Transcriptional Profiling of Pancreatic Progenitor Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas
Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag
Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. -
Cellular and Molecular Signatures in the Disease Tissue of Early
Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of -
(12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al
US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No. -
2/2/2011 1 Development of Development of Endodermal
2/2/2011 ZOO 401- Embryology-Dr. Salah A. Martin DEVELOPMENT OF THE DIGESTIVE SYSTEM ◦ Primitive Gut Tube ◦ Proctodeum and Stomodeum ◦ Stomach Development of Endodermal Organs ◦ Duodenum ◦ Pancreas ◦ Liver and Biliary Apparatus ◦ Spleen ◦ Midgut Wednesday, February 02, 2011 DEVELOPMENT OF THE DIGESTIVE SYSTEM 2 Wednesday, February 02, 2011 Development of Ectodermal Organs 1 ZOO 401- Embryology-Dr. Salah A. Martin ZOO 401- Embryology-Dr. Salah A. Martin Primitive Gut Tube Proctodeum and Stomodeum The primitive gut tube is derived from the dorsal part of the yolk sac , which is incorporated into the body of The proctodeum (anal pit) is the primordial the embryo during folding of the embryo during the fourth week. anus , and the stomodeum is the primordial The primitive gut tube is divided into three sections. mouth . The epithelium of and the parenchyma of In both of these areas ectoderm is in direct glands associated with the digestive tract (e.g., liver and pancreas) are derived from endoderm . contact with endoderm without intervening The muscular walls of the digestive tract (lamina mesoderm, eventually leading to degeneration propria, muscularis mucosae, submucosa, muscularis of both tissue layers. Foregut, Esophagus. externa, adventitia and/or serosa) are derived from splanchnic mesoderm . The tracheoesophageal septum divides the During the solid stage of development the endoderm foregut into the esophagus and of the gut tube proliferates until the gut is a solid tube. trachea. information. A process of recanalization restores the lumen. Wednesday, February 02, 2011 Primitive Gut Tube 3 Wednesday, February 02, 2011 Proctodeum and Stomodeum 4 ZOO 401- Embryology-Dr. Salah A. -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
Embryology, Comparative Anatomy, and Congenital Malformations of the Gastrointestinal Tract
Edorium J Anat Embryo 2016;3:39–50. Danowitz et al. 39 www.edoriumjournals.com/ej/ae REVIEW ARTICLE PEER REVIEWED | OPEN ACCESS Embryology, comparative anatomy, and congenital malformations of the gastrointestinal tract Melinda Danowitz, Nikos Solounias ABSTRACT Human digestive development is an essential topic for medical students and physicians, Evolutionary biology gives context to human and many common congenital abnormalities embryonic digestive organs, and demonstrates directly relate to gastrointestinal embryology. how structural adaptations can fit changing We believe this comprehensive review of environmental requirements. Comparative gastrointestinal embryology and comparative anatomy is rarely included in the medical anatomy will facilitate a better understanding of school curriculum. However, its concepts gut development, congenital abnormalities, and facilitate a deeper comprehension of anatomy adaptations to various evolutionary ecological and development by putting the morphology conditions. into an evolutionary perspective. Features of gastrointestinal development reflect the transition Keywords: Anatomy education, Digestive, Embry- from aquatic to terrestrial environments, such as ology, Gastrointestinal tract the elongation of the colon in land vertebrates, allowing for better water reabsorption. In How to cite this article addition, fishes exhibit ciliary transport in the esophagus, which facilitates particle transport in Danowitz M, Solounias N. Embryology, comparative water, whereas land mammals develop striated anatomy, and congenital malformations of the and smooth esophageal musculature and utilize gastrointestinal tract. Edorium J Anat Embryo peristaltic muscle contractions, allowing for 2016;3:39–50. better voluntary control of swallowing. The development of an extensive vitelline drainage system to the liver, which ultimately creates Article ID: 100014A04MD2016 the adult hepatic portal system allows for the evolution of complex hepatic metabolic ********* functions seen in many vertebrates today. -
Extrinsic Factors Involved in the Differentiation of Stem Cells Into Insulin-Producing Cells: an Overview
Hindawi Publishing Corporation Experimental Diabetes Research Volume 2011, Article ID 406182, 15 pages doi:10.1155/2011/406182 Review Article Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview RebeccaS.Y.Wong Division of Human Biology, School of Medical and Health Sciences, International Medical University, No. 126, Jalan Jalil Perkasa 19, Bukit Jalil, 57000 Kuala Lumpur, Malaysia Correspondence should be addressed to Rebecca S. Y. Wong, rebecca [email protected] Received 16 February 2011; Accepted 28 March 2011 Academic Editor: A. Veves Copyright © 2011 Rebecca S. Y. Wong. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs) from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects. -
Cellular Heterogeneity During Mouse Pancreatic Ductal Adenocarcinoma Progression at Single-Cell Resolution
Cellular heterogeneity during mouse pancreatic ductal adenocarcinoma progression at single-cell resolution Abdel Nasser Hosein, … , Udit Verma, Rolf A. Brekken JCI Insight. 2019. https://doi.org/10.1172/jci.insight.129212. Research In-Press Preview Gastroenterology Oncology Pancreatic ductal adenocarcinoma (PDA) is a major cause of cancer-related death with limited therapeutic options available. This highlights the need for improved understanding of the biology of PDA progression, a highly complex and dynamic process featuring changes in cancer cells and stromal cells. A comprehensive characterization of PDA cancer cell and stromal cell heterogeneity during disease progression is lacking. In this study, we aimed to profile cell populations and understand their phenotypic changes during PDA progression. To that end, we employed single-cell RNA sequencing technology to agnostically profile cell heterogeneity during different stages of PDA progression in genetically engineered mouse models. Our data indicate that an epithelial-to-mesenchymal transition of cancer cells accompanies tumor progression in addition to distinct populations of macrophages with increasing inflammatory features. We also noted the existence of three distinct molecular subtypes of fibroblasts in the normal mouse pancreas, which ultimately gave rise to two distinct populations of fibroblasts in advanced PDA, supporting recent reports on intratumoral fibroblast heterogeneity. Our data also suggest that cancer cells and fibroblasts may be dynamically regulated by epigenetic -
The Epigenome in Pluripotency and Differentiation
Review Review The epigenome in pluripotency and differentiation The ability to culture pluripotent stem cells and direct their differentiation into Rathi D Thiagarajan1, Robert specific cell types in vitro provides a valuable experimental system for modeling Morey1 & Louise C Laurent*1 1 pluripotency, development and cellular differentiation. High-throughput profiling of Department of Reproductive Medicine, The University of California, San Diego, the transcriptomes and epigenomes of pluripotent stem cells and their differentiated La Jolla, CA, USA derivatives has led to identification of patterns characteristic of each cell type, *Author for correspondence: discovery of new regulatory features in the epigenome and early insights into the [email protected] complexity of dynamic interactions among regulatory elements. This work has also revealed potential limitations of the use of pluripotent stem cells as in vitro models of developmental events, due to epigenetic variability among different pluripotent stem cell lines and epigenetic instability during derivation and culture, particularly at imprinted and X-inactivated loci. This review focuses on the two most well-studied epigenetic mechanisms, DNA methylation and histone modifications, within the context of pluripotency and differentiation. Keywords: differentiation • DNA methylation • epigenome • histone modification • imprinting • pluripotency • sequencing • stem cells • X inactivation Early mammalian development involves genetic mechanisms in the regulation of the precise orchestration -
Altered DNA Methylation Pattern Characterizes the Peripheral Immune Cells of Patients with Autoimmune Hepatitis
medRxiv preprint doi: https://doi.org/10.1101/2021.07.01.21259836; this version posted July 5, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Altered DNA methylation pattern characterizes the peripheral immune cells of patients with autoimmune hepatitis Kalliopi Zachou1,2*, Pinelopi Arvaniti1*, Aggeliki Lyberopoulou1, Eirini Sevdali3, Matthaios Speletas3, Maria Ioannou4, George K. Koukoulis4, Yves Renaudineau5,6**, George N. Dalekos1,2** *These authors contributed equally to this work **These authors contributed equally to this work as senior authors 1Department of Medicine and Research Laboratory of Internal Medicine, National Expertise Center of Greece in Autoimmune Liver Diseases, General University Hospital of Larissa, 41110 Larissa, Greece; 2Institute of Internal Medicine and Hepatology, 41447 Larissa, Greece; 3Department of Immunology and Histocompatibility, Faculty of Medicine, School of Health Sciences, University of Thessaly, Larissa, Greece; 4Department of Pathology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Larissa, Greece; 5INSERN U1291, CNR U5051, University Toulouse III, Toulouse Institute for infectious and inflammatory diseases, Toulouse, France; 6Department of Immunology, Purpan University Hospital Toulouse, Toulouse, France All correspondence and reprint requests to: George N. Dalekos, MD, PhD Professor of Medicine Head, Department of Medicine and Research Laboratory of Internal Medicine National Expertise Center of Greece in Autoimmune Liver Diseases General University Hospital of Larissa, 41110 Larissa, Greece Tel: ++30-241-350-2285; Fax: ++30-241-350-1557 e-mail: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.