein-Barr virus and associated malignant vating function are responsible for the inability of natural killer cells to kill diseases. Cancer Res. 45:3981. Epstein-Barr virus-infected cells. J. Exp. Med. 192:337. 6. Blacklow, N. R., B. K. Watson, G. Miller, and B. M. Jacobson. 1971. Mononu- 33. Benoit, L., X. Wang, H. F. Pabst, J. Dutz, and R. Tan. 2000. Defective NK cell cleosis with heterophil antibodies and EB virus infection; acquisition by an el- activation in X-linked lymphoproliferative disease. J. Immunol. 165:3549. derly patient in hospital. Am. J. Med. 51:549. 34. Nakajima, H., M. Cella, A. Bouchon, H. L. Grierson, J. Lewis, C. S. Duckett, Downloaded from 7. Magrath, I. 1992. Molecular basis of lymphomagenesis. Cancer Res. 52(Suppl. J. I. Cohen, and M. Colonna. 2000. Patients with X-linked lymphoproliferative 19):5529s. disease have a defect in 2B4 receptor-mediated NK cell cytotoxicity. Eur. J. Im- 8. Magrath, I., V. Jain, and K. Bhatia. 1992. Epstein-Barr virus and Burkitt’s lym- munol. 30:3309. phoma. Semin. Cancer Biol. 3:285. 35. Nakajima, H., and M. Colonna. 2000. 2B4: an NK cell activating receptor with 9. Mueller, N. 1991. An epidemiologist’s view of the new molecular biology find- unique specificity and signal transduction mechanism. Hum. Immunol. 61:39. ings in Hodgkin’s disease. Ann. Oncol. 2(Suppl. 2):23. 36. Sayos, J., K. B. Nguyen, C. Wu, S. E. Stepp, D. Howie, J. D. Schatzle, V. Kumar, 10. Mueller, N., A. Evans, N. L. Harris, G. W. Comstock, E. Jellum, K. Magnus, C. A. Biron, and C. Terhorst. 2000. Potential pathways for regulation of NK and

N. Orentreich, B. F. Polk, and J. Vogelman. 1989. Hodgkin’s disease and Ep- T cell responses: differential X-linked lymphoproliferative syndrome gene prod- http://www.jimmunol.org/ stein-Barr virus. Altered antibody pattern before diagnosis. N. Engl. J. Med. uct SAP interactions with SLAM and 2B4. Int. Immunol. 12:1749. 320:689. 37. Sutkowski, N., T. Palkama, C. Ciurli, R. P. Sekaly, D. A. Thorley-Lawson, and 11. Pallesen, G., S. J. Hamilton-Dutoit, and X. Zhou. 1993. The association of Ep- B. T. Huber. 1996. An Epstein-Barr virus-associated superantigen. J. Exp. Med. stein-Barr virus (EBV) with T cell lymphoproliferations and Hodgkin’s disease: 184:971. two new developments in the EBV ﬁeld. Adv. Cancer Res. 62:179. 38. Biesinger, B., I. Muller-Fleckenstein, B. Simmer, G. Lang, S. Wittmann, 12. Rickinson, A. B., L. S. Young, and M. Rowe. 1987. Inﬂuence of the Epstein-Barr E. Platzer, R. C. Desrosiers, and B. Fleckenstein. 1992. Stable growth transfor- virus nuclear antigen EBNA 2 on the growth phenotype of virus-transformed B mation of human T lymphocytes by herpesvirus saimiri. Proc. Natl. Acad. Sci. cells. J. Virol. 61:1310. USA 89:3116. 13. Yao, Q. Y., P. Ogan, M. Rowe, M. Wood, and A. B. Rickinson. 1989. Epstein- 39. Weber, F., E. Meinl, K. Drexler, A. Czlonkowska, S. Huber, H. Fickenscher, Barr virus-infected B cells persist in the circulation of acyclovir-treated virus I. Muller-Fleckenstein, B. Fleckenstein, H. Wekerle, and R. Hohlfeld. 1993. carriers. Int. J. Cancer 43:67. Transformation of human T-cell clones by Herpesvirus saimiri: intact antigen

14. Purtilo, D. T., C. K. Cassel, J. P. Yang, and R. Harper. 1975. X-linked recessive recognition by autonomously growing myelin basic protein-specific T cells. Proc. by guest on October 1, 2021 progressive combined variable immunodeficiency (Duncan’s disease). Lancet Natl. Acad. Sci. USA 90:11049. 1:935. 40. Mittrucker, H. W., I. Muller-Fleckenstein, B. Fleckenstein, and B. Fleischer. 15. Seemayer, T. A., T. G. Gross, R. M. Egeler, S. J. Pirruccello, J. R. Davis, 1993. Herpesvirus saimiri-transformed human T lymphocytes: normal functional C. M. Kelly, M. Okano, A. Lanyi, and J. Sumegi. 1995. X-linked lymphoprolif- phenotype and preserved T cell receptor signalling. Int. Immunol. 5:985. erative disease: twenty-five years after the discovery. Pediatr. Res. 38:471. 41. Berend, K. R., J. U. Jung, T. J. Boyle, J. M. DiMaio, S. A. Mungal, 16. Argov, S., D. R. Johnson, M. Collins, H. S. Koren, H. Lipscomb, and R. C. Desrosiers, and H. K. Lyerly. 1993. Phenotypic and functional conse- D. T. Purtilo. 1986. Defective natural killing activity but retention of lymphocyte- quences of herpesvirus saimiri infection of human CD8ϩ cytotoxic T lympho- mediated antibody-dependent cellular cytotoxicity in patients with the X-linked cytes. J. Virol. 67:6317. lymphoproliferative syndrome. Cell. Immunol. 100:1. 42. Broker, B. M., A. Y. Tsygankov, I. Muller-Fleckenstein, A. H. Guse, 17. Sullivan, J. L., K. S. Byron, F. E. Brewster, and D. T. Purtilo. 1980. Deficient N. A. Chitaev, B. Biesinger, B. Fleckenstein, and F. Emmrich. 1993. Immortal- natural killer cell activity in X-linked lymphoproliferative syndrome. Science ization of human T cell clones by Herpesvirus saimiri: signal transduction anal- 210:543. ysis reveals functional CD3, CD4, and IL-2 receptors. J. Immunol. 151:1184. 18. Coffey, A. J., R. A. Brooksbank, O. Brandau, T. Oohashi, G. R. Howell, 43. Del Prete, G., M. De Carli, M. M. D’Elios, I. M. Fleckenstein, H. Fickenscher, J. M. Bye, A. P. Cahn, J. Durham, P. Heath, P. Wray, et al. 1998. Host response B. Fleckenstein, F. Almerigogna, and S. Romagnani. 1994. Polyclonal B cell to EBV infection in X-linked lymphoproliferative disease results from mutations ϩ activation induced by herpesvirus saimiri-transformed human CD4 T cell in an SH2-domain encoding gene. Nat. Genet. 20:129. clones: role for membrane TNF-␣/TNF-␣ receptors and CD2/CD58 interactions. 19. Nichols, K. E., D. P. Harkin, S. Levitz, M. Krainer, K. A. Kolquist, C. Genovese, J. Immunol. 153:4872. A. Bernard, M. Ferguson, L. Zuo, E. Snyder, et al. 1998. Inactivating mutations 44. Sullivan, J. L., K. S. Byron, F. E. Brewster, S. M. Baker, and H. D. Ochs. 1983. in an SH2 domain-encoding gene in X-linked lymphoproliferative syndrome. X-linked lymphoproliferative syndrome: natural history of the immunodefi- Proc. Natl. Acad. Sci. USA 95:13765. ciency. J. Clin. Invest. 71:1765. 20. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van Schaik, L. Notarangelo, R. Geha, M. G. Roncarolo, et al. 1998. The X-linked lympho- 45. Pope, J. H., M. K. Horne, and W. Scott. 1968. Transformation of foetal human proliferative-disease gene product SAP regulates signals induced through the keukocytes in vitro by filtrates of a human leukaemic cell line containing herpes- co-receptor SLAM. Nature 395:462. like virus. Int. J. Cancer 3:857. 21. Cocks, B. G., C. C. Chang, J. M. Carballido, H. Yssel, J. E. de Vries, and 46. Mustelin, T., K. M. Coggeshall, N. Isakov, and A. Altman. 1990. T cell antigen G. Aversa. 1995. A novel receptor involved in T-cell activation. Nature 376:260. receptor-mediated activation of phospholipase C requires tyrosine phosphoryla- 22. Aversa, G., C. C. Chang, J. M. Carballido, B. G. Cocks, and J. E. de Vries. 1997. tion. Science 247:1584. Engagement of the signaling lymphocytic activation molecule (SLAM) on acti- 47. June, C. H., M. C. Fletcher, J. A. Ledbetter, G. L. Schieven, J. N. Siegel, vated T cells results in IL-2-independent, cyclosporin A-sensitive T cell prolif- A. F. Phillips, and L. E. Samelson. 1990. Inhibition of tyrosine phosphorylation eration and IFN-␥ production. J. Immunol. 158:4036. prevents T-cell receptor-mediated signal transduction. Proc. Natl. Acad. Sci. USA 23. Aversa, G., J. Carballido, J. Punnonen, C. C. Chang, T. Hauser, B. G. Cocks, and 87:7722. J. E. De Vries. 1997. SLAM and its role in T cell activation and Th cell responses. 48. June, C. H., M. C. Fletcher, J. A. Ledbetter, and L. E. Samelson. 1990. Increases Immunol. Cell Biol. 75:202. in tyrosine phosphorylation are detectable before phospholipase C activation after 24. Carballido, J. M., G. Aversa, K. Kaltoft, B. G. Cocks, J. Punnonen, H. Yssel, T cell receptor stimulation. J. Immunol. 144:1591. K. Thestrup-Pedersen, and J. E. de Vries. 1997. Reversal of human allergic T 49. Cooke, M. P., K. M. Abraham, K. A. Forbush, and R. M. Perlmutter. 1991. helper 2 responses by engagement of signaling lymphocytic activation molecule. Regulation of T cell receptor signaling by a src family protein-tyrosine kinase J. Immunol. 159:4316. (p59fyn). Cell 65:281. 25. Klein, G., and E. Klein. 1998. Immunology: sinking surveillance’s flagship. Na- 50. Sylla, B. S., K. Murphy, E. Cahir-McFarland, W. S. Lane, G. Mosialos, and ture 395:441. E. Kieff. 2000. The X-linked lymphoproliferative syndrome gene product 26. Sadelain, M., and E. Kieff. 1998. Why commonplace encounters turn to fatal SH2D1A associates with p62dok (Dok1) and activates NF-␬B. Proc. Natl. Acad. attraction. Nat. Genet. 20:103. Sci. USA 97:7470. The Journal of Immunology 2665

51. Tomlinson, M. G., J. Lin, and A. Weiss. 2000. Lymphocytes with a complex: 65. Kane, L. P., P. G. Andres, K. C. Howland, A. K. Abbas, and A. Weiss. 2001. Akt adapter proteins in antigen receptor signaling. Immunol. Today 21:584. provides the CD28 costimulatory signal for up-regulation of IL-2 and IFN-␥ but 52. Zhang, W., and L. E. Samelson. 2000. The role of membrane-associated adaptors not TH2 cytokines. Nat. Immunol. 2:37. in T cell receptor signalling. Semin. Immunol. 12:35. 66. Kelso, A., and N. M. Gough. 1988. Coexpression of granulocyte-macrophage ␥ 53. Genot, E., and D. A. Cantrell. 2000. Ras regulation and function in lymphocytes. colony-stimulating factor, interferon, and interleukins 3 and 4 is random in Curr. Opin. Immunol. 12:289. murine alloreactive T-lymphocyte clones. Proc. Natl. Acad. Sci. USA 85:9189. 67. Kelso, A., A. B. Troutt, E. Maraskovsky, N. M. Gough, L. Morris, M. H. Pech, 54. Myung, P. S., N. J. Boerthe, and G. A. Koretzky. 2000. Adapter proteins in and J. A. Thomson. 1991. Heterogeneity in lymphokine profiles of CD4ϩ and lymphocyte antigen-receptor signaling. Curr. Opin. Immunol. 12:256. CD8ϩ T cells and clones activated in vivo and in vitro. Immunol. Rev. 123:85. 55. van Oers, N. S. 1999. T cell receptor-mediated signs and signals governing T cell 68. Yin, L., V. Ferrand, M. F. Lavoue, D. Hayoz, N. Philippe, G. Souillet, M. Seri, development. Semin. Immunol. 11:227. R. Giacchino, E. Castagnola, S. Hodgson, B. S. Sylla, and G. Romeo. 1999. 56. Kane, L. P., J. Lin, and A. Weiss. 2000. Signal transduction by the TCR for SH2D1A mutation analysis for diagnosis of XLP in typical and atypical patients. antigen. Curr. Opin. Immunol. 12:242. Hum. Genet. 105:501. 57. Coffer, P. J., J. Jin, and J. R. Woodgett. 1998. Protein kinase B (c-Akt): a mul- 69. Lappalainen, I., S. Giliani, R. Franceschini, J. Y. Bonnefoy, C. Duckett, tifunctional mediator of phosphatidylinositol 3-kinase activation. Biochem. J. L. D. Notarangelo, and M. Vihinen. 2000. Structural basis for SH2D1A mutations 335:1. in X-linked lymphoproliferative disease. Biochem. Biophys. Res. Commun. 269: 58. Datta, S. R., A. Brunet, and M. E. Greenberg. 1999. Cellular survival: a play in 124. three Akts. Genes Dev. 13:2905. 70. Sumegi, J., D. Huang, A. Lanyi, J. D. Davis, T. A. Seemayer, A. Maeda, G. Klein, 59. Franke, T. F., D. R. Kaplan, and L. C. Cantley. 1997. PI3K: downstream AKTion M. Seri, H. Wakiguchi, D. T. Purtilo, and T. G. Gross. 2000. Correlation of blocks apoptosis. Cell 88:435. mutations of the SH2D1A gene and Epstein-Barr virus infection with clinical 60. Marte, B. M., and J. Downward. 1997. PKB/Akt: connecting phosphoinositide phenotype and outcome in X-linked lymphoproliferative disease. Blood 96:3118. 3-kinase to cell survival and beyond. Trends Biochem. Sci. 22:355. 71. Poy, F., M. B. Yaffe, J. Sayos, K. Saxena, M. Morra, J. Sumegi, L. C. Cantley, C. Terhorst, and M. J. Eck. 1999. Crystal structures of the XLP protein SAP 61. Downward, J. 1998. Mechanisms and consequences of activation of protein ki- reveal a class of SH2 domains with extended, phosphotyrosine-independent se- nase B/Akt. Curr. Opin. Cell Biol. 10:262. quence recognition. Mol. Cell 4:555. 62. Hemmings, B. A. 1997. Akt signaling: linking membrane events to life and death 72. Howie, D., J. Sayos, C. Terhorst, and M. Morra. 2000. The gene defective in Downloaded from decisions. Science 275:628. X-linked lymphoproliferative disease controls T cell-dependent immune surveil- 63. Schlessinger, J. 2000. Cell signaling by receptor tyrosine kinases. Cell 103:211. lance against Epstein-Barr virus. Curr. Opin. Immunol. 12:474. 64. Pawson, T., and P. Nash. 2000. Protein-protein interactions define specificity in 73. Sullivan, J. L. 1999. The abnormal gene in X-linked lymphoproliferative syn- signal transduction. Genes Dev. 14:1027. drome. Curr. Opin. Immunol. 11:431. http://www.jimmunol.org/ by guest on October 1, 2021