Transcriptional Profiling of Pancreatic Progenitor Cells

Total Page:16

File Type:pdf, Size:1020Kb

Load more

TRANSCRIPTIONAL PROFILING OF PANCREATIC PROGENITOR CELLS By Leah Ashley Potter Dissertation Submitted to the Faculty of the Graduate School of Vanderbilt University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY in Molecular Physiology and Biophysics December, 2011 Nashville, Tennessee Approved: Professor Maureen Gannon Professor Alyssa Hasty Professor Patricia Labosky Professor David Piston Professor Christopher V.E. Wright MOLECULAR PHYSIOLOGY AND BIOPHYSICS TRANSCRIPTIONAL PROFILING OF PANCREATIC PROGENITOR CELLS LEAH ASHLEY POTTER Dissertation under the direction of Mark A. Magnuson, M.D. Pluripotent stem cells, because of their ability to differentiate into any cell type, have been widely advocated as a means of producing a nearly unlimited source of new insulin- producing β cells for the treatment of diabetic diseases. However, while there has been remarkable progress in learning how to direct the differentiation of human embryonic stem (hES) cells towards pancreatic endocrine cell fates, insulin-expressing cells made in this manner are often polyhormonal and lack a normal response to glucose, thereby suggesting a need for a deeper understanding of the gene regulatory networks that are established in a stepwise manner during pancreas development. My thesis studies explored three main topics, each of which holds potential for the development of improved hES cell directed pancreatic differentiation protocols and the discovery of genes that may specifically affect β cell development. First, we used mice that contained a fluorescent reporter allele and fluorescence-activated cell sorting (FACS) to isolate several discrete pancreatic cell populations which were then analyzed using whole transcriptome sequencing (RNA-Seq). By doing so, we were able to examine the genetic requirement and temporal changes of cells expressing pancreas specific transcription factor 1a (Ptf1a), a marker of the pancreatic multipotent progenitor cells (MPCs) and of acinar- specified cells, during pancreas development. By comparing the transcriptional profiles, we identified five gene clusters, each of which provides insights into the dynamics of gene expression during specific aspects of pancreas development. Second, my studies revealed that Nephrocan, an inhibitor of the TGFβ signaling pathway, was expressed in pancreatic MPCs. Thus, to explore the role of Nepn further, we generated mice containing a single copy insertion of a Nepn-Cherry transgene. Finally, to facilitate the combinatorial sorting of Pdx1- and Ptf1a-expressing cells during early pancreas development, we generated a mouse line expressing a cyan fluorescent protein under control of the endogenous pancreatic and duodenal homeobox 1 (Pdx1) gene. The research that I have performed is part of a larger project focused on generating and characterizing a series of high quality transcriptional profiles representing key stages in the generation of pancreatic endocrine cells that occur naturally in the mouse. We anticipate that further analysis of the datasets I have generated for specific developmental stages, in combination with similarly generated datasets at other developmental stages, will facilitate identification of signaling pathways and gene clusters essential for formation of functional pancreatic β cells in the mouse, thereby stimulating new hypotheses for identifying pro-β cell signals necessary to direct the differentiation of pluripotent stem cells into pancreatic β cells. Approved: Professor Mark A. Magnuson Date: December 2011 ACKNOWLEDGEMENTS Chinese fortunes have always been a fundamental means of communication in the Magnuson laboratory. As I looked through my collection of fortunes on the corner of my desk, the one that stood out the most was, “A solid challenge will bring forth your finest abilities.” By far, graduate school has been my most challenging endeavor, and I would be remiss not to acknowledge the people who have imparted their knowledge and encouraged me along the way. First, I would like to thank the members of the Magnuson laboratory, both past and present. I am forever indebted to Jill Lindner, Susan Hipkens and Pamela Uttz. They have been with me since the very beginning, and I cannot fathom what my time here at Vanderbilt would have been like without them. They encouraged me every step of the way, “taught me the ropes,” and were always there to listen when I needed an ear. I am grateful to Eunyoung Choi, Anna Osipovich, Judsen Schneider, Madhi Saranadasa, Anil Laxman, Jared Burlison, Yanyun Gu, and Weiping Yuan. No lab can function without a scientific ‘sounding board,’ and I am thankful to them for providing an environment that stimulates scientific discussions. I would also like to thank, Rama Gangula, Changqing Zhang, Kathy Shelton, and Jody Peters, whose technical expertise and assistance were invaluable. I would like to thank the members of the Beta Cell Biology Consortium, specifically Chris Stoeckert, Elisabetta Manduchi, Guoqiang Gu, Lori Sussel, and Ray MacDonald, as well as the BCBC coordinating center affiliates, Jean-Philippe Cartailler, Thomas Houfek, Suzannah Green and Kim Cornwell. Within the Vanderbilt Center for Stem Cell Biology, I would like to thank members of the Labosky and Huppert laboratories, specifically Stacey Huppert, Kari Huppert, Erin Sparks, Jennifer Plank and Elise Pfaltzgraff. The work presented iv within this dissertation would not have been possible without the expertise and assistance from numerous shared resource facilities and their personnel, including Kevin Weller, Dave Flaherty, and Brittany Matlock from the Flow Cytometry Core and Shawn Levy, Vicky Amann, Chelsea Baker, Travis Clark, Christian Shaffer, David Sexton, and Robert Woodall from the Genome Sciences Resource. Additionally, a number of individuals at Vanderbilt have been generous in their assistance and in sharing their scientific expertise and reagents, including Anna Means, Al Powers, Michelle Southard-Smith, Jeffery Raum, Yan Hang, Michelle Guney, Chunhua Dai, Ashley Cantrell, Stephanie Byers, Clay Spencer, and Rebecca McWhirter. I am grateful to Roland Stein for providing constructive criticism, for cheering me on from the front row, and for simply making me smile even in the midst of difficult moments. I am especially grateful to the members of my dissertation committee who have guided me through this entire process. To my chair, Maureen Gannon, who has gone above and beyond what is required, and to Alyssa Hasty, Trish Labosky, David Piston and Chris Wright, who have provided much needed encouragement at exactly the right moments, demonstrated what it means to be a successful scientist, provided constructive criticism and critiques, and who have seen me at my worst and still believed I had the potential to succeed. While a great amount of support came from within my scientific community, a significant amount of support came from those outside this realm. First, I want to thank my family, Anthony, Charlotte, Rachel and Joshua. From the very beginning, they instilled in me the importance of hard work and nurtured my inquisitive mind. They have supported me every step of the way, from late night calls to weekend visits; they have been my one constant source of encouragement and for that I am grateful. To my extended family, Papa, Mrs. Doris, Nanny, JD, Dickey, KK, Jeff, Bob, Michelle, and Trey who were there v encouraging me at every step. To my close girlfriends, Amanda, Jessica, Mariruth, Mariam, Michelle, Stephanie, Katie, Heather and Stephanie, who were there to listen to every story and offer advice, an escape, a shoulder to cry on, or a glass of wine. To Eric, who has proved to be a wonderful distraction in the midst of what have been the most trying months of graduate school. I am blessed to call him my own. To Jennifer, who was one of the reasons I stayed, who was the solution to my FACS crisis, who was the one to practice my dissertation talk with, who was the shoulder to cry on, who was the one cheering when I succeeded, and who was the one has encouraged me at every point. For her, I am truly grateful. Last, but certainly not least, I would like to thank Mark. Scientifically, he has afforded me the luxury of working in a laboratory outfitted with the best resources to perform my experiments. The colleagues he has surrounded himself with and the collaborations he has engaged in have furthered my scientific development and permitted my project to move beyond what was capable in my hands alone. He has given me the opportunity to pursue a project, that while difficult, has been intellectually rewarding and forced me to ‘blaze a trail.’ He has provided constructive criticism and encouraged me along the way, which is evident by the numerous fortunes and quotes that are displayed on my desk. While he once told me, “You won’t get a Ph.D. if you listen to me every day,” I must admit that it has been by his example, guidance, criticism, and encouragement that I have accomplished what I have. vi TABLE OF CONTENTS Page ACKNOWLEDGEMENTS ..................................................................................................... iv LIST OF TABLES ................................................................................................................... xi LIST OF FIGURES ................................................................................................................. xii LIST OF ABBREVIATIONS ...............................................................................................
Recommended publications
  • Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Propranolol-Mediated Attenuation of MMP-9 Excretion in Infants with Hemangiomas

    Supplementary Online Content Thaivalappil S, Bauman N, Saieg A, Movius E, Brown KJ, Preciado D. Propranolol-mediated attenuation of MMP-9 excretion in infants with hemangiomas. JAMA Otolaryngol Head Neck Surg. doi:10.1001/jamaoto.2013.4773 eTable. List of All of the Proteins Identified by Proteomics This supplementary material has been provided by the authors to give readers additional information about their work. © 2013 American Medical Association. All rights reserved. Downloaded From: https://jamanetwork.com/ on 10/01/2021 eTable. List of All of the Proteins Identified by Proteomics Protein Name Prop 12 mo/4 Pred 12 mo/4 Δ Prop to Pred mo mo Myeloperoxidase OS=Homo sapiens GN=MPO 26.00 143.00 ‐117.00 Lactotransferrin OS=Homo sapiens GN=LTF 114.00 205.50 ‐91.50 Matrix metalloproteinase‐9 OS=Homo sapiens GN=MMP9 5.00 36.00 ‐31.00 Neutrophil elastase OS=Homo sapiens GN=ELANE 24.00 48.00 ‐24.00 Bleomycin hydrolase OS=Homo sapiens GN=BLMH 3.00 25.00 ‐22.00 CAP7_HUMAN Azurocidin OS=Homo sapiens GN=AZU1 PE=1 SV=3 4.00 26.00 ‐22.00 S10A8_HUMAN Protein S100‐A8 OS=Homo sapiens GN=S100A8 PE=1 14.67 30.50 ‐15.83 SV=1 IL1F9_HUMAN Interleukin‐1 family member 9 OS=Homo sapiens 1.00 15.00 ‐14.00 GN=IL1F9 PE=1 SV=1 MUC5B_HUMAN Mucin‐5B OS=Homo sapiens GN=MUC5B PE=1 SV=3 2.00 14.00 ‐12.00 MUC4_HUMAN Mucin‐4 OS=Homo sapiens GN=MUC4 PE=1 SV=3 1.00 12.00 ‐11.00 HRG_HUMAN Histidine‐rich glycoprotein OS=Homo sapiens GN=HRG 1.00 12.00 ‐11.00 PE=1 SV=1 TKT_HUMAN Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 17.00 28.00 ‐11.00 CATG_HUMAN Cathepsin G OS=Homo
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells

    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
  • Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag

    Mouse CELA3B ORF Mammalian Expression Plasmid, C-His Tag

    Mouse CELA3B ORF mammalian expression plasmid, C-His tag Catalog Number: MG53134-CH General Information Plasmid Resuspension protocol Gene : chymotrypsin-like elastase family, 1. Centrifuge at 5,000×g for 5 min. member 3B 2. Carefully open the tube and add 100 l of sterile water to Official Symbol : CELA3B dissolve the DNA. Synonym : Ela3; Ela3b; AI504000; 0910001F22Rik; 2310074F01Rik 3. Close the tube and incubate for 10 minutes at room Source : Mouse temperature. cDNA Size: 810bp 4. Briefly vortex the tube and then do a quick spin to RefSeq : NM_026419.2 concentrate the liquid at the bottom. Speed is less than Description 5000×g. Lot : Please refer to the label on the tube 5. Store the plasmid at -20 ℃. Vector : pCMV3-C-His Shipping carrier : The plasmid is ready for: Each tube contains approximately 10 μg of lyophilized plasmid. • Restriction enzyme digestion Storage : • PCR amplification The lyophilized plasmid can be stored at ambient temperature for three months. • E. coli transformation Quality control : • DNA sequencing The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. E.coli strains for transformation (recommended Sequencing primer list : but not limited) pCMV3-F: 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R : 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 : 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH : 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS.
  • Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early

    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
  • (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis Et Al

    US 201500 72349A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0072349 A1 Diamandis et al. (43) Pub. Date: Mar. 12, 2015 (54) CANCER BOMARKERS AND METHODS OF (52) U.S. Cl. USE CPC. G0IN33/57484 (2013.01); G0IN 2333/705 (2013.01) (71) Applicant: University Health Network, Toronto USPC ......................................... 435/6.12: 435/7.94 (CA) (57) ABSTRACT A method of evaluating a probability a Subject has a cancer, (72) Inventors: Eleftherios P. Diamandis, Toronto diagnosing a cancer and/or monitoring cancer progression (CA); Ioannis Prassas, Toronto (CA); comprising: a. measuring an amount of a biomarker selected Shalini Makawita, Toronto (CA); from the group consisting of CUZD1 and/or LAMC2 and/or Caitlin Chrystoja, Toronto (CA); Hari the group CUZD1, LAMC2, AQP8, CELA2B, CELA3B, M. Kosanam, Maple (CA) CTRB1, CTRB2, GCG, IAPP, INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, KLK3, NPY, (21) Appl. No.: 14/385,449 PSCA, RLN1, SLC45A3, DSP GP73, DSG2, CEACAM7, CLCA1, GPA33, LEFTY1, ZG16, IRX5, LAMP3, MFAP4, (22) PCT Fled: Mar. 15, 2013 SCGB1A1, SFTPC, TMEM100, NPY, PSCA RLN1 and/or SLC45A3 in a test sample from a subject with cancer; (86) PCT NO.: PCT/CA2O13/OOO248 wherein the cancer is pancreas cancer if CUZD1, LAMC2, S371 (c)(1), AQP8, CELA2B, CELA3B, CTRB1, CTRB2, GCG, LAPP (2) Date: Sep. 23, 2014 INS, KLK1, PNLIPRP1, PNLIPRP2, PPY, PRSS3, REG3G, SLC30A8, DSP GP73 and/or DSG2 is selected; the cancer is colon cancer if CEACAM7, CLCA1, GPA33, LEFTY 1 and/ Related U.S. Application Data or ZG16 is selected, the cancer is lung cancer if IRX5, (60) Provisional application No.
  • 2/2/2011 1 Development of Development of Endodermal

    2/2/2011 1 Development of Development of Endodermal

    2/2/2011 ZOO 401- Embryology-Dr. Salah A. Martin DEVELOPMENT OF THE DIGESTIVE SYSTEM ◦ Primitive Gut Tube ◦ Proctodeum and Stomodeum ◦ Stomach Development of Endodermal Organs ◦ Duodenum ◦ Pancreas ◦ Liver and Biliary Apparatus ◦ Spleen ◦ Midgut Wednesday, February 02, 2011 DEVELOPMENT OF THE DIGESTIVE SYSTEM 2 Wednesday, February 02, 2011 Development of Ectodermal Organs 1 ZOO 401- Embryology-Dr. Salah A. Martin ZOO 401- Embryology-Dr. Salah A. Martin Primitive Gut Tube Proctodeum and Stomodeum The primitive gut tube is derived from the dorsal part of the yolk sac , which is incorporated into the body of The proctodeum (anal pit) is the primordial the embryo during folding of the embryo during the fourth week. anus , and the stomodeum is the primordial The primitive gut tube is divided into three sections. mouth . The epithelium of and the parenchyma of In both of these areas ectoderm is in direct glands associated with the digestive tract (e.g., liver and pancreas) are derived from endoderm . contact with endoderm without intervening The muscular walls of the digestive tract (lamina mesoderm, eventually leading to degeneration propria, muscularis mucosae, submucosa, muscularis of both tissue layers. Foregut, Esophagus. externa, adventitia and/or serosa) are derived from splanchnic mesoderm . The tracheoesophageal septum divides the During the solid stage of development the endoderm foregut into the esophagus and of the gut tube proliferates until the gut is a solid tube. trachea. information. A process of recanalization restores the lumen. Wednesday, February 02, 2011 Primitive Gut Tube 3 Wednesday, February 02, 2011 Proctodeum and Stomodeum 4 ZOO 401- Embryology-Dr. Salah A.
  • Supplementary Materials

    Supplementary Materials

    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
  • Embryology, Comparative Anatomy, and Congenital Malformations of the Gastrointestinal Tract

    Embryology, Comparative Anatomy, and Congenital Malformations of the Gastrointestinal Tract

    Edorium J Anat Embryo 2016;3:39–50. Danowitz et al. 39 www.edoriumjournals.com/ej/ae REVIEW ARTICLE PEER REVIEWED | OPEN ACCESS Embryology, comparative anatomy, and congenital malformations of the gastrointestinal tract Melinda Danowitz, Nikos Solounias ABSTRACT Human digestive development is an essential topic for medical students and physicians, Evolutionary biology gives context to human and many common congenital abnormalities embryonic digestive organs, and demonstrates directly relate to gastrointestinal embryology. how structural adaptations can fit changing We believe this comprehensive review of environmental requirements. Comparative gastrointestinal embryology and comparative anatomy is rarely included in the medical anatomy will facilitate a better understanding of school curriculum. However, its concepts gut development, congenital abnormalities, and facilitate a deeper comprehension of anatomy adaptations to various evolutionary ecological and development by putting the morphology conditions. into an evolutionary perspective. Features of gastrointestinal development reflect the transition Keywords: Anatomy education, Digestive, Embry- from aquatic to terrestrial environments, such as ology, Gastrointestinal tract the elongation of the colon in land vertebrates, allowing for better water reabsorption. In How to cite this article addition, fishes exhibit ciliary transport in the esophagus, which facilitates particle transport in Danowitz M, Solounias N. Embryology, comparative water, whereas land mammals develop striated anatomy, and congenital malformations of the and smooth esophageal musculature and utilize gastrointestinal tract. Edorium J Anat Embryo peristaltic muscle contractions, allowing for 2016;3:39–50. better voluntary control of swallowing. The development of an extensive vitelline drainage system to the liver, which ultimately creates Article ID: 100014A04MD2016 the adult hepatic portal system allows for the evolution of complex hepatic metabolic ********* functions seen in many vertebrates today.
  • Extrinsic Factors Involved in the Differentiation of Stem Cells Into Insulin-Producing Cells: an Overview

    Extrinsic Factors Involved in the Differentiation of Stem Cells Into Insulin-Producing Cells: an Overview

    Hindawi Publishing Corporation Experimental Diabetes Research Volume 2011, Article ID 406182, 15 pages doi:10.1155/2011/406182 Review Article Extrinsic Factors Involved in the Differentiation of Stem Cells into Insulin-Producing Cells: An Overview RebeccaS.Y.Wong Division of Human Biology, School of Medical and Health Sciences, International Medical University, No. 126, Jalan Jalil Perkasa 19, Bukit Jalil, 57000 Kuala Lumpur, Malaysia Correspondence should be addressed to Rebecca S. Y. Wong, rebecca [email protected] Received 16 February 2011; Accepted 28 March 2011 Academic Editor: A. Veves Copyright © 2011 Rebecca S. Y. Wong. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Diabetes mellitus is a chronic disease with many debilitating complications. Treatment of diabetes mellitus mainly revolves around conventional oral hypoglycaemic agents and insulin replacement therapy. Recently, scientists have turned their attention to the generation of insulin-producing cells (IPCs) from stem cells of various sources. To date, many types of stem cells of human and animal origins have been successfully turned into IPCs in vitro and have been shown to exert glucose-lowering effect in vivo. However, scientists are still faced with the challenge of producing a sufficient number of IPCs that can in turn produce sufficient insulin for clinical use. A careful choice of stem cells, methods, and extrinsic factors for induction may all be contributing factors to successful production of functional beta-islet like IPCs. It is also important that the mechanism of differentiation and mechanism by which IPCs correct hyperglycaemia are carefully studied before they are used in human subjects.
  • Cellular Heterogeneity During Mouse Pancreatic Ductal Adenocarcinoma Progression at Single-Cell Resolution

    Cellular Heterogeneity During Mouse Pancreatic Ductal Adenocarcinoma Progression at Single-Cell Resolution

    Cellular heterogeneity during mouse pancreatic ductal adenocarcinoma progression at single-cell resolution Abdel Nasser Hosein, … , Udit Verma, Rolf A. Brekken JCI Insight. 2019. https://doi.org/10.1172/jci.insight.129212. Research In-Press Preview Gastroenterology Oncology Pancreatic ductal adenocarcinoma (PDA) is a major cause of cancer-related death with limited therapeutic options available. This highlights the need for improved understanding of the biology of PDA progression, a highly complex and dynamic process featuring changes in cancer cells and stromal cells. A comprehensive characterization of PDA cancer cell and stromal cell heterogeneity during disease progression is lacking. In this study, we aimed to profile cell populations and understand their phenotypic changes during PDA progression. To that end, we employed single-cell RNA sequencing technology to agnostically profile cell heterogeneity during different stages of PDA progression in genetically engineered mouse models. Our data indicate that an epithelial-to-mesenchymal transition of cancer cells accompanies tumor progression in addition to distinct populations of macrophages with increasing inflammatory features. We also noted the existence of three distinct molecular subtypes of fibroblasts in the normal mouse pancreas, which ultimately gave rise to two distinct populations of fibroblasts in advanced PDA, supporting recent reports on intratumoral fibroblast heterogeneity. Our data also suggest that cancer cells and fibroblasts may be dynamically regulated by epigenetic
  • The Epigenome in Pluripotency and Differentiation

    The Epigenome in Pluripotency and Differentiation

    Review Review The epigenome in pluripotency and differentiation The ability to culture pluripotent stem cells and direct their differentiation into Rathi D Thiagarajan1, Robert specific cell types in vitro provides a valuable experimental system for modeling Morey1 & Louise C Laurent*1 1 pluripotency, development and cellular differentiation. High-throughput profiling of Department of Reproductive Medicine, The University of California, San Diego, the transcriptomes and epigenomes of pluripotent stem cells and their differentiated La Jolla, CA, USA derivatives has led to identification of patterns characteristic of each cell type, *Author for correspondence: discovery of new regulatory features in the epigenome and early insights into the [email protected] complexity of dynamic interactions among regulatory elements. This work has also revealed potential limitations of the use of pluripotent stem cells as in vitro models of developmental events, due to epigenetic variability among different pluripotent stem cell lines and epigenetic instability during derivation and culture, particularly at imprinted and X-inactivated loci. This review focuses on the two most well-studied epigenetic mechanisms, DNA methylation and histone modifications, within the context of pluripotency and differentiation. Keywords: differentiation • DNA methylation • epigenome • histone modification • imprinting • pluripotency • sequencing • stem cells • X inactivation Early mammalian development involves genetic mechanisms in the regulation of the precise orchestration
  • Altered DNA Methylation Pattern Characterizes the Peripheral Immune Cells of Patients with Autoimmune Hepatitis

    Altered DNA Methylation Pattern Characterizes the Peripheral Immune Cells of Patients with Autoimmune Hepatitis

    medRxiv preprint doi: https://doi.org/10.1101/2021.07.01.21259836; this version posted July 5, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Altered DNA methylation pattern characterizes the peripheral immune cells of patients with autoimmune hepatitis Kalliopi Zachou1,2*, Pinelopi Arvaniti1*, Aggeliki Lyberopoulou1, Eirini Sevdali3, Matthaios Speletas3, Maria Ioannou4, George K. Koukoulis4, Yves Renaudineau5,6**, George N. Dalekos1,2** *These authors contributed equally to this work **These authors contributed equally to this work as senior authors 1Department of Medicine and Research Laboratory of Internal Medicine, National Expertise Center of Greece in Autoimmune Liver Diseases, General University Hospital of Larissa, 41110 Larissa, Greece; 2Institute of Internal Medicine and Hepatology, 41447 Larissa, Greece; 3Department of Immunology and Histocompatibility, Faculty of Medicine, School of Health Sciences, University of Thessaly, Larissa, Greece; 4Department of Pathology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Larissa, Greece; 5INSERN U1291, CNR U5051, University Toulouse III, Toulouse Institute for infectious and inflammatory diseases, Toulouse, France; 6Department of Immunology, Purpan University Hospital Toulouse, Toulouse, France All correspondence and reprint requests to: George N. Dalekos, MD, PhD Professor of Medicine Head, Department of Medicine and Research Laboratory of Internal Medicine National Expertise Center of Greece in Autoimmune Liver Diseases General University Hospital of Larissa, 41110 Larissa, Greece Tel: ++30-241-350-2285; Fax: ++30-241-350-1557 e-mail: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice.